DETECTION OF NUCLEIC ACID SEQUENCES
20210040550 ยท 2021-02-11
Inventors
Cpc classification
C12Q1/6848
CHEMISTRY; METALLURGY
International classification
C12Q1/6848
CHEMISTRY; METALLURGY
Abstract
The invention relates to methods of detecting a target nucleic acid having a variant sequence in a pool of nucleic acid comprising non-variant nucleic acid and/or non-targeted variant nucleic acid, and a method of highly specific PCR, together with associated primers, primers pairs, compositions, kits and uses.
Claims
1. A method of detecting one or more target nucleic acid(s) having a variant sequence in a pool of nucleic acid comprising non-variant nucleic acid and/or non-targeted variant nucleic acid, the method comprising: providing a forward and reverse PCR primer pair capable of hybridising to the target nucleic acid having a variant sequence for PCR amplification of the target nucleic acid having a variant sequence, wherein the terminal 3 nucleotide of either the forward or reverse primer is arranged to form a base pair with a variant nucleotide of interest in the target nucleic acid sequence having a variant sequence, thereby forming a variant-specific primer, and wherein the forward and reverse PCR primers have a minimum annealing temperature (Ta) of 65 C.; carrying out a PCR in order to amplify any target nucleic acid having a variant sequence in the pool of the nucleic acid; and detecting any PCR product or amplification in real-time, wherein the detection of a PCR product or amplification in real-time confirms the presence of the target nucleic acid having a variant sequence in the pool of the nucleic acid.
2. A method of detecting one or more target nucleic acid(s) having a variant sequence in a pool of nucleic acid that comprises non-variant nucleic acid and/or non-targeted variant nucleic acid, the method comprising: i) providing a forward and reverse PCR primer pair capable of hybridising to the target nucleic acid having a variant sequence for PCR amplification of the target nucleic acid having a variant sequence, wherein the forward and reverse PCR primers have a minimum Ta of 65 C.; ii) providing a blocking probe that is arranged to hybridise to the variant nucleic acid and/or non-targeted variant nucleic acid and prevent polymerisation from the forward and/or reverse PCR primers; carrying out a PCR in order to amplify any target nucleic acid having a variant sequence in the pool of the nucleic acid; and detecting any PCR product or amplification in real-time, wherein the detection of a PCR product or amplification in real-time confirms the presence of the target nucleic acid having a variant sequence in the pool of the nucleic acid.
3. A method of highly specific polymerase chain reaction (PCR) amplification of one or more target nucleic acids in a pool of nucleic acid, the method comprising: providing a forward and reverse PCR primer pair capable of hybridising to the target nucleic acid for PCR amplification of the target nucleic acid, wherein the forward and reverse PCR primers each comprise a 5 tag of non-complementary nucleotides and have a minimum annealing temperature (Ta) of 65 C.; carrying out a PCR with one or more first cycle temperature profiles, such that the 5 tag of non-complementary nucleotides of the forward and reverse PCR primer pair become incorporated into the PCR amplicons, wherein the first cycle temperature profile provides an annealing temperature of at least 65 C. and which is suitable for the annealing of the forward and reverser primer pair such that they hybridise to the target nucleic acid, and carrying out a PCR with one or more second cycle temperature profiles in order to amplify the PCR amplicons from the PCR cycle(s) of the first cycle temperature profile, wherein the second cycle temperature profile provides an annealing temperature that is higher than the first cycle temperature profile and which is suitable for the annealing of the PCR amplicons.
4. The method according to claim 1 or 2, wherein carrying out the PCR comprises the method of highly specific PCR in accordance with claim 3.
5. The method according to any preceding claim, wherein the forward and reverse PCR primers each comprise a 5 tag of non-complementary nucleotides.
6. The method according to any preceding claim, wherein the forward and reverse PCR primers each comprise nucleotide analogues.
7. The method according to any of claim 1, 2, or 4-6, wherein the variant sequence is a mutation, and the non-variant nucleic acid is wild-type nucleic acid.
8. The method according to any of claim 1, 2, or 4-7, wherein the variation comprises a single nucleotide variation (SNV).
9. The method according to any of claim 1, 2, or 4-8, wherein the variation comprises a nucleotide deletion, insertion, amplification or rearrangement.
10. The method according to any preceding claim, wherein the forward and/or reverse primer comprise nucleotide analogue selected from LNA, BNA or PNA.
11. The method according to any preceding claim, wherein the forward or the reverse primer comprises a nucleotide analogue, such as LNA, PNA, or BNA, at the terminal 3 position.
12. The method according to any preceding claim, wherein the forward or the reverse primer comprises a nucleotide analogue, such as LNA, PNA, or BNA, at the terminal 3 position, wherein the remaining primer sequence comprises DNA.
13. The method according to any preceding claim, wherein the forward or the reverse primer comprises a nucleotide analogue, such as LNA, PNA, or BNA, at the terminal 3 position, and a 5 tag of non-complementary nucleotides.
14. The method according to any preceding claim, wherein the forward and/or reverse primers comprise a GC content of between about 40% and about 60%.
15. The method according to any of claims 5-14, wherein the 5 tag of non-complementary nucleotides consists of a sequence of between about 5 and 100 nucleotides.
16. The method according to any of claims 5-15, wherein the GC content of the 5 tag is 100%.
17. The method according to any of claims 5-16, wherein the 5 tag of non-complementary nucleotides comprises or consists of a sequence of 5-gggccggccc-3 (SEQ ID NO: 35) or 5-gggccgggccggccc-3 (SEQ ID NO: 36).
18. The method according to any preceding claim, wherein the amplification of the PCR product is detected during the PCR, using Real-Time PCR.
19. A method of determining the status of a condition associated with a known mutation in a subject, the method comprising: providing a sample from the subject comprising a target nucleic acid, wherein the target nucleic acid may contain the mutation; detecting the mutation in the sample in accordance with the method of any of claim 1, 2, or 4-18, wherein the detection of the mutation is indicative of the status of the condition associated with the mutation in the subject.
20. The method according to claim 15, wherein the condition comprises cancer.
21. A primer for use in a primer pair for detecting a target nucleic acid having a variant sequence in a pool of nucleic acid, wherein the primer is capable of hybridising to the target nucleic acid having a variant sequence for PCR amplification of the target nucleic acid having a variant sequence, wherein the terminal 3 nucleotide of the primer is arranged to base pair with the variant nucleotide of interest in the target nucleic acid having a variant sequence; wherein the primer comprises a 5 tag of non-complementary nucleotides and/or comprise one or more nucleotide analogues such that the primers has a minimum Ta of 65 C.
22. The primer according to claim 21, wherein the primer comprises a nucleotide analogue at the terminal 3 position.
23. The primer according to claim 21 or 22, wherein the primer comprises a nucleotide analogue at the terminal 3 position, wherein the remaining primer sequence comprises DNA.
24. The primer according to any of claims 21-23, wherein the primer comprises a nucleotide analogue at the terminal 3 position and a 5 tag of non-complementary nucleotides.
25. A forward and reverse primer pair for the PCR detection of a KRAS, PIK3CA, EGFR, APC or BRAF mutation in a target nucleic acid, wherein the forward and/or reverse primer is selected from the KRAS, PIK3CA, EGFR, APC or BRAF forward and reverse primers respectively of table 1 herein wherein the forward and reverse primers further comprise a 5 tag of nucleotides that are non-complementary to the target nucleic acid, and/or wherein terminal 3 nucleotide of the forward or reverse primer is substituted with a nucleotide analogue.
26. A composition comprising the primer according to any of claims 21-24 or primer pair according to claim 25; and optionally a blocking probe.
27. A kit comprising the primer according to any of claims 21-24 or primer pair according to claim 25, or the composition according to claim 26.
28. The kit according to claim 27, further comprising a polymerase and/or a blocking probe.
29. Use of the primer according to any of claims 21-24 or primer pair according to claim 25, or the composition according to claim 26, or the kit in accordance with claim 26 or 27, for the detection of a target nucleic acid having a variant sequence in a pool of nucleic acid.
30. The use according to claim 29 for diagnosis or prognosis of a condition or response to chemotherapy associated with a mutation, in a subject.
Description
[0149] Embodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying drawings.
[0150]
[0151] This is a comparison of HOT_ARMS 1 primers tested in the cell line HCT116 (50% MAF) and the placental DNA showing wide separation. Eight replicates are shown for each demonstrating the precision of the test.
[0152]
[0153] HOT_ARMS1 was tested to its limit. Cell line DNA was spiked into placenta DNA. Mutant alleles at a frequency of 0.004% could be detected and discriminated from pure placental DNA.
[0154]
[0155] The dynamic range and efficiency of HOT_ARMS1 was tested on template with mutant allele frequency (MAF) ranging from 50%-0.09%.
[0156]
[0157] HOT_ARMS PCR works on DNA derived from formalin fixed tissue. Several samples which had been previously genotyped were tested.
[0158]
[0159] In attempt to improve the HOT_ARMS PCR assay, the HOT_ARMS1 primers were modified to include a locked nucleic acid (LNA) at the 3 base.
[0160]
[0161] Process 1 outlines the pathway for tumour specimen mutation detection. Whole genome sequencing will allow the maximum probability for identifying tumour mutations in cell-free DNA. However, other mutation detection methodologies can be used for smaller scale panel systems. Process 2 represents the pathway for cell-free DNA mutation detection. The cell-free DNA will be divided up in order to detect up to 4 or more specific mutations. Lower total DNA input which is distributed over a number of targets will allow greater sensitivity to be achieved via reduced wild-type bleed through as shown in table 6. Moreover, a panel of 4 or more mutations will increase the chances for mutation discovery. Mutation discovery probabilities are based on the heterogeneity of tumour mutations and location of the tumour. The greater the number of targets the increased likelihood for true mutation detection. This is especially important with most cancer treatments which can drive tumour homogeneity and minor clone mutation signals can be lost. Both processes can be carried out individually or simultaneously apart from the last step in process 2 which requires tumour specimen mutation identification beforehand.
[0162]
[0163] HOT_ARMS assays with Act >15 (40 ng total DNA) between 50% MAF and wild-type can undergo rapid 30-minute testing with clear 0.06% (4 mutant copy) detection when utilising a fast cycling mastermix and thermocycler. Rapid testing is made possible by the extremely high specificity HOT_ARMS primers achieve, as shown in table 8. HOT_ARMS assays with lower specificity; Act <15 between 50% MAF and wild-type will obtain lower sensitivities of 0.5% MAF (33 mutant copies). However, with the addition of 3 LNA, the specificity can be increased and 0.1-0.2% MAF can be detected. The magnetic induced cycler (MIC) PCR machine was utilised to reduce the total PCR time (50 cycles) to 30 minutes including melt-curve.
[0164]
[0165] Ct values are demonstrated in table 9 where 0.06% (4 copies) can be detected. Whilst ct values give yes/no answers for mutations; amplicons can be designed to be of different length, resulting in different melting temperatures. Thus, the mutation call can be determined by ct value and its identity by melting peak analysis. Double-stranded DNA binding dyes are utilised here and no probes. HOT_ARMS 1 and 12 melting peaks are shown in duplicate with clean specific peaks. HOT_ARMS 1 and 12 multiplexing demonstrates that some bleed through occurs. However, the bleed through is minimal and allows for the dominant mutant amplicon to be identified; representing the high specificity achieved by HOT_ARMS PCR.
[0166]
[0167] In all instances, 62.5 g (10 copies) can be amplified. Ct values shown in table 10.
[0168]
[0169] HOT_PI PCR products can undergo mutation detection via sequencing, high-resolution melting analysis, mutation specific probes or digital-droplet PCR. This figure demonstrates the enrichment potential using 100 nM of wild-type blocking probe which allows wild-type to partially amplify for sequencing. Further enrichment can be permitted as shown in table 12. Image A represents wild-type sequence from the HEK293T cell line; Image B shows a homozygous G>T mutation found in the colon cancer cell line SW480 (c.35G>T) on the second DNA base in the image; Image C shows SW480 spiked into HEK293T (wild-type) at 1% mutant allele frequency (MAF); Image D shows SW480 spiked into HEK293T (wild-type) at 5% MAF; Image E shows SW480 spiked into HEK293T (wild-type) at 10% MAF; Image F shows SW480 spiked into HEK293T (wild-type) at 20% MAF. As the limit of detection for Sanger sequencing is 10-20%, image C (1% MAF), D (5% MAF) and E (10% MAF) should be completely wild and image F (20% MAF) should show a small peak for Thymine. However, the mutation enrichment is so strong that the 1% MAF shown in image C becomes easily detectable and Thymine becomes the dominant peak in image D (5% MAF), E (10% MAF) and F (20% MAF). This figure is purely for demonstrations of enrichment potential rather than its true limit of sensitivity and fold-enrichment which can be obtained by pyrosequencing, deep-sequencing or mutation specific probes with higher blocker concentrations.
[0170]
[0171] Without wild-type blocking probe; 1% MAF does not differ from wild-type DNA. However, with 100 nM wild-type blocking probe, 1% MAF shows a large difference in melting behaviour representing a mutation. 0.1% MAF (8 mutant copies) can be detected using high resolution melting analysis with 100 nM wild-type blocking probe. HOT_PI PCR products can undergo mutation detection via sequencing, high-resolution melting analysis, mutation specific probes or digital-droplet PCR. This figure demonstrates the enrichment potential using 100 nM of wild-type blocking probe which allows wild-type to partially amplify for high-resolution melting analysis. Further enrichment can be permitted as shown in table 12. High-resolution melting analysis depends on heteroduplex formation. Thus, homozygous mutations can only be detected by ct value rather than melting behaviour. Greater mutation enrichment can be achieved with higher concentrations of blocking probe but heteroduplex formation restricts the method as low MAF samples begin forming mutant homoduplexes which disrupt the analysis. This figure is purely for demonstrations of enrichment potential rather than its true limit of sensitivity and fold-enrichment which can be obtained by pyrosequencing, deep-sequencing or mutation specific probes with higher blocker concentrations.
EXAMPLE 1HOT_ARMS PCR: A SIMPLE AND EXQUISITELY SENSITIVE METHOD FOR MUTATION DETECTION
[0172] Summary
[0173] Knowledge of tumour mutations underpins precision medicine in the management of cancer patients. This knowledge can also support other care pathways such as tumour surveillance. Not infrequently, however, the proportion of mutant alleles in patient-derived DNA samples is very low and the presence of contaminating wild-type DNA may make mutation detection unreliable. In order to circumvent this problem, the High Optimised Ta Amplification Refractory Mutation System (HOT_ARMS) PCR has been developed in accordance with the invention herein. This depends on modification of allele-specific primers (through addition of a GC-rich tag and/or incorporation of modified nucleic acids) to enable PCR to be performed at an annealing temperature 65 C. HOT_ARMS PCR does not require special probes and can be performed on standard real-time PCR machines without the need for expensive equipment.
[0174] 13 different mutations were tested (including single nucleotide variants and insertion-deletion mutations) in template derived from cell lines and formalin-fixed tissue. Robust mutation detection was shown with a limit-of-detection as low as 0.004% mutant allele frequency (MAF). The assay has a wide dynamic range and excellent precision even at low MAF. Each target tested using HOT_ARMS PCR required little or no optimisation and the tests could be multiplexed. Blind testing of 10 FFPE cases and 11 circulating tumour DNA cases with known KRAS mutation correctly identified the genotype of each case thus confirming the accuracy of the assay.
[0175] In summary, HOT_ARMS PCR is an extremely simple, robust and sensitive test. It is a single stage closed-tube test which could transform cancer patient management by widening access to genetic testing. The speed of the test means it can be established in the hospital out-patient and even the primary care setting.
[0176] Materials and Methods
[0177] DNA Extraction
[0178] DNA from cell lines (see Table 14 for list of cell lines used) was extracted using the GenElute mammalian genomic DNA miniprep kit (Sigma-Aldrich, U.S.A) using the manufacturers protocol.
[0179] DNA was extracted from formalin-fixed paraffin-embedded (FFPE) from 10 cases of colorectal cancer which had previously been tested for KRAS mutation. Sections were reviewed to confirm that, semi-quantitatively, tumour cells comprised at least 30% of the total cellular population. Twenty M section curls were cut from tumour blocks, dewaxed in xylene and digested completely at 55 C. with proteinase K (Qiagen) in accordance with the QIAamp FFPE DNA extraction protocol. DNA was extracted using the Qiamp FFPE DNA extraction kit (Qiagen) in accordance with manufacturer's instructions.
[0180] DNA Dilutions and Limit of Detection
[0181] Placental DNA and some of the mutation-containing cell line DNA was purchased from commercial sources. All DNA was quantified using a Nanodrop spectrophotometer 2000c (Thermo Scientific) and 260:280 absorbance ratio of 1.8-2.0 was taken as indicative of good quality. DNA was diluted to a final concentration of 20 ng/l with nuclease free water (Qiagen, Germany). DNA from cell lines with known mutations was spiked into placental DNA containing wild type sequence. Templates samples were prepared containing mutant alleles frequencies (MAF) ranging from 50% down to 0.004%.
[0182] Primer Design and Modification
[0183] (a) Primer Design
[0184] Two types of mutation were tested i.e. Single Nucleotide Variants (SNV) and insertion-deletion (Indel) mutations. In both cases, a novel sequence is createdfor SNVs this is due to the substitution of a wild-type base for a mutant base. For Indels, the insertion or deletion of bases results in the disruption of the wild type sequence. In both cases, primers were designed to produce short products (60-80 bp in some tests and 50-110 bp in other tests) and one of the primers contained a mutation specific base at the 3 end of the sequence. The other primer contained wild-type sequence. In total, 13 different mutations were tested in 8 different codons in 5 different genes (see Table 1). The mutations tested in BRAF, EGFR, KRAS and PIK3CA were SNV whilst the mutation detected in APC was a frameshift deletion mutation.
[0185] HOT_ARMS PCR works on the principle that a high Ta will improve the specificity of the PCR. As a rule of thumb, the Ta is usually 5 C. lower that the melting temperature (Tm). The definition of Tm is the temperature at which 50% of the DNA is melted (i.e. the strands are separated) and this is the physical property of DNA which is used by primers design software packages. Primers were initially designed in Primer 3 [15] mostly according to the standard rules [16] and then modifications were made to raise the Tm/Ta.
[0186] In this non-limiting example HOT_ARMS primers were designed as follows: (i) minimum primer length 20 bases, optimum primer length 25 bases and maximum primer length 30 bases (length/bases does not include 5 tag); (ii) minimum GC content 30%, optimum GC content 45%, maximum GC content 60% (GC content does not include 5 tag content); (iii) minimum Tm (melting temperature) 60 C., optimum Tm 65 C., maximum Tm 85 C.; (iv) minimum amplicon length 50 or 60 bp, maximum amplicon length 110 bp; (v) primer dimer free energy (G)<6 and Tm<60 C.; (vi) hairpin G<6 and Tm<60 C.; (vii) 3 base is specific for the mutation in either the forward or reverse primer; (viii) Maximum Tm difference between forward and reverse primer 3 C.
[0187] Examples of how the Mutation Specific Primers are Designed for Different Mutation Scenarios:
[0188] Hypothetical wild-type sequence of 30 nucleotides is mutated in different ways to model the different possibilities which would occur in practice. Mutations are highlighted and both the original and the new mutated sequence are shown. The ARMS specific primer which would work only on the mutant sequence are shown.
TABLE-US-00001 Hypotheticalsequence: GATCGGATTGGCAAATTAGCCGTAGGCCGG
[0189] Example SNV: Nucleotide Highlighted in Bold Changes from T to C
TABLE-US-00002 Originalsequence: GATCGGATTGGCAAATTAGCCGTAGGCCGG Newsequence: GATCGGATCGGCAAATTAGCCGTAGGCCGG Primersequence: GATCGGATC
[0190] Example Deletion: Nucleotide(s) Highlighted in Bold Deleted
TABLE-US-00003 Originalsequence: GATCGGATTGGCAAATTAGCCGTAGGCCGG Newsequence: GATCGGATGGCAAATTAGCCGTAGGCCGG Primersequence: GATCGGATG Originalsequence: GATCGGATTGGCAAATTAGCCGTAGGCCGG Newsequence: GATCGGATAGCCGTAGGCCGG Primersequence: GATCGGATA
[0191] Example Insertion: Nucleotide Highlighted in Bold is Inserted
TABLE-US-00004 Originalsequence: GATCGGATTGGCAAATTAGCCGTAGGCCGG Newsequence: GATCGGATTTGGCAAATTAGCCGTAGGCCGG Primersequence: GATCGGATTT
[0192] Example Amplification: Nucleotides Highlighted in bold amplified 4
TABLE-US-00005 Originalsequence: GATCGGATTGGCAAATTAGCCGTAGGCCGG Newsequence: GATCGGATTGGCTGGCTGGCTGGCTGGCAAATTAGCCGTAGGCCGG Primersequence: GATCGGATTGGCT
[0193] Example Rearrangement: Nucleotides Highlighted Bold are Moved to Another Site in the Sequence in Bold
TABLE-US-00006 Originalsequence: GATCGGATTGGCAAATTAGCCGTAGGCCGG Newsequence: GATCGGATTGAGGCCGGCAAATTAGCCGTG Primersequence: GATCGGATTGA
[0194] (b) Primer Modification
[0195] For HOT_ARMS PCR, the primers need to be further modified to increase the Tm. There are two main approaches available i.e. addition of a sequence tag to the primers or incorporation of modified bases into the primers.
[0196] (i) Addition of a tag. Extending the length of a primer by adding extra sequences in the form of a 5 tag will raise the Tm of the primer. The greatest increase will be achieved if the tag contains a high proportion of Guanine and Cytosine bases. Two tags were tested: a 10 base tag with the sequence 5-gggccggccc-3 (SEQ ID NO: 35) (predicted to raise the Tm by approximately 20 C.) and a 15 base tag with the sequence with the sequence 5-gggccgggccggccc-3 (SEQ ID NO: 36) (predicted to raise the Tm by approximately 25 C.). The tags were added to both the forward and reverse primers.
[0197] (ii) Incorporation of modified nucleic acids. Recently developed synthetic nucleic acids (such as Locked Nucleic Acids (LNA), Bridged Nucleic Acids (BNA) and Peptide Nucleic Acids (PNA)) have a much greater binding affinity for the paired base on the opposite DNA strand than naturally occurring nucleic acids [18-20]. Incorporation of synthetic nucleic acids into primers/probes has been used to increase the specificity [18, 21, 22] although the high binding affinity stabilizes double stranded DNA thereby increasing the Tm (by approximately 2 C. per nucleotide). LNA's were tested here (BNA/PNA are predicted to have the same effect). Primers were designed in accordance with the rules above and 3-5 LNAs were included at various sites within the primer in accordance with published recommendations [18, 21-23].
[0198] (iii) Combination of tag and LNA. Primers modifications of varying tags and LNAs were tested individually. Based on the results, a new modification of combining tag with LNA was developed. This consisted of the 10 base tag (5-gggccggccc-3 (SEQ ID NO: 35)) together with an LNA incorporated as the 3 base of the mutation specific primer.
[0199] HOT_ARMS PCR Protocol and Optimisation
[0200] All reactions were undertaken in 0.2 ml tubes with caps (Agilent, U.S.A). Each reaction was performed in a final volume of 10 l which contained the following components: 2 HotShot Diamond mastermix (Clent Life Science, U.K) which includes a final concentration of 6 mM MgCl.sub.2 and 400 M dNTPs with stabiliser; EvaGreen dye 20 in water (Biotium, U.S.A); adjusted DNA template; 375 nM each primer and Nuclease-Free water (Qiagen, Germany). Standard nucleic acid primers were purchased from Eurofins (Luxembourg) and LNA containing primers were purchased from Eurogentec, (Belgium).
[0201] Primers were designed to have a minimum Tm of 70 C. to allow a Ta 65 C. to be used. All primers worked at the same temperature as they were designed that way for minimal optimisation. The initial optimisation used template containing 50% mutant alleles and a single PCR product was confirmed by high resolution melting analysis on a Lightscanner (Biofire Defence, U.S.A). In order to produce a standard protocol which would work for multiple targets, generally a Ta of 71 C. was used. The effect of primer concentration on test performance at low levels of mutant allele frequency (0.125% and 0.0625%) was tested using differing primer concentrations (250 nM-600 nM) with a Ta of 71 C.
[0202] Tests were performed on the Stratagene MX3005P real-time machine. The threshold for detection was set using the machine's default parameters (10 standard deviations away from the mean of the baseline fluorescence). For tagged primers, template containing different mutant allele frequencies was tested using the following cycling parameters: (95 C./5 min)1/(95 C./20 sec; Ta/20 sec; 72 C./20 sec)50. LNA primers enhance specificity at the expense of PCR efficiency and to test these primers, a modified touch-up protocol was used as follows: (95 C./5 min)1/(95 C./30 sec; 60 C./20 sec; 72 C./20 sec)20 (95 C./20 sec; Ta/20 sec; 72 C./20 sec)30. This protocol was also used for the combined tag/LNA primers. A standard protocol can be used with mastermixes or nested PCR to improve efficiency.
[0203] HOT_ARMS PCR Assay Testing and Statistical Analysis
[0204] Limit-of-detection tests were performed on templates containing varying proportions of mutant allele and compared against placental DNA (containing only wild type DNA). In general, 20 ng of template was used although, at the lower mutant allele frequencies (MAF), the chances of a mutant allele being present follows a Poisson distribution. For this reason, the amount was DNA was adjusted to ensure that there were at least four copies of mutant allele theoretically calculated to be present. This means, by Poisson statistics, at least one copy would always be present. When testing the performance of HOT_ARMS PCR on DNA derived from FFPE tissue, 20 ng of tumour DNA was used.
[0205] Short term precision and PCR dynamic range was tested on a series of samples containing doubling dilution spiked-in MAF ranging from 50%-0.09%. Short term precision was tested by repeating the same assay 8 times in a single run and calculating the coefficient of variation of the Ct values. The short term precision was tested at several different mutant allele frequencies. The PCR efficiency for mutant alleles was calculated by plotting the Ct values against the log 2 [1/MAF] and calculating the slope of the curve. A slope value of 1.0 would be indicative of 100% efficiency.
[0206] For multiplex analysis, multiple different primers targeting mutations in codon 12 of KRAS and different exons in KRAS/BRAF were tested in a single reaction. Tests were performed on cell line DNA templates containing the different mutations and on placental wild-type template.
[0207] Results
[0208] HOT_ARMS PCR Robustly Distinguishes Mutant DNA Cell Line from Placental DNA
[0209] Primers were designed for 13 different mutations (Table 1) and for the purposes of simplicity the primer pairs for these mutations are referred to a HOT_ARMS1 through to HOT_ARMS13. Gradient PCR showed that HOT_ARMS1 primers produced a single PCR product at 71 C. and so this was adopted as the Ta for all subsequent reactions without further optimisation. Similarly, optimisation of the primer concentration showed that a concentration of 375 nM per reaction was the best across all mutant allele concentration and this was therefore chosen as the final consensus primer concentration.
[0210] Firstly the ability to detect mutations in cell line DNA was tested and compared against the non-specific background amplification of placental DNA (
[0211] It is expected that non-specific bleed-through amplification will occur in wild-type DNA even with mutation-specific primers and non-specific amplification in placental DNA. Every HOT_ARMS primer pair showed a difference in Ct (Ct value) between the cell lines and placenta of at least 10 cycles with a mean Ct value of 13. The HOT_ARMS primers were compared with the same primer sequences without the GC tags. When PCR was performed at a Ta of 55 C., the HOT_ARMS primers performed more poorly than the non-tagged primers with a Ct value between the cell lines and placenta of 3 and 4 respectively (data not shown). When PCR was performed at a Ta of 71 C., the non-tagged primers did not produce any amplification.
[0212] Given the specificity of the HOT_ARMS primers, we tested whether they could be multiplexed. For testing KRAS codon 12/13 mutations, many of the HOT_ARMS primers have a common reverse primer and a mutation specific forward primer (Table 1). This allowed an assay to be set up with several forward primers and a single reverse primer. Both wild-type and mutant templates were tested and it was possible to combine up to 4 forward primers with little change in the performance of the assay i.e. each of the mutations was detected at the expected Ct and the large numbers of primers did not interact to generate false positives when tested on the placental DNA.
[0213] Primers tagged with a 10 base GC tag were found to have a higher efficiency than primers tagged with 15 base GC tags.
[0214] HOT_ARMS PCR has a Very Low Limit of Detection
[0215] DNA from cell lines containing known heterozygous mutations was spiked into placental DNA (Table 6) to produce mutant allele frequencies (MAF) ranging from 50%-0.004%. Limit of detection tests were performed in duplicate and a test was called positive if there was a Ct value between test sample and placental DNA of 2. The limit of detection was variable ranging from 0.06% MAF for the least efficient primer pairs, down to 0.004% MAF for HOT_ARMS1, the most efficient primer pair (
[0216] HOT_ARMS PCR has a Wide Dynamic Range and Excellent Precision
[0217] All primer pairs were found to show a very low limit of detection when testing for specific mutations. In order to test the robustness of the assay, the short term precision (also known as the intra-assay variability) was evaluated, which is best evaluated through measuring the coefficient of variation.
[0218] Eight replicates were performed for the HOT_ARMS1 primer pair with spiked-in template containing MAFs ranging from 50% down to 0.09% (Table 3,
[0219] The templates had been diluted twofold and so the mean Ct value for each MAF was plotted against the log 2 [1/MAF] to enable the dynamic range to be assessed. Over this range, the slope of the curve was 1.07 (
[0220] HOT_ARMS PCR Works on DNA Derived from Formalin Fixed Paraffin-Embedded (FFPE) Tissue
[0221] The HOT_ARMS primers were designed to amplify short fragments with a view to using the assay on DNA obtained from formalin-fixed paraffin-embedded (FFPE) tissue. FFPE tissue-derived DNA is notorious for being fragmented and often of poor quality. A total of 10 cases, with known mutations in KRAS codon 12/13, were tested by HOT_ARMS PCR. For each case, there was successful amplification with the mutation-specific primer (
[0222] Further testing of BRAF V600E on 35 positive cases validated by high resolution melting analysis and KRAS on a further 32 positives cases validated by pyrosequencing all gave 100% concordance.
[0223] Combining LNA/GC Tag Improves Specificity of HOT_ARMS PCR
[0224] Data had shown that, of the different strategies, the optimal primer modification was a 10 base GC tag at the 5 end of both primers. Although this produced an exquisitely sensitive assay, the Ct value between test sample and placental DNA became progressively smaller at low MAF. This prompted us to combine the 10 base GC tag with LNA incorporation in order to reduce the non-specific bleed through amplification. By incorporating an LNA at the 3 mutation-specific base of the HOT_ARMS1 primers, we were able to abrogate non-specific amplification and no signal was detected even after 50 cycles (
[0225] 3LNA primers with tags can be used with nested PCR to increase efficiency. Increased specificity remains and 0.1% MAF detection can be achieved.
[0226] Discussion
[0227] The Amplification Refractory Mutation System (ARMS) was originally described as a means of genotyping single nucleotide variants (SNVs) without the need for formal sequencing [10]. It has subsequently been used for mutation detection in cancer and, since PCR is mutation-specific, it can be very sensitive. However, with standard ARMS PCR, there is still low-level base-pairing at the 3 end between the mutation-specific primer and the wild-type sequence despite being mismatched. This allows mis-priming of wild-type DNA by the mutant primer with consequent non-specific amplification. Discriminating non-specific from specific amplification when MAF is low can be problematic.
[0228] In High Optimized Ta ARMS (HOT_ARMS) PCR, specificity of the PCR is increased by modifying the primers to raise the annealing temperature (Ta). The increased kinetic energy of the primers hugely reduces non-specific 3 base-pairing. This specificity is achieved with a Ta 65 C. although the higher the Ta the greater the specificity. The primers can be modified in a number of ways and, in our hands, the best results were obtained by adding a 10 base GC tag onto each primer. With just this modification and a working Ta of 71 C., we demonstrated that HOT_ARMS PCR is an incredibly simple, robust and exquisitely sensitive method of detecting low frequency mutant alleles.
[0229] Thirteen different mutations, located in different genes and exons and including both SNVs and indel mutations, were tested. We believe we are the first group to use ARMS PCR for detection of indels and the results were comparable with detection of SNVs. The primers required minimal optimization and in fact, after the first two sets of primers, optimization was found to be not necessary as the primers worked off the shelf. The short term precision (reproducibility) of the assay was tested whilst there was slight increase in coefficient of variation at very low MAF (<1.56%), in most cases it was <1% as would be expected for an accurate real-time test [25-27]. Similarly, the PCR efficiency was 105% over the MAF range of 50%-0.09% MAF indicating a wide dynamic range and potentially mutant allele quantification.
[0230] The limit of detection of the 13 primer pairs ranged from 0.004% MAF for the best performing primer to 0.125% for the worst performing primer. This variation is to be expected as, apart from hydrogen-bonding between base pairs, other sequence-dependent factors will contribute to the stability of the primer-DNA duplex. Thus some mutation-specific primers will be innately more specific than other. However the robustness of the methodology is reflected in the fact that all of the primer pairs, with little or no optimisation had a limit of detection of 0.06% MAF. This is underlined further by the fact that tests can be multiplexed and, when tested on DNA derived from FFPE tissue, the mutations could be easily detected and tumours could be correctly genotyped when tested blind using HOT_ARMS PCR. cfDNA is usually of much higher quality than FFPE tissue-derived DNA, therefore HOT_ARMS PCR would easily work with cfDNA.
[0231] The need to identify low frequency tumour-derived mutant alleles in a pool of wild-type DNA is well described in molecular diagnostics. A number of methods of varying complexity have been established for detection of very low MAF each with its own utility and advantages/disadvantages (Table 7). Apart from setting a different cycling program and purchasing GC tagged primers, HOT_ARMS PCR does not differ from a standard real-time PCR i.e. this is a single closed-tube reaction which does not require extra mismatches, special probes, special enzymes or a nested protocol. It is much more sensitive than ARMS PCR and there is no other probe-free single stage closed tube method that comes even close to the most common limit of detection of 0.06% MAF. This system has a similar limit of detection as other more complicated systems published in the literature. Addition of probes has been used to improve the limit of detection and some closed-tube systems claim to have a limit of detection as low as 0.005% MAF [3]. Probe-based methods will however be more complex than HOT_ARMS PCR and will not be universally applicable since each mutation will require manufacture of specific probes. Methods such as COLD-PCR and its derivatives [6] can enrich low frequency mutant alleles allowing detection down to a MAF of 0.1%. These do however require a second step (i.e. sequencing or mutation screening) in order to confirm the presence of mutations. There are other high throughput methods described such as Beaming, digital droplet PCR and ultra-deep Next Generation Sequencing, which have been reported to detect MAF as low as 0.001%. These however require expensive machine as well as complex manipulation of the template (such as generating libraries in NGS).
[0232] HOT_ARMS PCR requires prior knowledge of the sequence changes induced by mutations and thus it cannot be used for mutation screening unless there is a very limited spectrum of sequence change (such as with KRAS codon 12/13 mutation [36]). However, it is likely that, in the near future, all tumours will undergo either whole genome or whole exome sequencing and a full mutation profile will be described in each case. HOT_ARMS PCR can be used to detect any mutation which causes a sequence change including SNVs and indels. If the specific sequence changes can be identified in structural variants, it could be used to test for these too. As we have shown, HOT_ARMS PCR is readily applicable to all mutations and therefore patient specific primer sets can be established for tumour surveillance as soon as the mutation profile is known. Tumour surveillance may become a major part of the cancer care pathway especially in the wake of data showing that tumour specific mutations can be detected in the cfDNA of patients up to a year before recurrence becomes clinically overt. Since HOT_ARMS PCR can be undertaken within the two hours and does not require complex data interpretation, it could provide a result within the time scale of a hospital outpatient appointment. Equally feasible, would be the establishment of a patient-specific HOT_ARMS PCR tumour surveillance assays in the primary care setting.
[0233] In summary, HOT_ARMS PCR is an extremely simple, robust and exquisitely sensitive test for detection of any kind of mutation which results in a sequence change. It is a single stage closed-tube test which does not require expensive equipment and, because it is not reliant on probes, it is easy to set up and requires little optimisation for most mutations. The speed of the test means it could be established in the hospital out-patient and even the primary care setting.
EXAMPLE 2HIGHLY OPTIMISED ANNEALING TEMPERATUREPROBEINHIBITEDPOLYMERASE CHAIN REACTION (HOT_PI-PCR) TECHNICAL WHITE PAPER
[0234] Summary
[0235] We reasoned that issues with standard wild-type blocking PCR could be counteracted by increasing the primer annealing temperature (Ta). The increase in free energy generated by raising the annealing temperature to >65 C. would prevent inappropriate base-pairing and perfect base matches would be more stable resulting in a probe which had higher specificity. Hence, giving more freedom for the mutant DNA to amplify without probe mispriming and blocking the wild-type DNA further as the probe would bind with greater affinity. Moreover, raising the annealing temperature would also allow a larger probe, due to the 8 C. gap required, in turn generating a larger scanning region for mutations. Here we show that by a simple modification of the primers to increase the Ta 65 C., the specificity of wild-type blocking PCR can be increased and further fold enrichment can be generated compared to previous iterations of the system. Moreover, a scanning region of 50 bp can be achieved. We call this modification High Optimized Ta-Probe inhibited (HOT_PI) PCR.
[0236] Materials and Methods
[0237] DNA Extraction
[0238] DNA from was extracted from cell lines in accordance with Example 1.
[0239] DNA Dilutions and Limit of Detection
[0240] Placental DNA and some of the mutation-containing cell line DNA was purchased from commercial sources. All DNA was quantified using a Nanodrop spectrophotometer 2000c (Thermo Scientific) and 260:280 absorbance ratio of 1.8-2.0 was taken as indicative of good quality. DNA was diluted to a final concentration of 20 ng/l with nuclease free water (Qiagen, Germany). DNA from cell lines with known mutations was spiked into placental DNA containing wild type sequence. Templates samples were prepared containing mutant alleles frequencies (MAF) ranging from 50% down to 0.1%.
[0241] Primer Design and Modification
[0242] (a) Primer Design
[0243] In total, 7 different mutations were tested in 2 different codons in 1 gene (see Table 1). The mutations tested in KRAS were single nucleotide variants.
[0244] HOT_PI PCR works on the principle that a high Ta will improve the specificity of the probe. As a rule of thumb, the Ta is usually 5 C. lower that the melting temperature (Tm). The definition of Tm is the temperature at which 50% of the DNA is melted (i.e. the strands are separated) and this is the physical property DNA used by primers design software packages. Primers were initially designed in Primer 3 [15] mostly according to the standard rules [16] and then modifications were made to raise the Tm/Ta.
[0245] A design guide for HOT_PI PCR is as follows: (i) minimum primer length 20 nt, optimum primer length 25 nt and maximum primer length 30 nt; (ii) minimum GC content 30%, optimum GC content 45%, maximum GC content 60%; (iii) minimum Tm (melting temperature) 60 C., optimum Tm 65 C., maximum Tm 85 C.; (iv) minimum amplicon length 50 nt, maximum amplicon length 110 nt; (v) primer dimer G<6 and Tm<60 C.; (vi) hairpin G<6 and Tm<60 C.; (vii) Max Tm difference between forward and reverse primer 3 C.
[0246] (b) Primer Modification
[0247] For HOT_PI PCR, the primers need to be modified to increase the Tm. There are two main approaches available i.e. addition of a sequence tag to the primers or incorporation of modified bases into the primers.
[0248] (i) Addition of a tag. Extending the length of a primer by adding extra sequences in the form of a 5 tag will raise the Tm of the primer. The greatest increase will be achieved if the tag contains a high proportion of Guanine and Cytosine bases. We have previously added tags to primers in order to develop multiplexed HRM protocols [8, 17]. One tag was tested: a 10 base tag with the sequence 5-gggccggccc-3 (predicted to raise the Tm by approximately 20 C.). The tags were added to both the forward and reverse primers.
[0249] (ii) Incorporation of modified nucleic acids. Recently developed synthetic nucleic acids (such as Locked Nucleic Acids (LNA), Bridged Nucleic Acids (BNA) and Peptide Nucleic Acids (PNA)) have a much greater binding affinity for the paired base on the opposite DNA strand than naturally occurring nucleic acids [18-20]. Incorporation of synthetic nucleic acids into primers/probes has been used to increase the specificity [18, 21, 22] although the high binding affinity stabilizes double stranded DNA thereby increasing the Tm (by approximately 5 C. per nucleotide). Only LNA's were tested here (although BNA/PNA would be predicted to have the same effect). Primers were designed in accordance with the rules above and 3-5 LNAs were included at various sites within the primer in accordance with published recommendations [18, 21-23].
[0250] (c) Probe design. The probe was designed to cover the whole region of interest generated between the two primers and to also extend 5 bp into each primer binding site. 6 LNA bases were added to the probe in this example to improve binding affinity further and clamp the region. Further LNA bases, such as up to 10 have also been shown to improve binding and clamping. 3 phosphate was added to prevent polymerase extension. The probe contained LNA bases on the hotspot regions of codon 12 and 13. LNAs were added solely to improve clamping of the region rather than to increase mismatch temperature.
[0251] HOT_PI PCR Protocol and Optimisation
[0252] All reactions were undertaken in 0.2 ml tubes with caps (Agilent, U.S.A). Each reaction was performed in a final volume of 10 l which contained the following components: 2 HotShot Diamond mastermix (Clent Life Science, U.K) which includes a final concentration of 6 mM MgCl.sub.2 and 400 M dNTPs with stabiliser; EvaGreen dye 20 in water (Biotium, U.S.A); 100 nM LNA wild-type blocking probe with 3 phosphate to prevent extension (Eurogentec); adjusted DNA template; 375 nM each primer and Nuclease-Free water (Qiagen, Germany). Standard nucleic acid primers were purchased from Eurofins (Luxembourg) and LNA probes were purchased from Eurogentec, (Belgium).
[0253] Primers were designed to have a minimum Tm of 70 C. to allow a Ta65 C. to be used. The initial optimisation used template containing 50% mutant alleles and a single PCR product was confirmed by high resolution melting analysis on a Lightscanner (Biofire Defence, U.S.A). In order to produce a standard protocol which would work for multiple targets, generally a Ta of 70 C. was used.
[0254] All tests were performed on the Stratagene MX3005P real-time machine. The threshold for detection was set using the machine's default parameters (10 standard deviations away from the mean of the baseline fluorescence). For tagged primers, template containing different mutant allele frequencies was tested using the following cycling parameters: (95 C./5 min)1/(95 C./30 sec; Ta/15 sec; 72 C./15 sec)10/(95 C./30 sec; 75 C./30 sec)40/(72 C./5 min)1. Similarly, fast cycling PCR for wild-type DNA amplification was carried out using the following protocol, demonstrating the potential speed of PCR using tagged primers (95 C./5 min)1/(95 C./1 sec; 71/5 sec; 72 C./5 sec)10/(95 C./1 sec; 75 C./5 sec)30.
[0255] For sequencing, the PCR products were first purified using the GenElute PCR Clean-Up Kit (Sigma-Aldrich, Dorset, United Kingdom). The purified products were then diluted to 1-3 ng/ml following quantification in a NanoDrop 2000 UV spectrophotometer (Thermo Fisher Scientific). Sequencing was performed with the dye terminator chemistry (BigDye, version 3.1) on the 3130xl ABI PRISM Genetic Analyzer (Thermo Fisher Scientific). The sequencing data were viewed and analyzed using FinchTV software.
[0256] HRM and analysis were performed on the LightScanner96 Hi-Res Melting System (BioFireDiagnostics, Salt Lake City, Utah, USA). The PCR products were first transferred into a LightScanner 96-well hard-shell plate (Bio-Rad Laboratories, Hertfordshire, United Kingdom), followed by the addition of a 20 l mineral oil overlay. Before HRM, plates were spun down in a Megafuge centrifuge (2500 rpm, 5 min; ThermoFisherScientific, Winsford, United Kingdom). HRM was performed between 65 and 95 C. with sample equilibration at 62 C. Exposure was set toauto, and data were captured at a ramp rate of 0.1 C./s. The acquired melting data were analyzed with the LightScanner Call-IT software, version 2.0.0.1.331.
[0257] HOT_PI PCR Assay Testing and Statistical Analysis
[0258] Limit-of-detection tests were performed on templates containing varying proportions of mutant allele and compared against HEK293T DNA (containing 0% mutant allele). In general, 40 ng of template was used with the lowest number of mutant copies being 8 (0.1%). When testing the performance of HOT_PI PCR on DNA derived from FFPE tissue, 40 ng of tumour DNA was used.
EXAMPLE 3HIGHLY OPTIMISED ANNEALING TEMPERATUREPOLYMERASE CHAIN REACTION
[0259] Summary
[0260] We reasoned that issues with PCR could be counteracted by increasing the primer annealing temperature (Ta). The increase in free energy generated by raising the annealing temperature to 65 C. would prevent inappropriate base-pairing and perfect base matches would be more stable resulting in increased oligonucleotide specificity as proven with invention example 1 and 2. Moreover, we reasoned that the implementation of 5 tags can increase selectivity for PCR amplicons over DNA template, reducing the amount of non-specific amplification in PCR, especially in exponential phase. When tagged primers initially bind DNA, the tag can only partially bind DNA as it does not contain the tag sequence. When primers form amplicons they are incorporated. Thus, when amplicons are formed, the tag sequence is present in the template for primers to bind with perfect complementarity rather than partial complementarity and this causes further gains in the maximum annealing temperature. This novel finding generates the ability to generate a 2-phase touch-up cycling PCR with phase 1 having a lower maximum potential annealing temperature than phase 2. During phase 2 the raised annealing temperature which is beyond the annealing temperature that can be achieved in phase 1 will provide preferential amplification of amplicons rather than DNA. For example, in cycle 1 as amplicons are forming, the maximum annealing temperature may be 71 C. After cycle 1, the annealing temperature may be increased to 72-80 C. Since polymerase activity is between 68-80 C., extension can still occur. Cycling can alternate between 95 C. and 72-80 C. and this greatly reduces the amount of time spent ramping up and down to standard annealing temperatures of 45-60 C. Moreover, PCR can be carried out using standard 1-phase PCR at >65 C. and still result in increased selectivity whereby tagged primers after cycle 2 bind amplicons preferentially due to tag incorporation, creating perfect complementarity. Dramatic increases in specificity result in less failure of PCR; reduced formation of non-specific products; increased multiplexing capability and increased amplification of areas of the genome containing difficult template which has high similarity with other sequences. We call this modification High Optimized Ta-PCR.
[0261] Materials and Methods
[0262] DNA Extraction
[0263] DNA from was extracted from cell lines in accordance with Example 1.
[0264] DNA Dilutions and Limit of Detection
[0265] All DNA was quantified using a Nanodrop spectrophotometer 2000c (Thermo Scientific) and 260:280 absorbance ratio of 1.8-2.0 was taken as indicative of good quality.
[0266] HEK293T cell line DNA was diluted with nuclease free water (Qiagen, Germany) to 120 ng/l, 80 ng/l, 60 ng/l, 40 ng/l, 20 ng/l, 10 ng/l, 5 ng/l and 1 ng/l, 100 g/l.
[0267] Primer Design and Modification
[0268] (a) Primer Design
[0269] In total, 2 exons in 2 genes were tested; KRAS (HOT_PI primers) and EGFR (HOT_WT13/HOT_ARMS13 (wild-type) (see Table 1 for primers).
[0270] HOT_PCR works on the principle that a high Ta will improve the specificity and speed of the PCR. As a rule of thumb, the Ta is usually 5 C. lower that the melting temperature (Tm). The definition of Tm is the temperature at which 50% of the DNA is melted (i.e. the strands are separated) and this is the physical property DNA used by primers design software packages. Primers were initially designed in Primer 3 [15] mostly according to the standard rules [16] and then modifications were made to raise the Tm/Ta.
[0271] A design guide for HOT_PCR is as follows: (i) minimum primer length 20 nt, optimum primer length 25 nt and maximum primer length 30 nt; (ii) minimum GC content 30%, optimum GC content 45%, maximum GC content 60%; (iii) minimum Tm (melting temperature) 60 C., optimum Tm 65 C., maximum Tm 85 C.; (iv) minimum amplicon length 50 nt, maximum amplicon length 110 nt; (v) primer dimer G<6 and Tm<60 C.; (vi) hairpin G<6 and Tm<60 C.; (vii) Max Tm difference between forward and reverse primer 3 C.
[0272] (b) Primer Modification
[0273] For HOT_PCR, the primers need to be modified to increase the Tm. There are two main approaches available i.e. addition of a sequence tag to the primers or incorporation of modified bases into the primers.
[0274] (i) Addition of a tag. Extending the length of a primer by adding extra sequences in the form of a 5 tag will raise the Tm of the primer. The greatest increase will be achieved if the tag contains a high proportion of Guanine and Cytosine bases. We have previously added tags to primers in order to develop multiplexed HRM protocols [8, 17]. One tag was tested: a 10 base tag with the sequence 5-gggccggccc-3 (predicted to raise the Tm by approximately 20 C.). The tags were added to both the forward and reverse primers.
[0275] (ii) Incorporation of modified nucleic acids. Recently developed synthetic nucleic acids (such as Locked Nucleic Acids (LNA), Bridged Nucleic Acids (BNA) and Peptide Nucleic Acids (PNA)) have a much greater binding affinity for the paired base on the opposite DNA strand than naturally occurring nucleic acids [18-20]. Incorporation of synthetic nucleic acids into primers/probes has been used to increase the specificity [18, 21, 22] although the high binding affinity stabilizes double stranded DNA thereby increasing the Tm (by approximately 5 C. per nucleotide). Only LNA's were tested here (although BNA/PNA would be predicted to have the same effect). Primers were designed in accordance with the rules above and 3-5 LNAs were included at various sites within the primer in accordance with published recommendations [18, 21-23].
[0276] HOT_PCR Protocol and Optimisation
[0277] All reactions were undertaken in 0.2 ml tubes with caps (Agilent, U.S.A). Each reaction was performed using fast cycling mastermixes in a final volume of 10 l which contained the following components: 2 fast cycling PCR mastermix (Qiagen, Germany) or 2 sensiFAST HRM (Bioline, England); EvaGreen dye 20 in water (Biotium, U.S.A); adjusted DNA template; 375 nM each primer and Nuclease-Free water (Qiagen, Germany). Standard nucleic acid primers were purchased from Eurofins (Luxembourg) and LNA primers were purchased from Eurogentec, (Belgium).
[0278] Primers were designed to have a minimum Tm of 70 C. to allow a Ta65 C. to be used. The initial optimisation used template containing 40 ng total wild-type DNA and a single PCR product was confirmed by high resolution melting analysis on a Lightscanner (Biofire Defence, U.S.A). In order to produce a standard protocol which would work for all targets universally, generally a Ta of 66 C. was used for maximum efficiency. All tests were performed on the Stratagene MX3005P real-time machine. The threshold for detection was set using the machine's default parameters (10 standard deviations away from the mean of the baseline fluorescence). For tagged primers, template containing different amounts of total DNA was tested using the following cycling parameters: (95 C./5 min)1/(95 C./5 sec; 66 C./5 sec; 68 C./5 sec)10/(95 C./5 sec; 70 C./10 sec)30/(72 C./1 min)1. Using standard PCR machines with regular ramp rates, PCR can be completed in 26 minutes. This would be enhanced further with fast ramping PCR machines.
[0279] HOT_PCR Assay Testing
[0280] Specificity increases for singleplex and multiplex PCR have been proven in example 1 and 2 as well as checking for absence of effects the modification may have on amplifying low amounts of cell line DNA, FFPE DNA and cell-free DNA. Thus, amplification of a range of total HEK293T DNA was tested to determine reliability and detection of low level DNA input when undergoing rapid amplification.
[0281] Tables
TABLE-US-00007 TABLE1 SequenceofprimersforHOT_ARMSandwild-typepositivecontrolprimers, HOT_WT.Onlythe3basediffersbetweenHOT_ARMSandHOT_WT.Moreover,they bothpairwiththesamecommonwild-typeprimer.Forexample:HOT_ARMS1 (mutationspecificprimer)pairswithHOT_ARMS1(wild-typeprimer)to detectmutationspecificsequence.HOT_WT1(wild-typeprimer)pairswith HOT_ARMS1(wild-typeprimer)todetectwild-typespecificsequenceas apositivecontrol.Thismethodallowsindividualquantificationofthe mutantsequenceandwild-typesequenceseparatelyratherthanquantification oftotalDNA(mutantandwild-typecombined).Therefore,inascenario whereasampleis100%mutant,thewild-typepositivecontrolprimerpair willnotgenerateasignalandtheARMSprimerpairwillgeneratea strongsignalgivingfurthervalidationfortheresult. ARMS/HOT_WT Amplicon orwildtype Target Sequence length Ref Direction primer gene change Primersequence(5to3) (bp) HOT_ARMS1 Forward ARMS KRAS c.38G>A CTTGTGGTAGTTGGAGCTGGTGA 60 (SEQIDNO:1) HOT_ARMS2 Reverse ARMS KRAS c.34C>A GCACTCTTGCCTACGCCACA 60 (SEQIDNO:2) HOT_ARMS2b Forward ARMS KRAS c.34G>T TATAAACTTGTGGTAGTTGGAGCTT 66 (SEQIDNO:3) HOT_ARMS3a Reverse ARMS KRAS c.35C>A GCACTCTTGCCTACGCCAA 60 (SEQIDNO:4) HOT_ARMS3b Forward ARMS KRAS c.35G>T ATAAACTTGTGGTAGTTGGAGCTGT 65 (SEQIDNO:5) HOT_ARMSS4 Forward ARMS KRAS c.35G>A ATAAACTTGTGGTAGTTGGAGCTGA 65 (SEQIDNO:6) HOT_ARMSS5 Forward ARMS KRAS c.34G>C TATAAACTTGTGGTAGTTGGAGCTC 66 (SEQIDNO:7) HOT_ARMS6 Forward ARMS KRAS c.34G>A TATAAACTTGTGGTAGTTGGAGCTA 66 (SEQIDNO:8) HOT_ARMS7 Reverse ARMS KRAS c.35C>G GCACTCTTGCCTACGCCAG 60 (SEQIDNO:9) HOT_ARMS8 Forward ARMS PIK3CA c.1624G>A GCAATTTCTACACGAGATCCTCTCTCTA 65 (SEQIDNO:10) HOT_ARMS9 Forward ARMS PIK3CA c.1633G>A GAGATCCTCTCTGAAATCACTA 69 (SEQIDNO:11) HOT_ARMS10 Forward ARMS PIK3CA c.3140A>G CATGAAACAAATGAATGATGCACG 80 (SEQIDNO:12) HOT_ARMS11 Forward ARMS APC c.4287_4296 TGATCTTCCAGATAGCCCTGGACAC 83 delAACCATGC (SEQIDNO:13) CA HOT_ARMS12 Reverse ARMS BRAF c.1799A>T GGACCCACTCCATCGAGATTTCT 70 (SEQIDNO:14) HOT_ARMS13 Reverse ARMS EGFR c.2369C>T CGAAGGGCATGAGCTGCA 50 (SEQIDNO:15) HOT_WT2b, Forward HOT_WT KRAS c.34 TATAAACTTGTGGTAGTTGGAGCTG 66 5,6 (SEQIDNO:16) HOT_WT2a Reverse HOT_WT KRAS c.34 GCACTCTTGCCTACGCCACC 60 (SEQIDNO:17) HOT_WT3b, Forward HOT_WT KRAS c.35 ATAAACTTGTGGTAGTTGGAGCTGG 65 4 (SEQIDNO:18) HOT_WT3a, Reverse HOT_WT KRAS c.35 GCACTCTTGCCTACGCCAC 60 7 (SEQIDNO:19) HOT_WT1 Forward HOT_WT KRAS c.38 CTTGTGGTAGTTGGAGCTGGTGG 60 (SEQIDNO:20) HOT_WT8 Forward HOT_WT PIK3CA c.1624 GCAATTTCTACACGAGATCCTCTCTG 65 (SEQIDNO:21) HOT_WT9 Forward HOT_WT PIK3CA c.1633 GAGATCCTCTCTGAAATCACTG 69 (SEQIDNO:22) HOT_WT10 Forward HOT_WT PIK3CA c.3140 CATGAAACAAATGAATGATGCACA 80 (SEQIDNO:23) HOT_WT11 Forward HOT_WT APC c.4287 TGATCTTCCAGATAGCCCTGGACAA 93 (SEQIDNO:24) HOT_WT12 Forward HOT_WT BRAF c.1799 GGACCCACTCCATCGAGATTTCA 70 (SEQIDNO:25) HOT_WT13 Reverse HOT_WT EGFR c.2369 CGAAGGGCATGAGCTGCG 50 (SEQIDNO:26) HOT_ARMS1, Reverse Wildtype KRAS N/A CTGAATTAGCTGTATCGTCAAGGCA N/A 2b,3b, (SEQIDNO:27) 4,5,6 HOT_ARMS2a, Forward Wildtype KRAS N/A GCTGAAAATGACTGAATATAAACTTGTGGT 3a,7 (SEQIDNO:28) N/A HOT_ARMS8 Reverse Wildtype PIK3CA N/A TGACTCCATAGAAAATCTTTCTCCTGCT N/A (SEQIDNO:29) HOT_ARMS9 Reverse Wildtype PIK3CA N/A ATTTTAGCACTTACCTGTGACTC N/A (SEQIDNO:30) HOT_ARMS10 Reverse Wildtype PIK3CA N/A CATGCTGTTTAATTGTGTGGAAGA N/A (SEQIDNO:31) HOT_ARMS11 Reverse Wildtype APC N/A ACTTCTCGCTTGGTTTGAGCTGTTT N/A (SEQIDNO:32) HOT_ARMS12 Forward Wildtype BRAF N/A TCATGAAGACCTCACAGTAAAAATAGGT N/A (SEQIDNO:33) HOT_ARMS13 Forward Wild-type EGFR N/A CATCTGCCTCACCTCCACCG N/A (SEQIDNO:34)
[0282] Table 2 Performance of HOT_ARMS PCR in multiple assays. Comparison of Ct values for a commercial mastermix. Demonstrates HOT_ARMS performance using a mastermix without special conditions or enhancers.
TABLE-US-00008 TABLE 2 Thirteen different primer pairs were designed for a number of different targets and this table shows the comparison between the relevant mutant cell lines and wild-type DNA. The column labelled LOD shows the limit of detection. HOT_ARMS1 was tested to its absolute limit. The remainder were not tested to limit to limit as this was felt to be sufficient. (MAF = mutant allele frequency). Commercial mastermix 40 ng total Protein DNA Ct sequence/ 50% MAF vs Sensitivity Ref Direction common name Sequence change wild-type achieved HOT_ARMS1 Forward KRAS G13D c.38G > A 12.395 0.004% HOT_ARMS2a Reverse KRAS G12C c.34C > A >24.955 0.01% HOT_ARMS3a Reverse KRAS G12V c.35C > A >24.385 0.01% HOT_ARMS4 Forward KRAS G12D c.35G > A 10.665 0.06% HOT_ARMS5 Reverse KRAS G12R c.34C > G >24.655 0.01% HOT_ARMS6 Forward KRAS G12S c.34G > A 13.395 0.06% HOT_ARMS7 Reverse KRAS G12A c.35C > G 16.18 0.01% HOT_ARMS8 Forward PIK3CA c.1624G > A 16.15 0.01% E542K HOT_ARMS9 Forward PIK3CA c.1633G > A 11.825 0.06% E545K HOT_ARMS10 Forward PIK3CA c.3140A > G 12.315 0.06% H1047R HOT_ARMS11 Forward APC c.4287_4296delAACCATGCCA 14.67 0.06% p.Q1429fs*41 HOT_ARMS12 Reverse BRAF c.1799A > T >22.87 0.01% V600E HOT_ARMS13 Reverse EGFR c.2369C > T 12.37 0.06% T790M
TABLE-US-00009 TABLE 3 HOT_ARMS PCR short term precision. Table 3. HOT_ARMS1 primers were tested for their short term precision. Cell line DNA was spiked into wild-type DNA to produce mutant allele frequency (MAF) ranging from 50%-0.09%. Eight replicates were performed and the results of the test are shown. The coefficient of variation (CV %) was below 1% until the MAF reached 0.78% indicating that the test is robust of a wide range. MAF (%) 50.00 25.00 12.50 6.25 3.13 1.56 0.78 0.09 Mean 26.26 27.45 28.72 29.84 31.03 31.85 33.37 35.79 Min 26.18 27.04 28.47 29.5 30.77 31.52 32.79 35.02 Max 26.42 27.68 28.99 30.16 31.24 32.24 33.89 36.4 Range 0.24 0.64 0.52 0.66 0.47 0.72 1.1 1.38 CV % 0.30 0.74 0.58 0.76 0.51 0.92 1.02 1.36
TABLE-US-00010 TABLE 4 Testing of HOT_ARMS PCR for KRAS exon 2 codons 12 and 13 mutations on DNA from formalin-fixed tissue. Table 4. The HOT_ARMS PCR was tested on 10 previously genotyped samples derived from formalin-fixed tissue. The samples were initially tested for their known mutations and these were confirmed. They were then tested blind using HOT_ARMS1-4 as a panel and each sample was correctly genotyped. Sample 4 was classed as unknown due to mutation being detected by HRM but not confirmed by Sanger Sequencing. The HOT_ARMS data shows that this is probably a c38G > A mutation but the relatively high Ct value indicates it is present at a low frequency. Sample 1 2 3 4 5 6 7 8 9 10 Validated C35G > T C34G > T C34G > T Unknown C38G > A C35G > A None C35G > A C35G > T C35G > A mutation (Sanger sequencing) HOT_ARMS1 35.69 37.23 38.96 32.87 27.26 37.44 37.79 35.33 37.64 36.76 C38G > A ct value HOT_ARMS2b 36.69 29.35 27.64 35.7 34.53 35.63 36.41 35.06 35.58 34.45 C34G > T ct value HOT_ARMS3b 28.33 34.84 34.89 37.24 36.74 35.22 35.96 35.43 30.88 38.15 C35G > T ct value HOT_ARMS4 34.79 35.98 35.43 34.75 34.45 28.97 37.15 25.9 35.12 29.59 C35G > A ct value Genotyping C35G > T C34G > T C34G > T C38G > A C38G > A C35G > A None C35G > A C35G > T C35G > A result (HOT_ARMS)
TABLE-US-00011 TABLE 5 Short term precision of HOT_ARMS PCR with combined GC-rich tag and 3LNA Table 5. HOT_ARMS1 primers were modified to include a locked nucleic acid (LNA) at the 3 base of the mutation specific primer. This abrogated amplification from placental DNA (even after 50 cycles) but there was reduced efficiency. Cell line DNA was spiked into placental DNA to produce mutant allele frequency (MAF) ranging from 50%-0.09%. Eight replicates were performed and the results of the test are shown. The coefficient of variation (CV %) was increased compared to the GC tag alone. MAF(%) 50.00 25.00 12.50 6.25 3.13 1.56 0.78 0.10 Mean 27.53 30.34 33.65 36.27 38.42 40.66 42.89 47.59 Min 27.32 29.73 32.66 35.28 37.50 39.19 40.50 45.05 Max 28.18 30.81 34.45 37.25 39.14 41.43 44.82 49.76 Range 20.86 21.08 21.79 21.97 21.64 22.24 24.32 24.71 CV % 3.85 3.60 4.11 4.10 3.41 3.55 6.72 5.81
TABLE-US-00012 TABLE 6 Demonstrates easy detection of low copy number with lower amounts of total DNA input. Circulating tumour DNA produces low yield; hence, performance may be enhanced by performing PCR in replicates with lower total DNA or by screening for multiple targets with lower total DNA. 5 ng total DNA Ct Protein 4 mutant sequence/ copies vs Ref Direction common name Sequence change wild-type HOT_ARMS1 Forward KRAS G13D c.38G > A 5.56 HOT_ARMS2a Reverse KRAS G12C c.34C > A 10.065 HOT_ARMS3a Reverse KRAS G12V c.35C > A >13.12 HOT_ARMS4 Forward KRAS G12D c.35G > A 5.51 HOT_ARMS5 Reverse KRAS G12R c.34C > G 8.70 HOT_ARMS6 Forward KRAS G12S c.34G > A 2.35 HOT_ARMS7 Reverse KRAS G12A c.35C > G 9.46 HOT_ARMS8 Forward PIK3CA E542K c.1624G > A 9.28 HOT_ARMS9 Forward PIK3CA E545K c.1633G > A 1.97 HOT_ARMS10 Forward PIK3CA H1047R c.3140A > G 3.97 HOT_ARMS11 Forward APC c.4287_4296delAACCATGCCA 4.85 p.Q1429fs*41 HOT_ARMS12 Reverse BRAF V600E c.1799A > T 11.41 HOT_ARMS13 Reverse EGFR T790M c.2369C > T 2.11
TABLE-US-00013 TABLE 7 Demonstration of wild-type blocking probe addition to HOT_ARMS PCR to further enhance Ct values. Ct 50% Ct 0.1% Ct: Ct: Blocker MAF & MAF & 50% 0.1% Ct: Target concentration wild-type wild-type MAF MAF wild-type HOT_ARMS4 0 nM 10.665 1.405 26.435 35.695 37.100 30 nM 14.436 5.311 31.10 40.225 45.536 HOT_ARMS6 0 nM 13.395 2.855 25.980 36.520 39.375 20 nM 19.62 8.45 30.38 41.55 48.874
TABLE-US-00014 TABLE 8 Demonstration of HOT_ARMS12 (BRAF V600E) rapid testing. Highly specific HOT_ARMS primers can take advantage of fast cycling mastermixes and PCR machines (Magnetic induction cycling) to reduce total cycling times to 30 minutes and maintain similar performance as regular HOT_ARMS PCR. Also shown in FIG. 7. MAF (40 ng total DNA) Wild- 50% 25% 12.5% 6.25% 1% 0.06% type Ct value 26.34 27.51 28.41 29.36 32.40 35.23 43.06
TABLE-US-00015 TABLE 9 Demonstration of HOT_ARMS multiplexing for multiple genes in the same reaction. Table 5 represents multiplexing of HOT_ARMS1 (KRAS c.38G > A) and HOT_ARMS12 (BRAF V600E) as well as individual singleplex reactions. The individual mutation can be identified as well as yes/no calling for mutations by melting peak analysis demonstrated in FIG. 8. 50% 1% 0.1% 50% 1% 0.1% MAF MAF MAF MAF MAF MAF BRAF BRAF BRAF KRAS KRAS KRAS Wild- Test V600E V600E V600E c.38G > A c.38G > A c.38G > A type Singleplex 26.07 38.1 39.49 42.42 HOT_ARMS1 ct value Singleplex 27.19 37.27 40.295 48.14 HOT_ARMS12 ct value Multiplex 26.82 33.05 33.54 25.69 31.865 33.22 34.47 HOT_ARMS1/12
TABLE-US-00016 TABLE 10 Amplification of cfDNA, FFPE and cell line DNA with wild-type modified primers. Demonstrates that the modification has no effect on amplifying low DNA input fragmented DNA samples. 2 ng 1 ng 250 pg 250 pg 125 pg 125 pg 62.5 pg 62.5 pg Sample total total total total total total total total type DNA ct DNA ct DNA ct DNA ct DNA ct DNA ct DNA ct DNA ct FFPE 31.06 30.66 31.62 31.62 32.47 32.35 32.00 32.50 DNA sample 1 FFPE 32.10 31.73 32.88 34.09 32.09 32.48 32.86 33.83 DNA sample 2 FFPE 31.51 31.30 32.34 32.29 32.69 33.22 33.44 33.37 DNA sample 3 cfDNA 31.94 32.40 32.39 33.02 33.12 33.66 33.36 32.53 sample 1 cfDNA 32.26 31.67 31.59 31.10 31.56 31.76 31.77 31.78 sample 2 cfDNA 30.33 30.58 30.96 30.77 31.55 30.42 32.81 32.10 sample 3 Cell line 29.67 30.22 30.44 30.62 31.79 30.54 31.70 34.22 DNA
TABLE-US-00017 TABLE 11 Comparison of HOT_ARMS2a screening results on cfDNA samples with Qiagen's current Therascreen assay for KRAS G12C. Samples were blinded by Qiagen before screening by HOT_ARMS. HOT Wild- Qiagen Mutation Mutation Sample HOT_ARMS2a Qiagen type ct WT Ct status status name ct value mut Ct value value HOT_ARMS2a Qiagen 1 38.46 34.31 29.02 27.53 Mutant Mutant 2 >50 n/a 50 n/a Wild Wild 3 >50 n/a 31.23 30.14 Wild Wild 4 >50 n/a 30.62 28.55 Wild Wild 5 >50 n/a 29.78 28.85 Wild Wild 6 >50 n/a 29.91 28.26 Wild Wild 7 >50 n/a 30.31 29.19 Wild Wild 8 38.87 35.89 30.09 29.34 Mutant Mutant 9 >50 n/a 26.89 25.61 Wild Wild 10 >50 n/a 31.04 29.98 Wild Wild 11 37.01 36.31 29.49 28.43 Mutant Mutant
TABLE-US-00018 TABLE 12 HOT_PI ct values for different wild-type blocking probe concentrations. 1% MAF becomes easily visible by ct value using higher concentrations of wild-type blocking probe. However, sequencing and high-resolution melting analysis require wild-type DNA present for analysis and ct values of below 30. Mutant specific probes could be combined with the technique for mutation detection with high sensitivity. ct 1% Wild-type blocking c.35G > T c.34G > A c.38G > A c.38 G > A and probe 100% 100% 50% 1% Wild- wild- concentration MAF MAF MAF MAF type type 0 nM 15.92 18.52 16.97 18.02 18.21 0.19 100 nM 17.24 20.18 20.10 25.06 26.48 1.42 200 nM 18.33 21.53 21.59 27.84 33.61 6.13 300 nM 19.28 22.73 23.15 30.32 39.32 9.00
TABLE-US-00019 TABLE 13 Demonstration of HOT_PI PCR combined with HOT_ARMS PCR. HOT_PI PCR has been used in the first stage reaction of a nested procedure and detection has been carried out in a second stage reaction by HOT_ARMS1 (KRAS c.38 G > A). Supreme sensitivity can be achieved with very low cross-reactivity with other mutations (c.35 G > T and c.34G > A). Also shows potential for nested HOT_ARMS PCR without HOT_PI enrichment as 1% MAF can still be easily detected. Wild-type blocking c.35G > T c.34G > A c.38G > A c.38 G > A Wild- probe concentration 100% MAF 100% MAF 50% MAF 1% MAF type 0 nM 25.28 22.63 6.40 12.24 16.20 100 nM 24.68 22.37 6.22 6.72 12.39
TABLE-US-00020 TABLE 14 Cell lines used for testing HOT_ARMS PCR. This table lists the cell lines used and the mutations contained in them. Most of the cell lines were available in-house (obtained from the NCI 60 panel) whilst some had to be obtained from external commercial sources. Cell Cell line Protein line Cell line DNA sequence/ harbouring tumour sourced Gene common name Gene sequence mutation source Zygosity from KRAS p.G13D c.38G > A HCT116 Colon Heterozygous In house KRAS p.G12C c.34G > T SW837 Colon Heterozygous In house KRAS p.G12V c.35G > T SW480 Colon Homozygous In house KRAS p.G12D c.35G > A GP2D Colon Heterozygous In house KRAS p.G12R c.34G > C SW48 + Colon + Heterozygous Commercial G12R knockin KRAS p.G12A c.35G > C SW1116 Colon Heterozygous Commercial KRAS p.G12S c.34G > A A549 Lung Homozygous In house PIK3CA p.E542K c.1624G > A SW948 Colon Heterozygous Commercial PIKCA p.E545K c.1633G > A MCF7 Breast Heterozygous In house PIK3CA p.H1047R c.3140A > G HCT116 Colon Heterozygous In house BRAF p.V600E c.1799 T > A HT-29 Colon Heterozygous In house TP53 p.R273H c.818G > A HT-29 Colon Homozygous In house APC p.T1556fs*3 c.4666_4667insA HT-29 Colon Heterozygous In house APC p.Q1429fs*41 c.4287_4296delAACCATGCCA SW1116 Colon Heterozygous Commercial
TABLE-US-00021 TABLE 15 Methods for detecting low frequency mutations. Table 7. This is a comparative analysis of the different methods available for testing for low mutant allele frequency and how they compare with HOT_ARMS PCR. Closed-tube means a single test whilst open tube means that at least two tests are required. Closed or Time to Technique Sensitivity Technical ease and cost open tube process Reference Hot_ARMS 0.004- Real time PCR machine Closed 1 day N/A 0.125% required only. Basic regular depending PCR optimisation. Basic on target regular qPCR analysis. ddPCR 0.001- Requires more expensive Closed 1 day [31-34] 2.99% ddPCR machine. Requires depending probe design and on target optimisation. More in depth and and complicated analysis. protocol BEAMing 0.01% Requires very expensive Open 2 days [30, 39] depending flow cytometry machine as on target well as PCR machine. and Requires probe design and protocol optimisation. More in depth and complicated analysis. CAPP-seq 0.025%- Requires very expensive Open 2-5 days depending [40, 41] (NGS) or 0.14% NGS machine which is also on the machine standard depending costly to run as well as a targeted deep on target PCR machine. CAPP-seq has sequencing and a special protocol for sample protocol preparation which has to be optimised. Standard sample preparation for targeted deep sequencing requires large optimisation. More in depth and complicated analysis. COLD-PCR 0.75-3% Requires a PCR machine. Open or 1-2 days [6, 42] depending Requires frequent closed on target optimisation of Tc. depending and Depending on post PCR on method protocol technique; additional of equipment and optimisation detection. may be required. Enhanced- 0.05- Requires a pyrosequencing Open 2 days [43] Ice-COLD 0.1% machine as well as PCR PCR machine. Requires optimisation of blocker and Tc. PNA LNA 0.001- Requires a real-time PCR Closed 1 day [44-47] qPCR or 0.01% machine. Requires LNA optimisation of a blocker and blocking probe. Requires a large qPCR number of PNA or LNA (ARMS making it expensive. qPCR) Intplex 0.004- Requires a real-time PCR Closed 1 day [3] (ARMS 0.014% machine. Requires qPCR) optimisation of a blocker and probe. SNPase- 0.0005% Requires a real-time PCR Open 1 day [4] ARMS qPCR machine. Requires expensive SNPase enzyme. Requires optimisation of a probe.
TABLE-US-00022 TABLE 16 Demonstration of potential time savings using HOT PCR for all types of PCR. Time savings can be increased without real-time capture or reduced with melt-curve analysis. To simplify time saving gains; the same total cycling times have been used for standard PCR (1 minute 30 seconds a cycle without ramping time) or fast PCR (13 seconds a cycle without ramping time). This determines the amount of time wasted from ramping using conventional protocols against HOT PCR protocols. Total time (including real-time capture, Time saving Time saving excluding melt curve compared to compared to protocol Protocol analysis) standard 1 above Standard 1 1 hour 51 minutes N/A N/A 95 C. 5 min 1 [95 C. 30 sec 50 C. 30 sec 72 C. 30 sec] 40 Standard 2 1 hour 45 minutes 6 minutes 6 minutes 95 C. 5 min 1 [95 C. 30 sec 60 C. 30 sec 72 C. 30 sec] 40 HOT Standard 1 1 hour 8 minutes 43 minutes 37 minutes 95 C. 5 min 1 [95 C. 30 sec 71 C. 1 min] 10 [95 C. 30 sec 78 C. 1 min] 30 HOT Standard 2 1 hour 51 minutes 8 minutes 95 C. 5 min 1 [95 C. 30 sec 71 C. 1 min] 2 [95 C. 30 sec 78 C. 1 min] 38 Fast 1 59 minutes 52 minutes 1 minute 95 C. 5 min 1 [95 C. 5 sec 50 C. 5 sec 72 C. 3 sec] 40 Fast 2 53 minutes 58 minutes 6 minutes 95 C. 5 min 1 [95 C. 5 sec 60 C. 5 sec 72 C. 3 sec] 40 HOT rapid 26 minutes (44 minutes 85 minutes 27 minutes universal including standard 95 C. 5 min 1 melt-curve). Universal [95 C. 5 sec conditions which 66 C. 8 sec] 10 require no optimisation [95 C. 5 sec and give efficient 70 C. 8 sec] 30 amplification HOT rapid 15 minutes for the Up to 96 minutes Up to 11 minutes optimised fastest protocol, varies 95 C. 5 min 1 based on the number of [95 C. 1 sec cycles and primer used. 65-72 C. 1 sec] 1-20 [95 C. 1 sec 70-82 C. 1 sec] 1-40
TABLE-US-00023 TABLE 17 Reliable rapid amplification of DNA using HOT_PCR. Quantification if desired can be improved with larger mastermix volumes and primer concentration optimisation and the use of probes. Master Ct: Ct: Ct: Ct: Ct: Ct: Ct: Ct: Ct: mix Target 120 ng 80 ng 60 ng 40 ng 20 ng 10 ng 5 ng 1 ng 100 pg Qiagen KRAS 24.74 24.86 25.31 25.41/25.47 25.62/25.73 27.95/27.58/ 28.29/28.82/ 31.09/31.18/ fast 27.72 28.84 31.26 cycling Qiagen EGFR 23.22 23.94 24.75 24.92/24.83 25.01/25.20 26.87/27.07/ 27.81/28.57/ 30.72/30.76/ fast 27.11 28.28 30.63 cycling SensiFAST KRAS 23.64 22.69 23.60 24.44/24.32 24.51/24.49 26.18/25.92/ 25.46/27.00/ 28.53/29.42/ 26.69 27.33 26.03 SensiFAST EGFR 22.67 22.77 23.42 23.30/23.89 23.87/23.61 25.66/25.75/ 26.58/26.37/ 29.05/29.21/ 25.73 26.15 29.00
REFERENCES
[0283] All references herein may be incorporated by reference. [0284] 3. Mouliere, F., et al., Circulating Cell-Free DNA from Colorectal Cancer Patients May Reveal High KRAS or BRAF Mutation Load. Translational Oncology, 2013. 6(3): p. 319-U281. [0285] 4. Stadler, J., et al., SNPase-ARMS qPCR: Ultrasensitive Mutation-Based Detection of Cell-Free Tumor DNA in Melanoma Patients. PLoS One, 2015. 10(11): p. e0142273. [0286] 6. Milbury, C. A., et al., COLD-PCR: improving the sensitivity of molecular diagnostics assays. Expert Rev Mol Diagn, 2011. 11(2): p. 159-69. [0287] 10. Newton, C. R., et al., Analysis of Any Point Mutation in DNAthe Amplification Refractory Mutation System (Arms). Nucleic Acids Research, 1989. 17(7): p. 2503-2516. [0288] 11. Thelwell, N., et al., Mode of action and application of Scorpion primers to mutation detection. Nucleic Acids Research, 2000. 28(19): p. 3752-3761. [0289] 12. Bui, M. and Z. C. Liu, Simple allele-discriminating PCR for cost-effective and rapid genotyping and mapping. Plant Methods, 2009. 5. [0290] 30. Taniguchi, K., et al., Quantitative Detection of EGFR Mutations in Circulating Tumor DNA Derived from Lung Adenocarcinomas. Clinical Cancer Research, 2011. 17(24): p. 7808-7815. [0291] 31. Sanmamed, M. F., et al., Quantitative cell-free circulating BRAFV600E mutation analysis by use of droplet digital PCR in the follow-up of patients with melanoma being treated with BRAF inhibitors. Clin Chem, 2015. 61(1): p. 297-304. [0292] 32. Abdel-Wahab, O., et al., Efficacy of intermittent combined RAF and MEK inhibition in a patient with concurrent BRAF-and NRAS-mutant malignancies. Cancer Discov, 2014. 4(5): p. 538-45. [0293] 33. Oxnard, G. R., et al., Noninvasive Detection of Response and Resistance in EGFR-Mutant Lung Cancer Using Quantitative Next-Generation Genotyping of Cell-Free Plasma DNA. Clinical Cancer Research, 2014. 20(6): p. 1698-1705. [0294] 34. Beaver, J. A., et al., Detection of Cancer DNA in Plasma of Patients with Early-Stage Breast Cancer. Clinical Cancer Research, 2014. 20(10): p. 2643-2650. [0295] 39. Diehl, F., et al., Circulating mutant DNA to assess tumor dynamics. Nat Med, 2008. 14(9): p. 985-90. [0296] 40. Newman, A. M., et al., An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage. Nat Med, 2014. 20(5): p. 548-54. [0297] 41. Dawson, S. J., et al., Analysis of circulating tumor DNA to monitor metastatic breast cancer. N Engl J Med, 2013. 368(13): p. 1199-209. [0298] 42. Hersh Abdul Ham-Karim, H. O. E., Wakkas Fadhil, Abutaleb Asiri, James Hassall and Mohammad Ilyas, COLD-HRM: A Combination of Methods to Infer the Nature of Somatic Mutations. Advances in cytology and pathology, 2017. 2(2). [0299] 43. How Kit, A., et al., Sensitive detection of KRAS mutations using enhanced-ice-COLD-PCR mutation enrichment and direct sequence identification. Hum Mutat, 2013. 34(11): p. 1568-80. [0300] 44. Guha, M., E. Castellanos-Rizaldos, and G. M. Makrigiorgos, DISSECT Method Using PNA-LNA Clamp Improves Detection of EGFR T790m Mutation. PLoS One, 2013. 8(6): p. e67782. [0301] 45. Shinozaki, M., et al., Utility of circulating B-RAF DNA mutation in serum for monitoring melanoma patients receiving biochemotherapy. Clin Cancer Res, 2007. 13(7): p. 2068-74. [0302] 46. Pinzani, P., et al., Allele specific Taqman-based real-time PCR assay to quantify circulating BRAFV600E mutated DNA in plasma of melanoma patients. Clin Chim Acta, 2010. 411(17-18): p. 1319-24. [0303] 47. Chen, D., et al., High-sensitivity PCR method for detecting BRAF V600E mutations in metastatic colorectal cancer using LNA/DNA chimeras to block wild-type alleles. Anal Bioanal Chem, 2014. 406(9-10): p. 2477-87.