Sulfonylurea herbicide resistant transgenic plants
10954528 · 2021-03-23
Assignee
Inventors
Cpc classification
A01P15/00
HUMAN NECESSITIES
C12N5/10
CHEMISTRY; METALLURGY
A01N25/32
HUMAN NECESSITIES
A01N25/32
HUMAN NECESSITIES
International classification
C12N15/82
CHEMISTRY; METALLURGY
A01N25/32
HUMAN NECESSITIES
C12N5/10
CHEMISTRY; METALLURGY
Abstract
A herbicide tolerant protein SUM1, a coding gene thereof and a use thereof, wherein the herbicide tolerant protein comprises: (a) a protein having an amino acid sequence as shown in SEQ ID NO: 1; or (b) a protein which is derived from (a) by substituting and/or deleting and/or adding one or more amino acids in the amino acid sequence of (a), and has the activity of thifensulfuron hydrolase. The herbicide tolerant protein SUM1 can show a higher tolerance to a plurality of sulfonylurea herbicides, can tolerate four-fold field concentration, and thus has a broad application prospect in plants.
Claims
1. A herbicide tolerant protein: consisting of the amino acid sequence as shown in SEQ ID NO: 1.
2. A herbicide tolerant gene, comprising: consisting of a polynucleotide sequence encoding the herbicide tolerant protein of claim 1.
3. An expression cassette or a recombinant vector, comprising the herbicide tolerant gene of claim 2 under regulation of an operably linked regulatory sequence.
4. A method for producing a herbicide tolerant protein, comprising: obtaining a cell of a transgenic host organism containing the herbicide tolerant gene of claim 2 or an expression cassette comprising the herbicide tolerant gene; cultivating the cell of the transgenic host organism under conditions allowing production of the herbicide tolerant protein; and recovering the herbicide tolerant protein.
5. A method for increasing the range of herbicides which can be tolerated, comprising: co-expressing the herbicide tolerant protein of claim 1 with at least one second protein which is different from the herbicide tolerant protein in a plant.
6. A method for selecting transformed plant cells, comprising: transforming a plurality of plant cells with the herbicide tolerant gene of claim 2 or an expression cassette comprising the herbicide tolerant gene, and cultivating the cells under a concentration of a herbicide which allows the growth of the transformed cells expressing the herbicide tolerant gene or the expression cassette, while killing the untransformed cells or inhibiting the growth of the untransformed cells, wherein the herbicide is a sulfonylurea herbicide.
7. A method for controlling weeds, comprising: applying an effective dose of a sulfonylurea herbicide to a field in which a target plant is planted, wherein the plant contains the herbicide tolerant gene of claim 2 or an expression cassette comprising the herbicide tolerant gene.
8. A method for protecting a plant from damage caused by a sulfonylurea herbicide, comprising: introducing the herbicide tolerant gene of claim 2 or an expression cassette comprising the herbicide tolerant gene or a recombinant vector comprising the herbicide tolerant gene into a plant, to make the post-introduction plant produce a sufficient amount of herbicide tolerant protein to protect the plant from being damaged by the sulfonylurea herbicide.
9. A method for controlling glyphosate resistant weeds in a field of a glyphosate tolerant plant, comprising: applying an effective dose of a sulfonylurea herbicide to a field in which the glyphosate tolerant plant is planted, wherein the glyphosate tolerant plant contains the herbicide tolerant gene of claim 2 or an expression cassette comprising the herbicide tolerant gene.
10. A method for imparting sulfonylurea herbicide tolerance to a plant, comprising: introducing the herbicide tolerant gene of claim 2 or an expression cassette comprising the herbicide tolerant gene or a recombinant vector comprising the herbicide tolerant gene.
11. A method for producing a plant which is tolerant to a sulfonylurea herbicide, comprising: introducing the herbicide tolerant gene of claim 2 or an expression cassette comprising the herbicide tolerant gene or a recombinant vector comprising the herbicide tolerant gene into the genome of the plant.
12. A method for cultivating a plant which is tolerant to a sulfonylurea herbicide, comprising: planting at least one plant propagule, the genome of which contains the herbicide tolerant gene of claim 2 or an expression cassette comprising the herbicide tolerant gene; allowing the plant propagule to grow into a plant; and applying an effective dose of the sulfonylurea herbicide to a plant growing environment comprising at least the plant, and harvesting the plant having a reduced plant damage and/or an increased plant yield compared to other plant without the herbicide tolerant gene or the expression cassette.
13. A planting system for controlling weed growth, comprising: a sulfonylurea herbicide and a plant growing environment in which at least one target plant exists, wherein the plant contains the herbicide tolerant gene of claim 2 or an expression cassette comprising the herbicide tolerant gene.
14. A planting system for controlling glyphosate resistant weeds in a field of a glyphosate tolerant plant, comprising: a sulfonylurea herbicide, a glyphosate herbicide and a field in which at least one target plant is planted, wherein the glyphosate tolerant plant contains the herbicide tolerant gene of claim 2 or an expression cassette comprising the herbicide tolerant gene.
15. The method according to claim 4, wherein the transgenic host organism comprises plants, animals, bacteria, yeasts, baculoviruses, nematodes, or algae.
16. The method according to claim 5, wherein the second protein is 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, -ketoglutarate-dependent dioxygenase, dicamba monooxygenase, 4-hydroxyphenylpyruvate dioxygenase, acetolactate synthase, cytochrome-like proteins and/or protoporphyrinogen oxidase.
17. The method according to claim 7, wherein the plant is a monocotyledonous plant or a dicotyledonous plant.
18. The method according to claim 17, wherein the plant is maize, soybean, Arabidopsis thaliana, cotton, rape, rice, sorghum, wheat, barley, millet, sugar cane or oats.
19. The method according to claim 7, wherein the sulfonylurea herbicide is tribenuron-methyl, sulfometuron-methyl, halosulfuron-methyl, pyrazosulfuron-ethyl, thifensulfuron-methyl, bensulfuron-methyl, metsulfuron-methyl, ethametsulfuron-methyl or chlorimuron-ethyl.
20. The herbicide tolerant gene of claim 2, wherein the polynucleotide sequence consists of the sequence of SEQ ID NO: 2 or SEQ ID NO: 3.
Description
DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
PARTICULAR EMBODIMENTS
(10) The present invention is further illustrated through the following specific examples. However, it should be understood that the examples are used for illustrating the present invention in more detail, but not intended to limit the protection scope of the invention in any way.
(11) The materials and experimental methods used in the experiments of the invention are described generally in this section. Although many materials and methods used for the invention are well known in the art, they will still be described herein in as much detail as possible. It would be clear to one skilled in the art that unless indicated otherwise in the context, the materials and methods used in the invention are well known in the art.
(12) The technical solutions of the herbicide tolerant protein, the coding gene thereof and a use thereof in the present invention are further described through specific examples below.
Example 1. Acquisition and Synthesis of a SUM1 Gene Sequence
(13) 1. Acquisition of the SUM1 Gene Sequence
(14) The amino acid sequence (350 amino acids) of the herbicide tolerant protein SUM1 is shown as SEQ ID NO: 1 in the sequence listings; the SUM1-01 nucleotide sequence (1053 nucleotides) as shown in SEQ ID NO: 2 in the sequence listings encoding the amino acid sequence corresponding to the herbicide tolerant protein SUM1 was obtained based on the soybean codon usage bias, and the SUM1-02 nucleotide sequence (1053 nucleotides) as shown in SEQ ID NO: 3 in the sequence listings encoding the amino acid sequence corresponding to the herbicide tolerant protein SUM1 was obtained based on the maize codon usage bias.
(15) 2. Synthesis of the Above-Mentioned Nucleotide Sequences
(16) The SUM1-01 nucleotide sequence (as shown in SEQ ID NO: 2 in the sequence listings) and the SUM1-02 nucleotide sequence (as shown in SEQ ID NO: 3 in the sequence listings) were synthesized by Nanjing Genscript Biotechnology Co., Ltd.; the synthetic SUM1-01 nucleotide sequence (SEQ ID NO: 2) is further connected with a SpeI restriction site at the 5 end, and the SUM1-01 nucleotide sequence (SEQ ID NO: 2) is further connected with a KasI restriction site at the 3 end; and the synthetic SUM1-02 nucleotide sequence (SEQ ID NO: 3) is further connected with a SpeI restriction site at the 5 end, and the SUM1-02 nucleotide sequence (SEQ ID NO: 3) is further connected with a KasI restriction site at the 3 end.
Example 2. Construction of Recombinant Expression Vectors for Arabidopsis thaliana
(17) 1. Construction of Recombinant Cloning Vectors Containing SUM1 Nucleotide Sequences for Arabidopsis thaliana and Soybean
(18) The synthetic SUM1-1-01 nucleotide sequence was ligated into cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and the operational procedure was carried out according to Promega's pGEM-T vector product instructions, thus obtaining a recombinant cloning vector DBN01-T, the construction process of which was as shown in
(19) Then, Escherichia coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) were transformed with the recombinant cloning vector DBN01-T using the heat shock method under the following heat shock conditions: water bathing 50 L of Escherichia coli T1 competent cells and 10 L of plasmid DNA (recombinant cloning vector DBN01-T) at 42 C. for 30 seconds; shake culturing at 37 C. for 1 hour (using a shaker at a rotation speed of 100 rpm for shaking); and growing on an LB plate (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar, and adjusting the pH to 7.5 with NaOH) of ampicillin (100 mg/L) having its surface coated with IPTG (isopropylthio--D-galactoside) and X-gal (5-bromo-4-chloro-3-indole--D-galactoside) overnight. White colonies were picked out and cultured in an LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 100 mg/L of ampicillin, and adjusting the pH to 7.5 with NaOH) at a temperature of 37 C. overnight. The plasmids in the cells were extracted through an alkaline method: centrifuging the bacteria solution at a rotation speed of 12000 rpm for 1 min, removing the supernatant, and suspending the precipitated thalli with 100 L of ice pre-cooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), and 50 mM glucose, with a pH of 8.0); adding 200 L of newly formulated solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), inverting the tube 4 times, and mixing and placing on ice for 3-5 min; adding 150 L of ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mixing uniformly immediately and placing on ice for 5-10 min; centrifuging under the conditions of a temperature of 4 C. and a rotation speed of 12000 rpm for 5 min, adding 2 volumes of anhydrous ethanol to the supernatant and placing at room temperature for 5 min after mixing uniformly; centrifuging under the conditions of a temperature of 4 C. and a rotation speed of 12000 rpm for 5 min, discarding the supernatant, and air drying the precipitate after washing with ethanol with a concentration of 70% (V/V); adding 30 L of TE (10 mM Tris-HCl, and 1 mM EDTA, with a pH of 8.0) containing RNase (20 g/mL) to dissolve the precipitate; water bathing at a temperature of 37 C. for 30 min to digest the RNA; and storing at a temperature of 20 C. for use.
(20) After identifying the extracted plasmid by SpeI and KasI digestion, positive clones were verified by sequencing. The results showed that the inserted SUM1-01 nucleotide sequence in the recombinant cloning vector DBN01-T was the nucleotide sequence as shown in SEQ ID NO: 2 in the sequence listings, that is, the SUM1-01 nucleotide sequence was inserted correctly.
(21) 2. Construction of Recombinant Expression Vectors Containing SUM1 Nucleotide Sequences for Arabidopsis thaliana
(22) The recombinant cloning vector DBN01-T and an expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (which can be provided by the CAMBIA institution)) were both digested with restriction enzymes SpeI and KasI; the excised SUM1-01 nucleotide sequence fragment was inserted between the SpeI and KasI sites in the expression vector DBNBC-01; and it is well known to a person skilled in the art to construct a vector using conventional enzyme digestion methods, wherein a recombinant expression vector DBN100996 was constructed, and the construction process of which was as shown in
(23) Escherichia coli T1 competent cells were transformed with the recombinant expression vector DBN100996 by a heat shock method under the following heat shock conditions: water bathing 50 L of Escherichia coli T1 competent cells and 10 L of plasmid DNA (recombinant expression vector DBN100996) at 42 C. for 30 seconds; shake culturing at 37 C. for 1 hour (using a shaker at a rotation speed of 100 rpm for shaking); then culturing under the condition of a temperature of 37 C. on an LB solid plate containing 50 mg/L of spectinomycin (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar, and adjusted to a pH of 7.5 with NaOH) for 12 hours, picking white colonies, and culturing under the condition of a temperature of 37 C. overnight in an LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 50 mg/L of spectinomycin, and adjusted to a pH of 7.5 with NaOH). The plasmids in the cells were extracted through the alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SpeI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and KasI sites in the recombinant expression vector DBN100996 was the nucleotide sequence as shown in SEQ ID NO: 2 in the sequence listings, i.e., the SUM1-01 nucleotide sequence.
(24) 3. Construction of Recombinant Expression Vectors Containing Control Sequences for Arabidopsis thaliana
(25) The recombinant cloning vector DBN01R1-T containing control sequence 1 and the recombinant cloning vector DBN01R2-T containing control sequence 2 were constructed using control sequence 1 (SEQ ID NO: 9) and control sequence 2 (SEQ ID NO: 10) respectively, according to the method for constructing the recombinant cloning vector DBN01-T containing the SUM1 nucleotide sequence as described in Example 1. Positive clones were validated by sequencing, with the results showing that the control sequence 1 inserted into the recombinant cloning vector DBN01R1-T was the nucleotide sequence as shown in SEQ ID NO: 9 in the sequence listings, and the control sequence 2 inserted into the recombinant cloning vector DBN01R2-T was the nucleotide sequence as shown in SEQ ID NO: 10 in the sequence listings, i.e., the control sequences were inserted correctly.
(26) The recombinant expression vector DBN100996N1 containing control sequence 1 was constructed using control sequence 1 according to the method for constructing the recombinant expression vector DBN100996 containing the SUM1 nucleotide sequence as described in Example 2, and has a structure as shown in
(27) The recombinant expression vector DBN100996N2 containing control sequence 2 was constructed using the control sequence 2 according to the method for constructing the recombinant expression vector DBN100996N1 containing control sequence 1 as described above. Positive clones were validated by sequencing, with the results showing that the control sequence 2 inserted into the recombinant expression vector DBN100996N2 was the nucleotide sequence as shown in SEQ ID NO: 10 in the sequence listings, i.e., the control sequence 2 was inserted correctly.
Example 3. Acquisition of Arabidopsis thaliana Plants Having an SUM1 Nucleotide Sequence Introduced
(28) 1. Transformation of Agrobacterium with the Recombinant Expression Vectors
(29) The Agrobacterium GV3101 was transformed with the recombinant expression vectors DBN100996, DBN100996N1 and DBN100996N2, which had been correctly constructed using the liquid nitrogen method, with the following transformation conditions: placing 100 L of Agrobacterium GV3101, and 3 L of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 minutes, and warm water bathing at 37 C. for 10 minutes; inoculating the transformed Agrobacterium GV3101 into an LB tube, culturing under the conditions of a temperature of 28 C. and a rotation speed of 200 rpm for 2 hours, spreading on an LB plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing enzyme digestion verification using restriction enzymes. The results showed that the structures of the recombinant expression vectors DBN100996, DBN100996N1 and DBN100996N2 were completely correct.
(30) 2. Acquisition of Transgenic Arabidopsis thaliana Plants
(31) Seeds of wild-type Arabidopsis thaliana were suspended in a 0.1% (w/v) agarose solution. The suspended seeds were stored at 4 C. for 2 days to complete the need for dormancy, in order to ensure synchronous seed germination. Vermiculite was mixed with horse manure soil, the mixture was sub-irrigated with water to wet same, and the soil mixture was allowed to drain the water away for 24 hours. The pretreated seeds were sowed in the soil mixture and covered with a moisturizing cover for 7 days. The seeds were germinated and the plants were cultivated in a greenhouse under long day conditions (16 hour light/8 hour dark) at a constant temperature (22 C.) and a constant humidity (40-50%), with a light intensity of 120-150 mol/(m.sup.2.Math.sec). The plants were initially irrigated with Hoagland's nutrient solution, followed by deionized water, thus keeping the soil moist, but not wet through.
(32) Arabidopsis thaliana was transformed using the flower soaking method. One or more 15-30 mL pre-cultures of a YEP culture solution (containing spectinomycin (50 mg/L) and rifampicin (10 mg/L)) were inoculated with the picked Agrobacterium colonies. The cultures were incubated at 28 C. and 220 rpm with shaking at a constant speed overnight. Each pre-culture was used to inoculate two 500 mL cultures of the YEP culture solution (containing spectinomycin (50 mg/L) and rifampicin (10 mg/L)), and the cultures were incubated at 28 C. with continuous shaking overnight. Cells were precipitated by centrifuging at about 8700g at room temperature for 10 minutes, and the resulting supernatant was discarded. The cell precipitate was gently re-suspended in 500 mL of an osmotic medium which contained MS salt/B5 vitamin, 10% (w/v) sucrose, 0.044 M of benzylaminopurine (10 L/L (1 mg/mL, a stock solution in DMSO)) and 300 L/L of Silvet L-77. About 1-month-old plants were soaked in a culture medium for 15 seconds to ensure immersion of the latest inflorescence. Then, the plants were reclined laterally and covered (transparently or opaquely) for 24 hours, then washed with water, and placed vertically. The plants were cultivated with a photoperiod of 16 hours of light/8 hours of darkness at 22 C. Seeds were harvested after soaking for about 4 weeks.
(33) The newly harvested (SUM1 nucleotide sequence and the control sequence) T.sub.1 seeds were dried at room temperature for 7 days. The seeds were sowed in 26.551 cm germination disks, and 200 mg of T.sub.1 seeds (about 10000 seeds) were accepted per disk, wherein the seeds had been previously suspended in 40 mL of 0.1% (w/v) agarose solution and stored at 4 C. for 2 days to complete the need for dormancy, in order to ensure synchronous seed germination.
(34) Vermiculite was mixed with horse manure soil, the mixture was sub-irrigated with water to wet same, and water was drained by gravity. The pretreated seeds (each 40 mL) were sowed evenly in the soil mixture using a pipette, and covered with a moisturizing cover for 4-5 days. The cover was removed 1 day before the step of performing the initial transformant selection by spraying glufosinate (used to select the co-transformed PAT gene) post emergence.
(35) The T.sub.1 plants were sprayed with a 0.2% solution of a Liberty herbicide (200 g ai/L of glufosinate) by a DeVilbiss compressed air nozzle at a spray volume of 10 mL/disk (703 L/ha) at 7 days after planting (DAP) and 11 DAP (the cotyledon stage and 2-4 leaf stage, respectively), to provide an effective amount of glufosinate of 280 g ai/ha per application. Surviving plants (actively growing plants) were identified 4-7 days after the final spraying, and transplanted to 7 cm7 cm square pots prepared with horse manure soil and vermiculite (3-5 plants/disk). The transplanted plants were covered with a moisturizing cover for 3-4 days, and placed in a 22 C. culture chamber or directly transferred into a greenhouse as described above. Then, the cover was removed, and at least 1 day before testing the ability of the SUM1 gene to provide sulfonylurea herbicide tolerance, the plants were planted in a greenhouse (225 C., 5030% RH, 14 hours of light: 10 hours of darkness, a minimum of 500 E/m.sup.2 s.sup.1 natural+supplemental light).
Example 4. Detection of Herbicide Tolerance Effects of the Transgenic Arabidopsis thaliana Plants
(36) T1 transformants were initially selected from the untransformed seeds using a glufosinate selection scheme. About 40000 T1 seeds were screened, and 380 T1 positive transformants (PAT gene) were identified, with a transformation efficiency of about 0.95%. The tolerance to sulfonylurea herbicides were determined for Arabidopsis thaliana T1 plants into which the SUM1-01 nucleotide sequence was introduced, Arabidopsis thaliana T1 plants into which the control sequence 1 was introduced, Arabidopsis thaliana T1 plants into which the control sequence 2 was introduced, and wild-type Arabidopsis thaliana plants (18 days after sowing).
(37) The Arabidopsis thaliana T1 plants into which the SUM1-01 nucleotide sequence was introduced, Arabidopsis thaliana T1 plants into which the control sequence 1 was introduced, Arabidopsis thaliana T1 plants into which the control sequence 2 was introduced, and wild-type Arabidopsis thaliana plants were sprayed with tribenuron-methyl (18 g ai/ha, one-fold field concentration), sulfometuron methyl (30 g ai/ha, one-fold field concentration), halosulfuron-methyl (34 g ai/ha, one-fold field concentration), pyrazosulfuron-ethyl (25 g ai/ha, one-fold field concentration), thifensulfuron (30 g ai/ha, one-fold field concentration), bensulfuron-methyl (30 g ai/ha, one-fold field concentration), metsulfuron-methyl (7.5 g ai/ha, one-fold field concentration), ethametsulfuron-methyl (15 g ai/ha, one-fold field concentration), chlorimuron-ethyl (15 g ai/ha, one-fold field concentration) or a blank solvent (water). Plants were detected for the resistance situations 14 days after spraying: those having a consistent growth status with the blank solvent (water) group after 14 days were classified as highly resistant plants, those having a bolting height less than of that of the blank solvent (water) group after 14 days were classified as moderately resistant plants, those still not capable of bolting after 14 days were classified as poorly resistant plants, and those which were dead after 14 days were classified as non-resistant plants. Since each Arabidopsis thaliana T1 plant was an independent transformation event, a significant difference in individual T1 responses could be expected at a given dose. The results are as shown in Table 1 and
(38) TABLE-US-00001 TABLE 1 Experimental results of the tolerance of transgenic Arabidopsis thaliana T1 plants to sulfonylurea herbicides Arabidopsis thaliana Highly Moderately Poorly Non- Treatment genotypes resistant resistant resistant resistant Total Blank SUM1-01 31 0 0 0 31 solvent Control 29 0 0 0 29 (water) sequence 1 Control 30 0 0 0 30 sequence 2 Wild-type 31 0 0 0 31 18 g ai/ha SUM1-01 26 4 1 1 32 tribenuron- Control 12 7 5 4 28 methyl sequence 1 (1xTri.) Control 11 9 4 6 30 sequence 2 Wild-type 0 0 0 32 32 30 g ai/ha SUM1-01 24 5 2 1 32 sulfometuron- Control 10 9 6 2 27 methyl sequence 1 (1xSul.) Control 11 7 5 6 29 sequence 2 Wild-type 0 0 0 31 31 34 g ai/ha SUM1-01 17 2 5 7 31 halosulfuron- Control 8 9 8 6 31 methyl sequence 1 (1xHal.) Control 9 7 6 6 28 sequence 2 Wild-type 0 0 0 32 32 25 g ai/ha SUM1-01 12 6 5 5 28 pyrazosulfuron- Control 5 7 6 11 29 ethyl sequence 1 (1xPyr.) Control 4 8 10 10 32 sequence 2 Wild-type 0 0 0 32 32 30 g ai/ha SUM1-01 28 0 0 3 31 thifensulfuron Control 15 4 5 6 30 (1xThi.) sequence 1 Control 16 2 5 6 29 sequence 2 Wild-type 0 0 0 31 31 30 g ai/ha SUM1-01 28 1 0 1 30 bensulfuron- Control 16 5 4 5 30 methy sequence 1 (1xBen.) Control 14 5 6 4 29 sequence 2 Wild-type 0 0 0 30 30 7.5 g ai/ha SUM1-01 18 4 5 5 32 metsulfuron- Control 9 5 8 6 28 methyl sequence 1 (1xMet.) Control 10 8 5 6 29 sequence 2 Wild-type 0 0 0 32 32 15 g ai/ha SUM1-01 24 2 0 6 32 ethametsulfuron- Control 15 4 5 7 31 methyl sequence 1 (1xEth.) Control 14 2 8 6 30 sequence 2 Wild-type 0 0 0 32 32 15 g ai/ha SUM1-01 23 2 4 3 32 chlorimuron- Control 13 6 5 4 28 ethyl sequence 1 (1xChl.) Control 14 7 5 3 29 sequence 2 Wild-type 0 0 0 32 32
(39) For Arabidopsis thaliana, one-fold field concentration of a sulfonylurea herbicide is an effective dose distinguishing sensitive plants from plants having an average level of resistance. The results of Table 1 and
Example 5. Construction of Recombinant Expression Vectors for Soybean and Transformation of Agrobacterium with the Recombinant Expression Vectors
(40) 1. Construction of Recombinant Expression Vectors Containing SUM1 Nucleotide Sequences for Soybean
(41) The recombinant cloning vector DBN01-T and an expression vector DBNBC-02 (vector backbone: pCAMBIA2301 (which can be provided by the CAMBIA institution)) were both digested with restriction enzymes SpeI and KasI; the excised SUM1-01 nucleotide sequence fragment was inserted between the SpeI and KasI sites in the expression vector DBNBC-02; and it is well known to a person skilled in the art to construct a vector using conventional enzyme digestion methods, wherein a recombinant expression vector DBN130028 was constructed, and the construction process of which was shown as
(42) According to the method in point 2 of Example 2, Escherichia coli T1 competent cells were transformed with the recombinant expression vector DBN130028 using the heat shock method, and the plasmids in the cells were extracted through the alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SpeI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and KasI sites in the recombinant expression vector DBN130028 was the nucleotide sequence as shown in SEQ ID NO: 2 in the sequence listings, i.e., the SUM1-01 nucleotide sequence.
(43) 2. Construction of Recombinant Expression Vectors Containing Control Sequences for Soybean
(44) The recombinant expression vector DBN130028N1 containing control sequence 1 was constructed using control sequence 1, according to the method for constructing the recombinant expression vector DBN130028 containing the SUM1 nucleotide sequence as described in point 1 of this example, and has a structure as shown in
(45) The recombinant expression vector DBN130028N2 containing control sequence 2 was constructed using the control sequence 2 according to the method for constructing the recombinant expression vector DBN130028N1 containing control sequence 1 as described above. Positive clones were validated by sequencing, with the results showing that the control sequence 2 inserted into the recombinant expression vector DBN130028N2 was the nucleotide sequence as shown in SEQ ID NO: 10 in the sequence listings, i.e., the control sequence 2 was inserted correctly.
(46) 3. Transformation of Agrobacterium with the Recombinant Expression Vectors
(47) Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) was transformed with the recombinant expression vectors DBN130028, DBN130028N1 and DBN130028N2 which have been constructed correctly using a liquid nitrogen method, under the following transformation conditions: placing 100 L of Agrobacterium LBA4404, and 3 L of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 minutes, and warm water bathing at 37 C. for 10 minutes; inoculating the transformed Agrobacterium LBA4404 into an LB tube, culturing under the conditions of a temperature of 28 C. and a rotation speed of 200 rpm for 2 hours, spreading on an LB plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing enzyme digestion verification using restriction enzymes. The results showed that the structures of the recombinant expression vectors DBN130028, DBN130028N1 and DBN130028N2 were completely correct.
Example 6. Acquisition and Verification of Transgenic Soybean Plants
(48) 1. Acquisition of Transgenic Soybean Plants
(49) According to the Agrobacterium infection method conventionally used, the cotyledonary node tissue of sterilely cultured soybean variety Zhonghuang13 was co-cultured with the Agrobacterium in point 3 of Example 5, so as to introduce the T-DNA (including the Arabidopsis thaliana Ubiquitin10 gene promoter sequence, an SUM1-01 nucleotide sequence, a control sequence 1, a control sequence 2, the tNos terminator, the rape eukaryotic elongation factor gene 1 promoter, the Arabidopsis thaliana chloroplast transit peptide, a 5-enolpyruvylshikimate-3-phosphate synthase gene, and the pea RbcS gene terminator) in the recombinant expression vectors DBN130028, DBN130028N1 and DBN130028N2 constructed in points 1 and 2 of Example 5 into the soybean chromosomes, and thereby obtaining soybean plants into which the SUM1-01 nucleotide sequence was introduced, soybean plants into which the control sequence 1 was introduced and soybean plants into which the control sequence 2 was introduced; meanwhile, wild-type soybean plants were used as the control.
(50) As regards the Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in a soybean germination culture medium (3.1 g/L of B5 salt, B5 vitamin, 20 g/L of sucrose, and 8 g/L of agar, with a pH of 5.6), and the seeds were inoculated on a germination culture medium and cultured under the conditions of a temperature of 251 C.; and a photoperiod (light/dark) of 16 h/8 h. After 4-6 days of germination, soybean sterile seedlings swelling at bright green cotyledonary nodes were taken, hypocotyledonary axes were cut off 3-4 millimeters below the cotyledonary nodes, the cotyledons were cut longitudinally, and apical buds, lateral buds and seminal roots were removed. A wound was made at a cotyledonary node using the knife back of a scalpel, and the wounded cotyledonary node tissues were contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the SUM1-01 nucleotide sequence to the wounded cotyledonary node tissues (step 1: the infection step). In this step, the cotyledonary node tissues were preferably immersed in the Agrobacterium suspension (OD660=0.5-0.8, an infection culture medium (2.15 g/L of MS salt, B5 vitamin, 20 g/L of sucrose, 10 g/L of glucose, 40 mg/L of acetosyringone (AS), 4 g/L of 2-morpholine ethanesulfonic acid (MES), and 2 mg/L of zeatin (ZT), pH 5.3)) to initiate the inoculation. The cotyledonary node tissues were co-cultured with Agrobacterium for a period of time (3 days) (step 2: the co-culturing step). Preferably, the cotyledonary node tissues were cultured in a solid culture medium (4.3 g/L of MS salt, B5 vitamin, 20 g/L of sucrose, 10 g/L of glucose, 4 g/L of 2-morpholine ethanesulfonic acid (MES), 2 mg/L of zeatin, and 8 g/L of agar, with a pH of 5.6) after the infection step. After this co-culturing stage, there can be an optional recovery step. In the recovery step, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in a recovery culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 2 mg/L of zeatin (ZT), 8 g/L of agar, 150 mg/L of cephalosporin, 100 mg/L of glutamic acid, and 100 mg/L of aspartic acid, with a pH of 5.6), without the addition of a selective agent for a plant transformant (step 3: the recovery step). Preferably, tissue blocks regenerated from the cotyledonary nodes were cultured in a solid culture medium with an antibiotic, but without a selective agent, to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the tissue blocks regenerated from the cotyledonary nodes were cultured in a culture medium containing a selective agent (glyphosate), and growing transformed calli were selected (step 4: the selection step). Preferably, the tissue blocks regenerated from the cotyledonary nodes were cultured in a screening solid culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 1 mg/L of 6-benzyladenine (6-BAP), 8 g/L of agar, 150 mg/L of cephalosporin, 100 mg/L of glutamic acid, 100 mg/L of aspartic acid, and 0.25 mol/L of N-(phosphonomethyl)glycine, with a pH of 5.6) containing a selective agent, thus resulting in selective growth of the transformed cells. Then, plants were regenerated from the transformed cells (step 5: the regeneration step). Preferably, the tissue blocks regenerated from the cotyledonary nodes grown in a culture medium containing a selective agent were cultured in solid culture media (a B5 differentiation culture medium and B5 rooting culture medium) to regenerate plants.
(51) The screened out resistant tissues were transferred onto the B5 differentiation culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 1 mg/L of zeatin (ZT), 8 g/L of agar, 150 mg/L of cephalosporin, 50 mg/L of glutamic acid, 50 mg/L of aspartic acid, 1 mg/L of gibberellin, 1 mg/L of auxin, and 0.25 mol/L of N-(phosphonomethyl)glycine, with a pH of 5.6), and cultured at 25 C. for differentiation. The differentiated seedlings were transferred onto the B5 rooting culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 8 g/L of agar, 150 mg/L of cephalosporin, and 1 mg/L of indole-3-butyric acid (IBA)), cultured in the rooting culture medium until reaching a height of about 10 cm at 25 C., and transferred to a glasshouse for culturing until fruiting. In the greenhouse, the plants were cultured at 26 C. for 16 hours, and then cultured at 20 C. for 8 hours every day.
(52) 2. Verification of the Transgenic Soybean Plants Using TaqMan
(53) About 100 mg of leaves from the soybean plants into which the SUM1-01 nucleotide sequence was introduced, soybean plants into which the control sequence 1 was introduced and soybean plants into which the control sequence 2 was introduced were taken as samples, and the genomic DNA thereof was extracted with a DNeasy Plant Maxi Kit of Qiagen, and copy numbers of an EPSPS gene were detected by the Taqman probe fluorescence quantitative PCR method so as to determine the copy numbers of the SUM1 gene. At the same time, wild-type soybean plants were used as controls, and detected and analyzed according to the above-mentioned method. Triple repeats were set for the experiments, and were averaged.
(54) The specific method for detecting the copy number of the EPSPS gene was as follows:
(55) Step 11. 100 mg of leaves of the soybean plants into which the SUM1-01 nucleotide sequence was introduced, soybean plants into which the control sequence 1 was introduced, soybean plants into which the control sequence 2 was introduced or wild-type soybean plants was taken, and ground into a homogenate using liquid nitrogen in a mortar, and triple repeats were taken for each sample;
(56) Step 12. The genomic DNA of the above-mentioned samples was extracted using a DNeasy Plant Mini Kit of Qiagen, and the particular method refers to the product manual thereof;
(57) Step 13. The concentrations of the genomic DNA of the above-mentioned samples were detected using NanoDrop 2000 (Thermo Scientific);
(58) Step 14. The concentrations of the genomic DNA of the above-mentioned samples were adjusted to a consistent concentration value which ranges from 80 to 100 ng/L;
(59) Step 15. The copy numbers of the samples were identified using the Taqman probe fluorescence quantitative PCR method, wherein samples for which the copy numbers had been identified and known were taken as standards, the samples of the wild-type soybean plants were taken as the control, and triple repeats were taken for each sample, and were averaged; the sequences of fluorescence quantitative PCR primers and a probe were as follows:
(60) the following primers and probe were used to detect the EPSPS gene sequence:
(61) primer 1: CTGGAAGGCGAGGACGTCATCAATA, as shown in SEQ ID NO: 15 in the sequence listings;
(62) primer 2: TGGCGGCATTGCCGAAATCGAG, as shown in SEQ ID NO: 16 in the sequence listings;
(63) probe 1: ATGCAGGCGATGGGCGCCCGCATCCGTA, as shown in SEQ ID NO: 17 in the sequence listings;
(64) PCR Reaction System:
(65) TABLE-US-00002 JumpStart Taq ReadyMix (Sigma) 10 L 50x primer/probe mixture 1 L genomic DNA 3 L water (ddH.sub.2O) 6 L
(66) The 50 primer/probe mixture comprises 45 L of each primer at a concentration of 1 mM, 50 L of the probe at a concentration of 100 M, and 860 L of 1TE buffer, and was stored at 4 C. in an amber tube.
(67) PCR Reaction Conditions:
(68) TABLE-US-00003 Step Temperature Time 21 95 C. 5 minute 22 95 C. 30 seconds 23 60 C. 1 minute 24 back to step 22, repeated 40 times
(69) Data was analyzed using software SDS2.3 (Applied Biosystems).
(70) It was further demonstrated, by analyzing the experimental results of the copy number of the EPSPS gene, that the SUM1-01 nucleotide sequence, control sequence 1 and control sequence 2 had all been incorporated into the chromosome of the detected soybean plants, and all of the soybean plants into which the SUM1-01 nucleotide sequence was introduced, the soybean plants into which the control sequence 1 was introduced, and the soybean plants into which the control sequence 2 was introduced resulted in single-copy transgenic soybean plants.
Example 7. Detection of Herbicide Tolerance Effects of the Transgenic Soybean Plants
(71) The tolerance of the soybean plants into which the SUM1-01 nucleotide sequence was introduced, the soybean plants into which the control sequence 1 was introduced, the soybean plants into which the control sequence 2 was introduced and the wild-type soybean plants (at seedling stage) to sulfonylurea herbicides were detected.
(72) The soybean plants into which the SUM1-01 nucleotide sequence was introduced, the soybean plants into which the control sequence 1 was introduced, the soybean plants into which the control sequence 2 was introduced and the wild-type soybean plants were taken and sprayed with tribenuron-methyl (72 g ai/ha, four-fold field concentration), sulfometuron methyl (120 g ai/ha, four-fold field concentration), halosulfuron-methyl (34 g ai/ha, one-fold field concentration), pyrazosulfuron-ethyl (25 g ai/ha, one-fold field concentration), thifensulfuron (120 g ai/ha, four-fold field concentration), bensulfuron-methyl (120 g ai/ha, four-fold field concentration), metsulfuron-methyl (30 g ai/ha, four-fold field concentration), ethametsulfuron-methyl (60 g ai/ha, four-fold field concentration), chlorimuron-ethyl (60 g ai/ha, four-fold field concentration) or a blank solvent (water). The degree of damage caused by the herbicide was measured for each plant according to the leaf curl degree and the growth point damage degree 3 days after spraying (3 DAT), 7 days after spraying (7 DAT), 14 days after spraying (14 DAT) and 21 days after spraying (21 DAT): the case where the leaves are flat as untreated plants and the growth points are intact is defined as having a damage degree of 0%; the case where veins are locally browned, new leaves are malformed and plant growth is slow is defined as having a damage degree of 50%; and the case where veins are purple, the whole plant is dead and the growth points are browned and dry is defined as having a damage degree of 100%. The soybean plants into which the SUM1-01 nucleotide sequence was introduced were of two strains in total (S1 and S2), the soybean plants into which the control sequence 1 was introduced were of two strains in total (S3 and S4), the soybean plants into which the control sequence 2 was introduced were of two strains in total (S5 and S6), and the wild-type soybean plants were of one strain in total (CK1); and 10-15 plants were selected from each strain and tested. The results are as shown in Table 2.
(73) TABLE-US-00004 TABLE 2 Experimental results of the herbicide tolerance of transgenic soybean T1 plants Average Average Average Average damage damage Soybean damage % damage % % % Treatment genotypes 3DAT 7DAT 14DAT 21DAT Blank solvent S1 0 0 0 0 (water) S2 0 0 0 0 S3 0 0 0 0 S4 0 0 0 0 S5 0 0 0 0 S6 0 0 0 0 CK1 0 0 0 0 72 g ai/ha S1 0 0 0 0 tribenuron- S2 0 0 0 0 methyl S3 15 25 23 20 (4xTri.) S4 14 22 24 19 S5 16 24 25 20 S6 15 25 25 21 CK1 43 83 100 100 120 g ai/ha S1 0 0 0 0 sulfometuron- S2 0 0 0 0 methyl S3 18 26 23 22 (4xSul.) S4 17 25 22 20 S5 16 27 24 21 S6 17 26 25 22 CK1 43 81 100 100 34 g ai/ha S1 13 0 0 0 halosulfuron- S2 15 0 0 0 methyl S3 26 31 25 22 (1xHal.) S4 27 33 26 23 S5 25 30 25 22 S6 26 34 27 25 CK1 47 81 100 100 25 g ai/ha S1 17 15 0 0 pyrazosulfuron- S2 18 16 0 0 ethyl S3 24 29 25 12 (1x Pyr.) S4 22 27 25 12 S5 23 27 26 13 S6 20 28 24 12 CK1 47 83 100 100 120 g ai/ha S1 0 0 0 0 thifensulfuron S2 0 0 0 0 (4xThi.) S3 18 20 16 13 S4 17 19 16 10 S5 17 19 15 10 S6 16 20 16 12 CK1 28 71 100 100 120 g ai/ha S1 0 0 0 0 bensulfuron- S2 0 0 0 0 methy S3 18 20 17 14 (4xBen.) S4 17 21 16 13 S5 19 22 16 12 S6 18 21 16 13 CK1 35 78 100 100 30 g ai/ha S1 11 0 0 0 metsulfuron- S2 10 0 0 0 methyl S3 23 25 22 19 (4xMet.) S4 24 26 23 19 S5 22 26 23 19 S6 23 25 23 18 CK1 47 85 100 100 60 g ai/ha S1 9 0 0 0 ethametsulfuron- S2 6 0 0 0 methyl S3 18 22 20 18 (4xEth.) S4 20 23 21 17 S5 20 23 21 17 S6 21 24 22 18 CK1 43 82 100 100 60 g ai/ha S1 9 0 0 0 chlorimuron- S2 8 0 0 0 ethyl S3 11 15 6 0 (4xChl.) S4 10 14 5 0 S5 11 15 5 0 S6 12 16 6 0 CK1 20 60 55 50
(74) For soybeans, four-fold field concentration of most sulfonylurea herbicides is an effective dose distinguishing sensitive plants from plants having an average level of resistance. The results in Table 2 showed that the herbicide tolerant protein SUM1 imparted transgenic soybean plants with the sulfonylurea herbicide tolerance; for any of the sulfonylurea herbicides, compared with the soybean plants into which the control sequence 1 was introduced and the soybean plants into which the control sequence 2 was introduced, the soybean plants into which the SUM1-01 nucleotide sequence was introduced had a significantly increased tolerance to sulfonylurea herbicides; while the wild-type soybean plants had no tolerance to most sulfonylurea herbicides.
Example 8. Construction of Recombinant Expression Vectors for Maize
(75) 1. Construction of Recombinant Cloning Vectors Containing SUM1 Nucleotide Sequences for Maize
(76) The synthetic SUM1-02 nucleotide sequence was ligated into a cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and the operational procedure was carried out according to Promega's pGEM-T vector product instructions, thereby obtaining a recombinant cloning vector DBN02-T, the construction process of which was as shown in
(77) According to the method in point 1 of Example 2, Escherichia coli T1 competent cells were transformed with the recombinant cloning vector DBN01-T using the heat shock method, and the plasmids in the cells were extracted through the alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SpeI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and KasI sites in the recombinant cloning vector DBN02-T was the nucleotide sequence as shown in SEQ ID NO: 3 in the sequence listings, i.e., the SUM1-02 nucleotide sequence.
(78) 2. Construction of Recombinant Expression Vectors Containing SUM1 Nucleotide Sequences for Maize
(79) The recombinant cloning vector DBN02-T and an expression vector DBNBC-03 (vector backbone: pCAMBIA2301 (which can be provided by the CAMBIA institution)) were both digested with restriction enzymes SpeI and KasI; the excised SUM1-02 nucleotide sequence fragment was inserted between the SpeI and KasI sites in the expression vector DBNBC-03; and it is well known to a person skilled in the art to construct a vector using conventional enzyme digestion methods, wherein a recombinant expression vector DBN130035 was constructed, and the construction process of which was shown as
(80) According to the method in point 2 of Example 2, Escherichia coli T1 competent cells were transformed with the recombinant expression vector DBN130035 using the heat shock method, and the plasmids in the cells were extracted through the alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SpeI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and KasI sites in the recombinant expression vector DBN130035 was the nucleotide sequence as shown in SEQ ID NO: 3 in the sequence listings, i.e., the SUM1-02 nucleotide sequence.
(81) 3. Construction of Recombinant Expression Vectors Containing Control Sequences for Maize
(82) The recombinant expression vector DBN130035N1 containing control sequence 1 was constructed using control sequence 1, according to the method for constructing the recombinant expression vector DBN130035 containing the SUM1 nucleotide sequence as described in point 2 of this example, and has a structure as shown in
(83) The recombinant expression vector DBN130035N2 containing control sequence 2 was constructed using the control sequence 2 according to the method for constructing the recombinant expression vector DBN130035N1 containing control sequence 1 as described above. Positive clones were validated by sequencing, with the results showing that the control sequence 2 inserted into the recombinant expression vector DBN130035N2 was the nucleotide sequence as shown in SEQ ID NO: 10 in the sequence listing, i.e., the control sequence 2 was inserted correctly.
(84) 4. Transformation of Agrobacterium with the Recombinant Expression Vectors for Maize
(85) Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) was transformed with the recombinant expression vectors DBN130035, DBN130035N1 and DBN130035N2 which have been constructed correctly using a liquid nitrogen method, with the following transformation conditions: placing 100 L of Agrobacterium LBA4404, and 3 L of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 minutes, and warm water bathing at 37 C. for 10 minutes; inoculating the transformed Agrobacterium LBA4404 into an LB tube, culturing under the conditions of a temperature of 28 C. and a rotation speed of 200 rpm for 2 hours, spreading on an LB plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing enzyme digestion verification using restriction enzymes. The results showed that the structures of the recombinant expression vectors DBN130035, DBN130035N1 and DBN130035N2 were completely correct.
Example 9. Acquisition and Verification of Transgenic Maize Plants
(86) According to the conventionally used Agrobacterium infection method, young embryos of sterilely cultured maize variety Zong31 (Z31) were co-cultured with the Agrobacterium in point 4 of Example 8, so as to introduce T-DNA (including the maize Ubiquitin1 gene promoter sequence, the SUM1-02 nucleotide sequence, the control sequence 1, the control sequence 2, the PMI gene and the tNos terminator sequence) in the recombinant expression vectors DBN130035, DBN130035N1 and DBN130035N2 constructed in points 2 and 3 of Example 8 into the maize chromosome, thereby obtaining maize plants into which the SUM1-02 nucleotide sequence was introduced, maize plants into which the control sequence 1 was introduced and maize plants into which the control sequence 2 was introduced; meanwhile, wild-type maize plants were used as the control.
(87) As regards the Agrobacterium-mediated maize transformation, briefly, immature young embryos were separated from maize, and contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the SUM1-02 nucleotide sequence to at least one cell of one of the young embryos (step 1: the infection step). In this step, the young embryos were preferably immersed in an Agrobacterium suspension (OD660=0.4-0.6, an infection culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 68.5 g/L of sucrose, 36 g/L of glucose, 40 mg/L of acetosyringone (AS), and 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), with a pH of 5.3)) to initiate the inoculation. The young embryos were co-cultured with Agrobacterium for a period of time (3 days) (step 2: the co-culturing step). Preferably, the young embryos were cultured in a solid culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 20 g/L of sucrose, 10 g/L of glucose, 100 mg/L of acetosyringone (AS), 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), and 8 g/L of agar, with a pH of 5.8) after the infection step. After this co-culturing stage, there can be an optional recovery step. In the recovery step, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in a recovery culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), and 3 g/L of phytagel, with a pH of 5.8), without the addition of a selective agent for a plant transformant (step 3: the recovery step). Preferably, the young embryos were cultured in a solid culture medium with an antibiotic, but without a selective agent, in order to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the inoculated young embryos were cultured in a culture medium containing a selective agent (mannose), and growing transformed calli were selected (step 4: the selection step). Preferably, the young embryos were cultured in a screening solid culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 12.5 g/L of mannose, 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), and 3 g/L of phytagel, with a pH of 5.8) with a selective agent, resulting in the selective growth of transformed cells. Then, plants were regenerated from the calli (step 5: the regeneration step). Preferably, the calli grown in a culture medium containing a selective agent were cultured in solid culture media (an MS differentiation culture medium and MS rooting culture medium) to regenerate plants.
(88) Resistant calli which were screened out were transferred onto the MS differentiation culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 2 mg/L of 6-benzyladenine, 5 g/L of mannose, and 3 g/L of phytagel, with a pH of 5.8), and cultured at 25 C. for differentiation. The differentiated seedlings were transferred onto the MS rooting culture medium (2.15 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of indole-3-acetic acid, and 3 g/L of phytagel, with a pH of 5.8), cultured at 25 C. to a height of about 10 cm, and transferred to a glasshouse for culturing until fruiting. In the greenhouse, the plants were cultured at 28 C. for 16 hours, and then cultured at 20 C. for 8 hours every day.
(89) 2. Verification of the Transgenic Maize Plants Using TaqMan
(90) The maize plant into which the SUM1-02 nucleotide sequence was introduced, the maize plant into which the control sequence 1 was introduced and the maize plant into which the control sequence 2 was introduced were detected and analyzed according to the method for verifying transgenic soybean plants with TaqMan as described in point 2 of Example 6. The copy number of the PMI gene was detected by the Taqman probe fluorescence quantitative PCR method so as to determine the copy number of the SUM1 gene. Meanwhile, wild-type maize plants were used as the control, and detected and analyzed according to the above-mentioned method. Triple repeats were set for the experiments, and were averaged.
(91) The following primers and probe were used to detect the PMI gene sequence:
(92) primer 3: GCTGTAAGAGCTTACTGAAAAAATTAACA, as shown in SEQ ID NO: 20 in the sequence listings;
(93) primer 4: CGATCTGCAGGTCGACGG, as shown in SEQ ID NO: 21 in the sequence listings;
(94) probe 2: TCTCTTGCTAAGCTGGGAGCTCGATCC, as shown in SEQ ID NO: 22 in the sequence listings.
(95) It was further demonstrated, by analyzing the experimental results of the copy number of PMI gene, that the SUM1-02 nucleotide sequence, control sequence 1 and control sequence 2 had all been incorporated into the chromosome of the detected maize plants, and all of the maize plants into which the SUM1-02 nucleotide sequence was introduced, the maize plants into which the control sequence 1 was introduced, and the maize plants into which the control sequence 2 was introduced resulted in single-copy transgenic maize plants.
Example 10. Detection of Herbicide Tolerance Effects of the Transgenic Maize Plants
(96) The tolerance of the maize plants into which the SUM1-02 nucleotide sequence was introduced, the maize plants into which the control sequence 1 was introduced, the maize plants into which the control sequence 2 was introduced and the wild-type maize plants (at V3-V4 stages) to sulfonylurea herbicides were detected.
(97) The maize plants into which the SUM1-02 nucleotide sequence was introduced, the maize plants into which the control sequence 1 was introduced, the maize plants into which the control sequence 2 was introduced and the wild-type maize plants were taken and sprayed with tribenuron-methyl (72 g ai/ha, four-fold field concentration), sulfometuron methyl (120 g ai/ha, four-fold field concentration), halosulfuron-methyl (136 g ai/ha, four-fold field concentration), pyrazosulfuron-ethyl (100 g ai/ha, four-fold field concentration), thifensulfuron (120 g ai/ha, four-fold field concentration), bensulfuron-methyl (120 g ai/ha, four-fold field concentration), metsulfuron-methyl (30 g ai/ha, four-fold field concentration), ethametsulfuron-methyl (60 g ai/ha, four-fold field concentration), chlorimuron-ethyl (60 g ai/ha, four-fold field concentration) or a blank solvent (water). The degree of damage caused by the herbicide was measured for each plant according to the plant growth status 3 days after spraying (3 DAT), 7 days after spraying (7 DAT), 14 days after spraying (14 DAT) and 21 days after spraying (21 DAT): a growth status equivalent to that of the untreated plants is defined as having a damage degree of 0%; the case where leaves are partially chlorotic and yellow but the normal plant growth is substantially not affected is defined as having a damage degree of 50%; and the case where the whole plant is purple and dying is defined as having a damage degree of 100%. The maize plants into which the SUM1-02 nucleotide sequence was introduced were of two strains in total (S7 and S8), the maize plants into which the control sequence 1 was introduced were of two strains in total (S9 and S10), the maize plants into which the control sequence 2 was introduced were of two strains in total (S11 and S12) and the wild-type maize plants were of one strain in total (CK2); and 10-15 plants were selected from each strain and tested. The results are as shown in Table 3.
(98) TABLE-US-00005 TABLE 3 Experimental results of the herbicide tolerance of transgenic maize T1 plants Average Average Average Average damage damage Maize damage % damage % % % Treatment genotypes 3DAT 7DAT 14DAT 21DAT Blank solvent S7 0 0 0 0 (water) S8 0 0 0 0 S9 0 0 0 0 S10 0 0 0 0 S11 0 0 0 0 S12 0 0 0 0 CK2 0 0 0 0 72 g ai/ha S7 0 0 0 0 tribenuron- S8 0 0 0 0 methyl S9 14 18 15 14 (4xTri.) S10 15 19 16 14 S11 16 19 16 14 S12 15 18 15 13 CK2 41 88 100 100 120 g ai/ha S7 8 0 0 0 sulfometuron- S8 5 0 0 0 methyl S9 16 20 16 13 (4xSul.) S10 17 21 17 14 S11 15 19 16 14 S12 16 20 17 15 CK2 48 83 100 100 136 g ai/ha S7 0 0 0 0 halosulfuron- S8 0 0 0 0 methyl S9 8 10 16 18 (4xHal.) S10 9 15 17 20 S11 6 16 16 18 S12 7 17 15 19 CK2 10 20 21 19 100 g ai/ha S7 6 15 12 10 pyrazosulfuron- S8 4 13 15 11 ethyl S9 28 34 28 25 (4xPyr.) S10 26 40 30 24 S11 27 39 30 24 S12 28 39 29 23 CK2 38 79 100 100 120 g ai/ha S7 0 0 0 0 thifensulfuron S8 0 0 0 0 (4xThi.) S9 4 6 17 18 S10 3 5 16 21 S11 2 4 16 20 S12 3 3 15 19 CK2 14 33 44 50 120 g ai/ha S7 0 0 0 0 bensulfuron- S8 0 0 0 0 methy S9 16 10 6 12 (4xBen.) S10 15 11 5 12 S11 15 10 5 12 S12 16 11 6 13 CK2 40 83 100 100 30 g ai/ha S7 2 0 0 0 metsulfuron- S8 3 0 0 0 methyl S9 14 10 18 14 (4xMet.) S10 15 12 19 15 S11 16 12 18 14 S12 15 11 18 13 CK2 40 86 100 100 60 g ai/ha S7 0 0 0 0 ethametsulfuron- S8 0 0 0 0 methyl S9 13 19 16 14 (4xEth.) S10 14 10 16 13 S11 14 10 15 13 S12 13 10 15 12 CK2 45 81 100 100 60 g ai/ha S7 2 0 0 0 chlorimuron- S8 3 0 0 0 ethyl S9 15 12 19 14 (4xChl.) S10 16 13 20 15 S11 16 12 19 14 S12 15 12 20 15 CK2 43 88 100 100
(99) For the maize, four-fold field concentration of most sulfonylurea herbicides is an effective dose distinguishing sensitive plants from plants having an average level of resistance. The results in Table 3 showed that the herbicide tolerant protein SUM1 imparted transgenic maize plants with the sulfonylurea herbicide tolerance; and for any of the sulfonylurea herbicides, compared with the maize plants into which the control sequence 1 was introduced and the maize plants into which the control sequence 2 was introduced, the maize plants into which the SUM1-02 nucleotide sequence was introduced had a significantly increased tolerance to sulfonylurea herbicides; while wild-type maize plants had no tolerance to most sulfonylurea herbicides.
(100) In conclusion, the herbicide tolerant protein SUM1 of the present invention can exhibit a higher tolerance to sulfonylurea herbicides, and the SUM1-01 nucleotide sequence and SUM1-02 nucleotide sequence containing the herbicide tolerant protein SUM1 coding sequences, are particularly suitable for expression in plants due to the use of the preferred codons of plants. The Arabidopsis thaliana plants into which the SUM1-01 nucleotide sequence was introduced, the soybean plants into which the SUM1-01 nucleotide sequence was introduced and the maize plants into which the SUM1-02 nucleotide sequence was introduced all have a strong tolerance to sulfonylurea herbicides and can tolerate four-fold field concentrations, and therefore, the herbicide tolerant protein SUM1 has a broad application prospect in plants.
(101) Finally, it should be stated that the above embodiments are merely used for illustrating, rather than limiting, the technical solution of the present invention; and although the present invention has been described in detail with reference to the preferred embodiments, a person skilled in the art should understand that modifications or equivalent substitutions may be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.