SOLID PHASE EXTRACTION MATERIAL AND ITS USE FOR NUCLEIC ACID ENRICHMENT AND DETECTION

20210087606 ยท 2021-03-25

    Inventors

    Cpc classification

    International classification

    Abstract

    A solid phase extraction material and its use in nucleic acid enrichment and detection. A solid phase extraction material modified by rGO or GO. The GO or rGO modified material can quickly and efficiently adsorb nucleic acids, especially short single-stranded nucleic acids, through electrostatic force, hydrogen bond, and - force. The detection limit of nucleic acid samples is accordingly reduced, and the detection sensitivity is accordingly improved.

    Claims

    1. A solid phase extraction material, wherein the solid phase support of the solid phase extraction material is modified at its surface with graphene oxide or reduced graphene oxide; and wherein the solid phase support is glass beads or magnetic beads.

    2. The solid phase extraction material according to claim 1, wherein the diameter of the glass beads is 100 m to 300 m, and the diameter of the magnetic beads is 10 nm to 5 m.

    3. A method for preparing the solid phase extraction material according to claim 1, comprising mixing and adsorbing a dispersion of graphene oxide or reduced graphene oxide with a solid phase support to prepare the solid phase extraction material; wherein the solid phase support is glass beads or magnetic beads.

    4. The method according to claim 3, wherein the graphene oxide has a lateral size of 0.5 m to 2 m, and the reduced graphene oxide has a lateral size of 0.5 m to 2 m.

    5. The method according to claim 3, wherein the adsorption condition is room-temperature shaking for 0.5 h to 2 h.

    6. A method of enriching and/or detecting nucleic acid comprising using the solid phase extraction material according to claim 1.

    7. (canceled)

    8. The method according to claim 6, wherein the enrichment is performed by mixing a sample with the solid phase extraction material and separating the solid phase extraction material after extraction to obtain a nucleic acid solution upon washing and eluting.

    9. (canceled)

    10. The method according to claim 6, wherein the detecting is performed by mixing a sample with the solid phase extraction material, separating solid phase extraction material after extraction, mixing with specific probe and in situ amplification reagents, amplifying and detecting the amplification product by electrophoresis.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0061] FIG. 1 shows the enrichment of ssDNA by GO modified glass beads; M is a DNA marker, lanes 1-4 are original solution amplifications; lanes 4-8 are in situ amplifications.

    [0062] FIG. 2 shows the enrichment of miRNA (let-7a) by rGO modified magnetic beads; M is a DNA marker, lanes 1-3 are original solution amplifications, lanes 4-6 are in situ amplifications.

    [0063] FIG. 3 shows the identification of homogeneous miRNAs by rGO modified beads in the examples. Lanes 1 and 2 are amplifications for let-7a and let-7d by normal RCAs; lanes 3 and 4 are in situ RCA of let-7a and let-7d after extracting by amino beads; lanes 5 and 6 are in situ RCA of let-7a and let-7d after extracting by rGO modified magnetic beads; 7 is a negative control experiment.

    [0064] FIG. 4 shows the selective adsorption of rGO modified beads for miRNA, gDNA, and mRNA. PC is the test of the nucleic acid amount in the original sample; supernatant is the test of the nucleic acid amount in the supernatant after adsorption, and the ordinate is the Ct value of the PCR; FIG. 4a shows the gDNA adsorption; FIG. 4b shows the mRNA adsorption; FIG. 4c shows the miRNA adsorption.

    [0065] FIG. 5 shows the enrichment of miRNA by rGO modified magnetic beads; FIG. 5a shows that without enrichment, RCA detection limit for a miRNA sample is 1.318 pM (3);

    [0066] FIG. 5b shows that RCA detection limit for a miRNA sample is 53.4 fM (3) after enrichment by a modified magnetic beads.

    DETAILED DESCRIPTION

    [0067] The present invention provides a solid phase extraction material and its use for the enrichment and detection of short single-stranded nucleic acid. Those skilled in the field can learn from the content herein and appropriately improve the process parameters. In particular, it should be noted that all similar replacements and modifications will be apparent to those skilled in the art, and they are all deemed to be included in the present invention. The method and application of the present invention have been described through the preferred embodiments, and it is apparent to those skilled in the art that the methods and applications herein may be modified or appropriately changed and combined without departing from the spirit, scope, and scope of the present invention to implement and use the present invention.

    [0068] The magnetic beads of the present invention are biological magnetic beads and are superparamagnetic beads with a fine particle size.

    [0069] The glass beads of the present invention are experimental glass beads, which are also called glass microbeads.

    [0070] The short single-stranded nucleic acid according to the present invention refers to short, single-stranded nucleic acid molecule such as miRNA and ssDNA.

    [0071] The various nucleic acids described in the present invention refer to various types of nucleic acid molecules such as gDNA, cDNA, cpDNA, msDNA, mtDNA, rDNA, ssDNA, miRNA, mRNA, tRNA, rRNA, tmRNA, snRNA, snoRNA, piRNA, or aRNA.

    [0072] The enrichment according to the present invention refers to a step of collecting a nucleic acid of interest from a sample, and can also refer to extraction or purification.

    [0073] The detection according to the present invention refers to a process of quantitative or qualitative analysis of the target nucleic acid in a sample based on the amplification result by a specific probe.

    [0074] Unless otherwise specified, the room temperature of the present invention is 18-30 C.

    [0075] The instruments and materials used in the present invention are all common commercial products and are all available in the market.

    [0076] The following further describes the present invention in combination with examples:

    EXAMPLES

    Example 1

    [0077] About 0.5 g of acid-washed glass beads (Sigma) was added to a beaker, 7 mL of concentrated sulfuric acid was added to the beaker, and then 3 mL of hydrogen peroxide was slowly added. The reaction system was shaken on a shaker for 1 h to complete the activation of the glass beads. After activation, the glass beads were washed 10 times with pure water and placed in an oven to dry.

    [0078] The dried glass beads were put into a 1.5 mL centrifuge tube, and silanization reagent and solvent (1 mL solvent, the ratio of ethanol to water 9:1, 1 L glacial acetic acid; 20 L APTES as silanization reagent) were added. The reaction was carried out for 2 h with shaking and the glass beads were washed with pure water 10 times.

    [0079] The excess water was removed from the glass beads and 200 L of water and 50 L of GO dispersion (purchased from Xianfeng Nano, with a lateral size of 0.5-2 m and an initial concentration of 1 mg/mL) were added to the silanized glass beads. The reaction was carried out for 1 h with shaking. The glass beads then were washed by water and dried at 80 C.

    Example 2

    [0080] About 0.5 g of acid-washed glass beads (Sigma) was added to a beaker, 7 mL of concentrated sulfuric acid was added to the beaker, and then 3 mL of hydrogen peroxide was slowly added. The reaction system was shaken on a shaker for 1 h to complete the activation of the glass beads. After activation, the glass beads were washed 10 times with pure water and placed in an oven to dry.

    [0081] The dried glass beads were put into a 1.5 mL centrifuge tube, and silanization reagent and solvent (1 mL solvent, the ratio of ethanol to water 9:1, 1 L glacial acetic acid; 20 L APTES as silanization reagent) were added. The reaction was carried out for 2 h with shaking and the glass beads were washed with pure water 10 times.

    [0082] The excess water was removed from the glass beads and 200 L of water and 50 L of rGO dispersion (purchased from Xianfeng Nano, with a lateral size of 0.5-2 m and an initial concentration of 1 mg/mL) were added to the silanized glass beads. The reaction was carried out for 1 h with shaking. The glass beads then were washed by water and dried at 80 C.

    Example 3

    [0083] APTES-modified magnetic beads were purchased from Beaver Company (particle size 500 nm, original concentration 10 mg/mL). 100 L magnetic beads were put into a 1.5 mL centrifuge tube and placed on a magnetic stand to collect the magnetic beads, and excess water was removed. The magnetic beads were washed 3 times with pure water, and excess water was removed. 300 L of GO dispersion (purchased from Xanfeng Nano, with a lateral size of 0.5-2 m, an initial concentration of 1 mg/mL) was added to the magnetic beads. The reaction was carried out for 1 h with shaking to ensure the fully binding of the magnetic beads with GO. Excess unbound GO was removed and the magnetic beads were washed with water until the supernatant became clear. The obtained GO modified magnetic beads were dispersed in 200 L of water and stored at 4 C.

    Example 4

    [0084] APTES-modified magnetic beads were purchased from Beaver Company (particle size 500 nm, original concentration 10 mg/mL). 100 L magnetic beads were put into a 1.5 mL centrifuge tube and placed on a magnetic stand to collect the magnetic beads, and excess water was removed. The magnetic beads were washed 3 times with pure water, and excess water was removed. 300 L of rGO dispersion (purchased from Xanfeng Nano, with a lateral size of 0.5-2 m, an initial concentration of 1 mg/mL.) was added to the magnetic beads. The reaction was carried out for 1 h with shaking to ensure the fully binding of the magnetic beads with rGO. Excess unbound rGO was removed and the magnetic beads were washed with water until the supernatant became clear. The obtained rGO modified magnetic beads were dispersed in 200 L of water and stored at 4 C.

    Test: Verification of Effectiveness

    1. Enrichment of Short Single-Stranded DNA (22 nt) by GO Modified Glass Beads

    [0085] First, 25 L of sample solution was prepared, containing ssDNA (sequence: 5-TGAGGTAGTAGGTTGTATAGTT-3) with a final concentration of 10 nM. 0.005 g of the GO modified glass beads prepared in Example 1 (extraction material) was weighed in a 0.2 mL centrifuge tube. After 20 L of the sample solution was added to the centrifuge tube containing the extraction material, the extraction material and the solution were mixed well by vortex. Extraction was carried out at room temperature for 10 min. After the extraction, the liquid in the centrifuge tube was aspirated and the obtained extraction material was subjected to subsequent RCA.

    [0086] The non-enriched (original) sample solution was amplified as a control. The volume of the RCA reaction was 20 L, containing 10 L of RCA mastermix, 2 L of sample solution, 2 L of circular probe (sequence: CACGCGATCCGCAACTATACAACCTACTACCTCAACACCCTCCAACCACCAAGGCA ATGTACACGAATTCGCCGAACG), and 6 L of water. The reaction system was mixed well and then incubated at 65 C. for isothermal amplification. The reaction duration was 1.5 h, which was called original solution amplification.

    [0087] For solid phase extraction material, 10 L of RCA master mix, 2 L of circular probe and 8 L of water were added to the centrifuge tube containing the material. The reaction system was mixed well and then incubated at 65 C. for isothermal amplification. The reaction duration was 1.5 h, which was called in situ amplification.

    [0088] The products of original solution amplification and in situ amplification were subjected to electrophoresis, respectively. The results were shown in FIG. 1: M was a DNA marker, lanes 1-4 were four replicates of the original solution amplification, and lanes 5-8 were four replicates of the in situ amplification. As shown in FIG. 1, in the sample solution before the enrichment, the concentration of ssDNA was not sufficient to be amplified to generate enough RCA products to show a bright band in gel electrophoresis. However, after the enrichment by GO modified glass beads, the amount of RCA products was significantly increased, and bright bands can be seen in the electrophoresis picture. This experiment demonstrates that GO modified glass beads are capable of efficiently enriching short single-stranded DNA and undergoing in situ amplification.

    2. Enrichment of miRNA let-7a (22nt) by rGO Modified Magnetic Beads

    [0089] First, 25 L of sample solution was prepared, containing let-7a (sequence: 5-UGAGGUAGUAGGUUGUAUAGUU-3) with a final concentration of 10 nM. 0.5 L of the rGO modified magnetic beads prepared in Example 3 (extraction material) was weighed in a 0.2 mL centrifuge tube. After 20 L of the sample solution was added to the centrifuge tube containing the extraction material, the extraction material and the solution were mixed well by vortex. Extraction was carried out at room temperature for 10 min. After the extraction, the liquid in the centrifuge tube was aspirated and the obtained extraction material was subjected to subsequent RCA.

    [0090] The non-enriched (original) sample solution was amplified as a control. The volume of the RCA reaction was 20 L, containing 10 L of RCA mastermix, 2 L of sample solution, 2 L of circular probe (sequence: CACGCGATCCGCAACTATACAACCTACTACCTCAACACCCTCCAACCACCAAGGCA ATGTACACGAATTCGCCGAACG), and 6 L of water. The reaction system was mixed well and then incubated at 65 C. for isothermal amplification. The reaction duration was 1.5 h, which was called original solution amplification.

    [0091] For solid phase extraction material, 10 L of RCA master mix, 2 L of circular probe and 8 L of water were added to the centrifuge tube containing the material. The reaction system was mixed well and then incubated at 65 C. for isothermal amplification. The reaction duration was 1.5 h, which was called in situ amplification.

    [0092] The products of original solution amplification and in situ amplification were subjected to electrophoresis, respectively. The results were shown in FIG. 2: M was a DNA marker, lanes 1-3 were original solution amplification, and lanes 5-8 were in situ amplification. As shown in FIG. 2, in the sample solution before the enrichment, the concentration of let-7a was not sufficient to be amplified to generate enough RCA products to show a bright band in gel electrophoresis. However, after the enrichment by rGO modified magnetic beads, the amount of RCA products was significantly increased, and bright bands can be seen in the electrophoresis picture. This experiment demonstrates that rGO modified magnetic beads are capable of efficiently enriching miRNA and undergoing in situ amplification.

    3. Ability to Distinguish SNP by Amino Magnetic Beads and rGO Modified Magnetic Beads

    [0093] Amino magnetic beads mainly rely on electrostatic adsorption to capture nucleic acids, while graphene solid phase extraction materials mainly use - interaction to capture single-stranded nucleic acids. For the capture of miRNAs, they have similar effects and graphene-modified solid phase extraction materials show no advantage. However, the following experiment demonstrates that the rGO modified magnetic beads can efficiently distinguish homologous miRNAs but not the amino acid beads.

    [0094] The miRNAs used in this example were let-7a and let-7d, which have a difference of two bases. The ring probe used in this example was probe designed for let-7a.

    [0095] First, 25 L each of let-7a and let-7d sample solutions (final concentration of 10 nM) were prepared. 0.5 L of the rGO modified magnetic beads prepared in Example 3 (extraction material) was weighed in a 0.2 mL centrifuge tube. 20 L each of the sample solutions was added to the centrifuge tube containing the extraction material, and the extraction material and the solution were mixed well by vortex or reverse mixing. Extraction was carried out at room temperature for 10 min. After the extraction, the liquid in the centrifuge tube was aspirated and the obtained extraction material was subjected to subsequent RCA. The non-enriched (original) sample solution was amplified as a control; sample enriched by unmodified amino magnetic beads was also set as control for RCA.

    [0096] 10 L of RCA mastermix, 2 L of circular probe (sequence: CACGCGATCCGCAACTATACAACCTACTACCTCAACACCCTCCAACCACCAAGGCA ATGTACACGAATTCGCCGAACG), and 8 L of water were added to each centrifuge tube containing the extraction materials after extraction. The reaction system was mixed well and then incubated at 65 C. for isothermal amplification. The reaction duration was 1.5 h. The amplification products were subjected to electrophoresis, respectively. The results were shown in FIG. 3.

    [0097] As shown in FIG. 3. Lane 1 and Lane 2 were amplifications of let-7a and let-7d by normal RCA with a reaction volume of 20 L.

    [0098] The amplification system of Lane 1 contained 10 L of mastermix, 2 L of let-7a (total amount of 200 nmol), 2 L of circular probe and 6 L of water.

    [0099] The amplification system of lane 2 contained 10 L of RCA mastermix, 2 L of let-7d (total amount 200 nmol), 2 L of circular probe and 6 L of water.

    [0100] Lanes 3 and 4 were in situ amplifications of the let-7a and let-7d (total amount 200 nmol, respectively) from amino magnetic beads without rGO modification.

    [0101] Lane 5 and Lane 6 were in situ amplifications of let-7a and let-7d (total amount 200 nmol, respectively) from rGO modified magnetic beads.

    [0102] Lane 7 was the negative control experiment.

    [0103] There were bands shown in lanes 2 and 4, indicating that normal RCA and amino magnetic beads cannot distinguish between homologous miRNAs; while lane 6 has no obvious band, indicating that rGO modified magnetic beads have the ability of distinguishing homologous miRNAs.

    4. Comparison of Adsorption Capacity of rGO Modified Magnetic Beads for Different Types of Nucleic Acid

    [0104] The present invention has for the first time found and confirmed that rGO modified materials can effectively adsorb miRNAs but not genomic DNA (gDNA) and mRNA, and thus can be used to extract miRNAs from complex nucleic acid solutions. While the most common commercially available silicon-based materials are not capable of differentially adsorbing miRNAs, gDNA, or mRNA.

    [0105] In the experiments, the extraction volume was fixed at 20 L, containing 20 nM Tris-HCl (pH=8.0), 5 mM MgCl.sub.2, 100 nM NaCl, and 15 ng of nucleic acid (miRNA, gDNA, and mRNA, respectively), water as balance. 20 L sample was extracted with rGO modified magnetic beads for 10 min. PCR was performed to verify the changes in nucleic acid content in the pre-extracted sample and in the supernatant after extraction.

    [0106] The nucleic acid used in FIG. 4a was a human gDNA and the target of amplification was the -actin gene. It can be seen from the Ct value of PCR that there is no change in the nucleic acid content of the samples before and after extraction, indicating that the material has no adsorption effect on gDNA.

    [0107] The nucleic acid used in FIG. 4b was a total RNA. The change of GAPDH mRNA content was determined by RT-qPCR. It can be seen from the Ct value of PCR that there is no change in the nucleic acid content of the samples before and after extraction, indicating that the material has no adsorption effect on mRNA.

    [0108] The sample used in FIG. 4-c was let-7a miRNA. The change of content before and after extraction was determined by RT-qPCR. It can be seen that the difference in Ct values before and after extraction was 7.8. If the amplification efficiency was 2, then 99.55% of let-7a miRNA was adsorbed.

    [0109] In FIGS. 4a to 4c, Ct values of the negative controls were 38.87, N/A (not detected) and 32.47, respectively.

    [0110] The above experiments show that the rGO modified magnetic beads can effectively adsorb miRNA but not gDNA and mRNA.

    5. Enrichment of miRNA Sample by rGO Modified Magnetic Beads

    [0111] In situ RCA was performed on the low concentration nuclei acid solutions without enrichment. The RCA system was 20 L, containing 10 l of RCA mastermix, 2 l of miRNA sample (let-7a), 2 L of circular probe (sequence: CACGCGATCCGCAACTATACAACCTACTACCTCAACACCCTCCAACCACCAAGGCA ATGTACACGAATTCGCCGAACG) and 6 L of water.

    [0112] 100 L of miRNA sample was extracted by rGO modified magnetic solid phase extraction material. After the extraction, the rGO modified magnetic solid phase extraction material was subjected to in situ RCA. The reaction system was 20 L, containing 10 L of mastermix, rGO modified magnetic beads, 2 L of circular probe (sequence: CACGCGATCCGCAACTATACAACCTACTACCTCAACACCCTCCAACCACCAAGGCA ATGTACACGAATTCGCCGAACG) and 8 l of water.

    [0113] As shown in FIG. 5a, without enrichment, the detection limit of RCA for miRNA sample was 1.318 pM (3), while after the enrichment by magnetic material, the detection limit of RCA for miRNA sample reached 53.4 fM (3) (FIG. 5b), reducing by about 25 times. It can be concluded that the magnetic material can be used for the detection of low concentration miRNA samples.

    [0114] The above are merely preferred embodiments of the present invention, and it should be pointed out that those of ordinary skill in the art can also make several improvements and improvements without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.