Reversible expression system for transgene expression in plants

10934556 ยท 2021-03-02

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to the development of expression cassettes to achieve tapetum specific reversible expression of transgene in female heterotic parent and in F1 progeny in the plants. The expression cassettes are based on the transcription regulation and light signaling. It includes two vector construct; female expression construct and male regulatory construct. The female expression construct was used to achieve tapetum specific expression of reporter gene while when cross is made with male plants having regulatory cassette, F1 plants were formed with abolished expression of reporter gene. Further, the system was deployed to achieve complete male sterility using candidate gene of male sterility; BECLIN1/ATG6 and successfully restoring the fertility of F1 by crossing with pollen of male regulatory transgenic. Here, we claim the expression system using which reversible male sterility can be achieved by expressing candidate gene for male sterility like BECLIN1 or other.

Claims

1. A MS DNA construct comprising: a. a first expression cassette comprising a first tapetum specific promoter operably linked to a desired gene of interest, expression of which leads to male sterility in plants, and a terminator; and wherein said desired gene of interest is AtBECLIN1 comprising SEQ ID NO: 2; and b. a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of i) N-terminal fragment of a transcription factor selected from the group consisting of HY5, HYH, and HFR1 and ii) TBPm3 encoded by SEQ ID NO: 6, and a terminator.

2. A ES DNA construct comprising: a. a first expression cassette comprising a first tapetum specific promoter operably linked to a gene of interest, and a terminator; and b. a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of i) N-terminal fragment of a transcription factor selected from the group consisting of HY5, HYH, and HFR1 and ii) TBPm3 encoded by SEQ ID NO: 6, and a terminator.

3. A RS DNA construct comprising an expression cassette comprising a tapetum specific promoter operably linked to a gene encoding a gene product that is a repressor of light signaling, and a terminator wherein said gene or gene product inactivates a transcription factor selected from the group consisting of HY5, HYH, and HFR1, wherein the gene comprises SEQ ID NO:8.

4. A reversible expression system for modulating male sterility in plants, said system comprising: a. a first component consisting of: i. a first expression cassette comprising: a first tapetum specific promoter operably linked to a desired gene of interest, expression of which causes male sterility in plants, and a terminator; and wherein said desired gene of interest is AtBECLIN1 comprising SEQ ID NO: 2; and ii. a second regulatory cassette comprising: a second promoter operably linked to a fragment encoding a fusion peptide of i) N-terminal fragment of a transcription factor selected from the group consisting of HY5, HYH, and HFR1 and ii) TBPm3 encoded by SEQ ID NO: 6, and a terminator; and b. a second component consisting of an expression cassette comprising: a second tapetum specific promoter operably linked to a gene, and a terminator.

5. A reversible expression system for modulating transgene expression in plants, said system comprising: a. a first component consisting of: i. a first expression cassette comprising: a first tapetum specific promoter operably linked to a gene of interest comprising AtBECLIN1 comprising SEQ ID NO: 2, and a terminator; and ii. a second regulatory cassette comprising: a second promoter operably linked to a fragment encoding a fusion peptide of i) N-terminal fragment of a transcription factor selected from the group consisting of HY5, HYH, and HFR1 and ii) TBPm3 encoded by SEQ ID NO: 6, and a terminator; and b. a second component consisting of an expression cassette comprising: a second tapetum specific promoter operably linked to a gene encoding a gene product that inactivates a transcription factor selected from the group consisting of HY5 and HYH, and a terminator.

6. The reversible expression system as claimed in claim 5, wherein said AtBECLIN1 consists of SEQ ID NO: 2.

7. The ES DNA construct as claimed in claim 2 or the system as claimed in claim 5, wherein said gene of interest is selected from the group consisting of gusA, GFP, YFP, LUX.

8. The MS DNA construct as claimed in claim 1 or the system as claimed in claim 4, wherein said first tapetum specific promoter is tapetum specific promoter TA29 having SEQ ID NO: 1.

9. The RS DNA construct as claimed in claim 3 or the system as claimed in claim 4, wherein said tapetum specific promoter is tapetum specific promoter having SEQ ID NO: 7.

10. The MS DNA construct as claimed in claim 1 or the system as claimed in claim 4, wherein said second promoter is constitutive or tissue specific.

11. The MS DNA construct or system as claimed in claim 10, wherein said second promoter is a constitutive promoter having SEQ ID NO: 4.

12. The MS DNA construct as claimed in claim 1, or the ES DNA construct as claimed in claim 2, or the system as claimed in claim 4, wherein said N-terminal fragment of a transcription factor consists of HFR1 encoded by SEQ ID NO:5.

13. The MS DNA construct as claimed in claim 1, or the ES DNA construct as claimed in claim 2, or the RS DNA construct as claimed in claim 3, or the system as claimed in claim 4, wherein said terminator is Nos terminator having SEQ ID NO: 3.

14. The RS DNA construct as claimed in claim 3 or the system as claimed in claim 4, wherein said gene is a mutant COP1 comprising SEQ ID NO: 8.

15. A DNA vector comprising a MS DNA construct as claimed in claim 1, or a ES DNA construct as claimed in claim 2, or a RS DNA construct as claimed in claim 3.

16. A recombinant host cell comprising a MS DNA construct as claimed in claim 1, or a ES DNA construct as claimed in claim 2, or a RS DNA construct as claimed in claim 3 or a DNA vector of claim 15.

17. A transgenic plant or parts thereof, including seeds comprising a MS DNA construct as claimed in claim 1, wherein the transgenic plant is male sterile.

18. A method of obtaining a transgenic plant of claim 17, said method comprising: a. obtaining a MS DNA construct as claimed in claim 1; or b. obtaining a recombinant host cell comprising said MS DNA construct; c. transforming plant cells with said MS DNA construct or recombinant host cells to obtain transformed cells; and d. selecting and regenerating transformed cells to obtain said transgenic plant or parts thereof, including seeds of claim 17, wherein said transgenic plant is male sterile.

19. A transgenic plant or parts thereof, including seeds comprising a RS DNA construct of claim 3.

20. A method of obtaining a transgenic plant of claim 19, said method comprising: a. obtaining a RS DNA construct as claimed in claim 3; or b. obtaining a recombinant host cell comprising said RS DNA construct; c. transforming plant cells with said RS DNA construct or recombinant host cells to obtain transformed cells; and d. selecting and regenerating transformed cells to obtain said transgenic plant or parts thereof, including seeds.

21. A hybrid plant or parts thereof, including seeds, comprising a MS DNA construct of claim 1 and a RS DNA construct of claim 3.

22. A method of obtaining a hybrid plant or part thereof, including seeds, said method comprising: a. obtaining a female transgenic plant having the MS DNA construct as claimed in claim 1, wherein said plant is male sterile; b. obtaining a male transgenic plant having the RS DNA construct as claimed in claim 3, wherein said plant is capable of restoring male fertility; c. crossing said female and male plant; d. obtaining hybrid seeds from said female plant of step (c) which comprises MS DNA construct of claim 1 and RS DNA construct of claim 3, wherein in said seeds male fertility is restored; and optionally e. developing said hybrid seeds into plants which comprise MS DNA construct of claim 1 and RS DNA construct of claim 3, wherein in said plants male fertility is restored.

23. A transgenic plant or parts thereof, including seeds comprising a ES DNA construct of claim 2, wherein said plant is capable of expression of a gene of interest.

24. A method of obtaining transgenic plant, said method comprising: a. obtaining a ES DNA construct as claimed in claim 2; or b. obtaining a recombinant host cell comprising said ES DNA construct; c. transforming plant cells with said ES DNA construct or recombinant host cells to obtain transformed cells; and d. selecting and regenerating transformed cells to obtain a transgenic plant, wherein said plant express gene of interest.

25. A method of obtaining transgenic plant, said method comprising: a. obtaining a RS DNA construct as claimed in claim 3; or b. obtaining a recombinant host cell comprising said RS DNA construct; c. transforming plant cells with said RS DNA construct or recombinant host cells to obtain transformed cells; and d. selecting and regenerating transformed cells to obtain a transgenic plant, wherein said plant is capable of inhibiting expression of a gene of interest.

26. The transgenic plant as claimed in claim 23, wherein said gene of interest is selected from the group consisting of gusA, GFP, YFP, LUX, nptI, and nptII genes.

27. A method of switching off expression of a gene of interest in a F1 population of plants or parts thereof, including seeds, said method comprising: a. obtaining a female transgenic plant of claim 17; b. obtaining a male transgenic plant of claim 25; c. crossing said female and male plant; and d. obtaining hybrid seeds from said female plant of step (c), wherein said hybrid seeds comprise ES DNA construct of claim 2 and RS DNA construct of claim 3, wherein the RS DNA construct inhibits the expression of gene of interest selected from the group consisting of gusA, GFP, YFP and LUX, of the ES DNA construct.

28. A method of switching off expression of a gene of interest in a F1 population of plants or parts thereof, including seeds as claimed in claim 27, wherein said method further comprises growing hybrid seeds into hybrid plants which comprise ES DNA construct of claim 2 and RS DNA construct of claim 3 and does not express said gene of interest.

Description

BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS

(1) The following drawings form part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.

(2) FIG. 1A depicts the vector construct 1 which is expression module (em) contain two expression cassettes; in first tapetum specific promoter with mutated TATA-box to TGTA drives the expression of reporter gene gusA while in second cassette artificial promoter Pcec express conjugated protein HFRI.sup.n-131aa-TBPm3. The expression module cloned in the binary vector pBI101 with NPTII as selectable marker gene for antibiotic. (TA.sub.29(m)=Tapetum specific promoter from tobacco with mutated TATA box to TGTA, gusA=reporter gene for -glucuronidase, Pcec=artificial promoter, HFRI.sup.n-131aa=N-terminus 131 amino acid fragment of HFR1 that lack it function but retain ability to interact with COP1 protein, TBPm3=TATA binding protein with three amino acid substitution (Ile.sub.152 to Phe.sub.152, Val.sub.161 to Thr.sub.161, and Leu.sub.163 to Val.sub.163), Tnos=transcriptional terminator).

(3) FIG. 1B depicts vector construct 2 which is male sterility module (ms); It is similar to vector construct 1 except the candidate gene of male sterility Arabidopsis BECLIN in place of gusA.

(4) FIG. 1C depicts vector construct 3 which is restoration module (rs); tapetum specific promoter A9 from Arabidopsis express COP1.sup.L105A (Constitutive photomorphogenic1) with amino acid mutation Leu to Ala increases nuclear abundance of the protein. The restoration module cloned in binary vector modified pCAMBIA1300 (of Cambia Institute, Canberra, Australia) with hptII as antibiotic marker gene. The vector is modified by replacing CaMV35S promoter by pNOS promoter to avoid leaky expression of COP1 due to bidirectional expression possibility by CaMV35S promoter.

(5) FIG. 2A depicts proposed model to achieve reversible male sterility; -parent should be transformed with MS module which resulted in complete male sterility while -parent with RS module with normal fertility, when both crossed to raise F1 with abolished expression of candidate gene (gusA/BECLIN1).

(6) FIG. 2B depicts male sterility (ms) module consists of two component; expression component and regulatory component. Promoter Pcec direct the expression of HFR1.sup.n-131aa-TBPm3 conjugated protein which localized to nucleus where it recognize mutated TATA box i.e. TGTA of TA29 promoter and bind to initiate transcriptional pre-initiation formation (PIC) which resulted in the expression of the AtBECLIN1 in the anther tapetum followed by pollen abortion i.e. male sterility.

(7) FIG. 2C depicts restoration module (rs) when transform in the -parent, tapetum specific A9 promoter drives the expression of COP1.sup.L105A in the anther tapetum which do not interfere with tapetal degeneration mechanism and plants are remaining fertile.

(8) FIG. 2D depicts the mechanism of fertility restoration of F1 hybrid. When custom character-parent expressing MS module crossed with custom character-parent expressing RS module, F1 hybrid form which contains both ms and rs module expressing in same tapetal cell. Pcec direct the expression of conjugated protein HFR1.sup.n-13aa-TBPm3 while A9 direct the expression of COP1.sup.L105A which localized in the nucleus and physically interact with HFR1.sup.n-131aa component and further resulted in sequential degradation of HFR1.sup.n-131aa-TBPm3. Therefore, it will be not available to initiate the PIC formation on the TA29 mutated TATA box (TGTA), hence, no transcriptional expression of AtBECLIN1 post-meiotically and normal tapetal degeneration resulted fertility restoration of F1 hybrids.

(9) FIG. 3i depicts flour-metric GUS analysis in S2 and S3 anther developmental stages of 10 independent transgenic lines expressing expression module (es) in tobacco with (n=3), expression was normalized with control (NTPH), ES transgenic were showing high expression of gusA protein while when cross is made ES(custom character)xRS(custom character) to raise F1, abolished expression of gusA protein was found in F1.

(10) FIG. 3ii A-C depicts histochemical GUS analysis; MS transgenic showing expression of gusA protein specific to tapetum of anther in S3 anther developmental stage while in F1 [ES(custom character)xRS(custom character)] no expression of gusA protein was found.

(11) FIG. 4A depicts the schematic presentation of the hypothesis; the vector construct with MS module will be transformed in female parent showing complete male sterility, while RS module in male parent with normal fertility. When both crossed, F1 hybrid derived with restored fertility.

(12) FIG. 4B depicts Pollen viability (Fluorescein diacetate-Propedium iodide stained pollen, FDA green fluorescence show viable while PI red fluorescence showing abortive pollen), pollen ermination and seed setting in transgenic with ms module, rs module and F1-hybrids [MS(custom character)xRS(custom character)]. Transgenic with MS module are showing complete male sterility with no seed setting while transgenic with rs module show fertility similar to control, when both crossed [MS(custom character)RS(custom character)]. F1 hybrid derived with restored pollen fertility and normal seed setting custom charactersimilar to control tobacco.

(13) FIG. 5A depicts in-vitro pollen viability (pv) and pollen germination (pg) assay; Transgenic with male sterile (ms) module shows complete abortion of pollen while in restorer plant shows normal fertility, in F1-hybrid the pollen fertility restored similar to the control plant (n=10).

(14) FIG. 5B depicts seed setting per pod (in mg); in ms transgenic no seed setting was observed while in rs transgenic normal seed setting, when F1 raise the normal seed setting restored (n=10).

(15) FIG. 6i depicts the relative expression of BECLIN1 in different anther development stages (S2-S6) of MS transgenic, it's predominantly express in S2 and S3 stage of the anther development. UBIQ was used for normalization, and the error bars indicate the SD of three independent experiments.

(16) FIG. 6ii depicts the relative expression of COP1.sup.L105A in different anther development stages (S1-S6) of RS transgenic, its predominantly express in S1 stage of the anther development. UBIQ was used for normalization, and the error bars indicate the SD of three independent experiments.

(17) FIG. 6iii depicts the relative expression of BECLIN1 and COP1.sup.L105A in different anther development stages (S1-S6) of F1 plants [MS(custom character)RS(custom character)], COP1.sup.L105A expression was found predominantly to S1 while diminished expression of BECLIN1 expression. UBIQ was used for normalization, and the error bars indicate the SD of three independent experiments.

(18) FIG. 6iv depicts the relative expression of BECLIN1 in the S3 developmental stage of ms transgenic and F1 was observed, high level of relative expression of BECLIN1 in the ms transgenic while diminished in F1. UBIQ was used for normalization, and the error bars indicate the SD of three independent experiments.

DETAILED DESCRIPTION OF THE INVENTION

(19) Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.

(20) In one embodiment of the invention an expression subsystem (ES) constructed which expresses reporter gene gusA in the anther tapetum at post meiotic stage of the anther development. The expression achieved using the ES was stringent and high level, driven by tapetum-specific promoter with two level of control that makes the system highly efficient.

(21) In another embodiment the restoration subsystem (RS) constructed which expresses regulatory protein COP1(m) in the anther tapetum driven by another tapetum-specific promoter at post-meiotic anther but prior to ES.

(22) In yet another embodiment of the invention expression module was transformed in one plant that is used as female-parent in crossing while restoration module in other that is used as male-parent in crossing, transgenic plants were generated and cross was made between female ES and male RS transgenics to generate F1 plants. The expression of reporter protein (gusA) was found high and stringently to post-meiotic tapetum of ES transgenic while in their F.sub.1 the expression was completely abolished.

(23) In still another embodiment expression system (ES) was used to express the candidate gene for male sterility that impairs the normal tapetum degeneration. Tapetum is the innermost wall layer of the male reproductive organ anther in flowering plants. Post meiotic PCD like degeneration of tapetum is crucial for pollen fertility. Alteration in the tapetal PCD (early/delayed) resulted in abortive pollen formation. Various genes were used to achieve male sterile transgenic plants by altering the tapetal degeneration; here in present invention we use express Arabidopsis BECLIN1/ATG6 using the expression system (ES), the system is now male sterility (MS) system. The transgenic expressing male sterility (MS) system were completely male sterile as was reported previously.

(24) For the development of the hybrid seed it is pre-requisite to have the sufficient restoration of the fertility of the F1 hybrid. Efficient restoration of fertility of F1 hybrid is limitation in the previous systems.

(25) In still another embodiment of the present invention transgenic plants with male sterility (MS) system which were completely male sterile, were used as female-parent in crossing while transgenic of restoration module (RS) with normal fertility were used as male-parent in crossing [MS (custom character)xRS(custom character)], to generate F.sub.1 plants. Abolished expression of BECLIN1 transcript was found in F.sub.1 in post-meiotic anther tapetum, therefore, normal tapetal degeneration occurs which results to restored fertility of F.sub.1-hybrid.

(26) The expression vectors claimed in this invention are the good tool to achieve reversible expression of candidate gene or more specifically BECLIN1. The restoration method of male sterility of present invention which is reliable as complete restoration was achieved, broad applicability both in intra- as well as inter-specific hybrids, toxin free as no chemical used, not sensitive to environmental factor like temperature.

(27) In the present invention definitions of the terms are, A cloning vector is a DNA molecule, such as a plasmid, cosmid, or bacteriophage that has the capability of replicating autonomously in a host cell. Cloning vectors typically contain one or a small number of restriction endonuclease recognition sites at which foreign DNA sequences can be inserted in a determinable fashion without loss of an essential biological function of the vector, as well as a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide antibiotic or herbicide resistance.

(28) A reporter gene is a gene whose phenotypic expression is easy to monitor; used to study promoter activity in different tissues or developmental stages.

(29) A promoter is a region of DNA that initiates transcription of a particular gene. Promoters are located near the transcription start sites of genes, on the same strand and upstream on the DNA (towards the 3 region of the anti-sense strand, also called template strand and non-coding strand). Promoters can be about 100-1000 base pairs long.

(30) A constitutive promoter is an unregulated promoter that allows for continual transcription of its associated gene.

(31) A tapetum-specific promoter is a regulated promoter that allows expression of the gene only to the tapetum tissue of the anther.

(32) The term expression refers to the biosynthesis of a gene product. For example, in the case of a structural gene, expression involves transcription of the structural gene into mRNA and the translation of mRNA into one or more polypeptides.

(33) An expression cassette is a DNA molecule comprising a gene that is expressed in a host cell and a promoter, driving its expression. Typically, gene expression is placed under the control of certain tissue-specific regulatory elements.

(34) A transcription factor is a protein that binds to a cis-regulatory element (eg. an enhancer, a TATA box) and thereby, directly or indirectly, affects the initiation of transcription.

(35) A recombinant vector is a vector in which a foreign DNA has been inserted.

(36) An expression vector is a vector in which an expression cassette has been genetically engineered.

(37) A binary vector is able to replicate in both E. coli and Agrobacterium tumefaciens. It typically contains a foreign DNA in place of T-DNA, the left and right T-DNA borders, marker for selection and maintenance in both E. coli and Agrobacterium tumefaciens, a selectable marker for plants. This plasmid is said to be disarmed since its tumor-inducing genes located in the T-DNA have been removed.

(38) A suitable promoter includes a tissue-specific or cell-specific promoter that controls gene expression in those particular cells of a particular tissue. An anther-specific promoter is a DNA sequence that directs a higher level of transcription of an associated gene in anther tissue than in some or all other tissues of a plant. In present invention suitable promoter directs expression only in cells that are critical for the formation or function of pollen, including tapetum cells, pollen mother cells, and early microspores.

(39) The program cell death (PCD)/apoptosis is a genetically directed process of cell self-destruction that is marked by the fragmentation of nuclear DNA, is activated either by the presence of a stimulus or removal of a suppressing agent or stimulus, and is a normal physiological process eliminating DNA-damaged, superfluous, or unwanted cells called also programmed cell death.

(40) The Autophagy is a self-degradative process that is important for balancing sources of energy at critical times in development and in response to nutrient stress. Autophagy also plays a housekeeping role in removing misfolded or aggregated proteins, clearing damaged organelles, such as mitochondria, endoplasmic reticulum and peroxisomes, as well as eliminating intracellular pathogens.

(41) The explants is living tissue transferred from an organism to an artificial medium for culture. Photo-morphogenesis is light-mediated development of plants.

(42) The present invention relates to the development of a regulated expression module where tapetum-specific post-meiotic expression of a candidate gene can be achieved and their expression can abolished completely in the F.sub.1 when crossed with transgenic containing second module. The invention provides a method which facilitates the use of male sterility related gene expression to achieve male-sterile plants and also restoration of fertility of F.sub.1 hybrid which is pre-requisite for development of hybrid seed.

(43) In one embodiment of the invention three expression vectors were constructed. The first vector construct is expression system (ES) consist of two transcription units (TUs); expression component and regulatory component (FIG. 1A). In first transcription unit (expression component) comprising a reporter gene which may be selected from gusA, GFP, YFP etc. under the transcriptional control of tapetum-specific promoter with mutated TATA-box to TGTA and suitable transcription termination signal including a polyadenylation signal.

(44) The individual component of first transcriptional unit (TUs) are discussed: (a) TA.sub.29(TGTA); a tapetum-specific promoter from tobacco. TGTATATG mutation was introduced in the TATATATG box. This site directed mutagenesis makes it specific to TBPm3. It do not recognize native TATA-binding protein (TBP) but when tree amino acid replacement was made to form TBPm3, mutated TATA-box will recognize and higher expression will be achieved due to increased pool of TBPm3 dedicated to expression of TA.sub.29(TGTA) tagged transcript. (TA.sub.29 promoter used from Nicotiana tabacum, TBPm3 gene from Arabidopsis thaliana. Nicotiana tabacum cv Petite Havana SR1, of LEHLE Seeds, United State. Arabidopsis genotype of Arabidopsis Biological Resource Centre (ABRC). (b) gusA; reporter gene encode -glucuronidase which can be measured in terms of quantity as well as qualitative (tissue specificity). (Of pBI101 vector). (c) nosT; transcriptional terminator sequence including polyadenylation signal (of pBI101 vector).

(45) The second transcriptional unit (TU) of ES (regulatory component) which regulates first TUs comprises of fusion polypeptide of the HFR1.sup.n-51.sup.31-TBPm3 under the control of constitutive promoter and fused to a suitable transcription termination signal including a polyadenylation signal. The individual component of second transcriptional unit (TUs) are discussed: (a) Pcec; an artificial constitutive promoter (designed in our laboratory at CSIR-NBRI, Lucknow). (b) HFR1.sup.n-1.sup.31; Long hypocotyls in far red, a transcription factor of light regulated promoter which plays role in photo-morphogenesis. Only N-terminus fragment of 131 amino acids was taken which do not have any functional domain. It contain only interacting domain with repressor of light signaling i.e. COP1 (Constitutive photomorphogenic1). Therefore, expressions of HFR1.sup.n-131 do not have any effect on the normal development on the plant (Yang J, Lin R, Sullivan J, Hoecker U, Liu B, Xu L, Deng X W, Wang H. (2005) Light regulates COP1-mediated degradation of HFR1, a transcription factor essential for light signaling in Arabidopsis Plant Cell, 17(3):804-21.). (HFR1.sup.n-131 gene used from Arabidopsis thaliana. (c) TBPm3; TATA binding protein (TBP) with three amino acid substitutions: Ile.sub.152 to Phe.sub.152, Val.sub.161 to Thr.sub.161, and Leu.sub.163 to Val.sub.63. The three amino acid substitutions resulted in the change in protein conformation that makes it specific to mutated TATA box recognition. (of Arabidopsis thaliana). (d) nosT; transcriptional terminator sequence including a polyadenylation signal.

(46) The sequence of ES construct is tapetum-specific promoter: reporter gene:transcriptional terminator:constitutive promoter: transcription factor fragment with ability to bind to restorer protein-TATA binding protein:transcriptional terminator, More specifically (TA29.sub.(TGTA):gusA:Tnos::Pcec:HFR1.sup.n-131-TBPm3:Tnos) (FIG. 1A).

(47) The second vector construct is male sterility (MS) module (FIG. 1B). The expression system similar to the first module except the reporter gene (gusA) is replaced by one of the several gene that impairs the tapetal degeneration and cause male sterility (described in prior art). In present invention Arabidopsis BECLIN1 gene (BECLIN1 gene from Arabidopsis thaliana) which is an autophagy related gene, when expressed in tapetum resulted male sterility. (Sudhir Pratap Singh, Tripti Pandey, Rakesh Srivastav, Praveen C. Verma, Praduman K. Singh, Rakesh Tuli and Samir V. Sawant (2010) BECLIN 1 from Arabidopsis thaliana under the generic control of regulated expression systems, a strategy for developing male sterile plants. Plant Biotech. J. 8, 1005-1022).

(48) The third vector construct is restoration (RS) module (Figure. IC) consist of the single transcription unit where a protein that regulates the expression of first/second vector is expressed under the control of another tapetum-specific promoter with a suitable transcription termination signal including a polyadenylation signal. The RS module comprises: (a) A9; tapetum-specific promoter isolated from Arabidopsis. It express gene in the tapetum in postmeiotic anther stage of development. (A9 promoter from Arabidopsis thaliana). (b) COP1.sup.L105A; Constitutive photomorphogenic1 (COP1) is a repressor of photo-morphogenesis. It functions as an essential negative regulator of light mediated plant development. It targets photo-morphogenesis promoting transcription factors like HYH, HY5, and HFR1 etc. for ubiquitylation and degradation in the dark and promote skoto-morphogenesis. The mutation in L105A in the nuclear exclusion sequence resulted increased nuclear localization while retaining functionality (Subramanian, C, Kim, D H, Lyssenko, N N, Xu, X, Johnson, C H and Arnim, AGV (2004) The Arabidopsis repressor of light signaling, COP1, is regulated by nuclear exclusion; mutational analysis by bioluminescence resonance energy transfer. PNAS, 101, 6798-6802). (COP1.sup.L105A gene from Arabidopsis thaliana). (c) nosT; transcriptional terminator sequence including a polyadenylation signal.

(49) Another embodiment is to develop method where reversible expression of said gene can be achieved. The strategy underlying to achieve male sterile plant and restoring the fertility of F1 hybrid through transcription regulation and light signaling mechanism (FIG. 2A) is, MS construct will be transformed in parent which will be taken as female parent (male sterile) in hybrid breeding while RS construct will be transformed in the parent which will be taken as male parent (male fertile).The cross is made MS (female)xRS (male) to raise the F.sub.1.

(50) The ms module (FIG. 2B) is based on TGTA-TBPm3 complementation principle based two component system (Chaturvedi, C P, Lodhi, N, Ansari S A, Tiwari S, Srivastav R, Sawant S V, Tuli, R (2007) Mutated TATA-box/TATA binding protein complementation system for regulated transgene expression in tobacco. The Plant Journal 50, 917-925); it contains two transcriptional units (TUs), expression component and regulatory component. In first TU (expression component), AtBECLIN1 gene expressed using tobacco tapetum-specific promoter TA.sub.29 with mutated TATA-box to TGTA. The TA.sub.29(TGTA) express AtBECLIN1 which is regulated by second TU (regulatory system). The regulatory system express fusion protein; only 311 amino acid N-terminus fragment of Long hypocotyls in Far-red (HFR1) SEQ ID-5, (a b-HLH transcription factor of light regulated promoters of Arabidopsis) and mutated version of TATA-binding protein TBPm3. HFR1.sup.n-131aa-TBPm3 fusion protein express which recognize the TGTA of TA29 promoter and form pre-initiation complex (PIC). TBPm3 pool is available only to TGTA, therefore, high-level of AtBECLIN1 expression occurs in anther tapetum. Their expression will confer the complete male sterility.

(51) Restoration (rs) module developed by expressing the Arabidopsis COP1 (constitutive photomorphogenic 1) in the anther tapetum using Arabidopsis tapetum-specific promoter A9. COP1 is repressor of Photomorphogenic development; it possesses E3 ligase activity toward a group of photo-morphogenesis promoting factors, including HFR1 and is responsible for their targeted degradation. Mutation in COP1.sup.L105A (SEQ ID-7) resulted in increased nuclear localization. A9 promoter confers the COP1.sup.L105A expression in the anther tapetum. Their expression do not alter the natural tapetal degeneration mechanism, hence, transgenic expressing COP1.sup.L105A are male fertile and are used as male-parent in hybrid development.

(52) F1-hybrids were developed by crossing ms module expressing transgenic (female-parent) and restorer module expressing transgenic (male-parent) (Figure. 2D). In them, both module express in same tapetal cell. COP1.sup.L105A protein form which localized in the nucleus where it physically interact with HFR1.sup.n-131aa fragment of fusion protein HFR1.sup.n-131aa-TBPm3 and resulted in the degradation of complete protein. TBPm3 will not available to form PIC, this results no expression of AtBECLIN1, normal tapetal degeneration and hence fertility of F1 hybrid will be restored.

(53) Another embodiment Agrobacterium (of DNA cloning service (DCS), Germany) mediated transformation method comprises: (a) Constructing a recombinant construct; ES and MS expression systems were cloned in a binary vector pBI101 pBI101, and pBI121 (of Clontech, USA) separately in which nptII gene is used to express by constitutive promoter (CamV35S) which give resistance to kanamycine. The RS expression system cloned in binary vector where hptII gene expressed by weak constitutive promoter (pNOS) to avoid bidirectional expression, it gives resistance to hygromycine; (b) mobilizing the recombinant constructs of step (a) into Agrobacterium strain to produce recombinant Agrobacterium strains; (c) obtaining a suitable explant from the plant; (d) cultivating the explant with the recombinant Agrobacterium strain of step (b) to produce transformed plant cells; (e) culturing the transformed plant cells to produce transformed plants; (f) obtaining transformed plants.

(54) The present invention relates to monocotyledonous or a dicotyledonous plant transformation, wherein the plant is selected from a group consisting of tobacco, cotton, rice, wheat, corn, potato, tomato, oilseed rape, alfalfa, sunflower, onion, clover, soyabean, pea.

(55) One embodiment provides Agrobacterium strain selected from a group consisting of LBA4404, EHA 101 and EHA 105.

(56) Another embodiment provides explant selected from a group consisting of leaf, stem, root, hypocotyl and embryo.

(57) Yet another embodiment provides a transformed plant cell comprising the recombinant construct.

(58) Still another embodiment provides a transgenic plant transformed with the recombinant constructs.

(59) Another embodiment provides the transgenic plant selected from a group consisting of tobacco, cotton, rice, brassica, potato, tomato, oilseed rape, alfalfa, sunflower, onion, clover, soyabean, pea.

(60) Yet another embodiment provides a plant, a plant part, a seed, a plant cell and a progeny thereof, wherein the plant, plant part, seed, plant cell, or progeny thereof comprises the recombinant construct.

(61) The present invention relates to a recombinant construct (FIG. 1A) for transforming plants to achieve tapetum-specific expression. Further, when another plant transformed with other recombinant construct (FIG. 1C) pollens used to cross the first one to raise F.sub.1, the expression of said gene will be completely abolished. The said hypothesis was tested in tobacco by expressing gusA gene. Fluorometric GUS assay of post-meiotic anther of transgenic showing elevated expression of reporter gene, while F1 showing abolished expression (FIG. 3-i). When histochemical GUS staining was performed to localize the expressed gene, GUS staining localized in tapetum tissue of post-meiotic anther and no staining was appear in other plant tissue also no staining was appear in the F.sub.1 tapetum of the same anther stage (FIG. 3-ii).

(62) Tapetum is the innermost wall layer of the male reproductive organ anther in flowering plants. Post meiotic PCD like degeneration of tapetum is crucial for pollen fertility. Tapetum degeneration at post-meiotic stage of pollen development is requires as it releases nutrients to developing microspores, pollen wall materials, callase to separate the tetrad and other enzymes, flavenoids, alkenes, proteins etc. Alteration in the tapetal PCD (early/delayed) resulted in abortive pollen formation. Various genes were expressed to disrupt normal tapetal degeneration and male sterility was achieves; Barnase, RNase T-I, Mammalian uncoupling protein, Diphtheria toxin A-chain, Ribosome Inactivating Protein, BAX, Arabidopsis Bax inhibitor-1, AtBECLIN1 (discussed in prior art). The said method of the tapetum-specific expression of any gene that interferes in the normal tapetal degeneration mechanism will resulted in the male sterility. The above said vector construct are designed for tapetum-specific expression using tapetum-specific promoter but two level of stringency and higher level of expression make it better as it will be helpful in generating complete male sterile plants. Here we use AtBECLIN1 gene which is a plant autophagy related gene without cytotoxic role.

(63) An embodiment of the present invention relates to a recombinant construct (FIG. 1B) expressing plant gene BECLIN1 in tapetum of post-meiotic anther (FIG. 6A). The expression vector includes restoration factor HFR1 which inclusion do not affect their expression. Their expression interfere normal tapetal degeneration causes pollen abortion and generates male sterile plant as was reported previously (FIG. 4B). These plants fail to produce viable pollen (FIG. 5A) and are not able to facilitate normal seed setting (FIG. 6B).

(64) For the production of hybrid seeds which is aim of hybrid breeding, male sterility based hybrids have several advantages and are cheaper as it replace the manual emasculation process. When the commercial product is hybrid seed, there is need to restore the fertility of F1 hybrid. In present condition effective restoration of F1 fertility is limitation. Here our said method provides effective restoration of F1 hybrid with broad applicability. The method is advanced as the control of the male sterility gene is at transcription level.

(65) Another embodiment of the present invention relates to a recombinant construct (FIG. 1C) wherein said regulatory sequence (COP1.sup.L105A) is expressed using suitable promoter i.e. tapetum specific promoter (A9) having polynucleotide sequence as shown in SEQ ID NO: 7. it express COP1.sup.L105A) post-meiotic but prior to the BECLIN1 (FIG. 6-ii). The transgenic of the said are fertile (FIG. 4B, 5A) and showing normal seed settings (FIG. 4B, 5B) . . . .

(66) Yet another embodiment of the present invention relates to the crossing of the ms transgenic (custom character) and rs transgenic (custom character) to raise the F.sub.1 plants.

(67) Still another embodiment is to analyses F.sub.1 plants, they are showing restored fertility as pollen viability and pollen germination is similar to control plant (FIG. 4B, 5A) and normal seed setting (FIG. 4B, 5B). When expression of BECLIN1 was checked in different anther developmental stages, it was found that their expression was abolished (FIGS. 6-iii and 6-iv).

(68) Hybrid crops are made to exploit heterosis or hybrid vigor. Heterosis is exhibited when two heterotic parents P1 (custom character) and P2 (custom character) will cross to make F.sub.1. The custom characterabove said method can be established in such that P1 parents will be transformed with MS vector and P2 with RS vector. P1 will be complete male sterile while P2 will show normal fertility. When both crossed [P1 (custom character)xP2 (custom character)], II rose with restored fertility. The method can be established in previously defined heterotic parents.

(69) In an embodiment of the present disclosure, there is provided a MS DNA construct comprising: (a) a first expression cassette comprising a first tissue specific promoter operably linked to a desired gene of interest, expression of which leads to male sterility in plants, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator.

(70) In an embodiment of the present disclosure, there is provided a MS DNA construct as described herein, wherein said first tissue specific promoter is tapetum specific promoter TA29 having SEQ ID NO: 1.

(71) In an embodiment of the present disclosure, there is provided a MS DNA construct as described herein, wherein said desired gene of interest is selected from the group consisting of BARNASE, RNase, T-I, Mammalian uncoupling protein, Diptheria toxin A-chain, BAX, and AtBECLIN1.

(72) In an embodiment of the present disclosure, there is provided a MS DNA construct as described herein, wherein said desired gene of interest is AtBECLIN1 having SEQ ID NO: 2.

(73) In an embodiment of the present disclosure, there is provided a MS DNA construct as described herein, wherein said second promoter is constitutive or tissue specific.

(74) In an embodiment of the present disclosure, there is provided a MS DNA construct as described herein, wherein said second promoter is a constitutive promoter having SEQ ID NO: 4.

(75) In an embodiment of the present disclosure, there is provided a MS DNA construct as described herein, wherein said terminator is Nos terminator having SEQ ID NO: 3.

(76) In an embodiment of the present disclosure, there is provided a MS DNA construct as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment selected from the group consisting of HY5, HYH, and HFR1.

(77) In an embodiment of the present disclosure, there is provided a MS DNA construct as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment from HFR1.

(78) In an embodiment of the present disclosure, there is provided a MS DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to AtBECLIN1 having SEQ ID NO: 2, expression of which leads to male sterility in plants, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a Nos terminator having SEQ ID NO: 3.

(79) In an embodiment of the present disclosure, there is provided a ES DNA construct comprising: (a) a first expression cassette comprising a first tissue specific promoter operably linked to a gene of interest, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator.

(80) In an embodiment of the present disclosure, there is provided a ES DNA construct as described herein, wherein said first tissue specific promoter is tapetum specific promoter TA29 having SEQ ID NO: 1.

(81) In an embodiment of the present disclosure, there is provided a ES DNA construct as described herein, wherein said gene of interest is selected from the group consisting of gusA, GFP, YFP, LUX, nptI, nptII genes.

(82) In an embodiment of the present disclosure, there is provided a ES DNA construct as described herein, wherein said terminator is Nos terminator having SEQ ID NO: 3.

(83) In an embodiment of the present disclosure, there is provided a ES DNA construct as described herein, wherein said second promoter is constitutive or tissue specific.

(84) In an embodiment of the present disclosure, there is provided a ES DNA construct as described herein, wherein said second promoter is a constitutive promoter having SEQ ID NO: 4.

(85) In an embodiment of the present disclosure, there is provided a ES DNA construct as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment selected from the group consisting of HY5, HYH, and HFR1.

(86) In an embodiment of the present disclosure, there is provided a ES DNA construct as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment from HFR1.

(87) In an embodiment of the present disclosure, there is provided a ES DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to a gene of interest, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a terminator.

(88) In an embodiment of the present disclosure, there is provided a RS DNA construct comprising an expression cassette comprising a third issue specific promoter operably linked to a restorer gene, and a terminator.

(89) In an embodiment of the present disclosure, there is provided a RS DNA construct as described herein, wherein said third tissue specific promoter is tapetum specific promoter having SEQ ID NO: 7.

(90) In an embodiment of the present disclosure, there is provided a RS DNA construct as described herein, wherein said restorer gene is a mutant COP1 having SEQ ID NO: 8.

(91) In an embodiment of the present disclosure, there is provided a RS DNA construct as described herein, wherein said terminator is Nos terminator having SEQ ID NO: 3.

(92) In an embodiment of the present disclosure, there is provided a RS DNA construct comprising an expression cassette comprising a third tapetum specific promoter having SEQ ID NO: 7 operably linked to a mutant COP1 having SEQ ID NO: 8, and a Nos terminator having SEQ ID NO: 3.

(93) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants, said system comprising: (a) a first component consisting of: (i) a first expression cassette comprising: a first tissue specific promoter operably linked to a desired gene of interest, expression of which causes male sterility in plants, and a terminator; and (ii) a second regulatory cassette comprising: a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator; (b) a second component consisting of an expression cassette comprising: a third tissue specific promoter operably linked to a restorer gene, and a terminator.

(94) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants as described herein, wherein said first tissue specific promoter is tapetum specific promoter TA29 having SEQ ID NO: 1.

(95) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants as described herein, wherein said desired gene of interest is selected from the group consisting of BARNASE, RNase, T-I, Mammalian uncoupling protein, Diptheria toxin A-chain, BAX, and AtBECLIN1.

(96) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants as described herein, wherein said desired gene of interest is AtBECLIN1 having SEQ ID NO: 2.

(97) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants as described herein, wherein said terminator is Nos terminator having SEQ ID NO: 3.

(98) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants as described herein, wherein said second promoter is constitutive or tissue specific.

(99) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants as described herein, wherein said second promoter is a constitutive promoter having SEQ ID NO: 4.

(100) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment selected from the group consisting of HY5, HYH, and HFR1.

(101) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment from HFR1.

(102) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants as described herein, wherein said third tissue specific promoter is tapetum specific promoter having SEQ ID NO: 7.

(103) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants as described herein, wherein said restorer gene is a mutant COP1 having SEQ ID NO: 8.

(104) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating male sterility in plants, said system comprising: (a) a first component consisting of: (i) a first expression cassette comprising: a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to AtBECLIN1 having SEQ ID NO: 2, expression of which causes male sterility in plants, and a Nos terminator having SEQ ID NO: 3; and (ii) a second regulatory cassette comprising: a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a Nos terminator having SEQ ID NO: 3; (b) a second component consisting of an expression cassette comprising: a third tapetum specific promoter having SEQ ID NO: 7 operably linked to a mutant COP1 having SEQ ID NO: 8, and a Nos terminator having SEQ ID NO: 3.

(105) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants, said system comprising: (a) a first component consisting of: (i) a first expression cassette comprising: a first tissue specific promoter operably linked to a gene of interest, and a terminator; and (ii) a second regulatory cassette comprising: a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator; (b) a second component consisting of an expression cassette comprising: a third tissue specific promoter operably linked to a restorer gene, and a terminator.

(106) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants as described herein, wherein said first tissue specific promoter is tapetum specific promoter TA29 having SEQ ID NO: 1.

(107) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants as described herein, wherein said gene of interest is selected from the group consisting of gusA, GFP, YFP, LUX, nptI, nptII genes.

(108) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants as described herein, wherein said terminator is Nos terminator having SEQ ID NO: 3.

(109) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants as described herein, wherein said second promoter is constitutive or tissue specific.

(110) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants as described herein, wherein said second promoter is a constitutive promoter having SEQ ID NO: 4.

(111) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment selected from the group consisting of HY5, HYH, and HFR1.

(112) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment from HFR1.

(113) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants as described herein, wherein said third tissue specific promoter is tapetum specific promoter having SEQ ID NO: 7.

(114) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants as described herein, wherein said restorer gene is a mutant COP1 having SEQ ID NO: 8.

(115) In an embodiment of the present disclosure, there is provided a reversible expression system for modulating transgene expression in plants, said system comprising: (a) a first expression cassette comprising: (i) a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to a gene of interest, and a Nos terminator having SEQ ID NO: 3; and (ii) a second regulatory cassette comprising: a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a Nos terminator having SEQ ID NO: 3; (b) a second component consisting of an expression cassette comprising: a third tapetum specific promoter having SEQ ID NO: 7 operably linked to a mutant COP1 having SEQ ID NO: 8, and a Nos terminator having SEQ ID NO: 3.

(116) In an embodiment of the present disclosure, there is provided a DNA vector comprising a MS DNA construct, said MS DNA construct comprising: (a) a first expression cassette comprising a first tissue specific promoter operably linked to a desired gene of interest, expression of which leads to male sterility in plants, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator.

(117) In an embodiment of the present disclosure, there is provided a DNA vector comprising a ES DNA construct, said ES DNA construct comprising: (a) first expression cassette comprising a first tissue specific promoter operably linked to a gene of interest, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator.

(118) In an embodiment of the present disclosure, there is provided a DNA vector comprising a RS DNA construct, said RS DNA construct comprising an expression cassette comprising a third issue specific promoter operably linked to a restorer gene, and a terminator.

(119) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said first tissue specific promoter is tapetum specific promoter TA29 having SEQ ID NO: 1.

(120) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said desired gene of interest is selected from the group consisting of BARNASE, RNase, T-I, Mammalian uncoupling protein, Diptheria toxin A-chain, BAX, and AtBECLIN1.

(121) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said desired gene of interest is AtBECLIN1 having SEQ ID NO: 2.

(122) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said second promoter is constitutive or tissue specific.

(123) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said second promoter is a constitutive promoter having SEQ ID NO: 4.

(124) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said terminator is Nos terminator having SEQ ID NO: 3.

(125) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment selected from the group consisting of HY5, HYH, and HFR1.

(126) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment from HFR1.

(127) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said gene of interest is selected from the group consisting of gusA, GFP, YFP, LUX, nptI, nptII genes.

(128) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said third tissue specific promoter is tapetum specific promoter having SEQ ID NO: 7.

(129) In an embodiment of the present disclosure, there is provided a DNA vector as described herein, wherein said restorer gene is a mutant COP1 having SEQ ID NO: 8.

(130) In an embodiment of the present disclosure, there is provided a DNA vector comprising a MS DNA construct, said MS DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to AtBECLIN1 having SEQ ID NO: 2, expression of which leads to male sterility in plants, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a Nos terminator having SEQ ID NO: 3.

(131) In an embodiment of the present disclosure, there is provided a DNA vector comprising a ES DNA construct, said ES DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to a gene of interest, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a Nos terminator having SEQ ID NO: 3.

(132) In an embodiment of the present disclosure, there is provided a DNA vector comprising a RS DNA construct, said RS DNA construct comprising an expression cassette comprising a third tapetum specific promoter having SEQ ID NO: 7 operably linked to a mutant COP1 having SEQ ID NO: 8, and a Nos terminator having SEQ ID NO: 3.

(133) In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a MS DNA construct, said MS DNA construct comprising: (a) a first expression cassette comprising a first tissue specific promoter operably linked to a desired gene of interest, expression of which leads to male sterility in plants, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator.

(134) In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a ES DNA construct, said ES DNA construct comprising: (a) a first expression cassette comprising a first tissue specific promoter operably linked to a gene of interest, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator.

(135) In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a RS DNA construct, said RS DNA construct comprising an expression cassette comprising a third issue specific promoter operably linked to a restorer gene, and a terminator.

(136) In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector, said DNA vector comprising a MS DNA construct comprising: (a) a first expression cassette comprising a first tissue specific promoter operably linked to a desired gene of interest, expression of which leads to male sterility in plants, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator.

(137) In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector, said DNA vector comprising a ES DNA construct comprising: (a) a first expression cassette comprising a first tissue specific promoter operably linked to a gene of interest, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator.

(138) In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector, said DNA vector comprising a RS DNA construct comprising an expression cassette comprising a third issue specific promoter operably linked to a restorer gene, and a terminator.

(139) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said first tissue specific promoter is tapetum specific promoter TA29 having SEQ ID NO: 1.

(140) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said desired gene of interest is selected from the group consisting of BARNASE, RNase, T-I, Mammalian uncoupling protein, Diptheria toxin A-chain, BAX, and AtBECLIN1.

(141) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said desired gene of interest is AtBECLIN1 having SEQ ID NO: 2.

(142) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said second promoter is constitutive or tissue specific.

(143) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said second promoter is a constitutive promoter having SEQ ID NO: 4.

(144) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said terminator is Nos terminator having SEQ ID NO: 3.

(145) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment selected from the group consisting of HY5, HYH, and HFR1.

(146) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment from HFR1.

(147) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said gene of interest is selected from the group consisting of gusA, GFP, YFP, LUX, nptI, nptII genes.

(148) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said third tissue specific promoter is tapetum specific promoter having SEQ ID NO: 7.

(149) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said restorer gene is a mutant COP1 having SEQ ID NO: 8.

(150) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said recombinant host cell is a plant cell.

(151) In an embodiment of the present disclosure, there is provided a recombinant host cell as described herein, wherein said recombinant host cell is Agrobacterium tumefaciens.

(152) In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a MS DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to AtBECLIN1 having SEQ ID NO: 2, expression of which leads to male sterility in plants, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a terminator.

(153) In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector, said DNA vector comprising a MS DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to AtBECLIN1 having SEQ ID NO: 2, expression of which leads to male sterility in plants, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a terminator.

(154) In an embodiment of the present disclosure, there is provide a recombinant host cell comprising a ES DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to a gene of interest, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a terminator.

(155) In an embodiment of the present disclosure, there is provide a recombinant host cell comprising a DNA vector, said DNA vector comprising a ES DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to a gene of interest, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a terminator.

(156) In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a RS DNA construct comprising an expression cassette comprising a third tapetum specific promoter having SEQ ID NO: 7 operably linked to a mutant COP1 having SEQ ID NO: 8, and a Nos terminator having SEQ ID NO: 3.

(157) In an embodiment of the present disclosure, there is provided a recombinant host cell comprising a DNA vector, said DNA vector comprising a RS DNA construct comprising an expression cassette comprising a third tapetum specific promoter having SEQ ID NO: 7 operably linked to a mutant COP1 having SEQ ID NO: 8, and a Nos terminator having SEQ ID NO: 3.

(158) In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds comprising a MS DNA construct comprising: (a) a first expression cassette comprising a first tissue specific promoter operably linked to a desired gene of interest, expression of which leads to male sterility in plants, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator, wherein the transgenic plant is male sterile.

(159) In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds comprising a RS DNA construct comprising a third issue specific promoter operably linked to a restorer gene, and a terminator, wherein said transgenic plant is capable of restoring male sterility.

(160) In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds comprising a ES DNA construct comprising: (a) a first expression cassette comprising a first tissue specific promoter operably linked to a gene of interest, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator, wherein said plant is capable of expression of a gene of interest.

(161) In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds comprising a RS DNA construct comprising a third issue specific promoter operably linked to a restorer gene, and a terminator, wherein said plant is capable of inhibiting expression of a gene of interest.

(162) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein said first tissue specific promoter is tapetum specific promoter TA29 having SEQ ID NO: 1.

(163) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein said desired gene of interest is selected from the group consisting of BARNASE, RNase, T-I, Mammalian uncoupling protein, Diptheria toxin A-chain, BAX, and AtBECLIN1.

(164) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein said desired gene of interest is AtBECLIN1 having SEQ ID NO: 2.

(165) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein said second promoter is constitutive or tissue specific.

(166) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein said second promoter is a constitutive promoter having SEQ ID NO: 4.

(167) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein said terminator is Nos terminator having SEQ ID NO: 3.

(168) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment selected from the group consisting of HY5, HYH, and HFR1.

(169) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment from HFR1.

(170) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein said gene of interest is selected from the group consisting of gusA, GFP, YFP, LUX, nptI, nptII genes.

(171) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein said third tissue specific promoter is tapetum specific promoter having SEQ ID NO: 7.

(172) In an embodiment of the present disclosure, there is provided a transgenic plant as described herein, wherein restorer gene is a mutant COP1 having SEQ ID NO: 8.

(173) In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds comprising a MS DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to AtBECLIN1 having SEQ ID NO: 2, expression of which leads to male sterility in plants, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a Nos terminator having SEQ ID NO: 3, wherein said transgenic plant is male sterile.

(174) In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds comprising a RS DNA construct comprising an expression cassette comprising a third tapetum specific promoter having SEQ ID NO: 7 operably linked to a mutant COP1 having SEQ ID NO: 8, and a Nos terminator having SEQ ID NO: 3, wherein said plant is capable of restoring male sterility.

(175) In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds comprising a RS DNA construct comprising an expression cassette comprising a third tapetum specific promoter having SEQ ID NO: 7 operably linked to a mutant COP1 having SEQ ID NO: 8, and a Nos terminator having SEQ ID NO: 3, wherein said plant is capable of inhibiting expression of a gene of interest.

(176) In an embodiment of the present disclosure, there is provided a transgenic plant or parts thereof, including seeds comprising a ES DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to a gene of interest, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a Nos terminator having SEQ ID NO: 3, wherein said plant is capable of expression of a gene of interest.

(177) In an embodiment of the present disclosure, there is provided a method of obtaining a transgenic plant or parts thereof, including seeds, wherein said plant is male sterile, said method comprising: (a) obtaining a MS DNA construct as described herein; or a recombinant host cell comprising a MS DNA construct as described herein; (b) transforming plant cells with said MS DNA construct or said recombinant host cell to obtain transformed cells; and (c) selecting and regenerating transformed cells to obtain transgenic plant or parts thereof, including seeds, wherein said plant is male sterile.

(178) In an embodiment of the present disclosure, there is provided a method of obtaining a transgenic plant or parts thereof, including seeds, wherein said plant is capable of restoring male sterility, said method comprising: (a) obtaining a RS DNA construct as described herein; or a recombinant host cell comprising a RS DNA construct as described herein; (b) transforming plant cells with said RS DNA construct or said recombinant host cell to obtain transformed cells; and (c) selecting and regenerating transformed cells to obtain transgenic plant or parts thereof, including seeds, wherein said plant is capable of restoring male sterility.

(179) In an embodiment of the present disclosure, there is provided a method of obtaining a transgenic plant or parts thereof, including seeds, wherein said plant is capable of expression of a gene of interest, said method comprising: (a) obtaining a ES DNA construct as described herein; or a recombinant host cell comprising a ES DNA construct as described herein; (b) transforming plant cells with said ES DNA construct or said recombinant host cell to obtain transformed cells; and (c) selecting and regenerating transformed cells to obtain transgenic plant or parts thereof, including seeds, wherein said plant is capable of expression of a gene of interest.

(180) In an embodiment of the present disclosure, there is provided a method of obtaining a transgenic plant or parts thereof, including seeds, wherein said plant is capable of inhibiting expression of a gene of interest, said method comprising: (a) obtaining a RS DNA construct as described herein; or a recombinant host cell comprising a RS DNA construct as described herein; (b) transforming plant cells with said RS DNA construct or said recombinant host cell to obtain transformed cells; and (c) selecting and regenerating transformed cells to obtain transgenic plant or parts thereof, including seeds, wherein said plant is capable of inhibiting expression of a gene of interest.

(181) In an embodiment of the present disclosure, there is provided a method of obtaining a transgenic plant as described herein, wherein transformation of plant cells is carried out by any method known to a person skilled in the art.

(182) In an embodiment of the present disclosure, there is provided a method of obtaining a transgenic plant as described herein, wherein transformation of plant cells is carried out by biolistic method.

(183) In an embodiment of the present disclosure, there is provided a method of obtaining a transgenic plant as described herein, wherein transformation of plant cells is carried out by Agorbacterium mediated method.

(184) In an embodiment of the present disclosure, there is provided a hybrid plant or parts thereof, including seeds comprising a MS DNA construct and a RS DNA construct.

(185) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said MS DNA construct comprises: (a) a first expression cassette comprising a first tissue specific promoter operably linked to a desired gene of interest, expression of which leads to male sterility in plants, and a terminator; and (b) a second regulatory cassette comprising a second promoter operably linked to a fragment encoding a fusion peptide of N-terminal fragment of a transcription factor and TBPm3 having SEQ ID NO: 6, and a terminator.

(186) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said RS DNA construct comprises an expression cassette comprising a third issue specific promoter operably linked to a restorer gene, and a terminator.

(187) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said first tissue specific promoter is tapetum specific promoter TA29 having SEQ ID NO: 1.

(188) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said desired gene of interest is selected from the group consisting of BARNASE, RNase, T-I, Mammalian uncoupling protein, Diptheria toxin A-chain, BAX, and AtBECLIN1.

(189) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said desired gene of interest is AtBECLIN1 having SEQ ID NO: 2.

(190) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said second promoter is constitutive or tissue specific.

(191) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said second promoter is a constitutive promoter having SEQ ID NO: 4.

(192) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said terminator is Nos terminator having SEQ ID NO: 3.

(193) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment selected from the group consisting of HY5, HYH, and HFR1.

(194) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said N-terminal fragment of a transcription factor is a 131 amino acid long fragment from HFR1.

(195) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said third tissue specific promoter is tapetum specific promoter having SEQ ID NO: 7.

(196) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said restorer gene is a mutant COP1 having SEQ ID NO: 8.

(197) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said MS DNA construct comprises: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to AtBECLIN1 having SEQ ID NO: 2, expression of which leads to male sterility in plants, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a Nos terminator having SEQ ID NO: 3.

(198) In an embodiment of the present disclosure, there is provided a hybrid plant as described herein, wherein said RS DNA construct comprises a third tapetum specific promoter having SEQ ID NO: 7 operably linked to a mutant COP1 having SEQ ID NO: 8, and a Nos terminator having SEQ ID NO: 3.

(199) In an embodiment of the present disclosure, there is provided a hybrid plant or pars thereof, including seeds, comprising a MS DNA construct comprising: (a) a first expression cassette comprising a first tapetum specific promoter TA29 having SEQ ID NO: 1 operably linked to AtBECLIN1 having SEQ ID NO: 2, expression of which leads to male sterility in plants, and a Nos terminator having SEQ ID NO: 3; and (b) a second regulatory cassette comprising a second constitutive promoter having SEQ ID NO: 4 operably linked to a fragment encoding a fusion peptide of 131 amino acid long fragment from HFR1 and TBPm3 having SEQ ID NO: 6, and a Nos terminator having SEQ ID NO: 3; and a RS DNA construct comprising a third tapetum specific promoter having SEQ ID NO: 7 operably linked to a mutant COP1 having SEQ ID NO: 8, and a Nos terminator having SEQ ID NO: 3.

(200) In an embodiment of the present disclosure, there is provided a method of obtaining a hybrid plant or parts thereof, including seeds, said method comprising: (a) obtaining a female of a male sterile transgenic plant as described herein; (b) obtaining a male of a transgenic plant capable of restoring male sterility as described herein; (c) crossing said female and male plant; (d) obtaining hybrid seeds from said female plant of step (c), which comprises a MS DNA construct as described herein and RS DNA construct as described herein, wherein in said seeds, male fertility is restored.

(201) In an embodiment of the present disclosure, there is provided a method of obtaining a hybrid plant or parts thereof, including seeds, said method comprising: (a) obtaining a female of a male sterile transgenic plant as described herein; (b) obtaining a male of a transgenic plant capable of restoring male sterility as described herein; (c) crossing said female and male plant; (d) obtaining hybrid seeds from said female plant of step (c); and (e) developing said hybrid seeds into plants which comprise a MS DNA construct as described herein and RS DNA construct as described herein, wherein in said plants, male sterility is restored.

(202) In an embodiment of the present disclosure, there is provided a method of switching off expression of a gene of interest in a F1 population of plants or parts thereof, including seeds, said method comprising: (a) obtaining a female of a transgenic plant comprising a ES DNA construct as described herein, wherein said plant is capable of expressing a gene of interest; (b) obtaining a male of a transgenic plant comprising a RS DNA construct as described herein, wherein said plant is capable of inhibiting expression of a gene of interest; (c) crossing said female and male plant; (d) obtaining hybrid seeds from said female plant of step (c), wherein said hybrid seeds comprise a ES DNA construct as described herein and RS DNA construct as described herein, and does not expression said gene of interest.

(203) In an embodiment of the present disclosure, there is provided a method of switching off expression of a gene of interest in a F1 population of plants or parts thereof, including seeds, said method comprising: (a) obtaining a female of a transgenic plant comprising a ES DNA construct as described herein, wherein said plant is capable of expressing a gene of interest; (b) obtaining a male of a transgenic plant comprising a RS DNA construct as described herein, wherein said plant is capable of inhibiting expression of a gene of interest; (c) crossing said female and male plant; (d) obtaining hybrid seeds from said female plant of step (c); (d) developing said hybrid seeds into hybrid plants which comprise a ES DNA construct as described herein and RS DNA construct as described herein, and does not expression said gene of interest.

(204) In an embodiment of the present disclosure, there is provided a MS DNA construct as described herein, for use in making transgenic plants.

(205) In an embodiment of the present disclosure, there is provided a ES DNA construct as described herein, for use in making transgenic plants.

(206) In an embodiment of the present disclosure, there is provided a RS DNA construct as described herein, for use in making transgenic plants.

(207) In an embodiment of the present disclosure, there is provided a reversible expression system as described herein, for use in making transgenic plants.

(208) Although the subject matter has been described in considerable detail with reference to certain preferred embodiments thereof, other embodiments are possible.

EXAMPLES

(209) The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary.

(210) Primer details, DNA sequence details, and further details of experiments as disclosed in the instant specification may be found in Singh, S. P. et. al., A novel male sterility-fertility restoration system in plants for hybrid seed production. Sci. Rep. 5, 11274; doi: 10.1038/srep11274 (2015).

Example 1

(211) Isolation of a cDNA Encoding Beclin1 from Arabidopsis

(212) Arabidopsis thaliana ecotype Columbia (Col-0) seedlings were taken and Total RNA was isolated by Plant spectrum Total RNA isolation kit (Sigma-aldrich). The quality of RNA was checked by visualizing the rRNA in ethedium bromide-coloured agarose gel under UV light. Twenty micrograms of total RNA was used in cDNA preparation using SuperScriprt Reverse Transcriptase kit (Invitrogen) following the manufacturer's instructions. The cDNA was used as template to amplify plant COP1 gene by using one set of primers, COP1_FP 5 ccg ctc gag atg gaa gag att tcg acg gat cc3 (SEQ ID NO: 26) and COP1_RP 5cga gct ctc acg cag cga gta cca gaa ctt 3 (SEQ ID NO: 27). The PCR reaction consisted of 30 cycles 94 C. for 30 sec, 58 C. for 30 sec and 72 C. for 120 sec. The PCR product of 2.0 kb was cloned in pBluescript SK+ vector (Stratagene, La Jolla, Calif.). Nucleotide sequence of the cloned PCR product was determined by using Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Sequence homology was analyzed using BLAST program.

Example 2

(213) Isolation of a cDNA Encoding COP1 from Arabidopsis

(214) Arabidopsis thaliana ecotype Columbia (Col-0) seedlings were taken and Total RNA was isolated by Plant spectrum Total RNA isolation kit (Sigma-aldrich). The quality of RNA was checked by visualizing the rRNA in ethedium bromide-coloured agarose gel under UV light. Twenty micrograms of total RNA was used in cDNA preparation using SuperScript Reverse Transcriptase kit (Invitrogen) following the manufacturer's instructions. The cDNA was used as template to amplify plant COP1 gene by using one set of primers, COP1_FP 5ccg ctc gag atg gaa gag att tcg acg gat cc3 and COP1 RP 5cga gct etc acg cag cga gta cca gaa ctt 3. The PCR reaction consisted of 30 cycles 94 C. for 30 sec, 58 C. for 30 sec and 72 C. for 120 sec. The PCR product of 2.0 kb was cloned in pBluescript SK+ vector (Stratagene, La Jolla, Calif.). Nucleotide sequence of the cloned PCR product was determined by using Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Sequence homology was analyzed using BLAST program.

Example 3

(215) Site Directed Mutagenesis in COP1 to Form COP1.sup.L105A

(216) Site directed mutagenesis PCR was performed using QuikChange XL Kit (Stratagene) according to the manufacture's instruction. 51TTCGCGGCCGATAAGGCAGCGAAG 3 (SEQ ID NO: 10) mutation was introduced in the 5 TTCTTGCTCGATAAGCTATTGAAG 3 (SEQ ID NO: 11) region of COP1 gene by using two set of primers COPM_f1 5GCT TTA CCC TAA TTT CGC GGC CCG ATA AGC TAT TGA AGA AAA CTT C 3 (SEQ ID NO: 12), COPM_ r1 5GTT TTC TTC AAT AGC TTA TCG GCC_GCG AAA TTA GGG TAA AGC TG 3 (SEQ ID NO: 13) and COPM_f2 5 TAA TTT CTT GCT CGA TAA GGC AGC GAA GAA AAC TTC AGC TCG GC 3 (SEQ ID NO: 14), COPM_r2 5 CGA GCT GAA GTT TTC TTC GCT GCC TTA TCG AGC AAG AAA TTA GG 3 (SEQ ID NO: 15) primers, Clones were screened by DNA sequencing for the desired mutation using T3 and T7 primers.

Example 4

(217) Isolation of a cDNA Encoding HFR1.sub.n-131 from Arabidopsis

(218) Arabidopsis thaliana ecotype Columbia (Col-0) seedlings were taken and Total RNA was isolated by Plant spectrum Total RNA isolation kit (Sigma-aldrich), The quality of RNA was checked by visualizing the rRNA in ethedium bromide-coloured agarose gel under UV light. Twenty micrograms of total RNA was used in cDNA preparation using SuperScript Reverse Transcriptase kit (Invitrogen) following the manufacturer's instructions. The cDNA was used as template to amplify only 131 amino acid N-terminus fragment of plant HFR1 coding gene by using one set of primers, HfrI_F1 5cca tcg ata tgt cga ata atc aag ctt tca tgg 3 (SEQ ID NO. 28) and 5cca tcg att ctt gta aac tcc tcc gat tca tc3 (SEQ ID NO: 29). The PCR reaction consisted of 30 cycles 94 C. for 30 sec, 58 C. for 30 sec and 72 C. for 30 sec. The PCR product of 0.4 kb was cloned in pBluescript SK+ vector (Stratagene, La Jolla, Calif.). Nucleotide sequence of the cloned PCR product was determined by using Big Dye Terminator v3,1 Cycle Sequencing Kit (Applied Biosystems). Sequence homology was analyzed using BLAST program.

Example 5

(219) Construction of Chimeric Gene Fusions

(220) Construction of expression module (em), Construct 1 (FIG. 1A): An early stage, tapetum specific 1 kb BamH1/Xba1 promoter was fused with 1.8 kb Xba1/Sac1 gusA gene and 250 bp Sac1/EcoR1 Nos terminator in BamH1/EcoR1 Sk+ Cloning vector. In second Sk+ Cloning vector 0.4 kb SalI/ClaI promoter Pcec was fused with 0.4 kb ClaI/ClaI HFR1.sup.n-131 and 0.6 kb ClaI/SacI TBPm3 genes and 250 bp Sac1/EcoR1 Nos terminator in Sal1/EcoR1 Sk+ Cloning vector. First expression fragment (TA29(m):gusA:Tnos) was isolated with BamH1/SalI site and second fragment (Pcec:HFR1.sup.n-131:TBPm3:Tnos) with SalI/EcoRI were triple ligated into BamH1/EcoRI cleaved binary vector pBI101. The resultant pBI101 carrying the expression cassette was transformed into Agrobacterium tumefaciens strain LBA4404 following the modified protocol (Cangelosi et al., 1991).

(221) Construction of Male sterility module (ms), Construct 2 (FIG. 1B): An early stage, tapetum specific 1 kb BamH1/Xba1 promoter was fused with 1.5 kb Xba1/Sac1 Beclin1 gene and 250 bp Sac1/EcoR1 Nos terminator in BamH1/EcoR1 Sk+ Cloning vector. In second Sk+ Cloning vector 0.4 kb SalI/ClaI promoter Pcec was fused with 0.4 kb ClaI/ClaI HFR1.sup.n-131 and 0.6 kb ClaI/SacI TBPm3 genes and 250 bp Sac1/EcoR1 Nos terminator in Sal1/EcoR1 Sk+ Cloning vector. First expression fragment (TA29(m):Beclin1:Tnos) was isolated with BamH1/SalI site and second fragment (Pcec:HFR1.sup.n-131:TBPm3:Tnos) with SalI/EcoRI were triple ligated into BamH1/EcoRI cleaved binary vector pBI101. The resultant pBI101 carrying the expression cassette was into Agrobacterium tumefaciens strain LBA4404 following the modified protocol (Cangelosi et al., 1991).

(222) Construction of restoration module (rs), Construct 3(FIG. 1C): Arabidopsis tapetum specific promoter A9 1.5 kb SalI/ClaI was fused with 2.0 kb ClaI/SacI plant COP1.sup.L105A gene and 250 bp Sac1/EcoRI Nos terminator in SalI/EcoRI Sk+ Cloning vector. pCAMBIA1300 binary vector was modified by replacing CaMV35S promoter by XhoI/BstXI Pnos promoter. The expression cassette (A9: COP1L105A: Tnos) SalI/EcoRI was subcloned in binary vector Modified pCAMBIA1300 SalI/EcoRI. The resultant pBI101 carrying the expression cassette was into Agrobacterium tumefaciens strain LBA4404 following the modified protocol (Cangelosi et al., 1991).

Example 6

(223) Transformation of Tobacco Plants

(224) As described in Example 4, recombinant Agrobacterium tumefaciens carrying the expression cassette was used for transformation of Nicotina tabacum cv. Petit Havana by protocol as described by Horsch et al., in 1985.

(225) In short a single isolated colony of A. tumefaciens LBA 4404 harboring binary vector with above described expression cassettes was inoculated in YEP medium containing antibiotics streptomycin (250 g/ml) rifampicin (50 g/ml) and kanamycin (100 g/ml) and grown (200 rpm, overnight, 28 C.). Fifty micro liters of the overnight culture was diluted to 100 ml in YEP medium and grown till OD.sub.600 reached to 0.8. Cells were recovered by centrifugation in SS34 rotor (5,000 rpm, 10 min, 4 C.). The pellet was suspended in co-cultivation medium (MS salts, 2% glucose, 10 mM MES and 100 mM acetosyrengone, pH 5.6) to OD.sub.600 0.6. Tobacco leaf discs were co-cultivated with A. tumefaciens for two days in dark. After co-cultivation, the leaf discs were transferred to regeneration medium supplemented with cefotaxime (250 g/ml) and kanamycin (100 g/ml). The culture was incubated at 25 with 16 hrs light and 8 hrs dark cycle for a period of four weeks. After this, the transgenic shoots were harvested and transferred to rooting medium containing kanamycin (50 g/ml). After incubation for 2-4 weeks, the putative transgenic plantlets were transferred to Hoagland solution for acclimatization and then transferred to vermiculite for hardening for three weeks. The plants were transferred from vermiculite to soil in glasshouse. Independent transgenic lines were developed for the expression cassette (chimeric gene fusion).

(226) The same method was deployed for all three constructs.

Example 7

(227) Analysis of Transgenic Lines for Transgene Integration

(228) Genomic DNA of the transgenic lines and control plant was isolated by CTAB method of DNA extraction.

(229) Analysis of transgenics; The genomic DNA was used as template to amplify a fragment of 2.5 kb comprising TA29 promoter and plant Beclin 1 gene by using one set of primers, 5cgc gga tcc aga tct tcc aac att tact cc aag gg 3 (SEQ ID NO: 30) and 5cgt cga gct cct aag ttt ttt tac atg aag gct ta 3 (SEQ ID NO: 31). The PCR reaction consisted of 94 C.; for 4 min, 94 C. for 1 min, 60 C. for 1 min and 72 C. for 2 min, Go to 2 for 30 cycles 72 C. for 5 min. The desired band of 2.5 kb was obtained in the PCR of transgenic lines and positive control but not in control plants and negative control (without template). This experiment was repeated for three times for conformation.

(230) Analysis of es transgenics; The genomic DNA was used as template to amplify a fragment of 1.67kb using Pcec_FP 5 -AAGGGCCTCGGTAATACCATTG-3 (SEQ ID NO: 16) and Tnos_RP 5-CCATCGATCTAGTAACATAGATGACAC-3 (SEQ ID NO: 7. The PCR reaction consisted of 94 C. for 4 min, 94 C. for 1 min, 58 C. for 2 min and 72 C. for 2 min. Go to 2 for 30 cycles 72 C. for 5 min. The desired band of 1.67kb was obtained in the PCR of transgenic lines and positive control but not in control plants and negative control (without template). This experiment was repeated for three times for conformation.

(231) Analysis of rs transgenics; The genomic DNA was used as template to amplify a fragment of 3.5kb using A9_FP 5-ACGCGTCGACTCTAGACATAAGGTGAGAGTTAA-3(SEQ ID NO: 18) and COP9 RP 5CGAGCTCTCACGCAGCGAGTACCAGAACTT-3 (SEQ II) NO: 19). The PCR reaction consisted of 94 C. for 4 min, 94 C. for 1 min, 61 C. for 1 min and 72 C. for 3 min, Go to 2 for 30 cycles 72 C. for 5 min. The desired band of 3.5kb was obtained in the PCR of transgenic lines and positive control but not in control plants and negative control (without template). This experiment was repeated for three times for conformation.

Example 8

(232) Analysis of Expression Module (es) Transgenic

(233) Transgenic of expression module (TA.sub.29 (TGTA)-gusA-Tnos-Pcec-HFR1.sup.n-131-TBPm3-Tnos) was analyzing at maturity.

(234) Fluorometric GUS assay; The anthers of developmental stage 3 and stage 4 were collected and florimetric GUS assay was performed. The anthers of one flower bud (16-20 mg) were crushed in liquid nitrogen, suspended in 0.180 ml of GUS extraction buffer (50 mM Na.sub.2HPO.sub.4 pH-7.0, 10 mM DTT, 1 mM EDTA, 0.1% SLS, 0.1% Triton X-100) and transferred to 1.5 ml eppendorf tubes. Whole procedure here after was done at 4 C. Cellular debris was pelleted by centrifugating the samples at 13,000 rpm for 20 min, and the supernatant were transferred into fresh tubes. 9 l of extract was mixed with 1 l of 10GUS assay buffer (MUG suspended in GUS extraction buffer) in fresh tubes and mixed by pipeting. The tubes were covered to protect from light and incubated at 37 C. for 1 h. After the incubation period the reaction was stopped by adding 90 l of 0.2 M sodium carbonate solution. The tubes were mixed properly by vortexing for few seconds. Relative fluorescence of MU was recorded using Perkin Elmer Spectrofluorometer with an excitation at 365 nm and emission at 455 nm. Total soluble protein in anther extract was quantified, using the Bio-Rad dye.

(235) Histochemical GUS analysis; The anther of developmental stage 3 was collected and histochemical GUS analysis was performed. Whole anthers of stage 3 were placed in a 50 mM 5-bromo-4-chloro-3-indolylglucuronide (X-Gluc) solution (50 mM sodium phosphate buffer pH7, 0.2% Triton X100, 3 mM potassium ferricyanide, 3 mM potassium ferrocyanide, 20% methanol) and vacuum infiltrated at 200 mm Hg for 5 minute, three times with the interval of 15 minutes. Then incubate for overnight. Stained anthers were fixed overnight in 4% paraformaldehyde Fixative at 4 C. Fixed anthers were dehydrated in ethanol series 50%, 70%, 85%, 95% and 100% for 1 h each. Infiltration was done in 2:1, 1:1 and 1:0 of (ethanol: infiltration solution) for 1 h each and embedded in resin (JB-4 Embedding Kit, Polysciences Inc. Eppelheim, Germany). 12-M thick sections were cut using Leica microtome and pictures were captured using Leica microscope.

(236) Crossing; ES transgenic were crossed with RS (ES()xRS()). The resultant F1 seeds were collected and sown on kanamycin (100 g/ml) and hygromycin (50 g/ml). Germinated seedlings were transferred on the soil to raise F1 plants.

(237) F1 analysis; The anther of stage 3 and stage 4 were collected and histochemical and fluoremertric gus assay was performed as described above. Leaf, root, bud and stem were also taken for the analysis to check the specificity of the expression to anther tapetum.

Example 9

(238) Analysis of Transgenic (MS) for Male Sterility and Restored Fertility of F1 Hybrid

(239) The transgenic plants grew well to visible maturity and showed normal flowering. Expression of the autophagy gene in anthers did not lead any morphological abnormalities except nonviable pollens and defected seed setting.

(240) Pollen viability assay was performed using double stain Fluorescein diacetate (FDA) and propedium iodide (PI). 2 mg/ml FDA solution was made in acetone in darkness. 10% sucrose solution was added drop by drop until FDA solution turn milky. PI of 1 mg/ml in final volume was added in the working FDA. Pollen from Control (NTPH), 1370 transgenic lines and F1 lines (1370()1373()) were incubated in for 5 min. followed by 3 washes in PBS. Pollens were collected by centrifuge and mounted on slowfade antifade (invitrogen) and observed under confocal microscope (LSM510META, CarlZeiss) using FDA (excitation 495 emission 519) and PI (excitation 536 emission 617). Viable pollen stained with FDA while aborted pollen was stained with PI. % of pollen viability was calculated by counting FDA/PI stained pollen in unit area (n=10).

(241) Pollen germination assay; In vitro pollen germination test was performed by using a liquid medium consisting of 10% Sucrose, 0.1 mg/ml Boric acid, 0.3 mg/ml Calcium nitrate, 0.2 mg/ml Magnesium sulphate, 0.1 mg/ml Potassium nitrate (Kwack, 1964). A droplet of pollen germination medium was deposited over pollen sample on a slide. The slide was placed in a petriplate over folded foil in such a position that the droplet along with pollen should hang. A wet filter paper was placed at the base of the petriplate to maintain some humidity around the germinating pollen. Data of pollen germination was recorded after 6 hours.

(242) Seed setting was observed after bagging the inflorescence before anthesis of flowers.

Example 10

(243) Real Time PCR Analysis

(244) Different developmental stages (S1-S6) of anther of MS, RS and F1plants were taken and Total RNA was isolated by Plant spectrum Total RNA isolation kit (Sigma aldrich). The quality of RNA was checked by visualizing the rRNA in ethedium bromide-coloured agarose gel under UV light. Two micrograms of total RNA was used in cDNA preparation using SuperScript Reverse Transcriptase kit (Invitrogen) following the manufacturer's instructions. qRT-PCR of COP1 was performed by using primer COP1RT_F 5 AAGCGGCGGTTCTGAGATT3 (SEQ ID NO: 20) COP1R 5ACCACAAGCCGTGAGGAAAG3 (SEQ ID NO: 20 and BECLIN1 by using AtBECLIN 1 forward 5AGGGCATTCCTCCACGTC3 (SEQ ID NO: 22) and reverse primer 5 AAGAGACA GATTGTGAGAACCACCA 3 (SEQ ID NO: 23) on AB I prism 7700 sequence detection system (Applied Biosystem, Foster city, CA, USA, http://www.appliedbiosystems.com). The AtBECLIN1 transcript was normalized with respect to ubiquitin transcript as internal control. For ubiquitin, primers (UbiF) 5CCACGGAGACGGAGGACAA3(SEQ ID NO: 24) and (UbiR) 5GAAGCA GCTCGAGGATGGAA 3(SEQ ID NO: 25) were used. The real time PCR mixture with reaction volume 20 l contained 10 l of Sybr green master mix, 1 l cDNA and 5 pmoles each of primers.

(245) TABLE-US-00001 SEQUENCELISTING <110> CouncilofScientificandIndustrialResearch <120> Novelreversibleexpressionsystemfortransgeneexpressionin plants <130> NA <160> 9 <170> PatentInversion3.5 <210> 1 <211> 1021 <212> DNA <213> Nicotianatabacum <400> 1 cgcggatccagatcttccaacaccatttactccaagggcactgtagtaaaaaaataatta 60 aatcatttttgaaatctaaaaaactcacttattttggaccataaaaaaagggccaaaaaa 120 taacttattgtggaccggagagagtaatacactttttggttagcgaatgcaattaattta 180 gacattgtgttatgttccagttaaccgcttccctgcacttctttcaatctatctctcgat 240 agaaaattgtgatactttgcgacttctatcagaggactttttgttttccatgtaacaatc 300 tgtcattttcgatggggagatttgcacaaataggctatttatgtgtcccaatttaaattt 360 taaccccatgtcgatcagaacttagccacgagcaccagaagtttgatggatatgtgactt 420 tgtcactatccggtttactaatcaagagctatttttattcaaaattggatatctagctaa 480 gtataactggataatttgcattaacagattgaatatagtgccaaacaagaagggacaatt 540 gacttgtcactttatgaaagatgattcaaacatgattttttatgtactaacatatacatc 600 ctactcgaattaaagcgacataggctcgaagtatgcacatttagcaatgtaaattaaatc 660 agtttttgaatcaagctaaaagcagacttgcataaggtgggtggctggactagaataaac 720 atcttctctagcacagcttcataatgtaatttccataactgaaatcagggtgagacaaaa 780 ttttggtactttttcctcacactaagtccatgtttgcaacaaattaatacatgaaacctt 840 aatgttaccctcagattagcctgctactccccattttcctcgaaatgctccaacaaaagt 900 tagttttgcaagttgttgtgtatgtcttgtgctctatatatgcccttgtggtgcaagtgt 960 aacagtacaacatcatcactcaaatcaaagtttttacttaaagaaattagctaaatctag 1020 a 1021 <210> 2 <211> 1554 <212> DNA <213> Arabidopsisthaliana <400> 2 atgaggaaagaggagattccagataaaagtcggactatcccgatcgatccgaatctgccg 60 aaatgggtctgccaaaactgtcaccactcccttaccatcgtcggcgtcgattcctacgcc 120 ggcaagttcttcaacgatccccctccgtccgctacgcagggctcatctatccatggagct 180 aacagtgttcttggttcaacacgcatggacaactcttttgttgttttacctcgacataag 240 cctcctcaatctcagggcattcctccacgtcctcgcggggcgtcctcacctcagcctgat 300 gctactcaatctggaaaggcgatggaggaatcgtttgtagttgtctataagtctgagcct 360 gtttctgattctggtggttctcacaatctgtctcttgaagtgggccaaaacggtccctta 420 cattcaaatacttctggctttaatgcgactatcaatgtcttaactcgtgcttttgatatt 480 gctagaactcagacacaggttgaacagccattgtgcttagaatgcatgagggtattgtct 540 gataaacttgaaaaagaagtcgaggatgtgacgagggacgtggaagcatacgaagcatgc 600 gttcagaggttagaaggagagacgcaagatgttcttagtgaagctgattttctcaaggaa 660 aagaagaagattgaggaagaagaaagaaaacttgttgcagctatagaagaaacagagaaa 720 caaaatgctgaagtaaaccatcaactgaaggagctagaattcaagggaaatcgttttaac 780 gaacttgaagatcggtattggcaagagttcaataattttcagtttcaattaattgcccat 840 caggaagagagagatgcaatcttggcaaagattgaagtttcacaagcacatttagagtta 900 ttaaataagacaaatgtacttattgatgccttccccatacggaatgatggggaatttggt 960 acaattaacaattttcgacttggaagactccctgccataaaagttgagtgggatgagatc 1020 aatgctgcttggggccaagcctgtcttctcctccatacgatgtgtaactatttccggcca 1080 aagtttcaatgtcaagttaaaatacagccgatggggagttatcctagaattgtagacagc 1140 aacaacgaaacttatgagctgtttggtcctgttaacttgttttggagcactcggtacgat 1200 aaagccatgacactgtatttgatgtgtcttaaagactttgctgattttgcaaattcaaag 1260 gaccaagagaacaatattccaccagataattgcctcaaccttccatacaagatcgaaaag 1320 gacaaagtattggggtattcaataacacagagcttcaacaagcaagagagttggaccaaa 1380 gcactaaagtatactctctgcaacctcaaatgggctctctactggttcgttggaaacact 1440 aatttccaacctctctctgcgacggtctctctgccttctaatatatcagcggctggttcc 1500 ttgtacgccaagcgaggtcctgactctagtaagccttcatgtaaaaaaacttag 1554 <210> 3 <211> 277 <212> DNA <213> plasmid <400> 3 gagctcgaatttccccgatcgttcaaacatttggcaataaagtttcttaagattgaatcc 60 tgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaat 120 aattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgca 180 attatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatc 240 gcgcgcggtgtcatctatgttactagatcgggaattc 277 <210> 4 <211> 450 <212> DNA <213> Promoter <400> 4 gtcgaccatcatttgaaagggcctcggtaataccattgtggaaaaagttggtaatacgga 60 aaaagaagattcatcatccagaaaaggtgtggaaaagttgtggattgcgtggaaaaagtt 120 cgatctgaccatctctagatcgtggaaaaagttcacgtaagcgcttacgtacatatgtgg 180 attgtggaaaaagaagacggaggcatcggtggaaaaagaagcttgtacgctgtacgctga 240 cgatagatagatacacgtgcacgcgtccacttgacgcacaattgacgcacaatgacgcca 300 cttgacgctacttcactatatataggaagttcatttcatttggaatggacacgtgttgtc 360 atttctcaacaattaccaacaacaacaaacaacaaacaacattatacaattactatttac 420 aattacatctagataaacaatggcttcctc 450 <210> 5 <211> 393 <212> DNA <213> Arabidopsisthaliana <400> 5 atgtcgaataatcaagctttcatggaattgggatggagaaacgacgtcggatcacttgct 60 gtgaaagatcagggcatgatgtcagaaagagcaagaagtgatgaagatcgtctaatcaac 120 ggtctaaaatggggctacggctactttgatcatgatcaaactgataattatcttcagatt 180 gttccagagattcataaagaagtagaaaatgcgaaggaggatttattggttgttgtccct 240 gatgaacattctgaaactgatgatcatcatcatattaaagatttttcagagagatcagat 300 catcgattttatctgagaaacaaacatgagaaccccaaaaaacgtcgtatccaggtctta 360 agtagtgatgatgaatcggaggagtttacaaga 393 <210> 6 <211> 603 <212> DNA <213> Arabidopsisthaliana <400> 6 atgactgatcaaggattggaagggagtaatccagttgatcttagcaagcatccttcaggg 60 attgttcctactcttcaaaacattgtctccacggtgaacttagactgcaagctagatctt 120 aaagccatagctttgcaggctcggaatgctgaatataatcccaagcgttttgctgcggtg 180 ataatgaggatcagagaaccgaagactacagcattaatattcgcctcagggaaaatggtc 240 tgtactggagctaagagcgaggacttttcgaagatggctgctagaaagtatgctaggatt 300 gtgcagaaattgggattccctgcaaaattcaaggatttcaagattcagaatattgtaggt 360 tcttgtgatgtcaaattccctataagacttgaaggtcttgcttactctcacgctgctttc 420 tcaagttatgagcccgagctcttcccagggctgttttataggatgaaagtcccaaaaatc 480 acccttgtaatctttgtctctgggaagatcgtaataacaggagccaagatgagagatgag 540 acctacaaagcctttgagaatatataccccgtgctctcggaattcagaaagatacagcaa 600 tag 603 <210> 7 <211> 1952 <212> DNA <213> Arabidopsisthaliana <400> 7 tctagacataacggtgagagttaatattaaaatttcaggcgagaaaaatgatacttgaaa 60 aatattatgatcgttttggatattccttacatcgagtgaatgttggtttgattcatcttc 120 caagtgttctgcaaacgtatattaaaggtttattaactggtaagagattaaccgggtttt 180 ggttcagcatataccatgattgactaactgatcaaatagtctttacttattatataaaga 240 cgatactattggtcatgctacaaaatcaagtcataccatatcctgagaatgaatgtggag 300 aatcgttataaggcataagtgtgggtattgatcgtggtacgaacaaccgccttggcatca 360 acattagccacgatatccaacatttgaagcattgcctatggcgagtgtttggttggtttt 420 gaaactgatgatgataaccagaacgagaaatgtcttgtgaagtataatgttccgatgaat 480 tgggattataataatgtgtagacattgtaggttggttttgatgatgataagtaatcattg 540 gagaattgtctaacacatgcactggagaattattgactctaccacgttctctttgatatt 600 cctcgattttcctcgtgatttcatcagcctctccgaaaaagtaattgtatccactagaac 660 tttgggaatctcccatctaatttatgtattagagaagttataatattttggggaaataga 720 ttttctctactgattttgttgtgtgacattatatttttataagtacatgtttctgtttcg 780 ttatattgttgtcgtggttgagtctttattagagcatgtaaatatgtttatgaaataagc 840 gagaaaggaattaattaaacgtatcgagtgataaatgctttaatggattcgagatttagt 900 attcttaaatttttgtttcattatcattgattataaaactaagttatgttgatctcaaat 960 ccttaattatgttctcctaagaagagtacaagtggtgggaacgaaagatgagtaaaatac 1020 taaaaatcttttctcaaaagtcaaatcgcattagttaacaaaaacaaaccatgtgttacc 1080 gtcaaatcaatgtgtttaaaagatgttaaccactaatcaagcatttacgtgtaaccggat 1140 caaccggatttgggttttgaatatgttgtggagatgtatataaatgataaattaattgaa 1200 tatcttaattaatctgtgaaagaaactacatcacacactttgttatttcccctagctttt 1260 agtttttttatcatgcaaaacttatgaagtaactagatcaagatcacaaaaaaaaagcat 1320 cacttcacttcatgacctaattattctcgaagcccaaaactatttacatacacttttatt 1380 ctataaatatagatgatggaattcaccaatccaaaagtgaataaaaaacacaagtacaaa 1440 caatatagtatctaattagaatggtatctctaaagtcccttgctgctattctcgttgcca 1500 tgtttcttgccaccggacctacggttctagcccagcagtgcagagacgaactgagcaatg 1560 tgcaggtgtgcgcgccgctgcttctgcccggtgcggtcaatcctgccgcgaactcaaatt 1620 gctgcgctgccctccaagcaactaacaaagattgtctatgtaaccgtcttcgagcagcca 1680 ccacacttacctctctttgtaacctcccctcttttgattgtggtaagatgatccatcgat 1740 taaaaccttttttactagatttttataaattattccatcaatagtgtttgttttatattt 1800 gttctcatgattttttggacttatgttttgtgaactgtgcaggcataagtgcctagttga 1860 acaacattcagttccgaggatttggggagtttggtctgcaaacgacaagacgaataaaat 1920 aaaataatgagaaatacactatttagtgtttt 1952 <210> 8 <211> 2007 <212> DNA <213> Arabidopsisthaliana <400> 8 atggaagagatttcgacggatccggttgttccagcggtgaaacctgacccgagaacatct 60 tcagttggtgaaggtgctaatcgtcatgaaaatgacgacggaggaagcggcggttctgag 120 attggagcaccggatctggataaagacttgctttgtccgatttgtatgcagattattaaa 180 gatgctttcctcacggcttgtggtcatagtttctgctatatgtgtatcatcacacatctt 240 aggaacaagagtgattgtccctgttgtagccaacacctcaccaataatcagctttaccct 300 aatttcttgctcgataagctattgaagaaaacttcagctcggcatgtgtcaaaaactgca 360 tcgcccttggatcagtttcgggaagcactacaaaggggttgtgatgtgtcaattaaggag 420 gttgataatcttctgacacttcttgcggaaaggaagagaaaaatggaacaggaagaagct 480 gagaggaacatgcagatacttttggactttttgcattgtctaaggaagcaaaaagttgat 540 gaactaaatgaggtgcaaactgatctccagtatattaaagaagatataaatgccgttgag 600 agacatagaatagatttataccgagctagggacagatattctgtaaagttgcggatgctc 660 ggagatgatccaagcacaagaaatgcatggccacatgagaagaaccagattggtttcaac 720 tccaattctctcagcataagaggaggaaattttgtaggcaattatcaaaacaaaaaggta 780 gaggggaaggcacaaggaagctctcatgggctaccaaagaaggatgcgctgagtgggtca 840 gattcgcaaagtttgaatcagtcaactgtctcaatggctagaaagaaacggattcatgct 900 cagttcaatgatttacaagaatgttacctccaaaagcggcgtcagttggcagaccaacca 960 aatagtaaacaagaaaatgataagagtgtagtacggagggaaggctatagcaacggcctt 1020 gcagattttcaatctgtgttgactaccttcactcgctacagtcgtctaagagttatagca 1080 gaaatccggcatggggatatatttcattcagccaacattgtatcaagcatagagtttgat 1140 cgtgatgatgagctgtttgccactgctggtgtttctagatgtataaaggtttttgacttc 1200 tcttcggttgtaaatgaaccagcagatatgcagtgtccgattgtggagatgtcaactcgg 1260 tctaaacttagttgcttgagttggaataagcatgaaaaaaatcacatagcaagcagtgat 1320 tatgaaggaatagtaacagtgtgggatgtaactactaggcagagtcttatggagtatgaa 1380 gagcacgaaaaacgtgcctggagtgttgacttttcacgaacagaaccatcaatgcttgta 1440 tctggtagtgacgactgcaaggttaaagtttggtgcacgaggcaggaagcaagtgtgatt 1500 aatattgatatgaaagcaaacatatgttgtgtcaagtacaatcctggctcaagcaactac 1560 attgcggtcggatcagctgatcatcacatccattattacgatctaagaaacataagccaa 1620 ccacttcatgtcttcagtggacacaagaaagcagtttcctatgttaaatttttgtccaac 1680 aacgagctcgcttctgcgtccacagatagcacactacgcttatgggatgtcaaagacaac 1740 ttgccagttcgaacattcagaggacatactaacgagaagaactttgtgggtctcacagtg 1800 aacagcgagtatctcgcctgtggaagcgagacaaacgaagtatatgtatatcacaaggaa 1860 atcacgagacccgtgacatcgcacagatttggatcgccagacatggacgatgcagaggaa 1920 gaggcaggttcctactttattagtgcggtttgctggaagagtgatagtcccacgatgttg 1980 actgcgaatagtcaaggaaccatcaaa 2007 <210> 9 <211> 307 <212> DNA <213> plasmid <400> 9 gatcatgagcggagaattaagggagtcacgttatgacccccgccgatgacgcgggacaag 60 ccgttttacgtttggaactgacagaaccgcaacgttgaaggagccactcagccgcgggtt 120 tctggagtttaatgagctaagcacatacgtcagaaaccattattgcgcgttcaaaagtcg 180 cctaaggtcactatcagctagcaaatatttcttgtcaaaaatgctccactgacgttccat 240 aaattcccctcggtatccaattagagtctcatattcactctcaatccaaataatctgcac 300 cggatct 307 <210> 38 <211> 21 <212> DNA <213> Propionibacteriumacnes <400> 38 ccggtattagccccagtttcc 21 <210> 39 <211> 19 <212> DNA <213> Gram-vebacterialspecificportionofgyrBgene <400> 39 cggcggcaagttcgacgac 19 <210> 40 <211> 19 <212> DNA <213> Gram-vebacterialspecificportionofgyrBgene <400> 40 ccaccgagacgcccacacc 19 <210> 41 <211> 18 <212> DNA <213> Gram-vebacterialaconitatehydratasegene <400> 41 ccaggtcggcggagaagc 18 <210> 42 <211> 17 <212> DNA <213> Gram-vebacterialaconitatehydratasegene <400> 42 ccaccggcccgatgacc 17 <210> 43 <211> 18 <212> DNA <213> Gram-veribonuclease1gene <400> 43 gccgccctgaccaccttc 18 <210> 44 <211> 19 <212> DNA <213> Gram-veribonuclease1gene <400> 44 gcgggttgttcggcatcag 19 <210> 45 <211> 87 <212> DNA <213> Herpessimplexvirus <400> 45 cgcttggtttcggatgggaggcaactgtgctatccccatcacggtcatggagtacaccga 60 atgctcctacaacaagtctctgggggc 87 <210> 46 <211> 70 <212> DNA <213> Herpessimplexvirus <400> 46 ggcaatcgtgtacgtcgtccgcacatcacagtcgcggcagcgtcatcggcggtaacgcaa 60 gacccccccg 70 <210> 47 <211> 79 <212> DNA <213> Herpessimplexvirus <400> 47 caagctgacggacatttacaaggtccccctggacgggtacggccgcatgaacggccgggg 60 cgtgtttcgcgtgtgggac 79 <210> 48 <211> 72 <212> DNA <213> Cytomegalovirus <400> 48 ttccggctcatggcgttaaccaggtagaaactgtgtgtacagttgcgttgtgcgtaacgt 60 aaaagcagggcg 72 <210> 49 <211> 65 <212> DNA <213> Cytomegalovirus <400> 49 cggcgacgacgacgataaagaatacaaagccgcagtgtcgtccagaggattacgcgacca 60 gattg 65 <210> 50 <211> 68 <212> DNA <213> Cytomegalovirus <400> 50 gggcacgtcctcgcagaaggactccaggtacaccttgacgtactggtcacctatcacctg 60 catcttgg 68 <210> 51 <211> 79 <212> DNA <213> Varicellazoster <400> 51 ggtcttgccggagctggtattaccttaaaactcactaccagtcatttctatccatctgtc 60 tttgtctttcacggaggca 79 <210> 52 <211> 85 <212> DNA <213> Varicellazoster <400> 52 tccatttaacgttgcatcattttgtgttatcatagaactgcgtaaacactcggcaagtaa 60 tacagataactcgctaccggaacgt 85 <210> 53 <211> 70 <212> DNA <213> Adenovirus <400> 53 cgccgccaacatgctctaccctatacccgccaacgctaccaacgtgcccatatccatccc 60 ctcccgcaac 70 <210> 54 <211> 86 <212> DNA <213> Eubacterial16sribosomalRNAgeneregionI <400> 54 tgggctacacacgtgctacaatggtcggtacagagggtcgccaaaccgcgaggtggagct 60 aatctcacaaaaccgatcgtagtccg 86 <210> 55 <211> 86 <212> DNA <213> Eubacterial16sribosomalRNAgeneregionII <400> 55 ggcctaacacatgcaagtcgagcggatgaaaggagcttgctcctggattcagcggcggac 60 gggtgagtaatgcctaggaatctgcc 86 <210> 56 <211> 71 <212> DNA <213> Gram+vebacterialspecificportionof16sribosomalRNAgene <400> 56 acgtcaaatcatcatgcccccttatgacctgggctacacacgtgctacaatggacggtac 60 aaagggctgca 71 <210> 57 <211> 84 <212> DNA <213> Mycobacteriumtuberculosis <400> 57 gcggaacgtgggaccaatacctgggttgggccggctgcttcgggcagcaactcccccggg 60 ttgaagaagaaaatcaccccgtcg 84 <210> 58 <211> 74 <212> DNA <213> Mycobacteriumfortuitum <400> 58 aacttttttgactgccagacacactattgggctttgagacaacaggcccgtgcccctttt 60 ggggggtggcatcc 74 <210> 59 <211> 70 <212> DNA <213> Mycobacteriumchelonae <400> 59 tggttactcgcttggtgaatatgttttataaatcctgtccaccccgtggataggtagtcg 60 gcaaaacgtc 70 <210> 60 <211> 70 <212> DNA <213> Toxoplasmagondii <400> 60 cccctctgctggcgaaaagtgaaattcatgagtatctgtgcaactttggtgtattcgcag 60 attggtcgcc 70 <210> 61 <211> 79 <212> DNA <213> Chlamydiatrachomatis <400> 61 aatcgtatctcgggttaatgttgcatgatgctttatcaaatgacaagcttagatccgttt 60 ctcatacggttttcctcga 79 <210> 62 <211> 68 <212> DNA <213> Fungalspecificportionof28sribosomalRNAgene <400> 62 gctgggactgaggactgcgacgtaagtcaaggatgctggcataatggttatatgccgccc 60 gtcttgaa 68 <210> 63 <211> 77 <212> DNA <213> Propionibacteriumacnes <400> 63 tggcgaacgggtgagtaacacgtgagtaacctgcccttgactttgggataacttcaggaa 60 actggggctaataccgg 77 <210> 64 <211> 68 <212> DNA <213> Gram-vebacterialspecificportionofgyrBgene <400> 64 cggcggcaagttcgacgacaacacctacaaggtgtccggcggcttgcacggtgtgggcgt 60 ctcggtgg 68 <210> 65 <211> 66 <212> DNA <213> Gram-vebacterialaconitatehydratasegene <400> 65 ccaggtcggcggagaagccgaggcaggcgaggtccttcagttcgtcgcgggtcatcgggc 60 cggtgg 66 <210> 66 <211> 64 <212> DNA <213> Gram-veribonuclease1 <400> 66 gccgccctgaccaccttcatcagcctggccggccgttacctggtgctgatgccgaacaac 60 ccgc 64 <210> 67 <211> 45 <212> DNA <213> Herpessimplexvirus <400> 67 gcaactgtgctatccccatcacggtcatggagtacaccgaatgct 45 <210> 68 <211> 30 <212> DNA <213> Herpessimplexvirus <400> 68 cacatcacagtcgcggcagcgtcatcggcg 30 <210> 69 <211> 37 <212> DNA <213> Herpessimplexvirus <400> 69 tccccctggacgggtacggccgcatgaacggccgggg 37 <210> 70 <211> 31 <212> DNA <213> Cytomegalovirus <400> 70 aggtagaaactgtgtgtacagttgcgttgtg 31 <210> 71 <211> 22 <212> DNA <213> Cytomegalovirus <400> 71 aatacaaagccgcagtgtcgtc 22 <210> 72 <211> 26 <212> DNA <213> Cytomegalovirus <400> 72 gactccaggtacaccttgacgtactg 26 <210> 73 <211> 33 <212> DNA <213> Varicellazoster <400> 73 cttaaaactcactaccagtcatttctatccatc 33 <210> 74 <211> 36 <212> DNA <213> Varicellazoster <400> 74 ttatcatagaactgcgtaaacactcggcaagtaata 36 <210> 75 <211> 30 <212> DNA <213> Adenovirus <400> 75 ctatacccgccaacgctaccaacgtgccca 30 <210> 76 <211> 38 <212> DNA <213> Eubacterial16sribosomalgeneregionI <400> 76 tcggtacagagggtcgccaaaccgcgaggtggagctaa 38 <210> 77 <211> 38 <212> DNA <213> Eubacterial16sribosomalgeneregionII <400> 77 ggatgaaaggagcttgctcctggattcagcggcggacg 38 <210> 78 <211> 24 <212> DNA <213> 16sribosomalgeneofgram-positiveorganism <400> 78 gacctgggctacacacgtgctaca 24 <210> 79 <211> 42 <212> DNA <213> Mycobacteriumtuberculosis <400> 79 ctgggttgggccggctgcttcgggcagcaactcccccgggtt 42 <210> 80 <211> 26 <212> DNA <213> Mycobacteriumfortuitum <400> 80 ggctttgagacaacaggcccgtgccc 26 <210> 81 <211> 23 <212> DNA <213> Mycobacteriumchelonae <400> 81 tttataaatcctgtccaccccgt 23 <210> 82 <211> 27 <212> DNA <213> Toxoplasmagondii <400> 82 aaattcatgagtatctgtgcaactttg 27 <210> 83 <211> 32 <212> DNA <213> Chlamydiatrachomatis <400> 83 atgatgctttatcaaatgacaagcttagatcc 32 <210> 84 <211> 25 <212> DNA <213> 28sribosomalRNAgeneoffungi <400> 84 gtaagtcaaggatgctggcataatg 25 <210> 85 <211> 26 <212> DNA <213> Propionibacteriumacnes <400> 85 gcttcagcgccgtcagcgaggataac 26 <210> 86 <211> 30 <212> DNA <213> gyrasegeneofgram-veorganism <400> 86 aacacctacaaggtgtccggcggcttgcac 30 <210> 87 <211> 31 <212> DNA <213> aconitatehydratasegeneofgram-veorganism <400> 87 cgaggcaggcgaggtccttcagttcgtcgcg 31 <210> 88 <211> 27 <212> DNA <213> Ribonucleasegeneofgram-veorganism <400> 88 atcagcctggccggccgttacctggtg 27