PACKAGING MATERIAL AND METHODS OF USING THE SAME
20210061965 ยท 2021-03-04
Assignee
Inventors
Cpc classification
C08L79/08
CHEMISTRY; METALLURGY
A01N41/08
HUMAN NECESSITIES
B32B2379/00
PERFORMING OPERATIONS; TRANSPORTING
C08K5/175
CHEMISTRY; METALLURGY
A01N37/24
HUMAN NECESSITIES
B65D65/466
PERFORMING OPERATIONS; TRANSPORTING
B65D81/28
PERFORMING OPERATIONS; TRANSPORTING
C08K5/0025
CHEMISTRY; METALLURGY
C08L79/08
CHEMISTRY; METALLURGY
C08J2367/04
CHEMISTRY; METALLURGY
B65B25/001
PERFORMING OPERATIONS; TRANSPORTING
B65B25/041
PERFORMING OPERATIONS; TRANSPORTING
B65B25/02
PERFORMING OPERATIONS; TRANSPORTING
A01N37/44
HUMAN NECESSITIES
A01N37/44
HUMAN NECESSITIES
A01N41/08
HUMAN NECESSITIES
C08L67/04
CHEMISTRY; METALLURGY
C08J3/24
CHEMISTRY; METALLURGY
B65D81/24
PERFORMING OPERATIONS; TRANSPORTING
C08J2379/08
CHEMISTRY; METALLURGY
B65B25/067
PERFORMING OPERATIONS; TRANSPORTING
C08K5/175
CHEMISTRY; METALLURGY
B32B2367/00
PERFORMING OPERATIONS; TRANSPORTING
B65B25/062
PERFORMING OPERATIONS; TRANSPORTING
International classification
A01N37/24
HUMAN NECESSITIES
B65D65/46
PERFORMING OPERATIONS; TRANSPORTING
C08J3/24
CHEMISTRY; METALLURGY
C08L79/08
CHEMISTRY; METALLURGY
Abstract
The present disclosure is directed to films. The films can include polyamic acid (PAA). Methods of making and using the film for food product coverings is also included.
Claims
1.-37. (canceled)
38. A film comprising: polyamic acid (PAA); glutaraldehyde (GA); and one or more molecule selected from the group consisting of alanine (A), tryptophan (W), 2-benzoylbenzoyl (BB), Polycaprolactone (PCl), L-Cysteine (C), D-glucosamine (DA), dipropylene glycol (DP), p-aminobenzoic acid (pAB), L-isoleucine (I), p-aminosalicylic acid (pAS), sulfanilic acid (SA), and 5-aminosalicylic acid (5AS).
39. The film of claim 38, wherein the one or more molecule is selected from the group consisting of sulfanilic acid (SA), p-aminosalicylic acid (pAS) and 5-aminosalicylic acid (5AS).
40. The film of claim 38, wherein the one or more molecule is selected from the group consisting of alanine (A), tryptophan (W), 2-benzylbenzoyl (BB), L-Cysteine (C), D-glucosamine (DA), dipropylene glycol (DP), p-aminobenzoic acid (pAB), L-isoleucine (I), p-aminosalicylic acid (pAS), and 5-aminosalicylic acid (5AS).
41. The film of claim 38, wherein the film has a thickness of about 0.02 mm to about 0.12 mm.
42. The film of claim 38, wherein the film has a modulus of elasticity of about 2.2 GPa to about 4.1 GPa.
43. The film of claim 38, wherein the film has a tensile strength of about 59.9 MPa to about 95.1 MPa.
44. The film of claim 38, wherein the film has an antibacterial activity of reducing the number of colony forming units (CFUs) by up to about 90%.
45. The film of claim 44, wherein the antibacterial activity against one or more of gram-positive and gram-negative bacterial species.
46. The film of claim 45, wherein the gram-positive species is Staphylococcus epidermidis and Listeria monocytogenes.
47. The film of claim 45, wherein the gram-negative species is one or more of Escherichia coli, Enterobacter aerogenes, Aeromonas hydrophila, and Citrobacter freundii.
48. The film of claim 38, wherein the film is synthesized from a solvent and does not include any petrochemical material.
49. The film of claim 38, wherein the solvent is ethanol.
50. The film of claim 38, wherein the film further comprises water.
51. The film of claim 38, wherein the film further comprises acetic acid.
52. The film of claim 38, wherein the concentration of GA is between about 0.21% and about 0.35%.
53. The film of claim 38, further comprising one or more of an adipate, a phthalate, a citrate and chitosan.
54. The film of claim 38, further comprising one or more of an oleic acid, a palmitoleic acid, a sapienic acid, a linoleic acid, a nitrile, a polychloroprene, a chlorinated polyethylene, an epichlorohydrin, a sabacate, a terephthalate, a gluterate, and an azelate.
55. A film comprising: polyamic acid (PAA); a cross-linker; and a small molecule, wherein the small molecule is a molecule having a molecular weight of less than about 900 Daltons.
56. The film of claim 55, wherein the cross-linker comprises one or more of glutaraldehyde and carbodiimidazole.
57. The film of claim 55, wherein the small molecule is one or more molecules selected from the group consisting of sulfanilic acid (SA), p-aminosalicylic acid (pAS) and 5-aminosalicylic acid (5AS).
58. The film of claim 55, wherein the small molecule is one or more molecules selected from the group consisting of alanine (A), tryptophan (W), 2-benzylbenzoyl (BB), L-Cysteine (C), D-glucosamine (DA), dipropylene glycol (DP), p-aminobenzoic acid (pAB), L-isoleucine (I), p-aminosalicylic acid (pAS), 5-aminosalicylic acid (5AS).
59. The film of claim 55, wherein the small molecule is one or more molecules selected from the group consisting of alanine (A), tryptophan (W), 2-benzylbenzoyl (BB), Polycaprolactone(PCl), L-Cysteine (C), D-glucosamine (DA), dipropylene glycol (DP), p-aminobenzoic acid (pAB), L-isoleucine (I), p-aminosalicylic acid (pAS), sulfanilic acid (SA), 5-aminosalicylic acid (5AS).
60. The film of claim 55, wherein the film further comprises water.
61. The film of claim 55, wherein the film further comprises acetic acid.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] The file of this application contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
[0013] The present disclosure will be better understood by reference to the following drawings of which:
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
DETAILED DESCRIPTION OF THE DISCLOSURE
[0085] In the discussion and claims herein, the term about indicates that the value listed may be somewhat altered, as long as the alteration does not result in nonconformance of the process or structure to the illustrated embodiment. For example, for some elements the term about can refer to a variation of 0.1%, for other elements, the term about can refer to a variation of 1% or 10%, or any point therein.
[0086] As used herein, the term substantially, or substantial, is equally applicable when used in a negative connotation to refer to the complete or near complete lack of an action, characteristic, property, state, structure, item, or result. For example, a surface that is substantially flat would either completely flat, or so nearly flat that the effect would be the same as if it were completely flat.
[0087] As used herein terms such as a, an and the are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration.
[0088] As used herein, terms defined in the singular are intended to include those terms defined in the plural and vice versa.
[0089] Reference herein to any numerical range expressly includes each numerical value (including fractional numbers and whole numbers) encompassed by that range. To illustrate, reference herein to a range of at least 50 or at least about 50 includes whole numbers of 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, etc., and fractional numbers 50.1, 50.2 50.3, 50.4, 50.5, 50.6, 50.7, 50.8, 50.9, etc. In a further illustration, reference herein to a range of less than 50 or less than about 50 includes whole numbers 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, etc., and fractional numbers 49.9, 49.8, 49.7, 49.6, 49.5, 49.4, 49.3, 49.2, 49.1, 49.0, etc. In yet another illustration, reference herein to a range of from 5 to 10 includes whole numbers of 5, 6, 7, 8, 9, and 10, and fractional numbers 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, etc.
[0090] As used herein, the term film refers to a thermoplastic film made using a film extrusion and/or foaming process, such as a cast film or blown film extrusion process. For the purposes of the present invention, the term includes nonporous films as well as microporous films. Films may be vapor permeable or vapor impermeable, and function as liquid barriers under normal use conditions.
[0091] As used herein, the term thermoplastic refers to polymers of a thermally sensitive material, which flow under the application of heat and/or pressure.
[0092] As used herein, the term polymers includes, but is not limited to, homopolymers, copolymers, such as for example, block, graft, random and alternating copolymers, terpolymers, etc. and blends and modifications thereof. Furthermore, unless otherwise specifically limited, the term polymer shall include all possible geometrical configurations of the material. These configurations include, but are not limited to isotactic, syndiotactic and atactic symmetries.
[0093] Biodegradable Ternary Co-polymers of Conducting Electroactive PAA Membranes hereby referred to as membranes or films. For descriptive purposes, the term membrane has the same definition as that of the term film discussed above.
[0094] Polyamic acid (PAA) is a polymer that has many novel properties. PAA is electroactive, substantially biodegradable and has free carboxyl and amide groups that can act as molecular anchors. PAA can also be used in conjunction with both organic and inorganic solvents due to its substantial chemical resistance. PAA is a generic name of use for the polycondensation product of dianilines and dianhydrides synthesized in anhydrous organic aprotic polar solvents.
[0095] The present disclosure is directed to PAA films and PAA films as food packaging materials that can provide both active-packaging qualities and intelligent-packaging qualities. These PAA films and PAA films as food packaging materials can be formed without any petroleum based or petrochemical ingredient and/or any ingredient formed from a hydrocarbon and/or without an organic solvent.
[0096] The PAA films were created from compositions including biological compounds (e.g. amino acids, sugars) and one or more of intrinsic antimicrobial agents (e.g. sulfanilic acid, p-aminosalicylic acid), and cross-linkers (e.g. glutaraldehyde, carbodiimidazole) in the presence of other substances, for example diamines and dianhydrides. Also, PAA can be further modified into polyimide depending on the processing conditions or employed as stabilizing agents during nanoparticles synthesis.
[0097] H DOSY NMR studies showed that the average molecular weight of PAA films were between about 10.sup.6 and about 107 Da while average molecular weight of regular PAA polymer was about 1.4310.sup.5 Da.
[0098] PAA has advanced mechanical properties in the range of about 2.2-about 2.7 GPa modulus elasticity comparable to strong plastics (2.4 to 3.2 GPa).
[0099] PAA also demonstrates stability in common solvents, high optical transparency, impermeability to gas exchange, oil and water vapor transfer.
[0100]
[0101] Non-crude oil-based plastic PAA films illustrate voltage changes in response to pH change. Showing a trend in response to pH change demonstrates the intelligent properties of the packaging material of the present disclosure, which does not require complicated sensor electronics to indicate food freshness/quality. In the table below, it can be also seen that there is a voltage change in the disclosed films as a function of their thickness.
TABLE-US-00001 TABLE A Membrane Type Thickness [mm] DC Voltage [mV] PAA-A-GA 0.02 0.7 PAA-W-GA 0.02 1.2 PAA-BB-GA 0.02/0.06 0.4/0.4 PAA-PCI-GA 0.06 0.9 PAA-C-GA 0.02 1.8 PAA-DA-GA 0.03 0.1 PAA-PCI-GA 0.06/0.12 0.6/1.1 PAA-W-GA 0.02 2.4 PAA-A-GA 0.05 0.4 PAA-DP-GA 0.05 0.4 PAA-pAB-W-GA 0.06 0.9 PAA-pAB-GA 0.06 0.5/0.4 PAA-A-GA 0.09 0.6
[0102] In Table A PAA: Poly (amic) acid; GA: Glutaraldehyde and the letters in the middle refer to different small molecules such as A-alanine and W-tryptophane. As referred to herein, the term small molecule can refer to any organic molecule having a low molecular weight of less than about 900 Daltons) that may regulate a biological process, with a size on the order of about 1 nm. Type of small molecule and concentration of glutaraldehyde affect voltage of dry PAA membrane's potential, and its behavior against changes as a function of pH and salt concentrations.
[0103] Microbiological tests showed that there was no bacterial development which means that PAA copolymer films developed in connection with the present disclosure worked as a strong active packaging material. As a packaging material, the PAA films can be provided on a roll, the film provided with a predetermined width and a predetermined length. An example of an existing roll of this type would be a roll of Saran Wrap, having a width of about 12 and a length of tens or hundreds of feet. Rolls of the disclosed PAA films can be wider or narrower, and can also be longer or shorter than this example, as desired.
[0104] The disclosed PAA films can be applied so as to cover an entire food product, or a portion thereof. The PAA films can also be provided so as to contact the entire food product or a portion of the food product, or so as to not contact any portion of the food product due to an intervening material or a space between the food product and the PAA film. The disclosed PAA films can be applied by a user and/or the disclosed PAA films can be applied by a packaging device/machine.
[0105] As discussed below, packaged food products did not include color changes or fungal development, this is related to the non-porous nature of PAA film, which did not allow air and water vapor entry. Measured voltage (0.2 mV) did not show any changes which means that there was no food spoilage and decomposition during the tested times.
[0106] The utilization of organic solvents such as ethanol is generally not preferred in the synthesis of PAA since they are nucleophiles and can compete with the dianiline component to attack the dianhydride resources. In the present disclosure, the use of ethanol and even water as part of the solvent system did not show any effect on the formation of the PAA polymer when solid dianhydride was added to an already dissolved dianiline. This represents a major deviation from standard chemistry of PAAs and one that has led to the preparation of a new class of stable polymeric compositions and novel processing procedures as reported here. We however, observed the (
TABLE-US-00002 TABLE B Selection of solvent and formation of viscous PAA solution. Mixture of solvent Observation 50:50 or 35:65 High viscosity, require warning (i.e. 50 C.), DMAC:EtOH resulting in membranes that are strong but limited colors (no blue color obtained) 25:75
Medium viscosity, require warning DMAC:EtOH (i.e. 60 C.), resulting in membranes that are strong, but limited colors 35:50:15 or Medium viscosity, require warning 30:50:20
(i.e. 60 C.), produces membranes with broad DMAC:EtOH:Water range of colors. The color intensity is stronger than those prepared using DMAC. 60:40
Did not form PAA viscous solution but DMAC:Water resulted in yellow precipitate. This did not result in any membrane formation. 60:30:10
Did not form PAA viscous solution but DMAC:Water:AcOH resulted in yellow precipitate. This did not result in any membrane formation. Acetic acid limits the role of GA.
indicates data missing or illegible when filed
[0107] It should be noted that heating was not continuous; rather it was stopped right after PMDA was added to the dissolved 4,4-oxydianiline (ODA). Continuation of heating resulted in highly viscous PAA solution which does not allow membrane formation.
[0108] Another important observation noted here was that the average molecular size of PAA polymers decreased when the solvent system changed from DMAC to DMAC/Ethanol, and further decreases were observed for DMAC/Ethanol/Water system.
[0109] Parameters relating to the synthesis of
(1) Formation of Amorphous, Glassy and Plasticized Membranes
[0110] When pure PAA viscous solution (either from ODA+PMDA or PDA+PMDA) was casted on glass to form membrane, the fate of the membrane was shown to be determined by evaporation mediated solvent elimination and solvent-nonsolvent exchange in coagulation bath.
TABLE-US-00003 TABLE C Effect of evaporation period on PAA membrane preparation Incubation time (h).sup.1 Texture Character <4 h Amorphous Similar to phase inverted PAA membrane in coagulation-bath 4-8 h Glassy The outer surface is shiny, but not totally plasticized. The membrane turns into brittle form within 2 h right after being taken out from the coagulation-bath 6-10 h Mix Mostly the outer layer is fully plasticized while the inner part is amorphous. The membranes are durable, and never turn into a glassy form >12 h Plasticized Plastic-like transparent membrane, durable and flexible. Coagulation-bath doesn't affect appearance of the membrane Incubation time refers to the time-period when membranes were incubated under a hood at 80 rpm/min face-shield. In all cases, the coagulation bath employed was pure-water. .sup.1Thickness and viscosity of the casted PAA solution affected the time requirement, but 12 h or over were enough to obtain plasticized membranes for the casted solutions at up to 2 mm (beyond this point, thicker membranes were not tested) thickness. For thin membranes (e.g. below 50 m), 6 h was enough to obtain fully plasticized membranes. Evaporation of the solvent is the main element determining the fate of the membrane's texture. This is further discussed below. However, the most prominent parameter is the humidity of the surrounding environment. However, pre-heating the casted PAA solution decreases the negative effect of the humidity, which can lead to accelerated removal of DMAC coupled with enhanced GA activity.
(2) Crosslinker Effect on Membrane Formation
[0111] In accordance with the present disclosure, glutaraldehyde (GA) was used as the cross-linker due to the fact that GA provided the most pronounced effect on PAA membrane formation.
TABLE-US-00004 TABLE D Effect of evaporation period on PAA-GA membrane preparation Incubation time (h).sup.1 Texture Character <2 h Amorphous Similar to phase inverted PAA membrane in coagulation-bath 4-6 h Glassy The outer surface is shiny, but not totally plasticized while the edges are totally plastic-like. The membrane turns into brittle form within 1 h right after taken out from the coagulation-bath. The brittle form shows very high glassy character. 4-8 h Mix The outer layer is fully plasticized while the inner part is amorphous. Only thicker membranes (e.g. over 2 mm) forms this type of membranes. These ultimately turns into glassy- brittle form within days. >8 h Plasticized Plastic-like transparent membrane, durable, flexible and non-soluble in common organic solvents. Coagulation-bath does not affect appearance of the membrane .sup.1Viscosity of the casted solution is determined by GA activity. Other than GA, other crosslinkers were also used as detailed below.
[0112] The time difference between transformations from amorphous to glassy texture were linked to the degree of crosslinking. This is attributed to the fact that the cross-linker is becoming an element in determining the fate of the membrane in terms of color and texture. It is not critical that the membrane loses a higher proportion of the DMAC in order to form the plasticized PAA membranes. This is related to cross-linking of individual PAA membranes with crosslinker (i.e. glutaraldehyde). For example, in the case of p-phenylenediamine (PDA)-PMDA based PAA membrane, 30 min incubation is sufficient to provide the plasticized PAA membranes unlike the ODA-PMDA based PAA membrane that requires over 4 h incubation. This is expected because PDA has two amino groups which enhance its cross-linking with GA. Even though, no chemical treatment was performed in DMAC, the final forms of the membranes even for relatively lower GA concentrations (pre-diluted in DMAC) were still obtained in the plasticized form. This was not common for the GA concentrations that were directly added from stock. For example, in the case of PAA-CS-GA membrane, the same amount of GA when dissolved in water produced an amorphous membrane while GA that was pre-diluted in DMAC provided plasticized membrane. Further, heat treatment to GA/PAA membranes resulted in plasticized membranes, which can be related to the promotion of cross-linking and faster evaporation of solvent. Further details are provided below.
(3) Small-Molecule Effect
[0113] None of the small molecules showed any strong impact on membrane formation when added to the casted PAA solution without the co-addition of the cross-linker. Increase in viscosity related to the addition of small molecule (excluding the cross-linker GA) did not affect the overall membrane formation (amorphous, glassy or plasticized) as detailed below. However, the use of small molecules in the presence of the cross-linkers significantly impacts the structure, the plasticity and other notable physical attributes of the resulting membranes.
[0114] As shown below, while certain small molecules with PAA copolymers ended up as plasticized membranes, others were amorphous in nature. Similarly, the mechanical properties of the membrane under same conditions showed direct dependence on type of the small molecule employed.
[0115] This above chart illustrates the effect of small molecule on membrane formation. (i) Selection of small molecule is not limited to these small molecules; (ii) GA concentration has strong influence on the final form of the membrane apart from the small molecule used in the study.
[0116] The addition of glutaraldehyde is an element in the kinetics of membrane formation. For example, at 0.5% GA concentration, the time needed to form a stand-alone membrane diminishes. This change is believed to be coming from the alteration in the characteristics of the solution itself. For example, PAA alone requires 12h to form a membrane of PAA alone; PAA-GA requires 8h while PAA-GA-SA requires 4h to give stand-alone (
[0117] When the stand-alone membrane is first obtained, its mechanical property is poorer than the membranes that are fully dried. The modulus of elasticity and tensile strength are the main parameters that improved dramatically when the membrane is fully dried. In contrast to this, % elongation decreases at least two-times upon total drying, which was observed for PAA-I-GA, PAA-K-GA, PAA-CA-GA or thicker PAA-GA (over 2 mm casted solution) membranes; when they get dry, they show very high glassy character which makes them as brittle as glass.
[0118] L-alanine and L-cysteine in all cases of provided plasticized PAA membranes, and L-tryptophan-methyl ester also provided plasticized-membranes if the conditions are controlled in terms of humidity and heat. However, utilizing higher concentrations of GA (i.e. 2% or higher) for any type of small molecule co-polymerized with PAA resulted in plasticized PAA membranes. These also affect the formation of colorful membranes. Here, for example, L-alanine gives green membrane while PAA-GA gives chestnut color membrane. Actually, PAA-A-GA provided the membranes which were the best examples of plasticized membranes for
(4) Final Step of Coagulation Bath
[0119]
TABLE-US-00005 TABLE E Effect of coagulation bath on membrane surface characteristics. Coagulation-bath Surface-characteristics Pure-water Shiny, porous or non-porous Methanol.sup.1,2 Sponge, nano-fabric or porous Ethanol.sup.1,3 Sponge, nano-fabric or porous Ethanol-water mixture.sup.1 Sponge and non-porous In Table E, .sup.1For extended evaporation times, sonication might be required in order to obtain nano-fabric and/or sponge surfaces. .sup.2The membranes, which are giving glassy texture/form in the case of pure-water coagulation bath, give sponge or non-porous surfaces and durable membranes. .sup.3In the case of pure-water coagulation bath, the membranes becomes brittle within times.
[0120] Membranes possessing nano-porous, sponge, nano-fabric, non-porous and featureless surfaces can be obtained using the method depicted in
[0121] Characteristic differences exist between the methods depicted in
[0122] GA is a cross-linker. Since GA can exist in different chemical forms in aqueous and organic solvents (as detailed below) it is adapted for the objectives met by the present disclosure. For example, GA can be polymerized into a water-soluble and non-soluble forms based on the objective. Here, GA was first aged through incubating the solution at 70 C. for hours. Optimization was followed with .sup.1H NMR characterization. As detailed below, the following manipulations were performed for GA to obtain the desired membranes; [0123] i. Utilization of aged or non-aged GA. While aged GA is used in order to obtain fluorescently active membranes, non-aged GA was preferential to obtaining physically strong membranes. [0124] ii. Quenching GA activity with methanol or ethanol is needed in order to obtain physically strong membranes. The addition of methanol results in physically strong and non-soluble membranes. [0125] iii. Concentration of GA or heat-treatment of GA before it is introduced to PAA solution has strong effect on membrane formation with respect to color and time-requirement for stand-alone membrane formation. [0126] iv. Very high concentrations of GA (i.e. over 2%) prevent the formation of ideal long-lasting membranes; higher GA makes PAA membranes brittle and even in some cases disrupts proper membrane formation. In the case of imidazole, concentrations can vary as described below.
[0127] As used herein, the term fresh or non-aged GA refers to GA purchased from companies, which were used as received and stored at all times at about 20 C. The term aged GA refers to GA that was kept in an oven for about 1-2 hours (e.g. 50-70 C.) prior to use. The term over-aged refers to GA that was stored at room temperature for about 2 weeks or longer.
[0128] The data and discussion below presents the development, processing, characterization and novel applications of the disclosed films. Due to the organic solvents being environmental pollutants, replacing them with substantially environmentally benign solvents are desired.
[0129] 1D and 2D NMR techniques indicated that DMAC/EtOH and DMAC/EtOH/Water solvent mixtures were applicable for generating PAA polymers synthesized in DMAC. Reducing the use of DMAC by about 75% did not affect the PAA synthesis. However, the repeating units were altered as cis-/trans-ratio and the average molecular weights of the PAA polymers decreased by up to 5 times. The use of crosslinkers, especially GA, was utilized to alter the kinetics of the phase-inversion. GA is a component in the synthesis leading to the formation of amorphous and plasticized membranes. Small molecules were co-polymerized with PAA to manipulate the overall properties of the membrane with respect to their plasticity, antimicrobial properties and mechanical strengths, as discussed in detail below.
[0130] The methods, apparatus and compositions of the present disclosure will be better understood by reference to the following Examples, which are provided as exemplary of the disclosure and not by way of limitation.
Example 1.1-Materials and Methods
[0131] All of the reagents used in this and the following examples were purchased from Sigma-Aldrich (St. Louis, Mo.). Escherichia coli ATCC 25922 Citrobacter freundii, ATCC 8090 and Staphylococcus epidermidis ATCC 12228 were purchased from American Type Culture Collection (ATCC) (Manassas, Va., USA). Dimethyl sulfoxide (DMSO)-d.sub.6, was purchased from Cambridge Isotope Laboratories (Andover, Mass. USA). Unless otherwise specified, phosphate saline (PBS) buffer was used as 50 mM pH 7.2. All solutions were prepared with triply distilled Nanopure water with resistivity of 18 M.
[0132] The above figure illustrates the steps in the synthesis of a PAA Polymer of the present disclosure using optional solvent systems: The ratio of 4,4-oxydianiline (ODA):PMDA was tested from 1.20:1.00 to 1.00:1.05. The ratio given for each solvent was used through the examples.
[0133] The synthesis of PAA films in accordance with the present disclosure is shown in
[0134] The superscript numbers herein refer to the steps of the corresponding superscript numbers in
[0135] Further synthesis of PAA films is shown in
Example 1.2-Structural Characteristics of PAA Films
[0136] The PAA film and the functionalized derivatives were dissolved in DMSOd6 (unless otherwise stated) and then subjected to 1H Nuclear Magnetic Resonance (NMR), 13C NMR, and 1H-correlation spectroscopy (COSY), 1H 13C Heteronuclear Single Quantum Coherence (HSQC), 1H 15N HSQC, 1H 13C Heteronuclear Multiple Bond Coherence (HMBC) and 1H 15N HMBC characterizations. A Bruker AM 600 spectrometer operated by Topspin 3.0 NMR software was used for spectra measurement and analysis.
[0137] In order to fully annotate structure of phase inverted PAA and the designed PAA, NMR and IR experiments were performed. NMR was also used to monitor the possibility of Bisphenol A formation in relation to heat treatment and exposure time.
[0138] To move step by step, ACD/ChemSketch (Freeware) academic edition was used to draw the PAA structures, and PAA-GA interaction. This was due to the fact that in all cases, GA was used as an element in preparation of PAA films.
##STR00001##
[0139] In the above structures, the proposed structure of PAA polymers are shown. [A].sub.a-[B].sub.b-[A]c-[B].sub.d [a, b, c and d can be 1 or more, and can be the same or different]. In the case of PAA synthesized in DMAC, [A].sub.2-[B].sub.3-[A].sub.2-[B].sub.3 is proposed as the possible structure.
TABLE-US-00006 TABLE F .sup.1H NMR of PAA and ternary PAA Films Carboxyl Amino Carbonyl Aromatic Aliphatic Film group group group protons proton PAA 13.05 10.56/10.53 N/A 8.35/8.00/7.74 N/A 7.72/7.05 PAA.sup.1 Not 10.57/10.54 N/A 8.37/8.02/7.77 N/A visible 7.73/7.06 PAA-GA 13.33 10.55/10.52 9.26 8.34/7.99/7.74 Not clear 7.71/7.05 PAA-GA.sup.2 13.54 10.65/10.54 9.30/9.22/9.1/8.75 8.33/7.97 5.00/4.92/4.87 10.52 7.70/7.04 4.68/1.77/1.23 PAA-GA- Not 10.66/10.55 9.32/9.28 8.35/8.00 4.68/3.51 SA.sup.1,2 visible 10.53 7.72/7.05 1.66/1.22 PAA-GA- 13.00 10.65/10.54 9.32/9.30 8.33/7.97/7.76 5.26/2.03/1.23 SA-pAS.sup.2 10.51 7.70/7.04 0.93/0.83 PAA-GA- 13.19 10.65/10.53 9.32/9.31/9.29 8.33/7.98/7.72 2.03/1.91/1.90 SA-pAS-A 10.51 9.06/9.04 7.70/7.04 1.39/1.23 PAA-GA- 13.19 10.65/10.53 9.39/8.74 8.33/7.97 5.74/2.08/1.23 SA-pAS.sup.2,3 10.51 7.70/7.04 PAA-GA- 13.16 10.66/10.54 9.29/9.22 8.33/7.97/7.72 6.09/5.97/4.32 SA.sup.4 10.51 7.70/7.04 3.69/3.45/1.32 1.23/1.05
TABLE-US-00007 TABLE G .sup.13C NMR of PAA and ternary PAA film Film Carbonyl Carboxl Amide aromatic Aliphatic PAA 165.79/ 166.73/ 152.95 141.20/139.08/134.81 N/A 165.69 166.42 133.12/129.83/128.86 127.56/121.53/118.83 PAA.sup.1 165.89/ 166.81/ 152.05 141.29/139.18/134.87 N/A 165.79 166.51 133.99/133.18/130.90 129.1/128.95/127.64 121.63/120.33/118.91 117.61/116.58 PAA- 165.77/ 166.68/ 152.94 141.21/139.08/134.79 Not seen GA 165.66 166.38 133.06/129.05/128.83 127.53/121.51/118.81 118.29 PAA- 165.70/ 166.62/ 152.86 141.14/139.01/134.74 Not seen GA.sup.2 165.59 166.31 133.71/129.02/128.77 167.59/ 127.49/121.44/121.35 167.30 118.74/118.72 PAA- 165.86/ 166.75/ 153.02 141.28/140.68/139.16 37.57 GA- 165.75 166.46 136.52/134.84/133.18 SA.sup.1, 2 167.28/ 166.36 130.83/129.13/128.91 167.89 121.60/118.88 PAA- 165.72/ 166.63/ 152.89 141.17/140.45/139.04 Not seen GA- 165.61 166.33 134.75/133.02/130.72 SA- 129.03/128.78/127.49 pAS-A 121.47/120.06/118.76 118.74 PAA- 165.73/ 166.63/ 152.89 141.18/140.47/139.05 37.47 GA- 165.63 166.33 134.75/131.66/130.72 SA- 167.60/ 129.04/127.49/121.48 pAS.sup.2, 3 167.27 120.05/118.77/118.74 PAA- 165.72/ 166.65/ 152.88 141.16/139.03/134.76 13.78 GA- 165.62 166.34 133.05/130.75/129.02 SA.sup.4 128.79/127.50/121.62 121.46/118.76/118.74 The following superscript numbers refer to the tables above: .sup.1very high concentration (150 mg/mL) of PAA; .sup.2GA used high concentration 2%. .sup.3high concentration (80-100 mg/mL) of pAS. .sup.4PAA was synthesized in 65:35, Ethanol:DMAC. Protons of N,N-dimethylacetamide were not listed on the table since they are only impurities.
[0140] Tables F and G provide a comparison for PAA alone vs. various PAA films. Since GA and small molecules were used at very low amount in comparison to PAA, .sup.1H and .sup.13C NMR techniques did not provide the presence of new peaks for each group. However, at higher amount of sulfanilic acid and glutaraldehyde, the characteristic peaks related to these were observed.
[0141] NMR data is shown in
[0142] In this disclosure, NMR data is used to obtain physical, chemical, electronic and structural information of the disclosed of organic compounds. It is due mostly to the chemical shift on the resonant frequencies of the nuclei present in the compound compared to a reference magnetic field (usually tetramethylsilane or TMS). Chemical shift is the function of the nucleus and its environment, which is measured relative to a reference compound (i.e. TMS). As for the specific NMR data presented in the figures of this disclosure, PAA does not give peaks at the following region including aliphatic region (single or double bond). So, any missing PAA signature peak is an indication that the polymer is not present or is degrading. The NMR images also provide how GA binds to the PAA molecules.
[0143] The disclosed data is used to provide detailed information on the topology, dynamics and three-dimensional structure of molecules. The NMR data in
[0144] .sup.1H NMR spectrum (
[0145] However, an amino group proton was obtained as an overlap of two peaks (
[0146] Glutaraldehyde (GA) can bind at different positions to PAA. According to .sup.1H (
[0147] Similarly, the long-range couplings for the adjacent peaks got lost via GA interaction. According to .sup.1H-.sup.15N HMBC NMR spectral data, nearly all of the long range couplings were lost between the amide nitrogen and the protons on phenyl ring of ODA; particularly proximal to the amino group. However, at the same time, one of the amino peaks seen in the .sup.1H-.sup.15N HMBC NMR spectrum was lost; this peak stayed the same for low GA concentrations. A new amino peak was observed at 10.65 ppm (
[0148] GA preferentially binds to phenyl ring of PAA. In particular, it binds to the ODA ring of PAA polymer.
[0149] GA preferentially binds to phenyl ring of PAA. In particular, it binds to the ODA ring of PAA polymer. This is partially illustrated in
[0150]
[0151] NMR data is shown in
[0152] Introduction of sulfanilic acid (SA) to PAA did not produce any additional peaks. However, some of the interactions observed in the .sup.1H COSY spectrum of PAA-GA were not observed for PAA-SA-GA. For .sup.1H-.sup.13C HSQC, one additional minor peak was observed at 8.21-130.18 ppm in addition to PAA-SA-GA. Similarly, .sup.1H-.sup.13C HMBC gave additional minor extra interactions for the protons at 8.16 and 7.82 ppm, which were more of long-range couplings shifted to more down-field, but simultaneously were protected. However, the cross-peak at 7.82-167.9 ppm could be speculated that it was from SA, rather GA. .sup.1H-.sup.15N HSQC spectrum did not show any differences. Overall, it can be said that, sulfanilic acid peaks were not clear in the membrane, while minor differences were observed in 2D NMR spectra.
[0153] As can be seen in
[0154] BPA is primarily used to make plastics such as water bottles. There are studies showing that BPA might mimic natural receptors in the body and thereby cause an irreversible change at the genetic levels. Based on this potential effect, BPA and a host of other compounds were classified as endocrine disrupting chemicals. Certain plastics may not have BPA at the outset but with time, they may produce BPA after extensive usage and breakdown. The disclosed films did not produce BPA during study of their degradation and are therefore considered substantially safe for human health and the environment.
[0155] Further, Cabot sharp cheddar cheese was wrapped in a PAA-pAS-SA-GA membrane of the present disclosure for three months. Subsequently, we compared the proton .sup.1H NMR of freshly purchased cheese (
[0156] As seen from
[0157] Insets in
[0158] Even though two amino protons were observed, only one carboxyl proton was observed; this difference is related to the fact that the carboxyl proton is more isolated despite the fact that two carboxyl carbons were observed. However, in the case of very high amount of PAA membrane dissolved in DMSO-d.sub.6 to run NMR, the carboxyl proton was not observed even though carboxyl protons were present; similar results were observed for PAA-GA-SA membranes.
[0159] Further, introduction of GA to PAA resulted in the presence of proton peaks related to carbonyl and aliphatic groups. In parallel to the increase in GA concentrations, the peaks became sharper and more visible. As seen from
[0160] Amino groups did not show any change in response to GA action while the presence of new peak at 10.65 ppm was observed in the cases of sulfanilic acid (SA). However, .sup.1H .sup.15N HSQC and .sup.1H .sup.15N HMBC did not show the presence of new amino groups: there was only one type of amino group. This can be speculated to mean that either SA content was not enough to be seen or prior treatment of SA with GA resulted in secondary amino group formation. .sup.1H COSY reveals the presence of aromatic proton and amino proton of SA interacting each other. Therefore, it is clear that SA chemically bonded to the PAA backbone.
[0161] Overall, GA chemically binds to the PAA backbone from phenyl ring of ODA located at the edges of the individual PAA polymers. Prior treatment of SA with GA results in the elimination of primary amino groups, and made them visible as secondary amino groups with PAA-SA-GA polymers.
[0162] NMR was also used to characterize the chemical stability of PAA-GA polymer. The polymer was kept in an air-tight flask under sun-light for over 3 years. As seen from
Example 1.2.1-Molecular Weight Characterization of PAA Polymers by NMR
[0163] Molecular weight (MW) characterization of the PAA polymers by NMR was performed using two approaches .sup.1H DOSY and T.sub.1-relaxation times.
[0164] .sup.1H Diffusion ordered NMR Spectroscopy (.sup.1H DOSY) is a two-dimensional NMR technique which relies on the relation between molecular mass of a molecule/polymer and its self-diffusion. The technique has been shown to be useful in determining the average molecular weight of a polymer. It is based on the theory of the Stokes-Einstein equation. In all DOSY experiments samples was 1.2-1.4 mg/mL in DMF-d.sub.7unless stated otherwise. In DOSY NMR experiments (a technique giving information about the average molecular weight of the molecules), concentration of the molecule/polymer should be low enough (1.2-1.4 mg/mL) to avoid viscosity related biased results.
[0165] As can be seen from
[0166] DOSY results of some PAA synthesized in the study are shown in Table H below.
TABLE-US-00008 Polymer .sup.1H DOSY MW (Da) PAA-DA-GA (0.12M) 1.6 10.sup.5 PAA-pAB-GA (fresh) (0.12M) 1.22 10.sup.5 *Standard mixture 1 4.49 10.sup.5 .sup.#Standard mixture 2 1.01 10.sup.6 .sup.+Standard mixture 3 1.44 10.sup.5 PAA-I-W-GA (0.12M) 1.76 10.sup.5 PAA (0.14M) 40 C. 3.01 10.sup.5 PAA (0.16M) 1.68 10.sup.5 PDA-PAA (0.16M) 1.49 10.sup.4 PAA (0.12M) 2.11 10.sup.5 PAA-IZ (0.12M) 1.78 10.sup.5 PAA (0.10M) 5.28 10.sup.5 PAA (0.14M) 2.33 10.sup.5 0.12M PAA-pAS-GA (fresh) 1.36 10.sup.5 0.08M PAA (1:1.03) 40 C. 5.28 10.sup.5 0.08M PAA-GA (aged) 1:1.03 40 C. 3.41 10.sup.5 0.08M PAA-GA (fresh) 1:1.03 40 C. 4.02 10.sup.5 0.16M PAA (1:1.03) 3.81 10.sup.5 0.12M PAA in 65:35 Ethanol:DMAC, 40 C. 2.61 10.sup.5 0.12M PAA in 50:15:35 Ethanol:H.sub.2O:DMAC 1.14 10.sup.5 40 C. PAA (0.14M) 30 C. 2.33 10.sup.5 0.12M PAA in 60:40 Ethanol:DMAC, 40 C. 1.78 10.sup.5 GA-autopolymer Less than 10.sup.3a GA-SA Less than 10.sup.3a 0.12M PAA, 1:1, Room temperature-cleaned 1.35 10.sup.5 0.12M PAA-GA, 1:1, Room temperature- 6 10.sup.5 cleaned 0.12M PAA-GA-SA, 1:1, Room temperature- 7.35 10.sup.5 cleaned In Table H, *Polymer mixture 1 [23% of 10.sup.3.114; 58% of 10.sup.5.236 and 19% of 10.sup.6.34]; .sup.#Polymer mixture 2 [14% of 10.sup.6.34, 2.6% of 10.sup.3.114]; .sup.+Polymer mixture 3 [38% of 3.11, 14% of 10.sup.4.455, 19% of 10.sup.5.236, 29% of 10.sup.6.34]. IZ: Carbodiimizole; 1:1.03 refers to ODA:PMDA ratio; I: isoleucine; W: L-tryptophane methylester; pAS: p-aminoscalicylic acid; PDA-PAA refers to p-phenylenedianiline + pyromellitic dianhydride PAA; SA: sulfanilic acid. .sup.aRefers to the value was below lowest MW of standard, so it was not calculated.
[0167] .sup.1H DOSY is a technique to identify average MW of polymer mixtures. Four individual polystyrene standards and three mixtures of them were used in order to generate the standard graphic shown in
[0168] Typically, crosslinked PAA polymers are supposed to show higher molar masses (MS). .sup.1H DOSY experiments showed that even individual PAA polymers showed higher MS than glutaraldehyde (GA) crosslinked PAA. Further tests include aged GA-crosslinked PAA, (fresh) GA-cross-linked PAA, GA autopolymers, and GA-small molecule co-polymers gave more clues about the size of the membranes. Among the cross-linked PAA polymers, fresh GA-PAA gave the highest value while PAA-W-GA (aged) gave the lowest MW. Since it is not possible to apply a strict control on the activity of GA, there can be a variety of co-polymers which could be generated from just the GA autopolymer-PAA, GA autopolymer, GA-small molecule copolymer, PAA-GA-PAA copolymers etc.
[0169] Comparison of different concentrations of PAA and the solvent systems showed that the average PAA size was not changed. However, heat treatment and ODA:PMDA ratio affected the MW. Based on .sup.1H DOSY data along with the observed viscosity, 0.12 M PAA prepared with Ethanol/DMAC mixture at 40-50 C. was employed as the standard film condition for any type of application described throughout the present disclosure.
[0170] NMR data provided additional information about the MW of polymers based on T.sub.1-relaxation times, which relies of spin-lattice relaxation. Due to the fact that PAA polymers possess aromatic protons, T.sub.1 relaxation times were compared in order to compare the MWs of the synthesized polymers. According to T.sub.1 relaxation time test, heavy crosslinking by GA increases the MW of PAA polymers in accordance with the present disclosure.
[0171] IR CharacterizationFunctional groups on PAA and PAA-copolymers were determined with a Spectrum 65 FT-IR spectrometer [Perkin Elmer, Waltham, Mass.]. Membranes at solid-state was used to perform IR study. The results are tabulated in Table I.
TABLE-US-00009 TABLE I Effect of GA on shifts in IR functional groups Film OH NH.sub.2/NH CO CN CC Phase 3688/3222/ 3422/3161/ 1692/1769 1352/1287/ 1352/1452/ inverted- 2680 1624/1578 1306 1520/1580 PAA All of 3224/2700 3432/3164/ 1812/1170/ 1352/1308/ 1636/1444/ the 1578 1668 1289 1464/1526/ modified 1574-1578 PAAs
[0172] Stand-alone membranes were directly used for IR-characterization; the membranes were not crushed into powder or located onto IR cards.
[0173] Functional groups on PAA and PAA-copolymers were determined with a Spectrum 65 FT-IR spectrometer [Perkin Elmer, Waltham, Mass.]. Membranes at solid-state were used to perform IR study.
[0174]
[0175] As seen from Table I, GA modification shifted the IR peaks to slightly higher frequencies for a majority of the PAA functional groups which is a sign of increases in mass of the polymers, which was depicted by .sup.1H DOSY results as GA increased MW of PAA polymers up to 5 times. Besides, abundant peaks for CC and CO bonds were observed while OH and NH showed less peaks. Due to some groups overlapping in these polymers, characteristics of certain added groups were not observed in IR spectrometry. As seen from NMR characterization, introduction of GA and small molecules reveal more peaks correlated to CO and CC groups, so it implies that the extra peaks seen are from GA and the small molecules. Decreases in OH and NH peaks could be related to the data that shows that cross-linking with GA might be shifting the amino groups resulting in overlapped and/or non-differentiable in IR spectra, whose spectrums are provided in
[0176]
[0177] .sup.1H COSY showed that the interaction at 0.9-0.9 ppm, 1.45-2.43 ppm, 2.47-9.65 ppm and 4.08-6.47 ppm were only seen for stock GA. Actually, the interaction at 0.9 ppm shows that the peak at 0.9 ppm of stock GA was not seen in the aged GA.
[0178] Comparison shows that .sup.1H .sup.13C has some differences as well such as the aged GA has more interaction at 1.2-1.7 (H) 13-35 (C) ppm and 4.6-5.2 (H) 93-97 (C) ppm ranges.
[0179] Integration of the characteristic peaks in .sup.1H showed that aging decreased free available carbonyl groups. GA can have different forms in aqueous solutions, some of them are shown in
Example 1.3Scanning Electron Microscopy/Optical Characterization
[0180] Characterization of the PAA membrane morphology was carried out on a Zeiss Supra 55 VP field emission scanning electron microscope (SEM). The membranes were imaged both before and after filtration. All samples were coated with 2-5 nm gold layers for SEM imaging.
[0181] Only the membranes produced according to
[0182] Digital images of ternary PAA membranes from
[0183] Digital images of some films from
[0184] A discussion of
[0185] As seen in
[0186] Comparing
[0187] However, L-Tryptophan methyl ester, L-Isoleucine and some other small molecules resulted in opaque membranes. Individual PAA, PAA-DA and PAA-CS are the ones gave distinctly different membrane formations by just shifting the procedure,
[0188] In contrast to this, it is possible to synthesize substantially transparent and durable membranes of
[0189]
[0190] Color formation in
Example 1.3.1UV-Vis Spectra of PAA and Ternary PAA Membranes
[0191] UV-Vis spectroscopic properties of PAA membranes were evaluated to determine the effect of small molecule and GA on formed membranes. PAA phase-inverted membranes that were processed in the hood were compared with the PAA that were synthesized according to
[0192]
[0193]
[0194] In
[0195] Transmittance of the membranes is important for food packaging material applications. All of the membranes showed over 65% transmittance between 450 to 700 nm. The used membranes (i.e. PAA-I-GA, PAA-I provided good visibility for monitoring food conditions. However, PAA-SA-pAS-5AS-GA and PAA-SN-pAS-5AS-GA have lower % transmittance at certain wavelengths such as 510 nm and 650 nm. It should be mentioned that these are not affecting the overall visibility of the packaged food.
[0196] Unlike UV-Vis properties, fluorescence characteristics of PAA membranes showed strong dependence on GA condition, incubation period, GA pretreatment with small molecules and the presence of methanol and ethanol. However, it should be noted that optimizing the conditions are challenging due to the fact that GA can crosslink a variety of other groups including primary/secondary amino groups, thiol groups, hydroxyl groups of sugars and aromatic carbons.
[0197] The Fluorescence Characteristics of several films are discussed below.
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207] Then a series of films were synthesized to test the fluorescence properties with Synchronous Fluorescence Spectroscopy. PAA-pAS-GA, PAA-pAB-GA, PAA-W-GA and PAA-W-GA combined with GA treated pAS.
[0208] In
[0209]
[0210]
[0211] In the above reference figures, increasing delta from 0 to 10 nm, improved fluorescence intensity was observed as expected since possessing too close excitation and emission wavelengths causes decreases in fluorescence intensity. However, for the membranes increasing delta from 0 to 1 nm, disrupted the observed fluorescence intensity. This was most probably from that over-load of fluorophore in the medium; fluorophores within the membranes can show FRET which then diminished the observed fluorescence intensity. This idea was supported through adding more diverse fluorescent active molecules in the membrane. Introduction of pAS into PAA-W-GA decreased the observed fluorescence. Similarly, introduction of GA cross-linked pAS into PAA-pAS diminished the fluorescence intensity. PAA-pAS-W-GA did not provide enough fluorescence intensity when the slit width was 1.5; the highest peak was around 0.5 (not shown). However, dissolving PAA-pAS-W-GA in DMF, and introduction of 2-aminopyridine to the membrane gave a visible spectrum even at 1.5 slit width. However, if the PAA membrane was used without dilution, the intensity was not visible at 1.5 slit width.
[0212] As seen from
[0213] Besides the selection of the emission range, the conditions must be controlled for reproducible results:
[0214] (1)Glutaraldehyde must be aged to obtain fluorescence active membranes, which was determined experimentally in the study. NMR spectroscopy can be used to keep the best conditions. (2) The presence of methanol end ethanol during membrane formation prevents fluorescence active membrane formation, which can be overcome with addition of water. (3) Humidity and longer incubation at room temperature disrupts UV-Vis and Fluorescence properties of PAA membranes. The humidity was not measured experimentally. (4) Care required during the addition of GA into the PAA-small molecule mixture. It should be drop by drop; sudden addition of high amount of GA prevents membrane formation.
[0215] Due to possessing unique properties and low cost, conjugated polymers are preferred as a sensor support material or direct sensing agent from electrical to optical sensors.
[0216] pAS was introduced into different polymers, and its fluorescent activity was shown dependent on the chemical and physical properties of the polymer, including ionization of side groups within the polymer, allowed volume and polarization properties of the groups within the molecules. Above, pAS is becoming part of the membrane itself. So, it is quite normal that fluorescence characteristics of pAS will show change. Besides the environment itself, the solvent also possesses strong effect on excitation and emission spectra, and quantum yield as well. For example, pAS itself gives only one emission in aprotic solvents, it gives more than one peak in protic solvents.
[0217] PAA itself is inherently not fluorescence-active, but introducing side groups to PAA was shown as a method to add fluorescence character to PAA such as grafted PAA with toluene-2,4-diisocyanate and straight alkyl chains showed fluorescence properties. Maximum absorption and excitation wavelengths of the high purity Rhodamine 6G in anhydrous ethanol were obtained at 527 nm and 550 nm, which refers to the stoke shift is over 20 nm which matched the literature. This shows there was only one fluorophore in the medium, and the working conditions only allowed possessing one broad peak. However, this was not valid for the stand-alone membranes and the dissolved membranes due to the fact that the membranes were composed of more than one fluorophore. As detailed in the examples below, GA can cross-link individual PAA polymers as well as it can cross-link PAA-small molecule and small molecule-small molecule, which can allow possessing fluorophore.
[0218] As seen from
[0219] As seen from the
[0220] Quantum yield of a fluorophore is more influenced by the environment in comparison to molecular extinction coefficients. Fluorescence quenching is the process of reduction in fluorescence quantum yield, which can be resulted from collisional quenching and/or occurrence of vibrations of non-fluorescent ground-state species. Self-quenching is, also, a common problem seen in fluorescence, which is arisen from over-load of fluorophores presence. Fluorescence resonance energy transfer (FRET) is a fluorescence technique in which emission of a fluorophore is absorbed by another fluorophore as the excitation. The technique is distance-dependent, and the yield of FRET is proportional to the distance, which makes it sensitive.
[0221]
[0222]
[0223]
[0224] Even though UV-vis gave peak at 570 nm, the best quantum yield was obtained for Ex 533 nm. While R6G in ethanol solution as shown in
1.4 Solvent Resistance Properties
[0225] Film lengths and widths were 2.5 cm while thicknesses were between 0.00128-0.00512 cm. The following buffers were used; 50 mM Acetate (pH 4.5) buffer, 50 mM PBS buffers (pH 6.8/7.0/7.4), 50 mM (pH 8.0) Tris-HCl and 50 mM (pH 9.6) carbonate buffer. All the buffers were prepared from their salts and pH was adjusted with 1M HCl and/or 1M NaOH. Glacial acetic acid, 30% hydrochloric acid, 100% sulfuric acid, 1 M sodium hydroxide and 37% NH4. The following organic solvents were employed for solubility testing: ethanol, methanol, tetrahydrofuran, hexane, ethylacetate, dimethyl formamide, dimethyl acetamide, dichloromethane, p-xylene, aceticanhydride, dimethyl-sulfoxide and acetone. The solvent resistance properties of various films is discussed in the data below.
[0226] PAA films are soluble in complex media such as protein and carbohydrate containing media and polar organic solvents. Therefore, it is essential to show the material will not live a problem of dissolvation during contact to food and possible chemical contaminants or the chemicals from food-itself.
[0227] Solvent resistance of the synthesized PAA membranes showed close relation to mostly GA condition and the small molecule. The findings are listed as below.
[0228] Aged GA made the membranes soluble for all small molecules PAA-copolymers in the case of
[0229] Fresh GA made the membranes of the small molecules PAA co-polymers synthesized according to
[0230] Sulfanilic acid (SA) advanced solvent resistance character of all the membranes synthesized according to
[0231] Tryptophan methyl ester-PAA-GA copolymers formed non-soluble membranes in the cases of that GA was fresh; methanol addition is required, or GA addition to the PAA solution could be beneficial to make the membranes non-soluble.
[0232] Membranes synthesized according to
[0233] Solubility of all the membranes did not show dependence on pH as shown in the figures and discussed below.
[0234]
[0235] Color changes of ternary PAA membranes in response to alcohol exposure is shown in
[0236] Color changes of PAA membranes in response to alcohol treatment is shown in
[0237] Color change in response to exposure alcohol is achieved in all types of PAA films, but when the membrane is very dark (low transparency), the change takes a comparatively longer time. Among the membranes, Ile containing membranes gave the response fastest; while Ile enhanced PAA-GA membrane gave color change within 30 min, pAS enhanced PAA-GA membrane required 2-4 h to give color change.
[0238] Color changes in response to alteration in environmental conditions can be further advanced with pH-dependent dyes. Here bromophenol blue (BPB) was simply tested, with the results shown in
[0239] In
[0240] Further color change is shown in
[0241] This section was to entrap BPB within PAA-GA, and release the BPB into the medium when there is a change in pH and/or ionic strength; when the PAA is treated with aged GA it doesn't have insoluble form for harsh environment such as high pH, strong organic solvents and so on. The color change of the membrane itself might be resulting from certain amount of BPB crosslinked to PAA. Actually, using fresh GA can advance BPB cross-linking to PAA, which could also a possible way of monitoring pH changes.
1.5 Mechanical Characterizations
[0242] The mechanical strengths of the membranes were determined using Instron Tension Testers run by Merlin Project Software (Norwoon, Mass.). The strength tests were evaluated using maximum load, tensile strength and modulus of elasticity.
[0243] Mechanical properties of food-packaging materials are a parameter in assessing their relevance as packaging materials. This is because packaging materials must protect the containment against possible exposure to physical pressures during transportation and storage. Maximum load, modulus elasticity, break elongation and tensile strength are common parameters to evaluate mechanical properties of a packaging material. Different approaches have been applied to advance the properties such as combination of biopolymers and chemicals, composites or nanomaterials (i.e. chitosan and graphene, whey protein-zein).
TABLE-US-00010 TABLE J illustrates Mechanical properties of FIG. 1a Films Maximum Modulus Break Tensile load elasticity Elongation Strength Film-Type (kg) (MPa) % (MPa) Composite.sup.a 12.75 180 24.3 13.79 PAA-C-GA.sup.b 5.13 406.89 13.4 32.41 PAA-A-GA.sup.b 3.86 1096.55 10.9 24.14 PAA-GA.sup.c 1.81 13.79 29.6 7.07 PAA-CS-GA 7.39 37.24 139.5 6.21 PAA-G-GA 6.08 45.52 83.1 8.97 PAA-W-GA 2.95 31.03 42.9 4.14 PAA-I-GA 5.67 24.14 181.3 8.97 PAA-R-GA 4.68 26.89 79.8 6.89 PAA-K-GA 6.21 35.86 73.9 9.66 PAA-T-GA 2.31 164.14 28.8 1.45 PAA-E-GA 5.67 58.62 67.9 8.28 PAA-CA-GA 10.61 86.89 115.4 15.86 PAA-DA-GA 6.4 121.3 7.2 11.73 PAA-GA.sup.d 8.62 485.52 38.8 43 .45 PAA-GA.sup.e 9.03 232.41 63.6 45.52 PAA-GA.sup.f 12.47 737.41 126.4 63.49 PAA-A-GA.sup.h 9.48 821.38 8.8 28.97 PAA-S-GA.sup.h 5.72 697.24 30 43 .45 PAA-A-CS-GA 4.04. 72.41 8.56 6.21 PAA-C-GA 14.51 920 48.3 73.79 All of these films were at 0.18M PAA concentration, but some of the membranes were at 0.20M concentrations. .sup.aPAA-GA was casted onto glass, and then non-GA treated W was added onto the PAA-GA. .sup.bGA treated PAA-C incubated overnight after being casted on the glass; 3-week old membrane. .sup.cGA treated PAA incubated overnight after being casted on the glass; 2h old membrane. .sup.dGA was first diluted in dry DMAC and then applied to PAA solution. PAA membranes were casted on clean glass and incubated overnight. After incubation, DMAC was eliminated from the membranes by soaking them in pure water. The thickness of PAA membrane is important for its modulus elasticity and % break elongation; .sup.ewhile thicker one has higher (4) break elongation, its modulus elasticity is lower [i.e. thicker one has %63.6 and 273.79 MPa while one was %38.8 and 485.2 MPa. Altering the incubation time was also an important factor as seen in .sup.fwhich has lower incubation time. .sup.hGA was dissolved in dry DMAC and then directly applied to PAA-A solution. The length and width of all membranes were 2.52 cm while thickness of the membranes was between 0.025-0.1 mm.
[0244] Maximum-load bearing capacities of the membranes mostly showed relation with the thickness of the membrane. For example, PAA-CA, Composite membrane, PAA.sup.f, PAA-CS were relatively thicker than PAA-T, PAA-A.sup.b and PAA-R which showed lower maximum-load bearing potential. However, PAA-C, PAA.sup.c and PAA.sup.th which were relatively thinner but could withstand high load, which is a sign of how small molecule affects the membrane's mechanical properties. Modulus elasticity and break elongation were dependent on the procedure and the small molecule combined with PAA. L-Cysteine and L-Alanine were by far best membranes in
[0245] New membranes were prepared according to
TABLE-US-00011 TABLE K Mechanical properties of FIG. 1b films Tensile Break Break Modulus Maximum strength strength, Elongation elasticity Film Type load (kg) (MPa) (MN) (%) (Mpa) Combined.sup.1, 2 5.25 26.89 24.68 3.4 1043.87 PAA-A.sup.1, 3, 4 3.13 47.57 22.27 6.1 1750.58 PAA-A.sup.1, 3, 5 2.54 19.3 16.55 2.2 930.79 PAA.sup.1, 3, 6 4.49 68.26 41.85 11.6 1872.62 PAA.sup.1, 3, 7 4.13 62.74 19.72 8 2244.93 PAA.sup.1, 8 2.86 86.18 30.34 16.4 1552.69 PAA.sup.1, 3, 4, 8 2.18 66.19 41.58 23.8 1101.51 PAA-CA.sup.1, 3, 4, 8 4.13 62.74 55.85 24.7 1221.06 PAA-A.sup.4, 9, 10, 11 2.9937072 45.51724138 44.62068966 61.7 235.862069 PAA-A.sup.9, 10, 12 2.3586784 35.86206897 21.5862069 11.2 961.3793103 PAA.sup.7, 9, 13 2.79412672 84.82758621 65.65517241 13.8 2639.310345 PAA-A.sup.4, 9, 10, 14 3.9916096 30.34482759 27.86206897 9.1 1038.62069 PAA-A.sup.7, 9, 10, 14 1.8597272 57.24137931 47.37931034 8.4 2062.068966 PAA-A.sup.7, 9, 10, 11 1.7236496 52.4137931 1.103448276 11.9 1678.62069 PAA-A.sup.7, 9, 10, 15 3.9008912 29.65517241 29.44827586 7.4. 1031.724138 PAA-A.sup.7, 9, 10, 15 4.3544832 33.10344828 27.31034483 8.6 866.2068966 PAA.sup.8, 9, 11 2.2226008 33.79310345 25.86206897 6.7 1193.793103 PAA-A.sup.7, 16, 17 2.5854744 39.31034483 34.89655172 6.3 1382.758621 PAA-A.sup.7, 13, 18 4.4905608 33.79310345 33.03448276 14.6 1264.137931 PAA-A.sup.7, 8, 18 1.9504456 29.65517241 27.24137931 4.9 1400 PAA.sup.7, 8, 19 3.2205032 48.96551724 41.31034483 14.2 1397.931034 PAA.sup.7, 8, 19 3.40194 51.72413793 48.13793103 29.4 1823.448276 PAA- 2.1772416 65.51724138 35.86706897 9.7 2185.517241 DC.sup.8, 9, 20, 21 PAA-A.sup.8, 9, 20 2.2226008 66.89655172 48.27586207 5.8 2762.068966 PAA-W.sup.8, 9, 20 1.4968536 46.20689655 42.48275862 9 1848.275862 PAA-W.sup.8, 9, 20 1.7690088 53.79310345 43.31034483 12.7 1880 PAA-W.sup.8, 9, 20 2.9029888 55.17241379 49.79310345 37.4 1615.172414 PAA-BB.sup.8, 9, 22 2.26796 68.96551724 58.68965517 40.9 2177.241379 PAA-DA.sup.8, 9, 20 2.0865232 63.44827586 10.48275862 30.4 1725.517741 PAA- 0.8164656 31.03448276 12.27586207 11.8 1315.172414 PCl.sup.8, 9, 23, 24 PAA- 2.4493968 46.89655172 32.48275862 6.6 1368.275862 PCl.sup.8, 9, 23, 25 PAA-pAS- 6.25 95.147 88.942 58 4101.62 SA (4 mg/mL).sup.26, 27 PAA-T-pAS- 4.8 48.95 47.44 63.3 1793.33 SA.sup.26, 27 PAA.sup.26, 27, 28 3.22 48.95 48.95 5.7 2255.28 PAA-SA.sup.26, 29 3.26 33.1 31 63.8 1245.88 PAA-pAS- 3.49 35.16 31.44 37.3 1531.3 SA-A.sup.26, 29 PAA-pAS- 3.76 38.61 31.78 27.1 1490 W.sup.26 PAA-SA.sup.26, 30 9.66 85.49 68.12 10.4 2590 PAA- 4.35 32.6 33.1 18.4 1530 SA.sup.26, 30, 31 PAA-IZ.sup.26 4.94 30.34 24.2 51.6 1170 PAA- 3.99 30.34 23.99 54.7 1400 SA.sup.26, 28, 30, 31 PAA-SA-SN- 5.3 37.4 37.4 45.3 2367 pAS.sup.26, 28, 30, 31 PAA- 5.6 91.2 84.76 57 3850 SA(4 mg/mL)- pAS-5AS- GA.sup.25, 26, 28 All GA concentrations were betweenn0.035-0.1% if not otherwise mentioned. In the cases of Sulfanilic acid (SA), GA was directly added to the SA for pre-crosslinking, flowed added to the PAA solution. .sup.1PAA concentrations were 0.18M with FIG. 1b; .sup.2Viscous PAA was casted on Glass, followed by 0.1 mg/mL GA added PAA introduced on top of the already casted PAA; .sup.3MeOH was directly added to the system right after GA addition, or GA-small molecule addition; .sup.440 L/mL MeOH added; .sup.580 L/mL MeOH added; .sup.610 L/mL MeOH added; .sup.720 L/mL MeOH added; .sup.8FIG. 1b ii; .sup.9PAA concentration is 0.16M; .sup.10FIG. 1b i; .sup.11Glass-surface was rinsed with dry DMAC; .sup.1210 min incubation at 72 C.; .sup.134 mg/mL imidazole was used as cross-linker; .sup.14Glass-surface is rinsed with dry MeOH; .sup.15Glass-surface and membrane surface were rinsed with DMAC; .sup.16FIG. 1a iii; .sup.17Glass-surface and membrane surface were rinsed with MeOH; .sup.18Glass-surface and membrane surface with EtOH; .sup.19Glass-surface was rinsed with EtOH; .sup.2020 L/mL MeOH was added to the PAA solution before cross-linker addition; .sup.214 mg/mL Diphenolcarbazide [DC]; .sup.224 mg/mL 2-Benzylbenzoyl; .sup.234 mg/mL 4-amino-2-chlorobenzoic acid; .sup.24The casted solution directly incubated under-hood for overnight; .sup.254 h incubation in room temperature, and then incubated under-hood for overnight; .sup.260.12M PAA; .sup.274 months old; .sup.28PAA prepared in 35% DMAC in Ethanol; .sup.291-3 days old; .sup.307-10 days old; .sup.31GA dissolved in DMAC was added in addition to GA in water. In Table K, BB refers to 2-benzylbenzoyl.
[0246] Among the synthesized films, sulfanilic acid supported membranes provided the highest mechanical property. Increasing the concentration of sulfanilic acid from 2 mg/mL to 4 mg/mL improved the advanced mechanical properties by up to 3 times as shown in Table K. Among the small molecules incorporated to PAA, sulfanilic acid is the only small molecule containing SOOOH group, this could be the main reason of why sulfanilic acid improved mechanical properties. The compound readily forms diazo compounds and is used to make dyes and sulpho-drugs.
1.6 Contact Angle Characterization
[0247] Pure-water contact angles of PAA membranes were tested with CAM Contact Angle Meter [KSV Instrument, CT] run by CAM100 image recorder software.
[0248] Contact angle is the parameters typically used to evaluate hydrophilicity of food-packaging materials. It provides information on the tendency of the material to absorb water. A good contact angle, which refers to over hydrophobic range (i.e. over 65), can substantially eliminate water-vapor absorption that may trigger microbial development on or within the packaging material.
TABLE-US-00012 TABLE L Contact angle of PAA membranes Procedure of Procedure of Membrane FIG. 1a Membrane FIG. 1b Type Top/Bottom Type Top/Bottom PAA-GA 55.87/51.27 PAA-GA.sup.b 61.73/74.66 PAA-CS- 62.07/53.6 PAA-PCl-GA 80.54/72.10 GA PAA-DA- 62.35/55.7; PAA-pAB-GA 91.49/73.63 GA 45.3/47.3 PAA-CA- 87.26/95.16; PAA-AN-GA.sup.c 57.74/59.21 GA 81.09/79.77* PAA-K-GA 47.81/54.89 PAA-pAB- 73.45/50.75 GA.sup.d PAA-A-GA 80.88/57.02; PAA-CA- 65.91/66.78 56.58/63.7* AcOH-GA PAA-W-GA 47.05/65.32 PAA.sup.e-AcOH- 88.19/80.56 GA PAA-R-GA 44.03/51.54 PAA.sup.f-AcOH- 82.84/79.88 GA PAA-C-GA 57.07/41.89 PAA.sup.g-AcOH- 80.98/78.43 67.37/51.2* GA PAA-T-GA 63.91/84.67 PAA-GA.sup.g 80.23/79.20 PAA-I-GA 47.23/55.65 PAA-GA.sup.h 62.20/66.25 PAA-G-GA 66.53/69.1; PAA-A-pAS- 75.60/74.20 65.11/62.5* GA.sup.h PAA-E-GA 78.78/59.09 PAA-I-pAS- 77.25/78.30 GA.sup.h PAA-S-GA 97.33/62.48; PAA-S-GA 52.62/60.53 74.27/61.5* Composite.sup.a 95.27/80.7 PAA-SA-pAS- 82.56/84.3 GA In Table L * refers to 0.5-1% GA concentration and overnight incubation. The remaining membranes were consistent with 0.1-0.2% GA concentration and 6 h incubation: .sup.aGA treated PAA casted on the glass, and then non-GA treated PAA-W and PAA-CA was added onto the PAA-GA and left 6 h incubation. .sup.bmembrane was phase-inverted under hood; .sup.cAN refers to Amonium Nitrate; .sup.dFormaldehyde was used for cross-linking; .sup.e20 L/mL olive oil; .sup.f40 L/mL olive oil; .sup.g100 L/mL olive oil; .sup.h0.12M PAA. Standard deviations out of 3-runs were less than 6% for all membranes developed.
[0249] Contact angle of the membranes synthesized according to
[0250] For
[0251] For
[0252] In all cases, the present films contain sulfanilic acid, p-aminosalicylic acid and glutaraldehyde The obtained contact angle was over 65, thus, the small molecule incorporated within the PAA film can serve as good-packaging materials due to the contact angle data.
1.7 Electrochemical Characterization
[0253] Four-probe and Ohm meters were utilized for characterization of the electronics properties of the membranes, as shown in
[0254] According to 4-probe and ohmmeter, none of the films was found to be conductive. The multimeter can go up to 200 M and the scale was not sufficient to measure the resistance of the membranes, therefore the membranes were accepted as insulators.
[0255] Then the films were utilized as support material for gold-coating, ash shown in
[0256] Four-point probe resistivity of gold e-beamed PAA ternary membrane and Whatman paper.
[0257] SEM images at 10000 and 100000 magnification of gold e-beamed PAA ternary membrane and Whatman paper are shown in
[0258] Since the membranes were determined to be non-conductive according to the 4-probe conductivity measurement, cyclic-voltammetry was further utilized to determine any possible electro-activity of the PAA membranes. All of the experiments were performed in 50 mM pH 7.4 PBS buffer. Platinum and silver wires were used as auxiliary and reference electrodes, respectively. Working electrodes were 200 nm gold-coated (via e-beam) Whatman papers. Scanning rate was 50 mV, and the range was 200-600 mV.
[0259] Cyclic voltammetry results of ternary PAA membranes is shown in
TABLE-US-00013 TABLE M Summary of the Electrochemical Characterization of PAA Membranes Peaks for Peaks for oxidation reduction Membrane (mV) (mV) Reversibility PAA 50 150 Quasi-reversible PAA-GA 50/100/295 130/320/470 Quasi-reversible PAA-PDA 55 410 Irreversible P AA-W-GA 100 220 Quasi-reversible PAA-pAS-GA 75 34 Quasi-reversible PAA-pAS-GA No peak No peak NA PAA-GA No peak No peak NA
[0260] Conductivity of the PAA co-polymers showed dependence on aged GA and the small molecule type, including the time of incubation. PAA-PDA-GA provided the highest oxidation reduction potentials (see the scale on the y-axis for
[0261] Even though PDA provides good conductivity, PDA-PMDA based PAA membranes did not provide strong mechanical properties and durability, so GA was subsequently introduced. PDA was first dissolved in DMAC, followed by cross-linking with GA for 30 sec; the polymerized PDA was then directly introduced to PAA solution. The resulting PAA-PDA-GA was casted on gold-coated Whatman paper, followed by drying under hood for 6 h with further rinsing in pure water. Similarly, all of the PAA coated electrodes were rinsed in pure water before they were exposed to cyclic voltammetry.
1.8 Water, Water-Vapor and Oil Permeability
[0262]
[0263]
[0264] Resistance to oil and water-vapor penetration are important for keeping a containment fresh and for preventing the loss of taste and flavor. Different approaches have been applied to provide resistant surface to oil and water vapor transfer.
[0265] Due to the good mechanical properties,
[0266] The water vapor permeability takes thickness as a parameter to determine the power of membrane against vapor permeability by which both the quality of membrane and the importance of thickness can be evaluated more objectively.
[0267] Certain membranes can be used to cover the top of the vial without requiring an adhesives for which only thin string or parafilm is enough. However, in some cases such as sulfanilic acid enhanced or 2BB co-polymerized PAA membranes are not easily attached with a thin string or parafilm since they are harder plastic.
[0268] Further, PAA-I-GA, PAA-I-pAS-GA and PAA-A-pAS-GA were tested, and no transfusion was observed. These results showed that the membranes synthesized according to
[0269] Since sulfanilic acid (SA), sulfanilamide (SN), p-aminosalicylic acid (pAS) and 5-aminosalicylic acid (5AS) were used as the main molecules in the developed membranes, PAA-pAS-5AS-SA-GA and PAA-pAS-5AS-SN membranes were tested as well. Membranes at different thickness were tested. Thickness and texture did not affect the membranes resistant to oil-permeability.
1.9 Biodegradability and Toxicity Characterization
[0270] The synthesized membranes were heavily cross-linked with glutaraldehyde, and co-polymerized with intrinsic antimicrobial agents (i.e. sulfanilic acid, p-aminosalicylic acid). The biodegradability of these films is determined below. However, the introduction of these antimicrobial agents made the resulting membranes to be biodegradable. Therefore, it was required to test biodegradability of the PAA membranes.
[0271] For the below data microorganisms were obtained from rotten sticks from American Elm (Ulmus americana) in the University's garden, Binghamton-NY. .sup.1H NMR, .sup.1H-correlation spectroscopy (COSY), and .sup.1H-.sup.13C-heteronuclear single quantum coherence (HSQC). The fungus chunk was directly introduced to the bioreactor without any selection. Pre-selected fungus and fungus chunk were characterized with molecular biological techniques. The plasticized PAA membranes showed dramatic differences in terms of physical characteristics than the membranes designed elsewhere, so it required further biodegradation testing of the new membranes.
[0272] Characterization of the isolated fungi species were done in the Department of Sustainable Bioproducts, College of Forest Resources, Mississippi State University, Starkville, Miss., USA.
[0273]
[0274] The bioreactor contained 25 mg/mL YPD medium, 0.1 mg/mL D-glucose, 1% L-glutamine, 25 L/mL trace-metal solution and 5 mg/mL Peptone, which only contains the fungi chunk that was later identified as Trichaptum biforme. The pH of the medium was adjusted to pH 5.7 before autoclave. The bioreactor volume was 100 mL, and the membranes were from 50 mg PAA-A-GA of
[0275] The membranes were not crushed, and put into the medium as they were. The blank bioreactor was cultured under same conditions without the membranes. Disintegration was monitored by visual decreases in the membrane size while structural degradation was monitored via NMR. Disintegration was not able to be monitored when microbial biomass totally covered the membrane surface. In this experimental design, there were four main differences from previous designs: [0276] The starting fungus inoculum was prepared by dissecting the fungi chunk, and taken the inner part as the starting biomass, which was later on characterized as Trichaptum biforme. [0277] Cells were not acclimatized before they were used to degrade the films of
[0280] For each NMR run, 1 mL of solution from the bioreactors was put into 1.5 mL polypropylene microcentrifuge tube. The sample was kept in 20 C. overnight, and then lyophilized for 24 h. The resulted solid sample was dissolved in 0.9 mL D.sub.2O. The dissolved sample was then left for precipitation of non-dissolved sample for 15 min; the final volume was between 0.75-0.8 mL. Degradation of the membranes was monitored via .sup.1H NMR, .sup.1H COSY and .sup.1H .sup.13C HSQC NMR techniques.
[0281] The trace metals solution contained 20 mM FeSO.sub.47H.sub.20, 2 mM CuSO.sub.45H.sub.20, 5 mM ZnCl.sub.2, 20 mM MnSO.sub.4 H.sub.20, 6 M CoCl.sub.2 6H.sub.20, 1 mM NiCl.sub.26H.sub.20, and 1 mM MoCl.sub.3.
[0282] Both Trichaptum biforme, a white rot fungus, belonging to Basidiomycota division of Fungi kingdom and Trichaptum biforme, similar to Fusarium oxysporum can degrade aliphatic and cyclic organic pollutants were used. Basidiomycetes are among the higher fungi that can develop multicellular mycelium. They are mainly found in rotten trees where they degrade lingo-cellulosic polymers via extracellular enzymes including manganese peroxidases, laccase peroxidase and so on.
[0283] Full .sup.1H spectra of the PAA for peptone-yeast medium (
[0284] DMAC is a volatile organic-solvent, and is supposed to evaporate from the system upon overnight lyophilization. NMR sample was prepared via freeze- and thawing procedure where overnight-lyophilization was applied to eliminate all the solvents coming from the biodegradation media. Disintegration of the membranes was completed within 20 days. That was why the 20.sup.th day was selected as the first day of sampling. Aromatic regions in I H NMR spectra at 20.sup.th and 30 days showed strong similarities; the doublets and triplets are quite similar. Aromatic regions in .sup.1H NMR spectra at 35.sup.th and 40.sup.th days showed largely triplets in contrast to 20.sup.th and 30.sup.th days; 35.sup.th day still showed some doublets and singlets which signifies the presence of PAA. However, the aromatic regions in .sup.1H NMR spectrum of 40.sup.th day did not show any clear evidence of the presence of PAA. Interestingly, the aromatic regions in .sup.1H NMR spectra at 20.sup.th and 40.sup.th days showed strong similarities for the presence of triplets. For the 20.sup.th and 30.sup.th days, a doublet was seen at 5.82 ppm which could be a sign of fragmentation of the PAA molecule, which was then consumed because at 35.sup.th and later-days the peak disappeared.
TABLE-US-00014 TABLE N Characteristic peaks related to PAA degradation Day Aliphatic range, incubation Aromatic range, ppm ppm 20 Doublets of PAA, 6.9-8.1 30 Doublets of PAA, 6.9-8.1 35 Triplets, no sign of PAA 40 Triplets, no sign of PAA 50 Doublets of PAA (6.9-8.1), and triplets from degradation/metabolites 120 Overwhelmingly doublets Peaks of DMAC of PAA, 6.9-8.1 (1.95, 2.7 and 3.2)
[0285] Since PAA is composed of aromatic groups, it is not expected to show any triplet. The triplets at aromatic region are a strong sign of partial or total saturation of the rings found in PAA. Then 50 mg of PAA-pAS-GA and PAA-SA-GA were added to the system at 40.sup.th day, which was then analyzed at 50.sup.th day. During this period, only 0.2 mg/mL sugar was added to the medium at 40.sup.th day. Then, the system was run in continuous mode. From 6.5 to 8.5 ppm range of 50.sup.th and 120.sup.th day was overlapped to see the changes in PAA degradation. Analyzing the 50.sup.th day data we found that the aromatic region in .sup.1H NMR revealed the peaks of PAA and the triplets which are the signs of saturation of aromatic groups in PAA and/or the newly formed cyclic groups. Then, 100 mg of PAA-pAS-GA were added to the medium, and the mixture was incubated for additional 70 without adding any sugar or peptone to the system. Then, at 120.sup.th day, .sup.1H NMR of the bioreactor was carried out; but only the PAA related peaks were found.
[0286] When the .sup.1H NMR spectra were compared the followings were observed; Peptone yeast .sup.1H NMR possesses doublets and triplets between 3.27-3.94 ppm, which is not found in any other; a singlet at 3.10 ppm, which is slightly larger at 20th and 30th days, while very small at 35th and 50th days; a singlet at 3.30 ppm is relatively larger at 20.sup.th, 30.sup.th and 35.sup.th days while it is smaller at 40.sup.th and 50.sup.th days; the peak is not clear for peptone-yeast medium; a singlet at 3.93 ppm probably found in all of them but not found in peptone-yeast medium; three singlets between 2.75-2.78 ppm in all, but not in peptone yeast; the triplet at 2.43 ppm found in all; a singlet 2.12 found in 20.sup.th and 30.sup.th days, might be in 50 day; but it was not found in peptone-yeast medium, 35.sup.th and 40.sup.th days; a singlet at 2.01 ppm is found in 20th, 30th, 35th and 50th days, but not in peptone yeast and 40th days, this peak is relatively bigger for 20th and 30th days; a peak at 1.95 ppm for 20.sup.th, 30.sup.th, 35.sup.th days which is very small for 50th day while it was not found in 40.sup.th day and peptone-yeast medium; a singlet found in all, except 30th day at 8.49 ppm; the singlets found at 8.37 and 8.29 ppm only for peptone-yeast medium; the singlet at 7.84 is only for peptone-yeast and 40th days; they are quite similar; the two singlets at 7.6 and 7.7 are only for peptone-yeast medium; there is a triplet at 7.46 ppm found in peptone yeast medium, 20.sup.th, 35.sup.th and 40.sup.th days; slight presence of the peak is in 50.sup.th day while it was not in 30th day; the singlet at 7.10 ppm is only for peptone yeast medium; the doublet (for 35.sup.th and 40.sup.th days) or the broad peak (for 20.sup.th, 30.sup.th and 50.sup.th days) at 7.22 ppm where peptone yeast medium has a triplet. However, the doublet is relatively bigger for 30.sup.th day. There are 4 broad (or doublet) and a one singlet on upper field of this peak. These are the sign of presence of PAA. However, it is not easy to say that they are present in 30th and 35th days; the broad peak at 7.61 ppm for 20.sup.th, 30.sup.th and 50.sup.th days, which is not included in 35.sup.th and 40.sup.th days; the singlet peaks between 6.5 to 8.5 ppm shifted during from 20 to 50.sup.th days, could be related to the biodegradation of PAA; the triplet at 7.56 ppm for 20.sup.th, 30.sup.th and 35.sup.th days where 40.sup.th day has nothing; peptone yeast medium has a doublet and 50.sup.th day has a singlet. This shows there is a degradation of PAA, but at 50.sup.th day intact PAA polymers or PAA polymers protected their back-bone structure are present in the media; the two triplets and a doublet between 7.3-7.5 ppm found in 20.sup.th, 30.sup.th, 35.sup.th and 40.sup.th day look similar, but that is not possible to say they are from peptone or sugar since the peaks between 2-4 ppm showed no similarity. Actually, the shapes of these triplets don't look alike; when 50.sup.th and 120.sup.th days compared, there is no improvement rather the triplet at 7.46 and the doublets 7.41 and 7.35 went away for 120.sup.th day, and the singlet at 8.49 ppm went away as well.
[0287] Biodegradation of the membranes (PAA-CS-GA and PAA-GA) showed some-differences such as PAA was fragmented into little fragment which was seen as that integrals of the four-peaks between 6.9 to 7.2 ppm became similar with time. For example, at 15.sup.th day, the major peak was overwhelmingly larger while at 30.sup.th day they were all the same. Also, at 30.sup.th day, the triplets appeared; the sign of saturation of the double bonds in PAA and/or conversion of the groups. However, for 15.sup.th to 27.sup.th days, the triplets were not seen or could be very low. Therefore, it can be said that the fungi degraded the PAA-CS-GA and PAA-GA polymers into two steps; first degraded the larger PAA polymers into small PAA polymers. In the second step, the fungi quickly degraded the smaller-sized PAA polymers. 10287 In contrast to this, as seen from the
Characterization of the Fungi Responsible for PAA Degradation Using Molecular Biological Techniques
[0288] Genomic DNA Isolation-Genomic DNA was isolated from dried mycelium by use of the NucleoSpin Plant II Kit (MACHEREY-NAGEL GmbH & Co. KG). The dried weight of the mycelium was 0.05 g for sample A and 0.07 g form sample B. Mycelium was washed with 95% ethanol for 2 hours. The mycelium was transferred to tubes with 2 mm glass bead sand homogenized with CTAB lysis buffer (2% cis-trimethyl ammonium boric acid, 100 mM Tris, 20 mM Na2 EDTA, 1.4 M NaCL, and 1% polyvinylpyrolidine). The extract was treated with RNase A (200 ng/ul, incubate at 65 C. for 10 min) followed by Proteinase-K and incubated at 65 C. for 1 hour. The remainder of the extraction followed the kit instructions for isolation of DNA from fungi. DNA was eluted with 50 l buffer PE heated to 65 C. The concentration was measured on a Nanodrop 1000 spectrophotometer. The purity of the DNA was evaluated in gel electrophoresis on a 1% agarose gel in 1SBA (Sodium Boric Acid).
PCR Amplification
[0289] The Internal transcribed spacer (ITS) region of the fungi was amplified using primers ITS1-F (5-CTT GGT CAT TTA GAG GAA GTA A-3) (SEQ ID NO: 1), which is specific for the higher fungi (Gardes et al. 1993), and ITS4 (5-TCC TCC GCT TAT TGA TAT GC-3) (SEQ ID NO: 2), the universal primer. Amplifications were performed in Eppendorf Mastercycler with the following settings: an initial hot start at 98 C. for 2 min (DNA template only), melting at 95 C. for 45 s, annealing at 52 C. for 45 s, and extension at 72 C. for 2 min, and final extension at 72 C. for 10 min for 35 cycles. After the initial hot start, a master mix containing 10 mM reaction buffer, 25 mM MgCl.sub.2, 10 mM Forward and 10 mM Reverse primers, 10 mM deoxynucleotide triphosphates (dNTPs), 10 mg/ml Bovine Serum Albumin (BSA), between 100-200 ng/l total DNA isolated from samples, deionized water, and 2.5 U/l Tag polymerase was added to each sample.
[0290] PCR products were separated by electrophoresis in 1% (wt/vol) agarose gels in 1SBA buffer (Sodium Boric Acid) with RedGel (100 ng/ml) and running buffer; DNA bands were visualized by the fluorescence of the intercalated RedGel under UV light and photographed.
Sequence Analysis
[0291] The amplified fragments were inserted into the pGEM-T easy vector (Promega, Madison, Wis.) for sequencing, and the sequence of ITS regions were confirmed by sequencing at least three individual recombinant colonies using a Beckman Coulter (Brea, Calif.) CEQ8000 DNA sequencer. The sequence data were assembled and analyzed by the use of CEQ sequencing analysis software and MegAlign (Lasergene) and were then searched by using the ITS-1F and ITS4 primer sequences to define the ITS region. Each sequence was analyzed into the ITS region and was then separately used to perform the individual nucleotide-nucleotide searches with the BLASTn algorithm at the NCBI website. The outputs from the BLAST searches were sorted on the basis of the maximum identity and were recorded. Sequence-based identities with a cutoff of 99% or greater were considered significant in this study, and the best hit was defined as the sequence with the highest maximum identity to the query sequence.
TABLE-US-00015 TABLEO TheconsensussequenceofsampleAandsampleB. Consensussequences Sample AGTTGGGGTTTAACGGCGTGGCCGCGACGATTACCAGTAA A CGAGGGCTTTACTACTACGCTATGGAAGCTCGACGTGACC GCCAATCAATTTGAGGACAGGCATGCCCGCCAGAATACTG GCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGA ATTCTGCAATTCACATTACTTATCGCATTTTGCTGCGTTCTT CATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTT GATTTATTTATGGTTTTACTCAGAAGTTACATATAGAAACA GAGTTTTAGGGGTCCTCTGGCGGGCCGTCCCGTTTTACCGG GAGCGGGCTGATCCGCCGAGGCAACAAGTGGTATGTTCAC AGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGC TGGTTCACCAACGGAGACCT(SEQIDNO:3) Sample CCCGGGGCAAGGGGCGGGCGGCGTTGGATTTTGCGGGACC B CTTAACACCCGCTTCCAGCCGCGCGGGCGCCGCCGCCCCG AGGCCCGGCGCCGATCTAACAAGTAATACATCTCAAAGGT GTCCAACCGTATCCAACCAGTGGACGTCCGAGGGTCGCGC CGTTTGAGTGTCATGTTAATATCAACTCTGATGGTTTTTTG TTAATCATTGGATGTTGGACTTGGGGATCCCGTCACAGTCG ACTACTGATGAGTACTATAGACTACGCATCGCGCAGCTGA TATATTTAATGTCTACGTATATCAATCCATTAATAAA (SEQIDNO:4)
[0292]
[0293]
Raw sequence data for the samples are listed below:
TABLE-US-00016 SampleA-1Forward (SEQIDNO:5) CCGCGNGGAGGTTTCTGGACCGCTGTCCGACCGCGCCGCTCCGTTC GGCGCCGAGTTCCACTTTGTCCCCTCATTNATATTGTCAATTACGCGGGTA TTCCACCGATTCCAGCTCACTTCGAAGTTGGGGTTTAACGGCGTGGCCGCG ACGATTACCAGTAACGAGGGTTTTACTACTACGCTATGGAAGCTCGACGTG ACCGCCAATCAATTTGAGGAACGCGAATTAACGCGAGTCCCAACACCAAG CTGTGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATA CTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCA ATTCACATTACTTATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAACCA AGAGATCCGTTGTTGAAAGTTTTGATTTATTTATGGTTTTACTCAGAAGTT ACATATAGAAACAGAGTTTTAGGGGTCCTCTGGCGGGCCGTCCCGTTTTAC CGGGAGCGGGCTGATCCGCCGAGGCAACAAGTGGTATGTTCACAGGGGTTT GGGAGTTGTAAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACC TGTNACAACTTTNACTCCCTCTAATGACAAAATCACTANTGAATCCCGCCG CCGCAGTCACATATGGGAGAGCTCCCACGCGTGGATCTANCTGAGTATCTA TANGTCACCTAATACTGGCGTATCTGGTATACCGTCCCGGTAATGTTATCC CCCATTCCCCACTCACCGAACTAATGTAACGGGTCA SampleA-1Reverse (SEQIDNO:6) CCCTCTTTNAAATTCTTTTTAGGGGGGGGCGACTTCCCGGCGGGGCT ACTCAGTCATGGATCTCTGGATGCAATAANATATTAGCGATCTTCGCCNGT GAACCACGAGGAGGATCACNAGTGCAACCCCAAACCCCTGTGAACATCC ACTTGTTGCCGCGCCGATNCGNCCGCCCCCGTAAAACGGGACGGCCCGCC AGAGGACCCCTAAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATA AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG AACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA TCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCT GTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGT NAATTCGCGTNCCCTCAAATTGATTGGCGGTCACGTCAAGCTTCCATAGCG TAATAGTAAAAACCCTCGTTACTGGTAATCTCCGGCCACGCCGTAACCCCA CTTTGAATGTGACCCGATCGGTAGGATACCGCGAACTAACTATATACGAG A SampleA-2Forward (SEQIDNO:7) CCGGGCGGGAGGTTTNGTTAGGGATCCCGTCGCTCGACGCGCGCCG CGCCGGTCGGCGCGCGAGTGGCCATCGGTGTCCGCCTCATTCAGTATNGTC AAGTGTGACGCGGGTATTCCTCACCCGATTCCAGGTGCACTTCCAGAAGTT GGGGTTTAACGGCGTGGCCGCGACGATTACCAGTAACGAGGGCTTTACTA CTACGCTATGGAAGCTCGACGTGACCGCCAATCAATTTGAGGAACGCGAA TTAACGCGAGTCCCAACACCGAGCTGTGCTTGAGGGTTGAAATGACGCTC GAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGA TTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTTGCTG CGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATT TATTTATGGTTTTACTCAGAAGTTACATATAGAAACAGAGTTTTAGGGGTC CTCTGGCGGGCCGTCCCGTTTTACCGGGAGCGGGCTGATCCGCCGAGGCAA CAAGTGGTATGTTCACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCC TCCGCTGGTTCACCAACGGAGACCTTGTTACGACTTTTACTTCCTCTAAAT GACCAAGAATCACTAGTGAATTCGCGGCCGCCTGCAGGTCAACATATGGA GAGCTCCACCCGTGGATGCATANCTGAGTATCTATAGTGTCCCTAATACTT GGCGTATCATGGCATACCGGTTCCGTGTGAAATGTTATCGCTCACCATCCA ACAAATACNACCCGAAACTTAANGTTAACCGGGGGTCCTAATAGTGACCA CCCATTANTGCNTTGCC SampleA-2Reverse (SEQIDNO:8) CGGAGGTTTTTTGGGNCNCCGTCGCGACNAGGGCCCTCACTTGGAG CTCCGACCGGNCGCGCCAATTAACTCATGGATTTCGGGGATTTAGAGGAA GTAAAAAGTTTTAACAGGTGTCCCGTTGGTGAACCAGCGGAGGGATCTTAC CGAGTTTACACTCCCAAACCCCTGTGAACATACCACTTGTTGCCTCGGCGG ATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAAA CTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTT TCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATG CGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACG CACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTT CAACCCTCAAGCACAGCTCGGTGTTGGGACTCGCGTTAATTCGCGTTCCTC AAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAGCCCTC GTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTT GACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGC GGAGGAAATCGAATTCCGCGGGCGCCATGGCGGCCGGAACATCAACTTCG GCCAATCCCCTATATATGTATACATCCTGGCGNTTNACAACTGGACGGGAA ACGCGTACCACTATCCTGCNCATCCCTTCCCCGGCTATTCAAGCCCCCACC CTCCAATGCCCCAATGG SampleA-3Forward (SEQIDNO:9) CCGGAGGTNAGNCAGCACCCGCCCCTNGGAACCCNCCCATATTCTA CCTGTNACCCATTTAGGCATACAATTGGGTGAACGCTGGCCCACATACCTA ACAGGGCTACACTACCATGGAAGCCACTGACCGCCATCATTTGAGGAACG CAATTAACGCGAGTCCCAACACCGAGCTGTGCTTGAGGGTTGAAATGACG CTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAA AGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATTCGCATTTT GCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTT GATTTATTTATGGTTTACTCAGAAGTTACATATAGAAACAGAGTTTTAGGG GTCCTCTGGCGGGCCCGTCCCGTTTTACCGGGAGCGGGCTGATCCGCCNAG CAACAAGTGGTATGTTACAGGGGTTGGGAGTTGTAACCGTAAT SampleA-3Reverse (SEQIDNO:10) GGGCGTTATATCTTGTGGTCTCCCGCGCTTGAGGAGCTCTCCCATAT GTGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTCTTGGTCATTTAG AGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGAT CATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCACTTGTTGCC TCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACC CCTAAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATC AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG CAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATC TTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAG CGTCATTTCAACCCTCAAGCACAGCTCGGTGTTGGGACTCGCGTTAATTCG CGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTA AAGCCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTC TGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC AATAAGCGGAGGAAATCGAATTCCGCCGGCCGCCATGGCGGCCGGGAGCA TGCGAAGTCGGGCCCAATTCGCCCTATAGTGAGTTTTATTACAATTCACTG GCCCGTCTTTTACAAACNTTGTGACTGGG SampleB-1Forward (SEQIDNO:11) GGATCGCGCCGGGGGTGGGGCGGGGCCTTAAGATTTTACGAGAATT AGGTTAGAGATTTTGTCTTAGATCGAGACAGACTCAAGAATAGTTCATGGT CAAGAGTAGGATCTAACAAGTAATACATCTCAAAGGTGTCCAACCGTATC CAACCAGTGGACGGATCTTNACCGAGTTGGTGCGCAGGGGGCGCATCCCCT TGTCGAACCCACTACCCCTGGATGGCTCGTAGCTCCATCGGACGGGTGCCG GGGGGGGATCGCGTCACTGTCGANTACTGATGNGAACTATAGACTATNGA TCCGGGCAGCTGATATATCCNANATCTATGTATATNAATCCATNAATAAA SampleB-1Reverse (SEQIDNO:12) NNNNTGTTTTTCGGGCGCGTCGCGCGGGGCCCTCTCTGGGGAGCGT CCGCCGGNCGTCCGCCGNTTACACTAAGATGNATTTGCGAGCACGNGCTA ACATGAGATAGTTATAGGCGTTNCGAGTCTTTCTACGNGAGCTCAAATCCC CTAGNTCACTGAGNCTCCCCAGCACGNGCTACAGNCCTCCTTGCAGAGAG GGGCGCTCTCTTTCGGGATCAGAATATNTACACGGGCGAAAAAAGAGGGC CCCCNTNATANCNANACNCGAGACAGTGCGACAGNCTGGACNCNGNTACA CAGGTTCTGAGAGTCGNTGGNGNGGAAGAGAGTGAGACGGGNCAAACAG GGAAAACCANANAGNTCGAGTTTGTNCNGCNGTGGTNCNCNATNGGAAA AANCTCATCCCGTNGAAGGGCCCACCGANGAGCCCCCNACNAAAATNCTN GGGGTTGGGCCCGGCNCTNGTTCCNACCAAAAANGTNATNGTTCTNCTTGT AATNTCTGGGGGGGGNGTGCCCGCCCCCCNGTNCANGAATTNTANCANTA NGANCGNAANAGNNTGNTGGGCAAAAACGGAGGTTCCCTCNACNCTNGA ATATTAACATATTTCCCCCCCCACCAAAATATTGGTTCCTCCCACCCCGCC CCCCTTTTTGTGGGGCCCCCGCGGGTTTGGGGTTTCCAATTCCCTCGGCCT NTNTTGGCCAGAAGGAAGGTGGGGGGCNGCNGANGAAAAAAANTCCGCAAA NANGGCCANGTNCAAGTTGCNACNGCNAATNGTGGGGCCTNATTTTTGGA AACCANCAATTGGGGT SampleB-2Forward (SEQIDNO:13) CCGGGGCNGCCGGGGCGCGTCGCCGGCNGNCNGCGGCNCNTNGGC NGCCCGCNGCGCGAGCGCAGCGNGCCGGTGGTGCNCGCGCNCACCTCCCG TCCCACCTCCTTCGCGCTCGNTGCGCNCANCTCTATANTANGTNAGAGNAG ATNGAATACTAGNACTATACNTATACNTATAGCACGTAGGACGANGNAAG NGANTCNCGANATTTTTATTTGGCCGATTNTCCTATANTGNANANGGGGA AAANGGNAGNAATTTTTGAA SampleB-2Reverse (SEQIDNO:14) CGGCGGTGGGTTTGGCTCGTGGGCCNCCCGTGCGCGGGGGGCGCCG CCTCCCTTTTTGCGGACGCGTCCNGCCCGGGCGCGCCCGNCGCGGTANACG GCTANAGTGGAGTGTGTTGCAGTGCACGNGCTATACATGGTAGTAGTTAT AGGCAGTTGGGCNTGAGTACTGCTCTGTACNGGGAGNCTCAAATCCCATG AGTCCCGTGGAGGCTCCCCGACACGGGCGTACAGGCCCTCCTTTGAGAGA GGGGGCGCTCTCTTTTCCGGACAGANATATACGCGGGCGAAAANGAGGGCC CNCNTTTNTNTCGGNACNCNAGGGTCANGTNCNGAGCANGNTCNTAGNAC CCCCCGGGGAAACAACANGGTTTTNCTCGACGAAAGTNCGNGTGGGGGCG GGGGGAAAGAACCAAGTNGAAAGAACGGGGGCCCANTAACAGGAGGAAA AACCCAAAGANGANTCNGAATTTGTNCCNCNGTGGTNAACCNATNGGAAN GANCTTATNCNGTNGAAGGGCCNAGNGANGAGCCCCCNACNGACATNCTT GGGGGTTGGGCCCGGCNCTNGTTCCCAACCAANACCGGTTAATNGTTCCTC CCTTGTTTAATNTCTGGGGGGGGGGTNNGTGCCCCGGCCCCCCCCTCGGTT CAAAAGAAATTTNTAACCAAANAAGGAACGCAAAAAAGNNTGNGTGCCA AAAACCGNAGGTTCCCTCNACNCTNGAATTANACNNATTCCCNCGCCACC AAANATTTGTTCCTCAACNCGGCCCCCTTTTGTGGGGCCCCCGGGGTTTGG TGTTTCTAAATTCCTTGGC SampleB-3Forward (SEQIDNO:15) CCCGGCGAATGTTTTATGGGGTCATGTTCGACCGCGCCGTCCGGTTG GCGGAGTTNCATTTTCGTGATCTANAAGAGATAAAATGGCTAAACAGGTT TACCGTAGGTTATTANCCGCGGAAGGATCTTAACAGTTTTGAAGTGGGCTT GATGCTGGCTTGTAACAGAGCACTGTGCTCAGTCCCGCTCCAATCCATTCA ACCCCTGTGCACTATTCGGAGTGTTGCAAGCTAAGACAATGTGGGGAGTG GTCCCGGTTGTATTTCTAATGCGACTTGGGCTTACTTTCAAACGGTCAAGG CTTGTCCTCCGGTTTATATACAAACACTTTTATTGTCTTGTCGAATGTATT AGCCTCTCGTTAGGCGAAATTTAAATACAACTTTCAACAACGGATCTCTTG GCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTG CAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCT ATTCCGAGGAGCATGCCTGUTGAGTGTCATGTTAATATCAACTCTGATGG TTTTTTGTTAATCATTGGATGTTGGACTTGGAGGTTCGTGCTGGCTGCAAA GTCGGCTCCTCTTGAATGCATTAGCTTGGACCTGTGCGCGTTTGCTAGCGG TGTAATACATTTAATTCACCACGGGCCGTGTCACTATTAGGGTCTGCTTCT ATTCGTCCTACCGGACAATAATAACTTATGACCTGACTCAATAGGTAGACA CCCCGACTAACTTAATACCGAGAATCANTATCCGCCCGCGTACATGAAA SampleB-3Reverse (SEQIDNO:16) CCAGAAGGATTTNATGAAACAAGATAAGCAGAGGTCCCTCATCTTN GGACTCCGACGGCGNCGCCATATAACTCATGATTTCCCGCTCTATTGATAT GCTAAGTTTTTAGCGGGTAGTCCACCGATTTGAGGTCAGAGTCATAAAGTT TATTATTGTCCGGTAAGGACGATTAGAAGCAGACCCTAATAGTGACACGG CCCGTGGTGAATAAAATGTATTACACCGCTAGCAAACGCGCACAGGTCCA AGCTAATGCATTCAAGAGGAGCCGACTTTGCAGCCAGCACGAACCTCCAA GTCCAACATCCAATGATTAACAAAAACCATCAGAGTTGATATTAACATGA CACTCAAACAGGCATGCTCCTCGGAATAGCCAAGGAGCGCAAGGTGCGTT CAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATT TCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTT GTATTTAAATTTCGCCTAACGAGAGGCTAATACATTCGACAAGACAATAA AAGTGTTTGTATATAAACCGGAGGACAAGCCTTGACCGTTTGAAAGTAAG CCCAAGTCGCATTAAAAATACAACCGGGACCACTCCCCACATTGTCTTAGC TTGCAACACTCCGAATAGTGCACAGGGGTTGAATGATGGAACGGACTGAC ACAGTGCTCTGTACAGCCACATAAGCCACTCAACTCGTATGATCTTCCGCA GTACTACGAACTGTACATTTATTCCCTATACA
[0294] The Sample B fungus used in this study was taken from a rotted-elm tree in Binghamton University Garden, Binghamton-New York. Sample A fungus was isolated semi-selectively from sample B which was grown on Nutrient Broth Medium, Trametes defined medium, and Candida albicans selective medium. The candidate fungi A and B were submitted for molecular characterization to the Molecular Biology lab in the Department of Sustainable Bioproducts at Mississippi State University.
TABLE-US-00017 TABLE P Comparison of Gen-Bank top hits for the ITS region No. of ITS matches/ Organism ITS % ITS no. identified Isolate identified identity in GenBank Sample A Fusarium 100% 328/328 oxysporum Sample B Trichaptum 99% 551/558 biforme
[0295] The characterization results showed that the fungi selection in the previous study lead selection of Fusarium oxysporum over Trichaptum biforme; it should be noted the fungi chunk can have some impurities.
[0296] Polycyclic organics can be degraded by Fusarium oxysporum and Trichaptum biforme, as well as, Penicillium italicum (P. italicum), Glomerella cingulata (G. cingulata), Aspergillus flavus, Colletotrichum alatae, Fusarium solani, Ceriporiopsis carnegieae, and Xenoacremonium falcatus. The type of extracellular enzymes released to the medium by these fungi, and their growth pattern and performance have an impact on their PAA degradation, which might be the reason for the time required to achieve full degradation of the membranes.
[0297] Full degradation refers to when the fungi have completely consumed the PAA membrane. As seen from the Table N above, 1H NMR did not show any peak related to PAA polymers and the polymer has been totally, or nearly totally, degraded.
Cytotoxicity Characterization of Ternary PAA Membranes
[0298] PAA membranes did not show any cytotoxic effects on non-cancerous and cancerous cell lines. Since the membranes synthesized here are different, their cytotoxicity on non-cancerous IEC6 and cancerous A549 cell lines were tested as well. Two different membranes from
[0299]
[0300] PAA-A-GA of
[0301] Good 3D cell culturing supports possess high transparency and low-background fluorescence ability for high quality light microscopy and fluorescence imaging. Stiffness of the support material is a factor for proper cell migration because cells must apply cytoskelatal forces for movement instead of passive-movement driven by fluidity of the support material or the system. This is possible by providing solid stiff support materials.
Antimicrobial Activity of the Films
[0302] The featureless membranes synthesized according to
[0303] Antibacterial activity of ternary PAA membranes.
[0304] The introduction of pAS or 5AS was found to advance the antibacterial activity of the disclosed films. Antibacterial activity refers to the fact that the disclosed film will not cause the growth of bacterial and hence will preserve contained food.
[0305] To visualize bacterial development, plate counting method was utilized. Incubations were made up to three days, and no bacterial colonies were observed. The disclosed films provide about a 99.999% reduction of bacterial growth.
[0306] Similarly, 5AS, pAS and pAB enhanced PAA membranes showed good antibacterial activity against Aeromonas hydrophila, Pseudomonas aeruginosa, Escherichia coli DH5alfa, Listeria monocytogenes strains F2365 and HCC7. Good antibacterial activity of the PAA membranes can also be displayed against other gram-positive and/or gram-negative bacterial species. Gram-positive species other than Listeria monocytogenes, can include Staphylococcus epidermidis. Gram-negative species other than Escherichia coli, Aeromonas hydrophila, can include Enterobacter aerogenes and Citrobacter freundii.
[0307] Virulent type strain L. monocytogenes were grown in a rich medium such as brain heart infusion (BHI). Lysogeny broth (LB), a nutritionally rich medium agar also used for the maintenance of the tested E. coli. The bacteria were taken from the culture collection unit 80 C. freezer in department of Basic Science, College of Veterinary Medicine, Mississippi State University Mississippi-USA.
[0308] Even though 5AS enhanced-PAA membranes showed that good antimicrobial activity includes showing antifungal activity, it disrupted membrane mechanical properties with over 0.5 mg/mL usage while pAS can be used up to 2 mg/mL for PAA membrane preparation. So, the packaging membrane can contain 0.5 mg/mL pAS and 0.1 mg/mL 5AS, which provides good physical and antimicrobial properties. However, it should be mentioned that selection of antibacterial molecule is also affecting the color, so instead of pAS/5AS, pAS and 5AS can be used independently at different concentrations.
[0309] As seen from
[0310] For well
[0311] For the well in
[0312] Aeromonas hydrophila was tested on membranes for 24h and 48h incubation. For
[0313] As a note, as seen from
[0314]
[0315]
[0316] Antifungal activity of some ternary PAA membranes is shown in
[0317] Poly(amic)acid polymer has been synthesized from 4,4-oxydianiline (ODA) and pyromellitic dianhydride (PMDA) in anhydrous N,N-dimethylacetamide. Three procedures have been applied to develop antibacterial and antifungal PAA membranes and thin films. (i) entrapping p-aminosalyclic acid (1 mg/mL) into PAA thin film, (ii) polymerizing p-aminosalyclic acid (1 mg/mL) via glutaraldehyde, followed by introduced to the PAA thin-film, and (iii) entrapping p-aminosalyclic acid (1 mg/mL) in PAA membrane. Thin films were prepared via controlled solvent evaporation method while membrane was prepared via coagulation-based phase inversion where 2 h controlled evaporation under hood was applied to increase pore-size. 1 mg/mL p-aminosalicyclic acid was shown to eliminate both E. coli and S. epidermidis under the testing conditions.
[0318] Scanning Electron Microscope (SEM) images of
[0319] Antibacterial activity of p-aminosalyclic acid supported PAA thin films and membranes on Escherichia coli ATCC 25922 (E. coli, gram) and Staphylococcus epidermidis ATCC 12228 (S. epidermidis, gram+) are shown in
[0320] The results indicate that capturing p-aminosalicylic acid in PAA membranes did not show a descent antibacterial activity towards both E. coli and S. epidermidis. However, as seen from
[0321] The results indicate that thickness of PAA thin film and eligibility of the molecule to transfer from inside of the membrane to the media (PAA membrane), and possible non-covalent modifications done on thin film enhances their antibacterial capability.
1.10 Surface Characterization
[0322] Surface characterization of the membranes synthesized according to
[0323] SEM image of PAA membrane of
[0324] SEM image of PAA-A-GA membrane of
[0325] SEM image of PAA-A-GA membrane of
[0326] SEM image of PAA-A-GA of
[0327] SEM image of PAA-CA-GA of
[0328] SEM image of PAA-SA-pAS-GA membrane of
[0329] SEM images of PAA-W-GA membrane are shown in
[0330] SEM images of PAA-W-GA and PAA-SA-GA membranes are shown in
[0331] Surface characteristics of all synthesized PAA membranes did not show any difference in response to alteration in PAA concentration (from 0.08 M to 0.20 M range), GA concentration and small molecule and its concentration. However, at macro-scale all parameters affected the eye-visible membrane surface. Addition of organic solvents include methanol, ethanol and tetrahydrofuran did not make any difference on surface characteristics. Here, the most dramatic change in surface characteristics were seen in parallel to changes in procedure. Here, three major surface types were obtained; featureless, macro-porous and woven-like surfaces. Nearly all the procedures provided featureless membrane surface; pore-free surfaces can be a good barrier against penetration of oil, water-vapor and gas transfers.
[0332] SEM image of PAA-GA are shown in
[0333] The right figure is top face
[0334] As illustrated and discussed above, both
1.10 PAA Concentrations
[0335] PAA concentration was selected as 0.16, 0.18, 0.20 and 0.25 M based on the pore size of pure PAA membrane obtained via phase-inversion. PAA solution's viscosity was not measured with an instrument; if the viscosity is low enough to be stirred with stirring magnet at high speed, the concentration was accepted as good. The following optimizations were obtained from FIG. a. 0.18 M was selected as best concentration for
[0336] In addition to viscosity, other parameters were considered including the ratio of ODA to PMDA, temperature of the medium and the speed of stirring showed great impact on PAA formation; in optimum conditions, the PAA concentration is 0.08 M in the cases of 1.00:1.03 ODA:PMDA ratio at 40 C. under mild mixing (i.e. between 400-600 rpm). The mixing should be enough to totally dissolve PMDA at less than 120 seconds but no earlier than 30 sec. In the case of 0.12 M, ODA:PMDA a good ratio was found to be between 1.00:1.04 at 40 C. under mild mixing to obtain viscous PAA solution. However, the formed PAA solution was highly viscous.
[0337] In the case of high temperature such as 70 C., PMDA was dissolved in seconds and the resulting 0.12 M PAA solution was not as viscous at 1.1:1.0 ODA:PMDA ratio. Similar results were observed for 1:1 ODA:PMDA ratio at high temperatures. At 40 C., 1.00:1.10 ODA:PMDA ratio, 0.12 M PAA became less viscous than 1:1 ratio. So, it can be concluded that a good PAA concentration is 0.08 M or 0.12 M for
TABLE-US-00018 TABLE Q Summary of optimization of ODA:PMDA ratio, stirring speed and temperature needed to produce viscous PAA solution. Observation ODA:PMDA Stirring viscosity low, ratio speed Temperature Time high, same? 1.00:1.00 400 25 C. Overnight Mild 1.00:1.01 400 25 C. Overnight Mild 1.00:1.02 400-600 40 C. Overnight High 1.00:1,02 400 50 C. Overnight Very high 1.00:1.02 400 60 C. Overnight Mild 1.00:1.02 1200 70 C. Overnight Very low 1.00:1,02 400-600 70 C. Overnight Low 1.00:1.04 400 40 C. Overnight Mild 1.00:1.05 400 40 C. Overnight Low 1.2:1.0 400 25 C. Overnight Very low
[0338] The choice of appropriate solvent depends on three parameters as (i) environmental-friendliness, (ii) chemistry such as reaction yield and (iii) engineering which is more of scalability and ease of down-stream process. Environmental aspects of solvents are regulated by US Environmental Protection Agency (EPA). Chemistry and engineering are defined by the process itself and aim of the study.
[0339] The solvents aim to meet the following requirements: the solvent must be neutral to all members of the reaction mixture, including reactants, products as well as catalysts; if the solvent is a provider of any group such as O, H, that should be just a carrier; the solvent must be liquid at the reaction condition such as if the reaction is happening at room temperature the solvent should not require higher degrees to be liquid; if the phase split is required for the solvent that should be preferred; the solvent should provide the desirable solubility for the reactants as well as products if it is required; the solvent should not undergo association or dissociation; and the solvent should selectively dissolve reactants or the possible products if it is desired.
[0340] In order to obtain greener membranes (those with a smaller ecological impact), DMAC was combined with ethanol at varying ratios. Ethanol is generally accepted as a green solvent. However, the criteria listed above were taken into account in the selection. The goal was to use as high a percentage of ethanol as possible while minimizing the volume of DMAC employed. Ultimately, an optimum condition is sought that will provide the highest benefit. Determining the possible highest Ethanol:DMAC ratio was done using only two parameters; (i) the physical properties of the membrane and (ii) the aim of application of the membrane.
[0341] The observed characteristics of the membrane were (i) durability, (ii) resistance against solvents and (iii) mechanical properties. 65:35 Ethanol:DMAC ratio was accepted as a good ratio to develop 0.12 M PAA membrane with 1.00:1.03 ODA:PMDA ratio at 50 C. medium temperature under mild mixing. However, the PAA polymer formed in 65:35 Ethanol:DMAC ratio did not form fluorescent active membrane, so it is not advised for fluorescent active membrane formation. Actually, introducing ethanol into PAA solution prepared in only DMAC still disrupting formation of fluorescent active membrane formation.
TABLE-US-00019 TABLE R Determining good conditions for Ethanol:DMAC ratios in membrane preparation. Mixture Observation 50:50, DMAC:EtOH Viscosity high, require warming up (i.e 50 C.), and forming membranes that are strong but hard to obtain different colors 35:65, DMAC:EtOH Viscosity mild, require warming up (i.e 50 C.), and forming membranes that are strong, but hard to obtain different colors 35:65, DMAC:EtOH Viscosity mild, require warming up (i.e 50 C.), and forming membranes are strong, require the addition of 2% water to obtain desired colors 25:75, DMAC:EtOH Viscosity acceptable, require warming up (i.e 60 C.), and forming membranes that are strong, but hard to obtain different colors 35:50:15, Viscosity acceptable, require warming up (i.e DMAC:EtOt:Water 60 C.), and require special care to form good membranes, but provide desired different colored membranes 30:50:20, Viscosity low, require warming up (i.e 60 C.), DMAC:EtOH:Water and require care to form good membranes, but provide desired different colored membranes 60:40, DMAC:Water Did not form PAA viscous solution 60:30:10, Did not form PAA viscous solution DMAC:Water:AcOH *PAA concentration employed was 0.12 for all experimental conditions indicated.
[0342] Water:Ethanol:DMAC and Ethanol:DMAC mixtures were tested as well. In all cases, PAA concentration was kept constant at 0.12 M. The following solvent mixtures were obtained a good reachable ratio as 15:50:35 (water:ethanol:DMAC) and 75:25 (Ethanol:DMAC). However, it was shown that 20:50:30 (water:ethanol:DMAC) ratio is possible, but the PAA solution should be used within 2 days, otherwise PAA precipitates in the solution due to presence of high water content and low DMAC ratio.
[0343] However, it was noted that introduction of water to the solvent system eliminates the ethanol effect of preventing colorful and fluorescent PAA membrane formation. Methanol was not tested with combination of DMAC; ethanol is less toxic in comparison to methanol. However, methanol, ethanol and water containing 0.1 M hydrochloric acid (HCl) were tested individually, but viscous PAA solutions were not obtained.
Optimization of Small Molecule Concentrations
[0344] Optimization of the small molecule concentrations were performed for the membranes synthesized according to
[0345] However, for the membranes synthesized according to
[0346] Structures of the small molecules used in
[0347] For all PAA concentration, 2 mg/mL chitosan (CS) [Low-molecular weight chitosan, Sigma-Aldrich] concentration can be used. CS mediated increase in the viscosity of PAA solution showed distinct characteristics; At 0.5 mg/mL, 1 mg/mL and 3 mg/mL of CS, PAA solution became highly viscous. From observations, CS is insoluble in DMAC: so it is clear that yellowish CS flanks are in PAA solution, which causes un-uniformity.
[0348] Cellulose acetate (100 kDa molecular weight) completely dissolved resulting in a clear solution when mixed with PAA solution despite the fact that cellulose has similar structure to CS. PAA and PAA-CA solutions exhibit similar color and uniformity with no air bubble in PAA-CA unlike PAA-CS mixture. The formation of the air bubbles resulted from combination of insolubility of the small molecule and high viscosity. When the PAA-small molecule mixture was stirred at 100 rpm for 10-30 min, the air-bubbles disappeared. Interestingly, CA at 1 mg/mL concentration makes PAA solution highly viscous which is like solid, so it is concentration should be used less than 0.5 mg/mL. Even at 0.5 mg/mL concentration, PAA-CA solution became viscous which made it eligible for membrane preparation by water-bath mediated phase inversion.
[0349] D-glucosamine (DA) is one of the two monomers in chitosan molecule, so they were expected to possess similar properties. Similar to CS, DA was not soluble in DMAC. However, when 1 mg/mL concentration of DA was dissolved in PAA solution, the resulting mixture became highly viscous resulting in even higher viscous solution than PAA-CA. Hence the optimum concentration of DA needed should be less than 0.5 mg/mL concentration in 0.20 M PAA, but 1 mg/mL works for 0.18 M PAA.
[0350] L-Alanine (A) can be used at 1 mg/mL concentration; higher concentrations were not tested because 1 mg/mL gave desirable viscosity even at 0.20M PAA solutions. A does not dissolve in DMAC, its insoluble crystals are visible in PAA-A solution; however it is possible some of A dissolved because in terms of mechanical properties PAA-A membrane was good. Its plastic-like structure did not turn brittle even at six months' exposure in the hood. Similar characteristics were observed for 3 weeks with PAA/PAA-W/PAA-CA composite membranes; when prepared using layer-by-layer casting on glass. In order to develop more durable membranes based on
[0351] Based on contact angle measurements data, this composite produced the highest hydrophobicity among
[0352] L-lysine (K) shows similar pattern to A, but it makes PAA solution much more viscous at the same concentration. A good concentration should be less than 1 mg/mL at 0.18 M PAA. At 0.20 M PAA concentration, 0.5 mg/mL of K produced a highly viscous PAA-K solution.
[0353] L-Cysteine (C) was selected because it has a free SH group. Introducing C to CS membrane via GA makes CS membrane very flexible. Like-wise K, C is not soluble in DMAC. Interestingly, it was observed that C forms fibrils in DMAC and during membrane preparation these fibrils resulted in blocks within the PAA-C membrane shown in
[0354] For the amino-acids of
[0355] L-isoleucine (I) can be used at less than 1 mg/mL concentration, at which concentration desirable PAA-I viscosity can be obtained. In this study, 0.5 mg/mL-3 mg/mL were tested at 0.20M PAA solution, and in all cases the extremely high viscosity of the mixture did not allow membrane formation. However, 0.5 mg/mL I was a good concentration at 0.18 M PAA solution for desired fluidity during membrane preparation.
[0356] Likewise, L-Tryptophane-methyl ester (W) can be used at less than 0.5 mg/mL concentration, at which concentrations desirable PAA-W viscosity could be obtained. In this study, 0.2 mg/mL-1 mg/mL were used at 0.20 M PAA solution, and in all cases extremely high viscosity did not allow membrane preparation. However, 0.5 mg/mL W could be used at 0.18 M PAA solution to get the desired fluidity. For the same concentrations, PAA-W gave the highest viscosity. W, gave unexpected results for
[0357] Glycine (G) and L-Aspartic Acid (D) exhibit similar pattern to A, but makes PAA solution much less viscous at the same concentration, hence the optimum concentration should be at about 1 mg/mL at 0.18 M PAA.
[0358] After PAA-W, PAA-R (L-Arginine (R)) has the second highest viscosity [these are just based on observations]. 0.2 mg/mL R can be used with 0.20 and 0.23 M PAA; 0.25 M PAA. 0.5 mg R was observed to give a good concentration at 0.18 M PAA solution. However, the formed membranes did not provide durable membranes; keeping the membrane at room temperature for 2 days made the membrane brittle.
[0359] L-Threonine (T) can be used at 0.5 mg/mL for 0.20 M PAA and 0.18 M PAA solutions. However, similar to L-arginine, T made the PAA membrane brittle within 3 days after drying.
[0360] All these amino acids were introduced to the PAA solution immediately after the formation of PAA solution as described in FIG. a. However, these biomolecules were added to the system at the same time with ODA. The resulting PAA solutions showed similar characteristics. All these characterizations were made for
Optimization of Cross-Linker Concentrations
Optimization of GA Concentration:
[0361] For desirable PAA membranes, the following parameters were found to be factors: Concentration of GA stock [Sigma-Aldrich, 70% Glutaraldehyde] solutions, the final concentration of GA when mixed with PAA solutions, age and temperature of GA added to the PAA solutions are highly important in terms of obtaining desirable PAA membranes. Age of GA is a term used here to describe what type of pre-treatment was applied to GA before it was introduced to PAA solution. Temperature of GA refers to that at which temperature GA was incubated before it was introduced to PAA solution.
[0362] There are similar procedures to age GA, but the way of aging in this study is not related to time, rather it is related to temperature. Aged GA, in general, provides distinct results than fresh GA during crosslinking. General rules in optimization of GA can be listed as below: concentration of GA stock is a factor in terms of how much water is introduced to the PAA solution; even though water provides a working microenvironment to GA, it can disrupt the cross-linked PAA membrane formation and also cause localized phase inverted PAA membrane formation in the PAA solution's vial, or during the membrane formation. So, it is advisable to use high stock concentration if the
[0363] Concentration of GA added to the PAA solutions should not be over the concentration at which it makes pure 0.16 M or 0.12 M PAA solutions solid less than 15 min and 30 min, respectively. Beyond this point, the leads to the formation of easily breakable PAA membranes. Similar observation was shown for PAA-CS.
[0364] Further optimization can be performed for each molecule accompanied with PAA.
[0365] However, it should be noted that incubation time also matters in defining the degree of cross-linking. When GA is less than 0.35%, the resulting PAA membranes are in between pure water phase inverted PAA membrane resulting in plasticized form.
[0366] However, higher GA concentrations such as 2% GA convert PAA solution into completely non-fluidic within 3 min, which was observed in
[0367] Age of GA defines its active individual GA molecule and degree of auto-polymerization. NMR characterization and further explanations are provided above.
[0368] GA stock vial should be kept in the hood until before being placed at room temperature for approximately 10-20 min; when the GA stock has been left at 4 C. needs 10 min, and it is then transitioned into room temperature, its viscosity decreases and becomes highly fluidic (for 25% or less forms), which was concluded based on observations through preparing different concentrations from 70% stock. When it is introduced directly from the refrigerator, it forms localized phase-inverted PAA membranes using the PAA solution.
[0369] Another point with respect to GA is that it must be thoroughly mixed with dry-DMAC before introducing it to PAA viscous solution. Moreover, there are two observations in this application as (i) adding GA into DMAC containing vial causes heat formation. In that respect, DMAC should be added slowly to the GA containing vial [note: the resulting heat may not increase the temperature up to flash point of DMAC but being cautious is advisable because mixing 25% stock GA with DMAC releases heat causes over 40 C.]. Increase in heat is possibly related to water-DMAC interaction since the same amount of GA in less water content added to the DMAC released less heat. The second observation (ii) is that using the stock solution of GA is different than GA that has been mixed in water. Pretreating GA with DMAC gives better membranes and causes no local membrane formation in PAA viscous solution. The PAA membranes prepared using
[0370] The overall result of addition of GA to PAA viscous solutions from stock GA [
Optimization of 1, 1-diimidazole
[0371] 1, 1-diimidazole (IZ) was employed as a solid by slowly adding the solid particles into PAA solutions. Introducing over 1 mg/mL IZ to the PAA solutions at once causes localized orange color solid formation. However, IZ's original color is pale-yellow. Besides; IZ-treated PAA forms heterogeneous membrane, for instance the inner part looked similar to the non-cross-linker treated PAA membranes while the outer layer looks more like a plastic [Synthesized as described in
[0372] IZ works slower than GA for membrane formation; while GA requires less than 3 min to increase the viscosity up to the desired level, IZ requires 15 min at 0.16 M PAA while 45 min requires at 0.12M PAA. The final membrane is physically similar to GA-treated PAA membrane. In order to prepare a totally plasticized-membrane, 3 mg/mL IZ should be added to the system under
[0373] Likewise, EDC/NHS, the use of glutaric acid [Sigma-Aldrich, MO] did not provide any plastic-like membranes. However, glutaric acid simply enhanced the IZ's activity to make PAA solutions' viscosity high enough to be prepared membrane relatively quick. It should be emphasized that plastic-like structure does not mean just being a transparent membrane, which is common for evaporation mediated phase inversion, but that means formation cross-linker mediated membranes. Neither carbodiimidazoles nor glutaraldehyde required EDC/NHS to modify PAA molecules. These combinations did not require EDC/NHS for crosslinking. Extensive tests were performed for GA, and NMR data show that GA covalently binds to PAA without the use of any EDC/NHS intermediate (discussed above).
[0374] Treating PAA with DCC until the PAA solution became solid resulted in vibrating solid which was seen for GA treated CS solution. This effect was not seen for GA treated PAA, and was observed for relatively lower in the cases of IZ treated PAA. For IZ, it could be related to lower and localized solubility of IZ in viscous PAA solution. The vibration property was not tested with an instrument: it was visually observed.
Time-Dependent Alterations in Membrane Physical Characteristics.
[0375] Incubation of PAA with a cross-linker alters its physical and chemical characteristics. These changes both depend on the type of cross-linker and the biomolecule used to modify PAA. Glutaraldehyde is highly active molecule, and it is not easy to control its diverse binding to PAA and other small molecules. Immediately after the phase-inversion, most of the PAA membranes protect their flexible natures. The membranes other than L-cysteine, L-alanine and chitosan modified PAA membranes did not protect their plasticized nature after about a week. However, the mentioned three membranes protected their plasticized nature well over 6 months. Measurement did not exceed 6 months. However, in parallel to increase in phase inversion incubation in water they become brittle, which takes weeks to months [Synthesized as described in
[0376] Phase inversion or the process of transformation from solution state to solid state is a technique in preparation of membranes. It is used from micro-filtration to gas separation applications. Four main approaches have been described for phase inversion; (i) coagulation bath mediated phase inversion, (ii) heat triggered phase inversion, (iii) precipitation from vapor phase and (iv) evaporation in non-solvent.
[0377] Pore formation on the top layer of membrane through coagulation-bath mediated phase inversion forms due to flow of non-solvent into the membrane while the thickness of membrane's skin layer depends on flow of solvent from inner part of membrane into the coagulation bath. However, open-pore formation also requires coalescence in the polymer-poor area which is right under the top-layer. The relation between solvent and polymer itself, and solvent and non-solvent are also important in determining the characteristics of the pores. For example, in the presence of high affinity solvent and non-solvent, macrovoids are formed.
[0378]
[0379] Solvent refers to the solvent used to prepare membrane solution while non-solvent refers to the solvent used in the coagulation bath (which is also not supposed to be main solvent for the membrane). The solvent can be any suitable solvent capable of dissolving other substances, such as ethanol, methanol, and combinations thereof. The non-solvent can be any suitable material that is not capable of substantially dissolving other substances, such as water.
[0380] Besides altering the non-solvent, addition of non-solvent into solvent (casting solution) also makes difference in pore formation. While a very fast desolvation of solvent into non-solvent forms finger like structures and cause no or rare pore formation, addition of solvent into non-solvent allows porous surface formation because this situation reduces solvent desolvation into the non-solvent. However, addition of non-solvent into the solution before it is casted, less porous surface with a less dense surface forms. The solvation power of solvent also possesses strong effect on pore formation for instance a less solvation power provides more pores on membrane surface.
[0381] The membrane formation process here is mostly driven by combination of glutaraldehyde, evaporation and coagulation-bath/glutaraldehyde evaporation. When there is no glutaraldehyde in the system, even the speed of stand-alone membrane formation through evaporation is reduced. However, it should be mentioned that this does not mean that GA enhances solvent evaporation. Faster formation of stand-alone membrane implies that GA cross-links individual polymers leading into macro-polymeric systems by which stand-alone membrane formation eliminates high percentage of DMAC removal from the system.
[0382] In the method used herein glutaraldehyde is not only functioning as a cross linker, it is also transforming the resulted PAA into optically active form such as fluorescence active forms. These bindings alter the membrane formation; the very basic alteration is the rate of solvent evaporation. Here, encrossslinking was used to refer extensive crosslinking.
[0383] As explained for PAA-GA, PAA-CS-GA, PAA-A-GA, PAA-DA-GA and PAA-C-GA, the concentration and activity of GA (i.e. heat treatment and pre-treatment with DMAC) showed dramatic effect on the resulting PAA membranes synthesized according to
[0384] For some small molecules, the membrane showed thin inner solid layer which was then disappeared when the membrane was incubated under hood for 6 h or more, which refers to a continuing progress of membrane formation. However, in the cases of higher GA concentrations and/or enhanced activity of GA, formation of plastic-like and transparent membrane surface didn't show any requirement to sonication in methanol/ethanol or drying under hood. It is evident that GA alters the kinetics of membrane formation; additives were shown a role-player in the kinetics. In the cases of the membranes synthesized according to
[0385] In
[0386] Similarly, losing the shiny outer surface appearance can be explained by the quenching activity of methanol on the activity of GA crosslinking. However, when methanol/ethanol bath was accompanied with sonication, membranes then can be synthesized porous. In the cases of high GA concentrations, the membranes can also be made porous if they are sonicated in methanol/ethanol bath. In essence, surface patterns of
[0387] Another test was performed to determine how glutaraldehyde, small molecule and the final step of phase-inversion affect the final texture of PAA membranes. The co-polymers were left in a vial overnight and the resulted PAA co-polymers were sticky gels. Then, they were exposed to evaporation under hood, phase-inversion in water-bath, methanol, methanol-water mixture, and ethanol and ethanol-water mixtures. PAA-W-GA and any other PAA co-polymers enhanced with sulfanilic acid provided plastic-like membrane surfaces under all final phase inversion conditions, but only sonication in organic solvent (i.e. methanol and ethanol) made the membranes fully plastic-like; as shown for
[0388] This is evidence that the speed of solvent removal from the inner part of the membrane is one of the parameters in order to form totally plastic-like membranes. Besides, sonication allowed the membranes possess porous surfaces in organic solvents; even though ethanol works better such as 80% ethanol is enough for porous surfaces while methanol can be 100%, methanol bath treated membranes showed better durability. Besides, introduction of organic solvents such as ethanol, hexane and others into co-polymerization media did not affect the pore formation as well. Introducing solvent into coagulation bath was shown a parameter to make flat membranes porous, but the approach did not work for the membranes synthesized according to
[0389] Classical pore preserving agents include PEG 400 or any other agents weren't tested to make the membranes porous since the goal was just to understand how membrane formation progresses under different conditions.
Preparation of Ternary PAA Membranes
[0390] Images of several films are shown in
[0391] The casted solutions shown in
[0392] The resulted membranes showed quite-similar characteristics with PAA-CS-GA membrane
[0393] PAA-GA
[0394]
[0395]
[0396] GA concentration and its form are important in terms of membrane characteristics. Besides, viscosity of PAA solution is important. As seen in
[0397]
[0398] 0.32 M highly viscous (no fluidity) was treated with 0.25% GA for 6 h at room temperature, followed by casted on glass and phase-inverted according to
PAA-GA
[0399] As seen from
PAA-CS-GA:
[0400] Here three different PAA-CS-GA were shown how glutaraldehyde affected color formation and formation of plastic-like structure. As seen from
PAA-A-GA
[0401]
PAA-C-GA and PAA-DA-GA
[0402] Dilution of GA in DMAC totally altered the view of PAA-DA-GA even though same GA concentration was used. PAA-DA-GA (
PAA-pAB-GA, PAA-W-GA, PAA-pAS-GA
[0403] pAB is also another small molecule altered overall view of PAA. In all cases, aged GA was used for preparation of PAA-pAB-GA membranes. As seen from the
[0404]
1.13 Application of PAA Membranes for Food Packaging
[0405] Cheese, pepperoni, apple and walnut were used to test packaging properties of the membranes.
[0406] The formed films are shown in
[0407] The films were sterilized rinsing 70% Ethanol, followed by rinsing with excess pure water (18.2 M), which were finally treated with 1 h UV light. Food samples were kept in fridge at 4 C. Cheeses and pepperoni protected their stability for the tested period, 3-6 months.
[0408]
[0409]
[0410]
[0411] The disclosed films can be used as a packaging material but at least a portion of the film makes no direct contact with the food sample. Any volatile or semivolatile organic vapor that is produced as a result of food spillage is drawn on to the sensor/packaging PAA. The sensor responds via a visible color change and a measurable change in conductivity using an optional conductivity monitor that is placed on the package. The concentration of the emission of volatile organic compounds (VOCse.g., sulfur compounds, acetone, methyl ethyl ketone, toluene, ethylbenzene, m,p-xylene, styrene, and o-xylene) largely increased over the storage time and should be correlated with the total number of microbial numbers. This should allow a rapid detection of food spoilage and may also allow consumers to visually determine food freshness. The PAA film can also detect pH-related changes in the air around the food (e.g. ammonia, alcohol).
1.14 Thermoplastic Examples
[0412] This example includes formulations that are capable of forming a PAA film that i) softens when heated (thus allowing the film to be molded to different shapes and sizes); ii) is flexible and undergoes crystallization transitions by incorporating sulfur-containing monomers, fatty acids, ionic salts and liquids, and plasticizers between the different functional groups; and iii) is resistant to shrinking while retaining good strength and chemical stability.
[0413] In this example, these films can exclude, wholly or partially, the formation of covalent bonds while increasing ionic properties, mechanical strength and dissolution. The resultant film in this example is referred to as Thermoplastic PAA.
[0414] Unlike a thermoset PAA polymer that is held together via irreversible chemical bonds, Thermoplastic PAA is relatively weakly held together through electrostatic interactions and Van der Walls forces. These relatively weak bonds in the thermoplastic polymers allow them to be re-usable, relatively soft when heated, and to be molded and remolded one or more times.
[0415] This ability to reuse thermoplastic typically means a higher recyclability. Also, other properties such as good strength and a tendency to resist shrinking is realized by these Thermoplastic PAA films.
[0416] These Thermoplastic PAA films can be made more thermoplastic by reacting sulfur containing monomers (e.g. 4,4-thiodianiline; an analogue of 4,4-oxydianiline) in a stoichiometric ratio of acid/amine functionality and other additives. Examples of Thermoplastic PAA Films include but are not limited to those shown in Table S.
TABLE-US-00020 TABLE S Examples of Proposed Thermoplastie PAA Film Formulations
[0417] Various Thermoplastic PAA films can be developed using various calculated concentrations of acid/amine, plasticizers, and monomers. These concentrations can be derived using the concept of critical branching coefficient. Mixtures of Thermoplastic PAA films can incorporate plasticizers (e.g. adipates, phthalates, and citrates) and/or two polymer chains (e.g PAA and chitosan) interacting via hydrogen bonding and electrostatic forces. The main polymer chains can move freely using these formulations.
[0418] Additional formulations can include the use of shorter or longer alkyl chains and a range of other dicarboxylic acids (e.g. oleic acids, palmitoleic acid, sapienic acid, and linoleic acid). Other materials to be added for the formation of the Thermoplastic PAA films can include low to high polarity esters (e.g. nitriles, polychloroprene, chlorinated polyethylene and epichlorohydrins) in order to decrease the attraction between polymer chains to make them more flexible. A range of esters (e.g. sabacates, terephthalates, gluterates and azelates) are options. These polymers can be synthesized in environmentally-friendly solvents.
[0419] The Thermoplastic PAA films can be analyzed in several ways, for example their structures can be characterized using 1H and 13C Nuclear Magnetic Resonance (1H NMR) Spectroscopy and Heteronuclear Single Quantum Coherence (HSQC) spectroscopy of the 1H-13C system. The polymerization can be validated via Infrared Spectroscopy (IR) by analyzing changes in the functional groups. The molecular weights can be determined via size exclusion chromatography. Also, Differential Scanning Calorimetry (DSC) can be used to study the thermal transitions of the polymers.
[0420] These Thermoplastic PAA films exhibit a decrease in the glass transition temperature (Tg) for the films containing plasticizers in their DSC curves. For all formulations, the appearance of a crystallization temperature (Tc) peak is evident in the DSC curves. This peak indicates the crystallinity of the polymers upon cooling, which also suggests thermoplasticity. Also, these films have an increase in plasticity and a reduction in rigidity due to an absence or a relatively low amount of covalent crosslinking.
[0421] Throughout the application the following acronyms are used when discussing PAA films. The meaning of these abbreviations appears below:
PAA: Poly(amic) acid
GA: Glutaraldehyde
A-alanine
W-tryptophane
CS-Chitosan
[0422] SA-Sulfanilic acid
I-isoleucine
K-L-Lysine
[0423] CA-cellulose acetate
pAS-p-aminoscalicylic acid
PDA-PAA-p-phenylenedianiline+pyromellitic dianhydride PAA
IZ-Carbodiimizole
[0424] pAB-: p-aminobenzoic acid
PCL-3-chloro-4-aminobenzoic acid
C-cysteine
[0425] BB-2 benzoylbenzoic acid
5AS-5-aminosalycylic acid
4AS-p-aminoscalicylic acid
Ser-L-Serin
DA-D-glucosamine
SN-sulfanilamide
T-L-Threonine
[0426] The described embodiments and examples of the present disclosure are intended to be illustrative rather than restrictive, and are not intended to represent every embodiment or example of the present disclosure. While the fundamental novel features of the disclosure as applied to various specific embodiments thereof have been shown, described and pointed out, it will also be understood that various omissions, substitutions and changes in the form and details of the devices illustrated and in their operation, may be made by those skilled in the art without departing from the spirit of the disclosure. For example, it is expressly intended that all combinations of those elements and/or method steps which perform substantially the same function in substantially the same way to achieve the same results are within the scope of the disclosure. Moreover, it should be recognized that structures and/or elements and/or method steps shown and/or described in connection with any disclosed form or embodiment of the disclosure may be incorporated in any other disclosed or described or suggested form or embodiment as a general matter of design choice. Further, various modifications and variations can be made without departing from the spirit or scope of the disclosure as set forth in the following claims both literally and in equivalents recognized in law.