Cannabis plants having modified expression of THCA synthase
10934554 ยท 2021-03-02
Assignee
Inventors
- EKATERINA ALEXANDRA BOUDKO (SMITHS FALLS, CA)
- Thomas IV Shipley (Smiths Falls, CA)
- DOUGLAS JOHNSON (OTTAWA, CA)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12Y121/03007
CHEMISTRY; METALLURGY
A61P29/00
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
C12N15/8218
CHEMISTRY; METALLURGY
A61K31/352
HUMAN NECESSITIES
C12N15/8243
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
A61K31/352
HUMAN NECESSITIES
Abstract
The invention relates to novel genetically modified plants and methods or materials, such as polynucleotides, expression cassettes, or vectors for producing the same. Moreover, the invention relates to altering the content of cannabinoids in plants and to medical compositions derived from such plants. In particular embodiments, the present invention relates to cannabis plants having modified expression of tetrahydrocannabinolic acid (THCA) synthase and methods of modifying the amount of delta-9-tetrahydrocannabinol (THC) and cannabidiol (CBD) in cannabis by modifying expression of THCA synthase.
Claims
1. A method for altering a content of one or more cannabinoids in a cannabis plant, the method comprising down-regulating activity of tetrahydrocannabinolic acid (THCA) synthase in the cannabis plant, wherein the THCA synthase is expressed from a THCA synthase gene comprising a polynucleotide sequence selected from SEQ ID NOs: 1-28, 38, 40, 44-45, and 47; wherein said down-regulating comprises introducing into the plant a selected DNA encoding an antisense RNA or a siRNA effective to suppress expression of the THCA synthase, the selected DNA operably linked to a heterologous promoter.
2. The method of claim 1, wherein altering the content of cannabinoids comprises decreasing delta-9-tetrahydrocannabinol (THC) content or increasing cannabidiol (CBD) content in the cannabis plant.
3. The method of claim 2, further comprising selecting a cannabis plant with a desired reduced THC content, increased CBD content, or reduced THC content and increased CBD content relative to a cannabis plant of a similar genotype that does not comprise the alteration.
4. The method of claim 1, wherein introducing the selected DNA comprises genetic transformation.
5. The method of claim 1, wherein the siRNA is encoded by a polynucleotide having a sequence selected from the group consisting of SEQ ID NO: 61, 63, 64, 69, 71, 72, 68, and a complement thereof.
6. The method of claim 1, wherein the antisense RNA is encoded by a polynucleotide sequence comprising SEQ ID NO: 81 or a fragment thereof capable of reducing the expression of the THCA synthase.
7. A method for altering a content of one or more cannabinoids in a cannabis plant, the method comprising down-regulating activity of tetrahydrocannabinolic acid (THCA) synthase in the cannabis plant, wherein the THCA synthase is expressed from a THCA synthase gene comprising a polynucleotide sequence selected from SEQ ID NOs: 1-28, 38, 40, 44-45, and 47; wherein said down-regulating comprises: (a) introducing into a cannabis plant or a cell thereof (i) at least one RNA-guided endonuclease comprising at least one nuclear localization signal or nucleic acid encoding at least one RNA-guided endonuclease comprising at least one nuclear localization signal, (ii) at least one guide RNA or DNA encoding at least one guide RNA, and, optionally, (iii) at least one donor polynucleotide; and (b) culturing the cannabis plant or cell thereof such that each guide RNA directs an RNA-guided endonuclease to a targeted site in the chromosomal sequence where the RNA-guided endonuclease introduces a double-stranded break in the targeted site, and the double-stranded break is repaired by a DNA repair process such that the chromosomal sequence is modified, wherein the targeted site is located in the THCA synthase gene and the chromosomal modification interrupts or interferes with transcription and/or translation of the THCA synthase gene.
8. The method of claim 7, wherein the RNA-guided endonuclease is derived from a clustered regularly interspersed short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system.
9. The method of claim 7, wherein down-regulating the activity of the THCA synthase does not insert exogenous genetic material and produces a non-naturally occurring cannabis plant or cell thereof.
10. A method for altering a content of one or more cannabinoids in a cannabis plant, the method comprising down-regulating activity of tetrahydrocannabinolic acid (THCA) synthase in the cannabis plant, wherein the THCA synthase is expressed from a THCA synthase gene comprising a polynucleotide sequence selected from SEQ ID NOs: 1-28, 38, 40, 44-45, and 47; wherein said down-regulating comprises: (a) identifying at least one THCA synthase gene locus within a DNA sequence in a cannabis plant or a cell thereof; (b) identifying at least one custom endonuclease recognition sequence within the at least one THCA synthase gene locus; (c) introducing into the cannabis plant or a cell thereof at least a first custom endonuclease, wherein the cannabis plant or a cell thereof comprises the recognition sequence for the custom endonuclease in or proximal to the THCA synthase gene locus, and the custom endonuclease is expressed transiently or stably; (d) assaying the cannabis plant or a cell thereof for a custom endonuclease-mediated modification in the DNA making up or flanking the THCA synthase gene locus; and (e) identifying the cannabis plant, a cell thereof, or a progeny cell thereof as comprising a modification in the THCA synthase gene locus.
11. A transgenic cannabis plant produced by the method of claim 1.
12. A seed of the transgenic plant of claim 11, wherein the seed comprises the selected DNA.
13. A method for producing a medical cannabis composition, the method comprising: (a) obtaining the transgenic cannabis plant of claim 11; (b) growing the transgenic cannabis plant under plant growth conditions to produce transgenic plant tissue from the transgenic cannabis plant; and (c) preparing the medical cannabis composition from the transgenic plant tissue.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
BRIEF DESCRIPTION OF THE SEQUENCES
(7) SEQ ID NOs:1-38 are Cannabis sativa THCA synthase genes, or partial coding sequence (cds) thereof.
(8) SEQ ID NO:39 is a Cannabis sativa gene for a hypothetical protein, complete cds.
(9) SEQ ID NO:40 is a Cannabis sativa mRNA for THCA synthase precursor, complete cds.
(10) SEQ ID NO:41 is a mRNA for cannabidiolic acid synthase homolog (CBDAS2); complete cds.
(11) SEQ ID NO:42 is a Cannabis sativa CBDAS mRNA for cannabidiolic acid synthase, complete cds.
(12) SEQ ID NO:43 is a Cannabis sativa mRNA for cannabidiolic acid synthase homolog (CBDAS3), complete cds.
(13) SEQ ID NO:44 is a Cannabis sativa THCA synthase gene.
(14) SEQ ID NO:45 is a Cannabis sativa THCA synthase gene.
(15) SEQ ID NO:46 is the Cannabis sativa THCA synthase gene sequence of DK-1 Cannabis sativa strain.
(16) SEQ ID NO:47 is the Cannabis sativa THCA synthase gene sequence of SH-4 Cannabis sativa strain.
(17) SEQ ID NO:48 is the forward primer of Kojoma et al., (TGAAGAAAAAAAATGAATTGCTCAGCATTTTCC).
(18) SEQ ID NO:49 is the complement of the reverse primer of Kojoma et al., (2006) (CCACCGCATCATCATTAATTATCTTTAAATAGA).
(19) SEQ ID NO:50 is the actual reverse primer of Kojoma et al., (TCTATTTAAAGATAATTAATGATGATGCGGTGG).
(20) SEQ ID NO:51 is the THCA-hpRNA1-SN-F1 (sense forward) RNAi construct primer.
(21) SEQ ID NO:52 is the THCA-hpRNA1-SN-R1 (sense reverse) RNAi construct primer.
(22) SEQ ID NO:53 is the THCA-hpRNA1-AS-F1 RNAi (antisense forward) construct primer.
(23) SEQ ID NO:54 is the THCA-hpRNA1-AS-R1 (antisense reverse) RNAi construct primer.
(24) SEQ ID NO:55 is the THCA-hpRNA2-SN-F2 RNAi construct primer.
(25) SEQ ID NO:56 is the THCA-hpRNA2-SN-R2 RNAi construct primer.
(26) SEQ ID NO:57 is the THCA-hpRNA2-AS-F2 RNAi construct primer.
(27) SEQ ID NO:58 is the THCA-hpRNA2-AS-R2 RNAi construct primer.
(28) SEQ ID NO:59 is the THCA-FullAS-F construct primer.
(29) SEQ ID NO:60 is the THCA-FullAS-R construct primer.
(30) SEQ ID NO:61 is the sense sequence of a small hair pin construct.
(31) SEQ ID NO:62 is the loop sequence of a small hair pin construct.
(32) SEQ ID NO:63 is the antisense sequence of the small hair pin construct.
(33) SEQ ID NO:64 is the complete insert sequence of the small hair pin construct.
(34) SEQ ID NO:65 is the THCA-hpRNA1-SN-F1 (sense forward) primer without restriction sites.
(35) SEQ ID NO:66 is the THCA-hpRNA1-SN-R1 (sense reverse) primer without restriction sites.
(36) SEQ ID NO:67 is the THCA-hpRNA1-AS-F1 RNAi (antisense forward) primer without restriction sites.
(37) SEQ ID NO:68 is the THCA-hpRNA1-AN-R1 (antisense reverse) RNAi primer without restriction sites.
(38) SEQ ID NO:69 is the sense strand of the large hair pin construct.
(39) SEQ ID NO:70 is the loop strand of the large hair pin construct.
(40) SEQ ID NO:71 is the antisense strand of the large hair pin construct.
(41) SEQ ID NO:72 is the complete insert sequence of the large hair pin construct.
(42) SEQ ID NO:73 is the THCA-hpRNA2-SN-F2 (sense forward) primer with SacI-MluI.
(43) SEQ ID NO:74 is the THCA-hpRNA2-SN-F2 (sense forward) primer with out restriction sites.
(44) SEQ ID NO:75 is the THCA-hpRNA2-SN-R2 primer.
(45) SEQ ID NO:76 is the THCA-hpRNA2-SN-R2 primer without restriction sites.
(46) SEQ ID NO:77 is the THCA-hpRNA2-AS-F2 primer.
(47) SEQ ID NO:78 is THCA-hpRNA2-AS-F2 primer without restriction sites.
(48) SEQ ID NO:79 is the THCA-hpRNA2-AS-R2 primer.
(49) SEQ ID NO:80 is the THCA-hpRNA2-AS-R2 primer without restriction sites.
(50) SEQ ID NO:81 is the full antisense THCA synthase.
(51) SEQ ID NO:82 is the THCA-Full AS-F (antisense forward) primer.
(52) SEQ ID NO:83 is the THCA-Full AS-F (antisense forward) primer, without restriction sites.
(53) SEQ ID NO:84 is the THCA-Full AS-R (antisense reverse) primer.
(54) SEQ ID NO:85 is the THCA-Full AS-R (antisense reverse) primer, without restriction sites.
(55) SEQ ID NO:86 is the Consensus THCA-Full AS-R (antisense reverse) primer, without restriction sites.
DETAILED DESCRIPTION OF THE INVENTION
(56) Described are genetically modified cannabis plants and cannabis plant derived products as well as expression cassettes, vectors, compositions, and materials and methods for producing the same. In particular, the present invention relates to cannabis plants that have modified expression of tetrahydrocannabinolic acid (THCA) synthase and methods of modifying the amount of delta-9-tetrahydrocannabinol (THC) and cannabidiol (CBD) in cannabis by modifying expression of THCA synthase.
(57) Cannabis (Cannabis sativa) is well known and widely used for the production of medical cannabis. Along with key cannabis compound, tetrahydrocannabinolic acid (THC), cannabis also produces a range of other secondary metabolites with proven and potential value as pharmaceuticals. However, only low levels are produced within the plant and, thus, high production and purification costs represent the major barriers to commercial viability of these pharmaceuticals. Metabolic engineering of cannabis secondary metabolite biosynthesis pathways can re-direct biochemical reactions, intermediates and energy from biosynthesis of THC to alternative compounds. This approach can lead to the development of new cannabis strains with value added production of novel pharmaceuticals.
(58) Plant secondary metabolite production results from tightly regulated biosynthetic pathways leading to the production of one or more bioactive metabolites that accumulate in the plant tissues at different concentrations. Metabolic engineering of these pathways can be used to generate plant lines with increased production of specific metabolite(s) of interest. Plant genetic engineering technologies can be applied to selectively modify cannabis secondary metabolism through the down regulation of key enzyme involved in THC biosynthesis. As demonstrated in multiple studies on variety of eukaryotic organisms, the down regulation of key steps in metabolic pathway re-directs intermediates and energy to alternative metabolic pathways and results in increased production and accumulation of other end products. Since THC and other valuable pharmaceutical compounds produced by cannabis share specific steps and intermediates in secondary metabolism biosynthetic pathways, the reduction of THC production is expected to increase the production of other compounds of interest.
(59) In certain embodiments, the modification of tetrahydrocannabinolic acid (THCA) synthase enzyme can be achieved by targeted gene silencing induced by antisense RNA (asRNA) and small interfering RNA (siRNA) via RNA interference (RNAi) technologies. Both RNA mediated gene regulation mechanisms have been found in nature in all eukaryotes and today are successfully applied in numerous organisms as gene silencing tools. The advantage of such genetic modification strategies is that the transformation of the construct resulting in gene silencing does not require full gene knock-out by targeting a specific genome locus. In addition, the generated genetically modified plant lines can possess different levels of target gene down-regulation and can be screened for production of the most desirable set of pharmaceutical compounds.
(60) The THCA synthase gene can be cloned from genomic DNA isolated from various Cannabis sativa strains. The cloning and sequencing of this gene from specific strains is an essential step as the variability in the sequence of this gene in different Cannabis sativa lines was demonstrated to affect production of cannabis compounds. Consensus sequence of the THCA synthase gene can be used to design and generate antisense RNA and RNA interference constructs. Synthesized RNA silencing constructs can be introduced into vectors designed for plant transformation. Different promoters can be used to drive expression of RNA silencing constructs such as constitutive promoters of different strength and origin. In addition, a THCA synthase gene regulatory region (promoter) may also be employed to direct expression of the silencing construct within the same tissues and during the same plant developmental phases as the native gene. This approach will help to avoid transgene expression in non-targeted plant tissues and minimize the risk of other possible and undesired effects of genetic modification.
(61) In certain embodiments, vectors may have novel polylinkers such that pairs of restriction enzyme sites (RES) can be used for directional cloning. By choosing relatively rare RES, their presence in the DNA to be cloned is unlikely. Even if they do occur, a different pair of RES can be used and the presence of all four enzymes in a small piece of target DNA is very unlikely.
(62) In certain embodiments, the THCA synthase gene can be cloned based upon sequence similarity.
(63) In certain embodiments, asRNA can be synthesized using a strong promoter in the vector to transcribe asDNA from the vector. Several approaches can be used: In one approach, the entire THCA synthase gene will be cloned in the antisense orientation. Thus potentially any region of the gene can form an antisense complex with the plant's sense mRNA that cannot be translated to make functional THCA synthase.
(64) In a different approach, various asDNAs that correspond to parts of the gene can be expressed with the following orientation: about 30 base pair from the gene or complement thereofloop domainsame gene as the gene in the complement orientation. This will produce a siRNA that has been successfully used in a variety of organisms.
(65) For both asDNA and vector construction a mixture of PCR+RES or DNA synthesis approaches can be used.
(66) Described are polynucleotides as well as methods for modifying metabolite biosynthesis pathways in cannabis plants and/or cannabis plant cells, cannabis plants and/or plant cells exhibiting modified metabolite biosynthesis pathways. In particular, described are methods for modifying production of THC and/or CBD in cannabis plants by modulating the expression and/or activity of THCA synthase and cannabis plants having modified expression and/or activity of THCA synthase.
(67) Accordingly, in certain embodiments, the present invention provides methods of downregulating production of THC. In particular embodiments, there is provided methods of downregulating expression and/or activity THCA synthase. Also provided are plants and/or plant cells having modified production of production of THC. In certain embodiments, there are provided cannabis plants and/or cells having down-regulated expression of and/or activity of THCA synthase.
(68) Down regulation of key steps in metabolic pathway re-directs intermediates and energy to alternative metabolic pathways and results in increased production and accumulation of other end products. THC and other cannabis metabolites share a biosynthetic pathway; that cannabigerolic acid is a precursor of THC, CBD and Cannabichromene. In particular, THCA synthase catalyzes the production of delta-9-tetrahydrocannabinolic acid from cannabigerolic acid; delta-9-tetrahydrocannabinolic undergoes thermal conversion to form THC. CBDA synthase catalyzes the production of cannabidiolic acid from cannabigerolic acid; cannabidiolic acid undergoes thermal conversion to CBD. CBCA synthase catalyzes the production of cannabichromenic acid from cannabigerolic acid; cannabichromenic acid undergoes thermal conversion to cannabichromene.
(69) A reduction in the production of THC, CBD, or Cannabichromene will enhance production of the remaining metabolites in this shared pathway. For example, production of CBD and/or Cannabichromene is enhanced by inhibiting production of THC. THC production may be inhibited by inhibiting expression and/or activity of tetrahydrocannabinolic acid (THCA) synthase enzyme.
(70) Described are certain embodiments of enhancing production of one or more secondary metabolites by downregulation of the production of one or more metabolites having a shared biosynthetic pathway. Certain embodiments provide methods of enhancing production of one or more secondary metabolites that share steps and intermediates in the THC biosynthetic pathway by downregulation of THC production. In specific embodiments, there are provided methods of enhancing production of CBD and/or Cannabichromene by inhibiting production of THC.
(71) Certain embodiments provide methods of enhancing production of one or more secondary metabolites which share steps and intermediates in the THC biosynthetic pathway by downregulation of expression and/or activity of THCA synthase. In specific embodiments, there are provided methods of enhancing production of CBD and/or Cannabichromene by downregulation of expression and/or activity of THCA synthase.
(72) Also provided are plants and plant cells having modified production of one or more metabolites having a shared biosynthetic pathway. In certain embodiments, there are provided cannabis plants and cells enhanced production of one or more secondary metabolites and downregulation of one or more other metabolites having a shared biosynthetic pathway. In certain embodiments, there are provided cannabis plants and cells having enhanced production of one or more secondary metabolites and downregulation of one or more other metabolites in the THC biosynthetic pathway. In certain embodiments, there are provided cannabis plants and cells having enhanced production of one or more secondary metabolites in the THC biosynthetic pathway and downregulated THC production. In specific embodiments, there are provided cannabis plants and cells having enhanced production of CBD and/or Cannabichromene and downregulated THC production.
(73) Certain embodiments provide for cannabis plants and/or cells having enhanced production of one or more secondary metabolites that share steps and intermediates in the THC biosynthetic pathway and downregulated expression and/or activity of THCA synthase. In specific embodiments, there are provided cannabis plants and/or cells having enhanced production of CBD and/or Cannabichromene and downregulated expression and/or activity of THCA synthase.
Definitions
(74) In the description and tables herein, a number of terms are used. In order to provide a clear and consistent understanding of the specification and claims, the following definitions are provided. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.
(75) Where a term is provided in the singular, the inventors also contemplate aspects of the invention described by the plural of that term.
(76) As used herein, the term tetrahydrocannabinolic acid (THCA) synthase inhibitory compound refers to a compound that suppresses or reduces an activity of THCA synthase enzyme activity, or expression of THCA synthase enzyme, such as for example synthesis of mRNA encoding a THCA synthase enzyme (transcription) and/or synthesis of a THCA synthase polypeptide from THCA synthase mRNA (translation). In some embodiments the selective THCA synthase inhibitory compound specifically inhibits a THCA synthase that decreases formation of delta-9-tetrahydrocannabinol (THC) and/or increases cannabidiol (CBD).
(77) As used herein, the term expression cassette refers to a DNA molecule that comprises a selected DNA to be transcribed. In addition, the expression cassette comprises at least all DNA elements required for expression. After successful transformation, the expression cassette directs the cell's machinery to transcribe the selected DNA to RNA. In certain embodiments, the expression cassette expresses an antisense RNA, iRNA, or siRNA that suppresses expression of a THCA synthase.
(78) Different expression cassettes can be transformed into different organisms including bacteria, yeast, plants, and mammalian cells as long as the correct regulatory sequences are used.
(79) As used herein, the term expression refers to the combination of intracellular processes, including transcription and translation undergone by a coding DNA molecule such as a structural gene to produce a polypeptide. Expression of antisense RNA, iRNA, or siRNA refers to the process of transcribing DNA into RNA.
(80) As used herein, the term abundance of a protein refers to the amount of the specific protein relative to the amount of total protein or relative to the weight or volume of the cell, tissue, plant, or plant part tested.
(81) As used herein, the term abundance of a mRNA refers to the amount of the specific mRNA relative to the amount of total protein or relative to the weight or volume of the cell, tissue, plant, or plant part tested.
(82) As used herein, the term genetic transformation refers to process of introducing a DNA sequence or construct (e.g., a vector or expression cassette) into a cell or protoplast in which that exogenous DNA is incorporated into a chromosome or is capable of autonomous replication.
(83) As used herein, the term heterologous refers to a sequence which is not normally present in a given host genome in the genetic context in which the sequence is currently found. In this respect, the sequence may be native to the host genome, but be rearranged with respect to other genetic sequences within the host sequence. For example, a regulatory sequence may be heterologous in that it is linked to a different coding sequence relative to the native regulatory sequence.
(84) As used herein, the term obtaining when used in conjunction with a transgenic plant cell or transgenic plant, means transforming a non-transgenic plant cell or plant to create the transgenic plant cell or plant, or planting transgenic plant seed to produce the transgenic plant cell or plant. Such a transgenic plant seed may be from an R0 transgenic plant or may be from a progeny of any generation thereof that inherits a given transgenic sequence from a starting transgenic parent plant. In addition, obtaining includes obtaining plants through breeding.
(85) As used herein, the term R0 transgenic plant refers to a plant that has been genetically transformed or has been regenerated from a plant cell or cells that have been genetically transformed.
(86) As used herein, the term transformation construct refers to a chimeric DNA molecule which is designed for introduction into a host genome by genetic transformation. Preferred transformation constructs will comprise all of the genetic elements necessary to direct the expression of one or more exogenous genes. In particular embodiments of the instant invention, it may be desirable to introduce a transformation construct into a host cell in the form of an expression cassette.
(87) As used herein, the term transgene refers to a segment of DNA which has been incorporated into a host genome or is capable of autonomous replication in a host cell and is capable of causing the expression of one or more coding sequences. Exemplary transgenes will provide the host cell, or plants regenerated therefrom, with a novel phenotype relative to the corresponding non-transformed cell or plant. Transgenes may be directly introduced into a plant by genetic transformation, or may be inherited from a plant of any previous generation which was transformed with the DNA segment.
(88) As used herein, the term transgenic plant refers to a plant or progeny plant of any subsequent generation derived therefrom, wherein the DNA of the plant or progeny thereof contains an introduced exogenous DNA segment not naturally present in a non-transgenic plant of the same strain. The transgenic plant may additionally contain sequences which are native to the plant being transformed, but wherein the exogenous gene has been altered in order to alter the level or pattern of expression of the gene, for example, by use of one or more heterologous regulatory or other elements.
(89) As used herein, the term vector refers to a DNA molecule designed for transformation into a host cell. Some vectors may be capable of replication in a host cell. A plasmid is an exemplary vector, as are expression cassettes isolated therefrom.
(90) As used herein, the terms DNA, DNA molecule, and DNA polynucleotide molecule refer to a single-stranded DNA or double-stranded DNA molecule of genomic or synthetic origin, such as, a polymer of deoxyribonucleotide bases or a DNA polynucleotide molecule.
(91) As used herein, the terms DNA sequence, nucleotide sequence, and polynucleotide sequence refer to the nucleotide sequence of a DNA molecule. ssDNA refers to single-stranded DNA; dsDNA refers to double-stranded DNA.
(92) As used herein, the terms RNA or RNA molecule refer to a single-stranded RNA or double-stranded RNA molecule of genomic or synthetic origin, such as, a polymer of ribonucleotide bases that comprise single or double stranded regions. ssRNA specifically refers to single-stranded RNA; dsRNA refers to double-stranded RNA.
(93) Unless otherwise stated, nucleotide sequences in the text of this specification are given, when read from left to right, in the 5 to 3 direction. The nomenclature used herein is that required by Title 37 of the United States Code of Federal Regulations 1.822 and set forth in the tables in WIPO Standard ST.25 (1998), Appendix 2, Tables 1 and 3.
(94) As used herein, a polynucleotides may be in the form of ssDNA, encompass dsDNA equivalents, dsRNA equivalents, ssRNA equivalents, ssRNA complements, ssDNA, and ssDNA complements.
(95) As used herein, a first nucleic-acid sequence, selected DNA, or polynucleotide is operably connected or linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to an RNA and/or protein-coding sequence, or a sequence encoding an iRNA, an siRNA, or a nucleic acid encoding an antisense oligonucleotide if the promoter provides for transcription or expression of the RNA or coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, are in the same reading frame.
(96) In certain embodiment, the selected DNA encodes an antisense RNA or RNAi construct. In another embodiment, the selected DNA encodes a ribozyme, or zinc-finger protein.
(97) As used herein, the phrase wherein said plant does not comprise a transgene refers to a plant that lacks either a DNA molecule comprising a promoter that is operably linked to a polynucleotide or a recombinant viral vector.
(98) As used herein, the term transcript corresponds to any RNA that is produced from a gene by the process of transcription. A transcript of a gene can thus comprise a primary transcription product which can contain introns or can comprise a mature RNA that lacks introns.
(99) As used herein, nucleases means natural and engineered (i.e. modified) polypeptides with nuclease activity such as endonucleases possessing sequence motifs and catalytic activities of the LAGLIDADG, GIY-YIG, His-Cys box, and HNH families (e.g. Chevalier and Stoddard, 2001), as well as zinc finger nucleases (ZFNs), naturally occurring or engineered for a given target specificity (e.g. Durai et al., 2005; U.S. Pat. No. 7,220,719), among others. Another contemplated endonuclease is the Saccharomyces cerevisiae HO nuclease (e.g. Nickoloff et al., 1986), or variant thereof.
(100) As used herein, a custom endonuclease means an endonuclease that has been evolved or rationally designed (e.g. WO06097853, WO06097784, WO04067736, or US20070117128) to cut within or adjacent to one or more recognition sequences. Such a custom endonuclease would have properties making it amenable to genetic modification such that its recognition, binding and/or nuclease activity could be manipulated.
(101) As used herein, an allele refers to an alternative sequence at a particular locus; the length of an allele can be as small as 1 nucleotide base, but is typically larger. Allelic sequence can be denoted as nucleic acid sequence or as amino acid sequence that is encoded by the nucleic acid sequence. Alternatively, an allele can be one form of a gene, and may exhibit simple dominant or recessive behavior, or more complex genetic relationships such as incomplete dominance, co-dominance, conditional dominance, epistasis, or one or more combinations thereof with respect to one or more other allele(s).
(102) A locus is a position on a genomic sequence that is usually found by a point of reference; e.g., a short DNA sequence that is a gene, or part of a gene or intergenic region. The loci of this invention comprise one or more polymorphisms in a population; i.e., alternative alleles present in some individuals.
Nucleic Acids
(103) The present invention provides for nucleic acids comprising nucleotide sequences or sequences complementary to the nucleotide sequence encoding THCA synthase and fragments thereof. Nucleic acids include, but are not limited to, genomic DNA, cDNA, RNA, fragments and modified versions thereof.
(104) As used herein, polynucleotide may refer to a DNA or RNA molecule containing multiple nucleotides and generally refers both to oligonucleotides (a polynucleotide molecule of 18-25 nucleotides in length) and longer polynucleotides of 26 or more nucleotides. Embodiments of this invention include compositions including oligonucleotides having a length of 18-25 nucleotides (18-mers, 19-mers, 20-mers, 21-mers, 22-mers, 23-mers, 24-mers, or 25-mers), and longer, or medium-length polynucleotides having a length of 26 or more nucleotides (polynucleotides of 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, or about 300 nucleotides), or long polynucleotides having a length greater than about 300 nucleotides (e.g., polynucleotides of between about 300 to about 400 nucleotides, between about 400 to about 500 nucleotides, between about 500 to about 600 nucleotides, between about 600 to about 700 nucleotides, between about 700 to about 800 nucleotides, between about 800 to about 900 nucleotides, between about 900 to about 1000 nucleotides, between about 300 to about 500 nucleotides, between about 300 to about 600 nucleotides, between about 300 to about 700 nucleotides, between about 300 to about 800 nucleotides, between about 300 to about 900 nucleotides, or about 1000 nucleotides in length, or even greater than about 1000 nucleotides in length, for example up to the entire length of a target THCA synthase gene, including coding or non-coding or both coding and non-coding portions of the THCA synthase gene. Where a polynucleotide is double-stranded, its length can be similarly described in terms of base pairs.
(105) Polynucleotide compositions used in the various embodiments of this invention include compositions including oligonucleotides, polynucleotides, or a mixture of both, including: RNA or DNA or RNA/DNA hybrids or chemically modified oligonucleotides or polynucleotides or a mixture thereof. In certain embodiments, the polynucleotide may be a combination of ribonucleotides and deoxyribonucleotides, for example, synthetic polynucleotides consisting mainly of ribonucleotides but with one or more terminal deoxyribonucleotides or synthetic polynucleotides consisting mainly of deoxyribonucleotides but with one or more terminal dideoxyribonucleotides. In certain embodiments, the polynucleotide includes non-canonical nucleotides such as inosine, thiouridine, or pseudouridine. In certain embodiments, the polynucleotide includes chemically modified nucleotides. Examples of chemically modified oligonucleotides or polynucleotides are well known in the art; see, for example, U.S. Patent Publication 2011/0171287, U.S. Patent Publication 2011/0171176, U.S. Patent Publication 2011/0152353, U.S. Patent Publication 2011/0152346, and U.S. Patent Publication 2011/0160082, which are herein incorporated by reference. Illustrative examples include, but are not limited to, the naturally occurring phosphodiester backbone of an oligonucleotide or polynucleotide which can be partially or completely modified with phosphorothioate, phosphorodithioate, or methylphosphonate internucleotide linkage modifications, modified nucleoside bases or modified sugars can be used in oligonucleotide or polynucleotide synthesis, and oligonucleotides or polynucleotides can be labeled with a fluorescent moiety (e.g., fluorescein or rhodamine) or other label (e.g., biotin).
(106) Polynucleotides can be single- or double-stranded RNA, single- or double-stranded DNA, double-stranded DNA/RNA hybrids, and modified analogues thereof. In certain embodiments of the invention, the polynucleotides that provide single-stranded RNA in the plant cell may be: (a) a single-stranded RNA molecule (ssRNA), (b) a single-stranded RNA molecule that self-hybridizes to form a double-stranded RNA molecule, (c) a double-stranded RNA molecule (dsRNA), (d) a single-stranded DNA molecule (ssDNA), (e) a single-stranded DNA molecule that self-hybridizes to form a double-stranded DNA molecule, (f) a single-stranded DNA molecule including that is transcribed to an RNA molecule, (g) a double-stranded DNA molecule (dsDNA), (h) a double-stranded DNA molecule that is transcribed to an RNA molecule, and (i) a double-stranded, hybridized RNA/DNA molecule, or combinations thereof. In certain embodiments, these polynucleotides can comprise both ribonucleic acid residues and deoxyribonucleic acid residues. In certain embodiments, these polynucleotides include chemically modified nucleotides or non-canonical nucleotides. In certain embodiments of the methods, the polynucleotides include double-stranded DNA formed by intramolecular hybridization, double-stranded DNA formed by intermolecular hybridization, double-stranded RNA formed by intramolecular hybridization, or double-stranded RNA formed by intermolecular hybridization. In certain embodiments where the polynucleotide is a dsRNA, the anti-sense strand may comprise at least 18 nucleotides that are essentially complementary to the target THCA synthase gene. In certain embodiments the polynucleotides include single-stranded DNA or single-stranded RNA that self-hybridizes to form a hairpin structure having an at least partially double-stranded structure including at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. Not intending to be bound by any mechanism, it is believed that such polynucleotides are or will produce single-stranded RNA with at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression.
(107) The polynucleotide molecules of the present invention are designed to modulate expression by inducing regulation or suppression of an endogenous THCA synthase gene, to reduce the content of THC and/or increase content of CDB in a cannabis plant and are designed to have a nucleotide sequence essentially identical or essentially complementary to the nucleotide sequence of an endogenous THCA synthase gene of a plant or to the sequence of RNA transcribed from an endogenous THCA synthase gene of a plant, which can be coding sequence or non-coding sequence. These effective polynucleotide molecules that modulate expression are referred to herein as a trigger, or triggers.
(108) By essentially identical or essentially complementary it is meant that the trigger polynucleotides (or at least one strand of a double-stranded polynucleotide) have sufficient identity or complementarity to the endogenous gene or to the RNA transcribed from the endogenous THCA synthase gene (e.g., the transcript) to suppress expression of the endogenous THCA synthase gene (e.g., to effect a reduction in levels or activity of the gene transcript and/or encoded protein). Polynucleotides of the methods and compositions provided herein need not have 100 percent identity to a complementarity to the endogenous THCA synthase gene or to the RNA transcribed from the endogenous THCA synthase gene (i.e., the transcript) to suppress expression of the endogenous THCA synthase gene (i.e., to effect a reduction in levels or activity of the gene transcript or encoded protein). Thus, in certain embodiments, the polynucleotide or a portion thereof is designed to be essentially identical to, or essentially complementary to, a sequence of at least 18 or 19 contiguous nucleotides in either the target gene or messenger RNA transcribed from the target gene (e.g., the transcript). In certain embodiments, an essentially identical polynucleotide has 100 percent sequence identity or at least about 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to the sequence of 18 or more contiguous nucleotides in either the endogenous target gene or to an RNA transcribed from the target gene (e.g., the transcript). In certain embodiments, an essentially complementary polynucleotide has 100 percent sequence complementarity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to the sequence of 18 or more contiguous nucleotides in either the target gene or RNA transcribed from the target gene. Complements of polynucleotides include complete complementary and complete reverse complimentary sequences of the reference sequence.
(109) In certain embodiments, polynucleotides used in the methods and compositions provided herein can be essentially identical or essentially complementary to any of: i) conserved regions of the THCA synthase gene, non-conserved regions of THCA synthase gene. Such polynucleotides that are essentially identical or essentially complementary to such regions can be used to reduce delta-9-tetrahydrocannabinol (THC) and/or increase cannabidiol (CBD).
(110) Polynucleotides containing mismatches to the target gene or transcript can thus be used in certain embodiments of the compositions and methods provided herein. In certain embodiments, a polynucleotide can comprise at least 19 contiguous nucleotides that are essentially identical or essentially complementary to said gene or said transcript or comprises at least 19 contiguous nucleotides that are essentially identical or essentially complementary to the target gene or target gene transcript. In certain embodiments, a polynucleotide of 19 continuous nucleotides that is essentially identical or essentially complementary to the endogenous target gene or to a RNA transcribed from the target gene (e.g., the transcript) can have 1 or 2 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 20 or more nucleotides that contains a contiguous 19 nucleotide span of identity or complementarity to the endogenous target gene or to an RNA transcribed from the target gene can have 1 or 2 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 21 continuous nucleotides that is essentially identical or essentially complementary to the endogenous target gene or to an RNA transcribed from the target gene (e.g., the transcript) can have 1, 2, or 3 mismatches to the target gene or transcript. In certain embodiments, a polynucleotide of 22 or more nucleotides that contains a contiguous 21 nucleotide span of identity or complementarity to the endogenous target gene or to an RNA transcribed from the target gene can have 1, 2, or 3 mismatches to the target gene or transcript. In designing polynucleotides with mismatches to an endogenous target gene or to an RNA transcribed from the target gene, mismatches of certain types and at certain positions that are more likely to be tolerated can be used. In certain exemplary embodiments, mismatches formed between adenine and cytosine or guanosine and uracil residues are used as described by Du et al. Nucleic Acids Research, 2005, Vol. 33, No. 5 1671-1677. In certain exemplary embodiments, mismatches in 19 base pair overlap regions can be at the low tolerance positions 5, 7, 8 or 11 (from the 5 end of a 19 nucleotide target) with well tolerated nucleotide mismatch residues, at medium tolerance positions 3, 4, and 12-17, and/or at the high tolerance nucleotide positions at either end of the region of complementarity (i.e., positions 1, 2, 18, and 19) as described by Du et al. Nucleic Acids Research, 2005, Vol. 33, No. 5 1671-1677. It is further anticipated that tolerated mismatches can be empirically determined in assays where the polynucleotide is applied to the plants via the methods provided herein and the treated plants assayed for suppression of THCA synthase gene expression or appearance of improved shelf life and reduced postharvest losses.
(111) In certain embodiments, polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to one allele or one family member of a given THCA synthase gene coding or non-coding sequence. Target THCA synthase genes include the THCA synthase genes of SEQ ID NO:1-47. In other embodiments, the polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to multiple alleles or family members of a given target gene.
(112) In certain embodiments, polynucleotide compositions and methods provided herein typically effect regulation or modulation (e. g., suppression) of gene expression during a period during the life of the treated plant of at least 1 week or longer and typically in systemic fashion. For instance, within days of treating a plant leaf with a polynucleotide composition of this invention, primary and transitive siRNAs can be detected in other leaves lateral to and above the treated leaf and in apical tissue. In certain embodiments, methods of systemically suppressing expression of a gene in a plant, the methods comprising treating said plant with a composition comprising at least one polynucleotide and a transfer agent, wherein said polynucleotide comprises at least 18 or at least 19 contiguous nucleotides that are essentially identical or essentially complementary to a gene or a transcript encoding a THCA synthase gene of the plant are provided, whereby expression of the gene in said plant or progeny thereof is systemically suppressed in comparison to a control plant that has not been treated with the composition.
(113) Compositions used to suppress a target gene can comprise one or more polynucleotides that are essentially identical or essentially complementary to multiple genes, or to multiple segments of one or more genes. In certain embodiments, compositions used to suppress a target gene can comprise one or more polynucleotides that are essentially identical or essentially complementary to multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple target genes from one or more species.
(114) In certain embodiments, the polynucleotide includes two or more copies of a nucleotide sequence (of 18 or more nucleotides) where the copies are arranged in tandem fashion. In another embodiment, the polynucleotide includes two or more copies of a nucleotide sequence (of 18 or more nucleotides) where the copies are arranged in inverted repeat fashion (forming an at least partially self-complementary strand). The polynucleotide can include both tandem and inverted-repeat copies. Whether arranged in tandem or inverted repeat fashion, each copy can be directly contiguous to the next, or pairs of copies can be separated by an optional spacer of one or more nucleotides. The optional spacer can be unrelated sequence (i.e., not essentially identical to or essentially complementary to the copies, nor essentially identical to, or essentially complementary to, a sequence of 18 or more contiguous nucleotides of the endogenous target gene or RNA transcribed from the endogenous target gene). Alternatively the optional spacer can include sequence that is complementary to a segment of the endogenous target gene adjacent to the segment that is targeted by the copies. In certain embodiments, the polynucleotide includes two copies of a nucleotide sequence of between about 20 to about 30 nucleotides, where the two copies are separated by a spacer no longer than the length of the nucleotide sequence.
(115) In certain embodiments, the nucleic acid molecule comprises the sequence or the compliment of the sequences as set forth in GenBank Accession number JQ437488.1 (SEQ ID NO:1); JQ437487.1 (SEQ ID NO:2); JQ437486.1 (SEQ ID NO:3); JQ437485.1 SEQ ID NO:4); JQ437484.1 (SEQ ID NO:5); JQ437483.1 (SEQ ID NO:6); JQ437482.1 (SEQ ID NO:7); JQ437481.1 (SEQ ID NO:8); JQ437496.1 (SEQ ID NO:9); JQ437495.1 (SEQ ID NO:10), JQ437494.1 (SEQ ID NO:11); JQ437493.1 (SEQ ID NO:38); JQ437492.1 (SEQ ID NO:12); JQ437491.1 (SEQ ID NO:13); JQ437490.1 (SEQ ID NO:14); JQ437489.1 (SEQ ID NO:15); AB212841.1 (SEQ ID NO:16), AB212840.1 (SEQ ID NO:17); AB212839.1 (SEQ ID NO:18); AB212838.1 (SEQ ID NO:19); AB212837.1 (SEQ ID NO:20); AB212836.1 (SEQ ID NO:21); AB212835.1 (SEQ ID NO:22); AB212834.1 (SEQ ID NO:23); AB212833.1 (SEQ ID NO:24); AB212832.1 (SEQ ID NO:25); AB212831.1 (SEQ ID NO:26); AB212830.1 (SEQ ID NO:27); AB212829.1 (SEQ ID NO:28); AB183705.1 (SEQ ID NO:29) AB183704.1 (SEQ ID NO:30); AB183703.1 (SEQ ID NO:31); AB183702.1 (SEQ ID NO:32); AB183701.1 (SEQ ID NO:33); AB183700.1 (SEQ ID NO:34); AB183699.1 (SEQ ID NO:35); AB183698.1 (SEQ ID NO:36), EU839988.1 (SEQ ID NO:37); AB057805.1 (SEQ ID NO:40); E33090.1 (SEQ ID NO:44), E33091.1 (SEQ ID NO:45), AB731220.1 (SEQ ID NO:39); a variant or fragment thereof, or a polynucleotide sequence having at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity or 100% sequence identity to a nucleic acid molecules. In certain embodiments the fragment has at least 18, 19, 20, 21, 22, 24, 25, 80, 100, 150, or 200 consecutive nucleotides.
(116) In certain embodiments, the nucleic acid molecule comprises the sequence or the compliment of the sequences as set forth in GenBank Accession number AB731220.1 (SEQ ID NO:39); AB292682.1 (SEQ ID NO:42); AB292683.1 (SEQ ID NO:41); AB292684.1 (SEQ ID NO:43); AB212829.1 (SEQ ID NO:28); AB212838.1 (SEQ ID NO:19); AB212837.1 (SEQ ID NO:20); AB212835.1 (SEQ ID NO:22); AB212834.1 (SEQ ID NO:23); AB212832.1 (SEQ ID NO:25); AB057805.1 (SEQ ID NO:40) AB731220.1 (SEQ ID NO:39); AB212833.1 (SEQ ID NO:24); AB212836.1 (SEQ ID NO:21); AB212841.1 (SEQ ID NO:16); AB212831.1 (SEQ ID NO:26); AB212839.1 (SEQ ID NO:18); AB212830.1 (SEQ ID NO:27); AB212840.1 (SEQ ID NO:17); JQ437490.1 (SEQ ID NO:14); JQ437485.1 SEQ ID NO:4); JQ437487.1 (SEQ ID NO:2); JQ437486.1 (SEQ ID NO:3); JQ437481.1 (SEQ ID NO:8); JQ437482.1 (SEQ ID NO:7); JQ437483.1 (SEQ ID NO:6); JQ437484.1 (SEQ ID NO:5); JQ437488.1 (SEQ ID NO:1); JQ437492.1 (SEQ ID NO:12); JQ437489.1 (SEQ ID NO:15); JQ437491.1 (SEQ ID NO:13); a variant or fragment thereof, or a polynucleotide sequence having at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity or 100% sequence identity to a nucleic acid molecules. In certain embodiments the fragment has at least 18, 19, 20, 21, 22, 24, 25, 80, 100, 150, or 200 consecutive nucleotides.
(117) In other embodiments, there is provided a nucleic acid comprising a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to sequences encoding THCA synthase and fragments thereof or the complement thereof.
(118) In some embodiments of the present invention, the nucleotide sequences comprise one or more substitutions, insertions and/or deletions. For certain embodiments, the nucleotide sequence includes one or more T-DNA insertions. In other embodiments, the nucleic acid comprises a selection marker cassette. In other embodiments, the nucleotide sequence includes one or more point mutations. In certain embodiments, the nucleotide sequence includes a deletion. In certain embodiments, the nucleotide sequence includes a rearrangement. In certain embodiments, the nucleotide sequence includes a frame shift.
(119) Also provided are nucleic acids that hybridize to the nucleic acids of the present invention or the complement thereof. In certain embodiments, there is provided a nucleic acid that hybridizes to any one of the sequences under conditions of low, moderate or high stringency. A worker skilled in the art readily appreciates that hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, the Tm of the formed hybrid, and the G:C ratio within the nucleic acids. Such a worker could readily determine appropriate stringent conditions (see, for example, Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York (1989) pp. 9.50-51, 11.48-49 and 11.2-11.3).
(120) Typically under high stringency conditions only highly similar sequences will hybridize (typically >95% identity). Under moderate stringency conditions typically those sequence having greater than 80% identity will hybridize and under low stringency conditions those sequences having greater than 50% identity will hybridize.
(121) A non-limiting example of high stringency conditions when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42 C. in a solution consisting of 5SSPE (43.8 g/l NaCl, 6.9 g/l NaH2PO4H2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5Denhardt's reagent and 100 g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1SSPE, 1.0% SDS at 42 C. when a probe of about 500 nucleotides in length is employed. A non-limiting example of medium stringency conditions when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42 C. in a solution consisting of 5SSPE (43.8 g/l NaCl, 6.9 g/l NaH2PO4H2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5Denhardt's reagent and 100 g/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0SSPE, 1.0% SDS at 42 C. when a probe of about 500 nucleotides in length is employed. A non-limiting example low stringency conditions when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42 C. in a solution consisting of 5SSPE (43.8 g/l NaCl, 6.9 g/l NaH2PO4H2O and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5Denhardt's reagent and 100 g/ml denatured salmon sperm DNA followed by washing in a solution comprising 5SSPE, 0.1% SDS at 42 C. when a probe of about 500 nucleotides in length is employed. The nucleic acids may include additional sequences. For example, the nucleic acids may include multiple restriction sites, additional coding sequences (e.g., a purification tag, a localization signal, as a fusion-protein, as a pre-protein, or the like) and/or with non-coding sequences (e.g., introns or inteins, regulatory elements such as promoters (including constitutive promoters such as the CaMV 35S promoter, inducible promoters, tissue-specific promoters (such as root-specific, flower-specific promoters, fruit-specific promoters, seed specific promoters or leaf specific promoters), enhancers, terminators, and the like), and/or in a vector or host environment in which the polynucleotide encoding a transcription factor or transcription factor homologue polypeptide is an endogenous or exogenous gene. Appropriate additional coding sequences (e.g., a purification tag, a localization signal, as a fusion-protein, as a pre-protein, or the like), non-coding sequences (e.g., introns, regulatory elements such as promoters (including constitutive promoters, inducible promoters, tissue specific promoters), enhancers, terminators, and the like), and vectors for use in plants/plant cells are known in the art.
Regulatory Elements
(122) Exemplary promoters for expression of a nucleic acid sequence include plant promoter such as the CaMV 35S promoter (Odell et al., 1985), or others such as CaMV 19S (Lawton et al., 1987), nos (Ebert et al., 1987), Adh (Walker et al., 1987), sucrose synthase (Yang and Russell, 1990), a tubulin, actin (Wang et al., 1992), cab (Sullivan et al., 1989), PEPCase (Hudspeth and Grula, 1989) or those associated with the R gene complex (Chandler et al., 1989). Tissue specific promoters such as root cell promoters (Conkling et al., 1990) and tissue specific enhancers (Fromm et al., 1986) are also contemplated to be useful, as are inducible promoters such as ABA- and turgor-inducible promoters. The PAL2 promoter may in particular be useful with the invention (U.S. Pat. Appl. Pub. 2004/0049802, the entire disclosure of which is specifically incorporated herein by reference).
(123) The DNA sequence between the transcription initiation site and the start of the coding sequence, i.e., the untranslated leader sequence, can also influence gene expression. One may thus wish to employ a particular leader sequence with a transformation construct of the invention. Preferred leader sequences are contemplated to include those which comprise sequences predicted to direct optimum expression of the attached gene, i.e., to include a preferred consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate initiation of translation. The choice of such sequences will be known to those of skill in the art in light of the present disclosure. Sequences that are derived from genes that are highly expressed in plants will typically be preferred.
(124) It is contemplated that vectors for use in accordance with the present invention may be constructed to include an ocs enhancer element. This element was first identified as a 16 bp palindromic enhancer from the octopine synthase (ocs) gene of Agrobacterium (Ellis et al., 1987), and is present in at least 10 other promoters (Bouchez et al., 1989). The use of an enhancer element, such as the ocs element and particularly multiple copies of the element, may act to increase the level of transcription from adjacent promoters when applied in the context of plant transformation.
(125) It is envisioned that polynucleotide sequences or selected DNA sequences may be introduced under the control of novel promoters or enhancers, etc., or homologous or tissue specific promoters or control elements. Vectors for use in tissue-specific targeting of genes in transgenic plants will typically include tissue-specific promoters and may also include other tissue-specific control elements such as enhancer sequences. Promoters which direct specific or enhanced expression in certain plant tissues will be known to those of skill in the art in light of the present disclosure. These include, for example, the rbcS promoter, specific for green tissue; the ocs, nos and mas promoters which have higher activity in roots or wounded leaf tissue. In certain embodiments, promoters can be employed that cause low expression of the selected DNA. Low expression promoters can be obtained by mutation and/or recombination of DNA elements of promoters that cause high expression or by selecting upstream regulatory elements of genes that cause expression of mRNA or protein with low abundance.
(126) Promoters have been described in the art; thus the invention provides, in certain embodiments, novel combinations of promoters and a selected DNA. In one embodiment, a constitutive promoter is cloned 5 to selected DNA in order to constitutively express the selected DNA in transformed cells.
(127) In another embodiment, an inducible promoter can be used to turn on expression of the selected DNA under certain conditions. For example, a cold shock promoter cloned upstream of selected DNA might be used to induce the selected DNA under cold temperatures. Other environmentally inducible promoters have been described and can be used in a novel combination with a selected DNA. Another type of inducible promoter is a chemically-inducible promoter. Such promoters can be precisely activated by the application of a chemical inducer. Examples of chemical inducible promoters include the steroid inducible promoter and a quorum sensing promoter (see, e.g., You et al., 2006; U.S. Patent Application Publication No. 2005/0227285). Recently it has been shown that modified RNA molecules comprising a ligand specific aptamer and riboswitch can be used to chemically regulate the expression of a target gene (Tucker et al, 2005; International Publication No. WO2006073727). Such a riboregulator can be used to control the expression of a TALER-encoding gene by the addition or elimination of a chemical ligand.
(128) The construct may comprise a nucleotide sequence of the invention operably linked to a promoter sequence that functions in the host cell. Such a promoter may be tissue-specific and may, for example, be specific to a tissue type which is the subject of pest attack. In the case of rootworms, for example, it may be desired to use a promoter providing leaf-preferred expression.
(129) Promoters that function in different plant species are also well known in the art. Promoters useful for expression of polypeptides in plants include those that are inducible, viral, synthetic, or constitutive as described in Odell et al. (1985), and/or promoters that are temporally regulated, spatially regulated, and spatio-temporally regulated. Preferred promoters include the enhanced CaMV35S promoters, and the FMV35S promoter. For the purpose of the present invention, e.g., for optimum control of species that feed on roots, it may be preferable to achieve the highest levels of expression of these genes within the roots of plants. A number of root-enhanced promoters have been identified and are known in the art (Lu et al., 2000; U.S. Pat. Nos. 5,837,848 and 6,489,542).
(130) Examples of leaf-specific promoter are described in U.S. Pat. No. 6,229,067, which is hereby incorporated by reference in its entirety, and flower-specific promoter are known in the art and described in Du L., et al., Plant Molecular Biology Reporter, February 2014, Volume 32, Issue 1, pp 234-245.
Terminators
(131) Transformation constructs prepared in accordance with the invention will typically include a 3 end DNA sequence that acts as a signal to terminate transcription and allow for the poly-adenylation of the mRNA produced by coding sequences operably linked to a promoter. Examples of terminators that are deemed to be useful in this context include those from the nopaline synthase gene of Agrobacterium tumefaciens (nos 3 end) (Bevan et al., 1983), the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3 end of the protease inhibitor I or II genes from potato or tomato. Regulatory elements such as an Adh intron (Callis et al., 1987), sucrose synthase intron (Vasil et al., 1989) or TMV omega element (Gallie et al., 1989), may further be included where desired.
Marker Genes
(132) By employing a selectable or screenable marker protein, one can provide or enhance the ability to identify transformants Marker genes are genes that impart a distinct phenotype to cells expressing the marker protein and thus allow such transformed cells to be distinguished from cells that do not have the marker. Such genes may encode either a selectable or screenable marker, depending on whether the marker confers a trait which one can select for by chemical means, i.e., through the use of a selective agent (e.g., a herbicide, antibiotic, or the like), or whether it is simply a trait that one can identify through observation or testing, i.e., by screening (e.g., the green fluorescent protein). Of course, many examples of suitable marker proteins are known to the art and can be employed in the practice of the invention.
(133) Included within the terms selectable or screenable markers also are genes which encode a secretable marker whose secretion can be detected as a means of identifying or selecting for transformed cells. Examples include markers which are secretable antigens that can be identified by antibody interaction, or even secretable enzymes which can be detected by their catalytic activity. Secretable proteins fall into a number of classes, including small, diffusible proteins detectable, e.g., by ELISA; small active enzymes detectable in extracellular solution (e.g., alpha-amylase, beta-lactamase, phosphinothricin acetyltransferase); and proteins that are inserted or trapped in the cell wall (e.g., proteins that include a leader sequence such as that found in the expression unit of extensin or tobacco PR S).
(134) Many selectable marker coding regions are known and could be used with the present invention including, but not limited to, neo (Potrykus et al., 1985), which provides kanamycin resistance and can be selected for using kanamycin, G418, paromomycin, etc.; bar, which confers bialaphos or phosphinothricin resistance; a mutant EPSP synthase protein (Hinchee et al., 1988) conferring glyphosate resistance; a nitrilase such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al., 1988); a mutant acetolactate synthase (ALS) which confers resistance to imidazolinone, sulfonylurea or other ALS inhibiting chemicals (European Patent Application 154, 204, 1985); a methotrexate resistant DHFR (Thillet et al., 1988), a dalapon dehalogenase that confers resistance to the herbicide dalapon; or a mutated anthranilate synthase that confers resistance to 5-methyl tryptophan.
(135) An illustrative embodiment of selectable marker capable of being used in systems to select transformants are those that encode the enzyme phosphinothricin acetyltransferase, such as the bar gene from Streptomyces hygroscopicus or the pat gene from Streptomyces viridochromogenes. The enzyme phosphinothricin acetyl transferase (PAT) inactivates the active ingredient in the herbicide bialaphos, phosphinothricin (PPT). PPT inhibits glutamine synthetase, (Murakami et al., 1986; Twell et al., 1989) causing rapid accumulation of ammonia and cell death.
(136) Screenable markers that may be employed include a beta-glucuronidase (GUS) or uidA gene which encodes an enzyme for which various chromogenic substrates are known; an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al., 1988); a beta-lactamase gene (Sutcliffe, 1978), which encodes an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin); a xylE gene (Zukowsky et al., 1983) which encodes a catechol dioxygenase that can convert chromogenic catechols; an alpha-amylase gene (Ikuta et al., 1990); a tyrosinase gene (Katz et al., 1983) which encodes an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone which in turn condenses to form the easily-detectable compound melanin; a beta-galactosidase gene, which encodes an enzyme for which there are chromogenic substrates; a luciferase (lux) gene (Ow et al., 1986), which allows for bioluminescence detection; an aequorin gene (Prasher et al., 1985) which may be employed in calcium-sensitive bioluminescence detection; or a gene encoding for green fluorescent protein (Sheen et al., 1995; Haseloff et al., 1997; Reichel et al., 1996; Tian et al., 1997; WO 97/41228). The gene that encodes green fluorescent protein (GFP) is also contemplated as a particularly useful reporter gene (Sheen et al., 1995; Haseloff et al., 1997; Reichel et al., 1996; Tian et al., 1997; WO 97/41228). Expression of green fluorescent protein may be visualized in a cell or plant as fluorescence following illumination by particular wavelengths of light.
Plants/Plant Cells Having Modified Expression and/or Activity of THCA Synthase
(137) Described are cannabis plants and/or plant cells having modified production of THC as compared to wild-type plants (for example, original cultivars). In certain embodiments, there is provided cannabis plants and/or cells having downregulated expression and/or activity of THCA synthase as compared to wild-type plants (for example, original cultivars). In certain embodiments the cannabis plants and/or cells produce reduced amounts or no THC. In certain embodiments of the cannabis plants and/or cells with reduced amounts or no THC, there is increased production of other metabolites on the THC biosynthesis pathway.
(138) In certain embodiments, there is provided cannabis plants and cells having enhanced production of one or more secondary metabolites in the THC biosynthetic pathway and downregulated THC production. In specific embodiments, there is provided cannabis plants and cells having enhanced production of CBD and/or Cannabichromene and downregulated THC production.
(139) In certain embodiments, there is provided cannabis plants and/or cells having enhanced production of one or more secondary metabolites which share steps and intermediates in the THC biosynthetic pathway and down-regulated expression and/or activity of THCA synthase. In specific embodiments, there is provided cannabis plants and/or cells having enhanced production of CBD and/or Cannabichromene and down-regulated expression and/or activity of THCA synthase.
(140) Cannabis plants can be engineered to have modified expression and/or activity of other proteins in addition to THCA synthase. For example, the cannabis plants may also include modified expression and/or activity of other enzymes sharing intermediates with THCA synthase, such as CBDA synthase, CBCA synthase. Likewise, the cannabis plants of the invention may be crossed with plants having specific phenotypes.
(141) The cannabis plants with modified secondary metabolite production may be non-mutagenized, mutagenized, or transgenic, and the progeny thereof.
(142) In certain embodiments, the cannabis plants exhibiting modified secondary metabolite are the result of spontaneous mutations.
(143) In certain embodiments, the cannabis plants exhibiting modified secondary metabolite have been mutagenized by chemical or physical means. For example, ethylmethane sulfonate (EMS) may be used as a mutagen or radiation, such as x-ray, gamma-ray, and fast-neutron radiation may be used as a mutagen.
(144) In certain other embodiments, the cannabis plants exhibiting modified secondary metabolite are genetically engineered.
Antisense, siRNA and RNAi
(145) Antisense or RNA interference approaches may be used to down-regulate expression of a nucleic acid of the invention, e.g., as a further mechanism for modulating plant phenotype. That is, antisense sequences of the nucleic acids of the invention, or subsequences thereof, may be used to block expression of naturally occurring homologous nucleic acids. A variety of sense and antisense technologies, e.g., as set forth in Lichtenstein and Nellen (Antisense Technology: A Practical Approach IRL Press at Oxford University, Oxford, England, 1997), can be used.
(146) In certain embodiments, sense or antisense sequences are introduced into a cell, where they are transcribed. Such sequences may include both simple oligonucleotide sequences and catalytic sequences such as ribozymes.
(147) In certain embodiments, a reduction or elimination of expression (i.e., a knock-out or knockdown) THCA synthase in a transgenic plant is produced by introduction of a construct which expresses an antisense of THCA synthase coding strand or fragment thereof. For antisense suppression, the THCA synthase cDNA or fragment thereof is arranged in reverse orientation (with respect to the coding sequence) relative to the promoter sequence in the expression vector. In certain embodiments, the introduced sequence need not correspond to the full length cDNA or gene, and need not be identical to the cDNA or gene found in the plant to be transformed.
(148) In certain embodiments, the antisense sequence need only be capable of hybridizing to the target gene or RNA of interest. Thus, where the introduced sequence is of shorter length, a higher degree of homology to the endogenous transcription factor sequence will be needed for effective antisense suppression. While antisense sequences of various lengths can be utilized, in some embodiments, the introduced antisense sequence in the vector is at least 30 nucleotides in length in certain embodiments. In certain embodiments, the length of the antisense sequence is increased, and improved antisense suppression is observed. In some embodiments, the length of the antisense sequence in the vector is greater than 100 nucleotides. Transcription of an antisense construct as described results in the production of RNA molecules that comprise a sequence that is the reverse complement of the mRNA molecules transcribed from the endogenous gene to be repressed. The antisense nucleic acid may also include additional sequences.
(149) In certain embodiments, a reduction or elimination of expression (i.e., a knock-out or knockdown) of THCA synthase in a transgenic plant is accomplished by introduction of a construct that expresses siRNA that targets THCA synthase. In certain embodiments, siRNAs are short (20 to 24-bp) double-stranded RNA (dsRNA) with phosphorylated 5 ends and hydroxylated 3 ends with two overhanging nucleotides.
(150) Antisense and RNAi treatments represent one way of altering THCA synthase activity in accordance with the invention. In particular, constructs comprising a THCA synthase coding sequence, including fragments thereof, in antisense orientation, or combinations of sense and antisense orientation, may be used to decrease or effectively eliminate the expression of THCA synthase in a plant and obtain an improvement in shelf life as is described herein. Accordingly, this may be used to knock-out the THCA synthase or homologous sequences thereof.
(151) Techniques for RNAi are well known in the art and are described in, for example, Lehner et al., (2004) and Downward (2004). The technique is based on the fact that double stranded RNA is capable of directing the degradation of messenger RNA with sequence complementary to one or the other strand (Fire et al., 1998). Therefore, by expression of a particular coding sequence in sense and antisense orientation, either as a fragment or longer portion of the corresponding coding sequence, the expression of that coding sequence can be down-regulated.
(152) Antisense, and in some aspects RNAi, methodology takes advantage of the fact that nucleic acids tend to pair with complementary sequences. By complementary, it is meant that polynucleotides are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, the larger purines will base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairing.
(153) Targeting double-stranded (ds) DNA with polynucleotides leads to triple-helix formation; targeting RNA will lead to double-helix formation. Antisense oligonucleotides, when introduced into a target cell, specifically bind to their target polynucleotide and interfere with transcription, RNA processing, transport, translation and/or stability. Antisense and RNAi constructs, or DNA encoding such RNA's, may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host plant cell. In certain embodiments of the invention, such oligonucleotide may comprise any unique portion of a nucleic acid sequence provided herein. In certain embodiments of the invention, such a sequence comprises at least 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more contiguous nucleic acids of the nucleic acid sequence of a THCA synthase, and/or complements thereof, which may be in sense and/or antisense orientation. By including sequences in both sense and antisense orientation, increased suppression of the corresponding coding sequence may be achieved.
(154) Constructs may be designed that are complementary to all or part of the promoter and other control regions, exons, introns or even exon-intron boundaries of a gene. It is contemplated that the most effective constructs will include regions complementary to intron/exon splice junctions. Thus, one embodiment includes a construct with complementarity to regions within 50-200 bases of an intron-exon splice junction. It has been observed that some exon sequences can be included in the construct without seriously affecting the target selectivity thereof. The amount of exonic material included will vary depending on the particular exon and intron sequences used. One can readily test whether too much exon DNA is included simply by testing the constructs in vitro to determine whether normal cellular function is affected or whether the expression of related genes having complementary sequences is affected.
(155) As stated above, complementary or antisense means polynucleotide sequences that are substantially complementary over their entire length and have very few base mismatches. The term complement also includes sequences that are inverse complementary to the reference sequence. For example, sequences of fifteen bases in length may be termed complementary when they have complementary nucleotides at thirteen or fourteen positions. Naturally, sequences which are completely complementary will be sequences which are entirely complementary throughout their entire length and have no base mismatches. Other sequences with lower degrees of homology also are contemplated. For example, an RNAi or antisense construct which has limited regions of high homology, but also contains a non-homologous region (e.g., ribozyme; see above) could be designed. These molecules, though having less than 50% homology, would bind to target sequences under appropriate conditions.
(156) It may be advantageous to combine portions of genomic DNA with cDNA or synthetic sequences to generate specific constructs. For example, where an intron is desired in the ultimate construct, a genomic clone will need to be used. The cDNA or a synthesized polynucleotide may provide more convenient restriction sites for the remaining portion of the construct and, therefore, would be used for the rest of the sequence.
Tiling
(157) Polynucleotide trigger molecules can be identified by tiling gene targets in random length fragments, e.g., 200-300 polynucleotides in length, with partially overlapping regions, e.g., 25 or so nucleotide overlapping regions along the length of the target gene. Multiple gene target sequences can be aligned and polynucleotide sequence regions with homology in common are identified as potential trigger molecules for multiple targets. Multiple target sequences can be aligned and sequence regions with poor homology are identified as potential trigger molecules for selectively distinguishing targets. To selectively suppress a single gene, trigger sequences may be chosen from regions that are unique to the target gene either from the transcribed region or the non-coding regions, e.g., promoter regions, 3 untranslated regions, introns and the like.
(158) In some embodiments random design or empirical selection of polynucleotide sequences is used in selecting polynucleotide sequences effective in gene silencing. In some embodiments the sequence of a polynucleotide is screened against the genomic DNA of the intended plant to minimize unintentional silencing of other genes.
Insertion Mutagenesis
(159) In one embodiment, a reduction or elimination of expression (i.e., a knock-out) of THCA synthase in a transgenic plant can be obtained by insertion mutagenesis using the T-DNA of Agrobacterium tumefaciens or a selection marker cassette or any other non-sense DNA fragments. After generating the insertion mutants, the mutants can be screened to identify those containing the insertion in the THCA synthase gene. Plants containing one or more transgene insertion events at the desired gene can be crossed to generate homozygous plants for the mutation, as described in Koncz et al., (Methods in Arabidopsis Research; World Scientific, 1992).
Ribozyme
(160) Suppression of gene expression may also be achieved using a ribozyme. Ribozymes are RNA molecules that possess highly specific endoribonuclease activity. The production and use of ribozymes are disclosed in U.S. Pat. Nos. 4,987,071 and 5,543,508, which are incorporated by reference in their entirety. Synthetic ribozyme sequences including antisense RNAs can be used to confer RNA cleaving activity on the antisense RNA, such that endogenous mRNA molecules that hybridize to the antisense RNA are cleaved, which in turn leads to an enhanced antisense inhibition of endogenous gene expression.
Dominant Negative Transcription Factors
(161) Vectors expressing a mutated form of a transcription factor mRNA, e.g., sequences comprising one or more stop codon, or nonsense mutation) may also be used to suppress expression of a gene, such as THCA synthase, thereby reducing or eliminating it's activity and modifying one or more traits. Methods for producing such constructs are described in U.S. Pat. No. 5,583,021, which is incorporated herein by reference in its entirety. In certain embodiments, such constructs are made by introducing a premature stop codon into the transcription factor gene. Alternatively, a plant trait can be modified by gene silencing using double-strand RNA as described in Sharp (Genes and Development 13: 139-141, 1999).
Homologous Recombination or Site-Directed Mutagenesis
(162) Plant phenotype may also be altered by eliminating an endogenous gene, e.g., by homologous recombination (Kempin et al. (1997) Nature 389: 802).
(163) Targeted genome modification is a powerful tool for genetic manipulation of plant cells. For example, exogenous sequences can be integrated at targeted genomic locations and/or specific endogenous chromosomal sequences can be deleted, inactivated, or modified. In certain embodiments, engineered nuclease enzymes, such as, for example, zinc finger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs) are used.
(164) In certain embodiments, custom designed genome-modifying enzymes using molecular biology methods can be used. At least one plant cell can be obtained comprising at least one recognition sequence for a custom endonuclease, wherein the custom endonuclease is a fusion protein and the fusion protein comprises a zinc finger DNA binding domain or a Vir protein domain. Further, the custom endonuclease can comprise a polypeptide, a catalytically active RNA, an RNA-directed endonuclease, or a synthetic aptamer. The custom endonuclease can, for instance, be a meganuclease, wherein the meganuclease is selected from the group consisting of I-CreI, PI-SceI, and I-CeuI. The custom endonuclease can, for instance, comprise a LAGLIDADG, GIY-YIG, His-Cys Box, ZFN, or HNH sequence motif.
(165) In certain embodiments, the custom endonuclease is delivered as a protein or as a nucleic acid molecule. The nucleic acid molecule can be operably linked to a promoter active in the plant cell, wherein the promoter is a constitutive promoter, an inducible promoter, a tissue specific promoter, a cell cycle regulated promoter, or a developmentally regulated promoter. The nucleic acid construct can comprise at least one nucleic acid molecule that encodes at least one custom endonuclease flanked by one or more T-DNA borders. The construct can comprise a selectable or screenable marker gene.
(166) The plant cell can further comprise a second exogenous custom endonuclease, wherein the first and the second exogenous custom endonuclease each comprise different recognition sequences within the genome of the plant cell and are capable of producing a cut proximal to said recognition sequences. The plant cell can further comprise a selected DNA, wherein selected DNA comprises a promoter, intron, coding sequence or 3 UTR.
(167) A locus of interest in a plant cell is modified by introducing into a plant cell at least a first custom endonuclease, wherein the cell comprises a recognition sequence for the custom endonuclease in or proximal to the locus of interest; allowing the custom endonuclease to create a double stranded break in the DNA making up or flanking the locus of interest; and identifying the cell or a progeny cell thereof as comprising a modification in said locus of interest.
(168) In certain cases, only one custom endonuclease recognition sequence is introduced in the genome of a plant cell; alternatively, at least a second custom endonuclease may be introduced to a plant cell, wherein the cell comprises a second recognition sequence for the second custom endonuclease and the at least a second endonuclease is introduced at the same time as the first endonuclease or under serial transformation. Any endonuclease introduced into the plant cell can be expressed transiently or stably.
(169) Following transient or stable transformation of a plant cell with an expression construct encoding at least one custom endonuclease as well as a selectable or screenable marker gene, the plant or plant cell can be selected or screened based on the presence of the selectable or screenable marker gene.
(170) Following transformation the custom endonuclease can produce a double stranded break in the genome of the plant cell proximal to the recognition sequence, wherein the double stranded break is in a sequence that encodes the gene product of interest. Further, the modification in the locus of interest comprises gene conversion, gene replacement, homologous recombination, heterologous recombination, a deletion, or homeologous recombination and wherein the modification is in a sequence that regulates the expression of a gene of interest.
(171) Methods known in the art for assaying the cell or progeny cell thereof for evidence of the modification, including a genotypic assay, a phenotypic assay, or associating a plant genotype and a plant phenotype are used. The genotypic assay comprises PCR or nucleic acid sequencing. The phenotypic assay may comprise: a visual assay, measurement of an agronomic parameter, a biochemical assay, or an immunological assay.
(172) Thus the invention provides a method for altering an allele at a locus of interest in a plant genome comprising: expressing in a plant cell a first and second custom endonucleases, wherein the first and second custom endonucleases introduce double stranded breaks that flank the locus of interest; and allowing genetic recombination to occur at the locus of interest. This method may further comprise introducing into the plant cell a target DNA, wherein the genetic recombination results in the replacement of the allele with the target DNA.
(173) A plant trait may also be modified by using the Cre-lox system (for example, as described in U.S. Pat. No. 5,658,772). A plant genome can be modified to include first and second lox sites that are then contacted with a Cre recombinase. If the lox sites are in the same orientation, the intervening DNA sequence between the two sites is excised. If the lox sites are in the opposite orientation, the intervening sequence is inverted.
(174) In addition, silencing approach using short hairpin RNA (shRNA) system, complementary mature CRISPR RNA (crRNA) by CRISPR/Cas system, virus inducing gene silencing (VIGS) system may also be used to make down regulated or knockout of THCA synthase mutants. Dominant negative approaches may also be used to make down regulated or knockout of THCA synthase mutants.
(175) Other examples of site-directed mutagenesis include but are not limited to meganucleases and TALENs and also appreciate that post-translational gene silencing can be used to down regulate gene expression.
(176) In certain embodiments, transgenic plants (or plant cells, or plant explants, or plant tissues) are produced by a variety of techniques as described above or known in the art. Following construction of a vector, the vector or a polynucleotide is introduced into a plant, a plant cell, a plant explant or a plant tissue of interest. In certain embodiments, the plant cell, explant or tissue can be regenerated to produce a transgenic plant.
(177) RNA-Guided Endonucleases
(178) In certain embodiments, RNA-guided endonucleases may be used for silencing target sequences as part of a protein-RNA complex comprising a guide RNA. The guide RNA interacts with the RNA-guided endonuclease to direct the endonuclease to a specific target site, wherein the 5 end of the guide RNA base pairs with a specific protospacer sequence.
(179) The RNA-guided endonuclease can be derived from a clustered regularly interspersed short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system. The CRISPR/Cas system can be a type I, a type II, or a type III system. Non-limiting examples of suitable CRISPR/Cas proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966.
(180) In general, CRISPR/Cas proteins comprise at least one RNA recognition and/or RNA binding domain. RNA recognition and/or RNA binding domains interact with guide RNAs. CRISPR/Cas proteins can also comprise nuclease domains (i.e., DNase or RNase domains), DNA binding domains, helicase domains, RNAse domains, protein-protein interaction domains, dimerization domains, as well as other domains.
(181) The CRISPR/Cas-like protein can be a wild type CRISPR/Cas protein, a modified CRISPR/Cas protein, or a fragment of a wild type or modified CRISPR/Cas protein. The CRISPR/Cas-like protein can be modified to increase nucleic acid binding affinity and/or specificity, alter an enzyme activity, and/or change another property of the protein. For example, nuclease (i.e., DNase, RNase) domains of the CRISPR/Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR/Cas-like protein can be truncated to remove domains that are not essential for the function of the fusion protein. The CRISPR/Cas-like protein can also be truncated or modified to optimize the activity of the effector domain of the fusion protein.
Transformation
(182) Appropriate transformation techniques can include, but are not limited to: electroporation of plant protoplasts; liposome-mediated transformation; polyethylene glycol (PEG) mediated transformation; transformation using viruses; micro-injection of plant cells; micro-projectile bombardment of plant cells; vacuum infiltration; and Agrobacterium tumeficiens mediated transformation. Transformation means introducing a nucleotide sequence into a plant in a manner to cause stable or transient expression of the sequence.
(183) Examples of the modification of plant characteristics by transformation with cloned sequences which serve to illustrate the current knowledge in this field of technology, and which are herein incorporated by reference, include: U.S. Pat. Nos. 5,571,706; 5,677,175; 5,510,471; 5,750,386; 5,597,945; 5,589,615; 5,750,871; 5,268,526; 5,780,708; 5,538,880; 5,773,269; 5,736,369; and 5,610,042.
(184) Following transformation, plants may be selected using a dominant selectable marker incorporated into the transformation vector. In certain embodiments, such marker confers antibiotic or herbicide resistance on the transformed plants, and selection of transformants can be accomplished by exposing the plants to appropriate concentrations of the antibiotic or herbicide. After transformed plants are selected and grown to maturity, those plants showing a modified trait are identified. The modified trait can be any of those traits described above. Additionally, expression levels or activity of the polypeptide or polynucleotide of the invention can be determined by analyzing mRNA expression using Northern blots, RT-PCR, RNA seq or microarrays, or protein expression using immunoblots or Western blots or gel shift assays.
(185) Suitable methods for transformation of plant or other cells for use with the current invention are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG-mediated transformation of protoplasts (Omirulleh et al., 1993), by desiccation/inhibition-mediated DNA uptake (Potrykus et al., 1985), by electroporation (U.S. Pat. No. 5,384,253, specifically incorporated herein by reference in its entirety), by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. No. 5,302,523, specifically incorporated herein by reference in its entirety; and U.S. Pat. No. 5,464,765, specifically incorporated herein by reference in its entirety), by Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,591,616 and 5,563,055; both specifically incorporated herein by reference) and by acceleration of DNA coated particles (U.S. Pat. Nos. 5,550,318; 5,538,877; and 5,538,880; each specifically incorporated herein by reference in its entirety), etc. Through the application of techniques such as these, the cells of virtually any plant species may be stably transformed, and these cells developed into transgenic plants.
(186) Agrobacterium-Mediated Transformation
(187) Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art. See, for example, the methods described by Fraley et al., (1985), Rogers et al., (1987) and U.S. Pat. No. 5,563,055, specifically incorporated herein by reference in its entirety.
(188) Agrobacterium-mediated transformation is most efficient in dicotyledonous plants and is the preferable method for transformation of dicots, including Arabidopsis, tobacco, tomato, alfalfa and potato. Indeed, while Agrobacterium-mediated transformation has been routinely used with dicotyledonous plants for a number of years, it has only recently become applicable to monocotyledonous plants. Advances in Agrobacterium-mediated transformation techniques have now made the technique applicable to nearly all monocotyledonous plants. For example, Agrobacterium-mediated transformation techniques have now been applied to rice (Hiei et al., 1997; U.S. Pat. No. 5,591,616, specifically incorporated herein by reference in its entirety), wheat (McCormac et al., 1998), barley (Tingay et al., 1997; McCormac et al., 1998), alfalfa (Thomas et al., 1990) and maize (Ishidia et al., 1996).
(189) Modern Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described (Klee et al., 1985). Moreover, recent technological advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate the construction of vectors capable of expressing various polypeptide coding genes. The vectors described (Rogers et al., 1987) have convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide coding genes and are suitable for present purposes. In addition, Agrobacterium containing both armed and disarmed Ti genes can be used for the transformations. In those plant strains where Agrobacterium-mediated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer.
(190) Electroporation
(191) To effect transformation by electroporation, one may employ either friable tissues, such as a suspension culture of cells or embryogenic callus or alternatively one may transform immature embryos or other organized tissue directly. In this technique, one would partially degrade the cell walls of the chosen cells by exposing them to pectin-degrading enzymes (pectolyases) or mechanically wounding in a controlled manner Examples of some species which have been transformed by electroporation of intact cells include maize (U.S. Pat. No. 5,384,253; Rhodes et al., 1995; D'Halluin et al., 1992), wheat (Zhou et al., 1993), tomato (Hou and Lin, 1996), soybean (Christou et al., 1987) and tobacco (Lee et al., 1989).
(192) One also may employ protoplasts for electroporation transformation of plants (Bates, 1994; Lazzeri, 1995). For example, the generation of transgenic soybean plants by electroporation of cotyledon-derived protoplasts is described by Dhir and Widholm in Intl. Patent Appl. Publ. No. WO 9217598 (specifically incorporated herein by reference). Other examples of species for which protoplast transformation has been described include barley (Lazerri, 1995), sorghum (Battraw et al., 1991), maize (Bhattacharjee et al., 1997), wheat (He et al., 1994) and tomato (Tsukada, 1989).
(193) Microprojectile Bombardment
(194) Another method for delivering transforming DNA segments to plant cells in accordance with the invention is microprojectile bombardment (U.S. Pat. Nos. 5,550,318; 5,538,880; 5,610,042; and PCT Application WO 94/09699; each of which is specifically incorporated herein by reference in its entirety). In this method, particles may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, platinum, and preferably, gold. It is contemplated that in some instances DNA precipitation onto metal particles would not be necessary for DNA delivery to a recipient cell using microprojectile bombardment. However, it is contemplated that particles may contain DNA rather than be coated with DNA. Hence, it is proposed that DNA-coated particles may increase the level of DNA delivery via particle bombardment but are not, in and of themselves, necessary.
(195) For the bombardment, cells in suspension are concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate.
(196) An illustrative embodiment of a method for delivering DNA into plant cells by acceleration is the Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with monocot plant cells cultured in suspension. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. Microprojectile bombardment techniques are widely applicable, and may be used to transform virtually any plant species. Examples of species for which have been transformed by microprojectile bombardment include monocot species such as maize (PCT Application WO 95/06128), barley (Ritala et al., 1994; Hensgens et al., 1993), wheat (U.S. Pat. No. 5,563,055, specifically incorporated herein by reference in its entirety), rice (Hensgens et al., 1993), oat (Torbet et al., 1995; Torbet et al., 1998), rye (Hensgens et al., 1993), sugarcane (Bower et al., 1992), and sorghum (Casa et al., 1993; Hagio et al., 1991); as well as a number of dicots including tobacco (Tomes et al., 1990; Buising and Benbow, 1994), soybean (U.S. Pat. No. 5,322,783, specifically incorporated herein by reference in its entirety), sunflower (Knittel et al., 1994), peanut (Singsit et al., 1997), cotton (McCabe and Martinell, 1993), tomato (VanEck et al., 1995), and legumes in general (U.S. Pat. No. 5,563,055, specifically incorporated herein by reference in its entirety).
(197) Other Transformation Methods
(198) Transformation of protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments (see, e.g., Potrykus et al., 1985; Lorz et al., 1985; Omirulleh et al., 1993; Fromm et al., 1986; Uchimiya et al., 1986; Callis et al., 1987; Marcotte et al., 1988).
(199) Application of these systems to different plant strains depends upon the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts have been described (Toriyama et al., 1986; Yamada et al., 1986; Abdullah et al., 1986; Omirulleh et al., 1993 and U.S. Pat. No. 5,508,184; each specifically incorporated herein by reference in its entirety). Examples of the use of direct uptake transformation of cereal protoplasts include transformation of rice (Ghosh-Biswas et al., 1994), sorghum (Battraw and Hall, 1991), barley (Lazerri, 1995), oat (Zheng and Edwards, 1990) and maize (Omirulleh et al., 1993).
(200) To transform plant strains that cannot be successfully regenerated from protoplasts, other ways to introduce DNA into intact cells or tissues can be utilized. For example, regeneration of cereals from immature embryos or explants can be effected as described (Vasil, 1989). Also, silicon carbide fiber-mediated transformation may be used with or without protoplasting (Kaeppler, 1990; Kaeppler et al., 1992; U.S. Pat. No. 5,563,055, specifically incorporated herein by reference in its entirety). Transformation with this technique is accomplished by agitating silicon carbide fibers together with cells in a DNA solution. DNA passively enters as the cells are punctured. This technique has been used successfully with, for example, the monocot cereals maize (PCT Application WO 95/06128, specifically incorporated herein by reference in its entirety; (Thompson, 1995) and rice (Nagatani, 1997).
Tissue Cultures
(201) Tissue cultures may be used in certain transformation techniques for the preparation of cells for transformation and for the regeneration of plants therefrom. Maintenance of tissue cultures requires use of media and controlled environments. Media refers to the numerous nutrient mixtures that are used to grow cells in vitro, that is, outside of the intact living organism. The medium usually is a suspension of various categories of ingredients (salts, amino acids, growth regulators, sugars, buffers) that are required for growth of most cell types. However, each specific cell type requires a specific range of ingredient proportions for growth, and an even more specific range of formulas for optimum growth. Rate of cell growth also will vary among cultures initiated with the array of media that permit growth of that cell type.
(202) Nutrient media is prepared as a liquid, but this may be solidified by adding the liquid to materials capable of providing a solid support. Agar is most commonly used for this purpose. Bactoagar, Hazelton agar, Gelrite, and Gelgro are specific types of solid support that are suitable for growth of plant cells in tissue culture.
(203) Some cell types will grow and divide either in liquid suspension or on solid media. As disclosed herein, plant cells will grow in suspension or on solid medium, but regeneration of plants from suspension cultures typically requires transfer from liquid to solid media at some point in development. The type and extent of differentiation of cells in culture will be affected not only by the type of media used and by the environment, for example, pH, but also by whether media is solid or liquid.
(204) Tissue that can be grown in a culture includes meristem cells, Type I, Type II, and Type III callus, immature embryos and gametic cells such as microspores, pollen, sperm and egg cells. Type I, Type II, and Type III callus may be initiated from tissue sources including, but not limited to, immature embryos, seedling apical meristems, root, leaf, microspores and the like. Those cells which are capable of proliferating as callus also are recipient cells for genetic transformation.
(205) Somatic cells are of various types. Embryogenic cells are one example of somatic cells which may be induced to regenerate a plant through embryo formation. Non-embryogenic cells are those which typically will not respond in such a fashion. Certain techniques may be used that enrich recipient cells within a cell population. For example, Type II callus development, followed by manual selection and culture of friable, embryogenic tissue, generally results in an enrichment of cells. Manual selection techniques which can be employed to select target cells may include, e.g., assessing cell morphology and differentiation, or may use various physical or biological means. Cryopreservation also is a possible method of selecting for recipient cells.
(206) Manual selection of recipient cells, e.g., by selecting embryogenic cells from the surface of a Type II callus, is one means that may be used in an attempt to enrich for particular cells prior to culturing (whether cultured on solid media or in suspension).
(207) Where employed, cultured cells may be grown either on solid supports or in the form of liquid suspensions. In either instance, nutrients may be provided to the cells in the form of media, and environmental conditions controlled. There are many types of tissue culture media comprised of various amino acids, salts, sugars, growth regulators and vitamins Most of the media employed in the practice of the invention will have some similar components, but may differ in the composition and proportions of their ingredients depending on the particular application envisioned. For example, various cell types usually grow in more than one type of media, but will exhibit different growth rates and different morphologies, depending on the growth media. In some media, cells survive but do not divide. Various types of media suitable for culture of plant cells previously have been described. Examples of these media include, but are not limited to, the N6 medium described by Chu et al. (1975) and MS media (Murashige and Skoog, 1962).
Production and Characterization of Stably Transformed Plants
(208) After effecting delivery of exogenous DNA to recipient cells, the next steps generally concern identifying the transformed cells for further culturing and plant regeneration. In order to improve the ability to identify transformants, one may desire to employ a selectable or screenable marker gene with a transformation vector prepared in accordance with the invention. In this case, one would then generally assay the potentially transformed cell population by exposing the cells to a selective agent or agents, or one would screen the cells for the desired marker gene trait.
(209) Selection
(210) It is believed that DNA is introduced into only a small percentage of target cells in any one study. In order to provide an efficient system for identification of those cells receiving DNA and integrating it into their genomes one may employ a means for selecting those cells that are stably transformed. One exemplary embodiment of such a method is to introduce into the host cell, a marker gene which confers resistance to some normally inhibitory agent, such as an antibiotic or herbicide. Examples of antibiotics which may be used include the aminoglycoside antibiotics neomycin, kanamycin and paromomycin, or the antibiotic hygromycin. Resistance to the aminoglycoside antibiotics is conferred by aminoglycoside phosphostransferase enzymes such as neomycin phosphotransferase II (NPT II) or NPT I, whereas resistance to hygromycin is conferred by hygromycin phosphotransferase.
(211) Potentially transformed cells then are exposed to the selective agent. In the population of surviving cells will be those cells where, generally, the resistance-conferring gene has been integrated and expressed at sufficient levels to permit cell survival. Cells may be tested further to confirm stable integration of the exogenous DNA.
(212) One herbicide which constitutes a desirable selection agent is the broad spectrum herbicide bialaphos. Bialaphos is a tripeptide antibiotic produced by Streptomyces hygroscopicus and is composed of phosphinothricin (PPT), an analogue of L-glutamic acid, and two L-alanine residues. Upon removal of the L-alanine residues by intracellular peptidases, the PPT is released and is a potent inhibitor of glutamine synthetase (GS), a pivotal enzyme involved in ammonia assimilation and nitrogen metabolism (Ogawa et al., 1973). Synthetic PPT, the active ingredient in the herbicide Liberty also is effective as a selection agent. Inhibition of GS in plants by PPT causes the rapid accumulation of ammonia and death of the plant cells.
(213) The organism producing bialaphos and other species of the genus Streptomyces also synthesizes an enzyme phosphinothricin acetyl transferase (PAT) which is encoded by the bar gene in Streptomyces hygroscopicus and the pat gene in Streptomyces viridochromogenes. The use of the herbicide resistance gene encoding phosphinothricin acetyl transferase (PAT) is referred to in DE 3642 829 A, wherein the gene is isolated from Streptomyces viridochromogenes. In the bacterial source organism, this enzyme acetylates the free amino group of PPT preventing auto-toxicity (Thompson et al., 1987). The bar gene has been cloned (Murakami et al., 1986; Thompson et al., 1987) and expressed in transgenic tobacco, tomato, potato (De Block et al., 1987) Brassica (De Block et al., 1989) and maize (U.S. Pat. No. 5,550,318). In previous reports, some transgenic plants which expressed the resistance gene were completely resistant to commercial formulations of PPT and bialaphos in greenhouses.
(214) Another example of a herbicide which is useful for selection of transformed cell lines in the practice of the invention is the broad spectrum herbicide glyphosate. Glyphosate inhibits the action of the enzyme EPSPS which is active in the aromatic amino acid biosynthetic pathway. Inhibition of this enzyme leads to starvation for the amino acids phenylalanine, tyrosine, and tryptophan and secondary metabolites derived thereof. U.S. Pat. No. 4,535,060 describes the isolation of EPSPS mutations which confer glyphosate resistance on the Salmonella typhimurium gene for EPSPS, aroA. The EPSPS gene was cloned from Zea mays and mutations similar to those found in a glyphosate resistant aroA gene were introduced in vitro. Mutant genes encoding glyphosate resistant EPSPS enzymes are described in, for example, International Patent WO 97/4103. The best characterized mutant EPSPS gene conferring glyphosate resistance comprises amino acid changes at residues 102 and 106, although it is anticipated that other mutations will also be useful (PCT/WO97/4103).
(215) To use the bar-bialaphos or the EPSPS-glyphosate selective system, transformed tissue is cultured for 0-28 days on nonselective medium and subsequently transferred to medium containing from 1-3 mg/l bialaphos or 1-3 mM glyphosate as appropriate. While ranges of 1-3 mg/l bialaphos or 1-3 mM glyphosate will typically be preferred, it is proposed that ranges of 0.1-50 mg/l bialaphos or 0.1-50 mM glyphosate will find utility.
(216) An example of a screenable marker trait is the enzyme luciferase. In the presence of the substrate luciferin, cells expressing luciferase emit light which can be detected on photographic or x-ray film, in a luminometer (or liquid scintillation counter), by devices that enhance night vision, or by a highly light sensitive video camera, such as a photon counting camera. These assays are nondestructive and transformed cells may be cultured further following identification. The photon counting camera is especially valuable as it allows one to identify specific cells or groups of cells which are expressing luciferase and manipulate those in real time. Another screenable marker which may be used in a similar fashion is the gene coding for green fluorescent protein.
(217) Regeneration and Seed Production
(218) Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay, may be cultured in media that supports regeneration of plants. In an exemplary embodiment, MS and N6 media may be modified by including further substances such as growth regulators. One such growth regulator is dicamba or 2,4-D. However, other growth regulators may be employed, including NAA, NAA+2,4-D or picloram. Media improvement in these and like ways has been found to facilitate the growth of cells at specific developmental stages. Tissue may be maintained on a basic media with growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration, at least 2 wk, then transferred to media conducive to maturation of embryoids. Cultures are transferred every 2 wk on this medium. Shoot development will signal the time to transfer to medium lacking growth regulators.
(219) The transformed cells, identified by selection or screening and cultured in an appropriate medium that supports regeneration, will then be allowed to mature into plants. Developing plantlets are transferred to soiless plant growth mix, and hardened, e.g., in an environmentally controlled chamber, for example, at about 85% relative humidity, 600 ppm CO2, and 25-250 microeinsteins m 2 s1 of light. Plants may be matured in a growth chamber or greenhouse. Plants can be regenerated from about 6 wk to 10 months after a transformant is identified, depending on the initial tissue. During regeneration, cells are grown on solid media in tissue culture vessels. Illustrative embodiments of such vessels are petri dishes and Plant Cons. Regenerating plants can be grown at about 19 to 28 C. After the regenerating plants have reached the stage of shoot and root development, they may be transferred to a greenhouse for further growth and testing.
(220) Seeds on transformed plants may occasionally require embryo rescue due to cessation of seed development and premature senescence of plants. To rescue developing embryos, they are excised from surface-disinfected seeds 10-20 days post-pollination and cultured. An embodiment of media used for culture at this stage comprises MS salts, 2% sucrose, and 5.5 g/l agarose. In embryo rescue, large embryos (defined as greater than 3 mm in length) are germinated directly on an appropriate media. Embryos smaller than that may be cultured for 1 wk on media containing the above ingredients along with 10-5M abscisic acid and then transferred to growth regulator-free medium for germination.
(221) Characterization
(222) To confirm the presence of the exogenous DNA or transgene(s) in the regenerating plants, a variety of assays may be performed. Such assays include, for example, molecular biological assays, such as Southern and Northern blotting and PCR; biochemical assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzyme function; plant part assays, such as leaf or root assays; and also, by analyzing the phenotype of the whole regenerated plant.
(223) DNA Integration, RNA Expression and Inheritance
(224) Genomic DNA may be isolated from cell lines or any plant parts to determine the presence of the exogenous gene through the use of techniques well known to those skilled in the art. Note, that intact sequences will not always be present, presumably due to rearrangement or deletion of sequences in the cell. The presence of DNA elements introduced through the methods of this invention may be determined, for example, by polymerase chain reaction (PCR). Using this technique, discreet fragments of DNA are amplified and detected by gel electrophoresis. This type of analysis permits one to determine whether a gene is present in a stable transformant, but does not prove integration of the introduced gene into the host cell genome. It is typically the case, however, that DNA has been integrated into the genome of all transformants that demonstrate the presence of the gene through PCR analysis. In addition, it is not typically possible using PCR techniques to determine whether transformants have exogenous genes introduced into different sites in the genome, i.e., whether transformants are of independent origin. It is contemplated that using PCR techniques it would be possible to clone fragments of the host genomic DNA adjacent to an introduced gene.
(225) Positive proof of DNA integration into the host genome and the independent identities of transformants may be determined using the technique of Southern hybridization. Using this technique specific DNA sequences that were introduced into the host genome and flanking host DNA sequences can be identified. Hence the Southern hybridization pattern of a given transformant serves as an identifying characteristic of that transformant. In addition it is possible through Southern hybridization to demonstrate the presence of introduced genes in high molecular weight DNA, i.e., confirm that the introduced gene has been integrated into the host cell genome. The technique of Southern hybridization provides information that is obtained using PCR, e.g., the presence of a gene, but also demonstrates integration into the genome and characterizes each individual transformant.
(226) It is contemplated that using the techniques of dot or slot blot hybridization which are modifications of Southern hybridization techniques one could obtain the same information that is derived from PCR, e.g., the presence of a gene.
(227) Both PCR and Southern hybridization techniques can be used to demonstrate transmission of a transgene to progeny. In most instances the characteristic Southern hybridization pattern for a given transformant will segregate in progeny as one or more Mendelian genes (Spencer et al., 1992) indicating stable inheritance of the transgene.
(228) Whereas DNA analysis techniques may be conducted using DNA isolated from any part of a plant, RNA will only be expressed in particular cells or tissue types and hence it will be necessary to prepare RNA for analysis from these tissues. PCR techniques also may be used for detection and quantitation of RNA produced from introduced genes. In this application of PCR it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA. In most instances PCR techniques, while useful, will not demonstrate integrity of the RNA product. Further information about the nature of the RNA product may be obtained by Northern blotting. This technique will demonstrate the presence of an RNA species and give information about the integrity of that RNA. The presence or absence of an RNA species also can be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and will only demonstrate the presence or absence of an RNA species.
(229) Gene Expression
(230) While Southern blotting and PCR may be used to detect the gene(s) in question, they do not provide information as to whether the corresponding protein is being expressed. Expression may be evaluated by specifically identifying the protein products or the RNA products of the introduced genes or evaluating the phenotypic changes brought about by their expression.
(231) Assays for the production and identification of specific proteins may make use of physical-chemical, structural, functional, or other properties of the proteins. Unique physical-chemical or structural properties allow the proteins to be separated and identified by electrophoretic procedures, such as native or denaturing gel electrophoresis or isoelectric focusing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography. The unique structures of individual proteins offer opportunities for use of specific antibodies to detect their presence in formats such as an ELISA assay. Combinations of approaches may be employed with even greater specificity such as western blotting in which antibodies are used to locate individual gene products that have been separated by electrophoretic techniques. Additional techniques may be employed to absolutely confirm the identity of the product of interest such as evaluation by amino acid sequencing following purification. Although these are among the most commonly employed, other procedures may be additionally used.
(232) Assay procedures also may be used to identify the expression of proteins by their functionality, especially the ability of enzymes to catalyze specific chemical reactions involving specific substrates and products. These reactions may be followed by providing and quantifying the loss of substrates or the generation of products of the reactions by physical or chemical procedures. Examples are as varied as the enzyme to be analyzed and may include assays for PAT enzyme activity by following production of radiolabeled acetylated phosphinothricin from phosphinothricin and 14C-acetyl CoA or for anthranilate synthase activity by following loss of fluorescence of anthranilate, to name two.
(233) Very frequently the expression of a gene product is determined by evaluating the phenotypic results of its expression. These assays also may take many forms including but not limited to analyzing changes in the chemical composition, morphology, or physiological properties of the plant. Chemical composition may be altered by expression of genes encoding enzymes or storage proteins which change amino acid composition and may be detected by amino acid analysis, or by enzymes which change starch quantity which may be analyzed by near infrared reflectance spectrometry. Morphological changes may include greater stature or thicker stalks. Most often changes in response of plants or plant parts to imposed treatments are evaluated under carefully controlled conditions termed bioassays.
(234) Breeding Plants of the Invention
(235) In addition to direct transformation of a particular plant genotype with a construct prepared according to the current invention, transgenic plants may be made by crossing a plant having a selected DNA of the invention to a second plant lacking the construct. For example, a selected lignin biosynthesis coding sequence can be introduced into a particular plant variety by crossing, without the need for ever directly transforming a plant of that given variety. Therefore, the current invention not only encompasses a plant directly transformed or regenerated from cells which have been transformed in accordance with the current invention, but also the progeny of such plants.
(236) As used herein the term progeny denotes the offspring of any generation of a parent plant prepared in accordance with the instant invention, wherein the progeny comprises a selected DNA construct. Crossing a plant to provide a plant line having one or more added transgenes relative to a starting plant line, as disclosed herein, is defined as the techniques that result in a transgene of the invention being introduced into a plant line by crossing a starting line with a donor plant line that comprises a transgene of the invention. To achieve this one could, for example, perform the following steps: (a) plant seeds of the first (starting line) and second (donor plant line that comprises a transgene of the invention) parent plants; (b) grow the seeds of the first and second parent plants into plants that bear flowers; (c) pollinate a flower from the first parent plant with pollen from the second parent plant; and (d) harvest seeds produced on the parent plant bearing the fertilized flower.
(237) Backcrossing is herein defined as the process including the steps of: (a) crossing a plant of a first genotype containing a desired gene, DNA sequence or element to a plant of a second genotype lacking the desired gene, DNA sequence or element; (b) selecting one or more progeny plant containing the desired gene, DNA sequence or element; (c) crossing the progeny plant to a plant of the second genotype; and (d) repeating steps (b) and (c) for the purpose of transferring a desired DNA sequence from a plant of a first genotype to a plant of a second genotype.
(238) Introgression of a DNA element into a plant genotype is defined as the result of the process of backcross conversion. A plant genotype into which a DNA sequence has been introgressed may be referred to as a backcross converted genotype, line, inbred, or hybrid. Similarly a plant genotype lacking the desired DNA sequence may be referred to as an unconverted genotype, line, inbred, or hybrid.
Medical Benefits of Cannabis, Content of Cannabinoids and Analysis Thereof
(239) Some of the medical benefits attributable to one or more of the cannabinoids isolated from cannabis include treatment of pain, nausea, AIDS-related weight loss and wasting, multiple sclerosis, allergies, infection, depression, migraine, bipolar disorders, hypertension, post-stroke neuroprotection, epilepsy, and fibromyalgia, as well as inhibition of tumor growth, angiogenesis and metastasis. Studies have shown that cannabinoids may also be useful for treating conditions such as glaucoma, Parkinson's disease, Huntington's disease, migraines, inflammation, Crohn's disease, dystonia, rheumatoid arthritis, emesis due to chemotherapy, inflammatory bowel disease, atherosclerosis, posttraumatic stress disorder, cardiac reperfusion injury, prostate carcinoma, and Alzheimer's disease. For example, U.S. Pat. No. 6,630,507 discloses cannabinoids for use as antioxidants and neuroprotectants; U.S. Pat. No. 7,105,685 discloses cannabinoids for the treatment of diseases associated with immune dysfunction, particularly HIV disease and neoplastic disorders; U.S. Pat. No. 7,109,245 discloses cannabinoids useful as vasoconstrictors; U.S. Pat. Publication US2011/0257256 discloses THC-CBD composition for use in treating or preventing Cognitive Impairment and Dementia; PCT Publication WO/2009/147439 discloses use of cannabinoids in the manufacture of a medicament for use in the treatment of cancer, in particular the glioma tumor; PCT Publication WO/2007/148094 discloses use of cannabinoids composition for the treatment of neuropathic pain; and U.S. Pat. Publication US2010/0286098 discloses a method of treating tissue injury in a patient with colitis administering the cannabinoids.
(240) While a wide range of medical uses has been identified, the benefits achieved by cannabinoids for a particular disease or condition are believed to be attributable to a subgroup of cannabinoids or to individual cannabinoids. That is to say that different subgroups or single cannabinoids have beneficial effects on certain conditions, while other subgroups or individual cannabinoids have beneficial effects on other conditions. For example, THC is the main psychoactive cannabinoid produced by cannabis and is well-characterized for its biological activity and potential therapeutic application in a broad spectrum of diseases. CBD, another major cannabinoid constituent of cannabis, acts as an inverse agonist of the CB1 and CB2 cannabinoid receptors. Unlike THC, CBD does not produce psychoactive effects in humans. CBD is reported to exert analgesic, antioxidant, anti-inflammatory, and immunomodulatory effects.
(241) Terpenes, including terpenoids, are another class of compounds that are produced by cannabis. Reportedly, as many as 200 or more terpenes can be produced by cannabis plants, although the types and ratios of terpenes produced by a cannabis strain are dependent on genetics and growth conditions (e.g., lighting, fertilization, soil, watering frequency/amount, humidity, carbon dioxide concentration, and the like), as well as age, maturation, and time of day. Terpenes have been shown to have medicinal properties, and may be responsible for at least a portion of the medicinal value of cannabis.
(242) Some of the medical benefits attributable to one or more of the terpenes isolated from cannabis include treatment of sleep disorders, psychosis, anxiety, epilepsy and seizures, pain, microbial infections (fungal, bacterial, etc.), cancer, inflammation, spasms, gastric reflux, depression, and asthma. Some terpenes have been shown to: lower the resistance across the blood-brain barrier, act on cannabinoid receptors and other neuronal receptors, stimulate the immune system, and/or suppress appetite.
(243) To date, however, medicinal cannabis is used as a generic product whereby the patient utilizes the entirety of the different cannabinoids to achieve medicinal results. Efforts have been made to maximize the medicinal benefit of cannabis for a patient having a particular condition, but such efforts are invariably complicated. For example, because THC is psychoactive, some patients and regulatory authorities view cannabis with high CBD (and low THC) as being an alternative to traditional cannabis that is acceptable, legally, medically, and/or culturally. Additionally, cannabis as currently employed by a patient may lack consistent cannabinoid components and concentrations, and thereby fails to provide the maximum benefit to the patient.
(244) Cannabis expresses a large number of cannabinoids which are useful in the treatment of a variety of diseases. However, the usefulness of a cannabis cultivar for a particular disease is dependent upon the concentration of one or more specific cannabinoids, and/or the ratio between amounts of cannabinoids, produced by the cultivar.
(245) Other components of cannabis that have therapeutic effects include Cannabigerol (antimicrobial properties as well as inhibits proliferation of keratinocytes and cancer cells), delta-8-tetrahydrocannabinol (appetite stimulant). Other components of cannabis include Cannabielsoin, Cannabitriol, Cannabichromene, Cannabinol, Cannabicycol, and Terpenoids (including alpha-pinene, linalool, myrcene, beta-caryophyllene, carophyllene oxide, humulene-humulene, limonene and terpinolene).
(246) Cannabinoid biosynthesis occurs primarily in glandular trichomes that cover female flowers at a high density. Cannabigerolic acid is a precursor of THC, CBD, and Cannabichromene. In particular, THCA synthase catalyzes the production of delta-9-tetrahydrocannabinolic acid from cannabigerolic acid; delta-9-tetrahydrocannabinolic acid undergoes thermal conversion to form THC. CBDA synthase catalyzes the production of cannabidiolic acid from cannabigerolic acid; cannabidiolic acid undergoes thermal conversion to CBD. CBCA synthase catalyzes the production of cannabichromenic acid from cannabigerolic acid; cannabichromenic acid undergoes thermal conversion to cannabichromene. U.S. 2013/0067619 describes the pathway leading to the main cannabinoid types in Cannabis sativa and is incorporated herein by reference in its entirety.
(247) Cannabis, cannabis species, cannabis plant, or marijuana refers to a flowering plant including the species (or sub-species) Cannabis sativa, Cannabis ruderalis, and Cannabis indica.
(248) Cannabinoids refers to a class of chemical compounds that act on the cannabinoid receptors. Endocannabinoids are produced naturally in animals, including humans Phytocannabinoids are naturally-occurring cannabinoids produced in plants. Synthetic cannabinoids are artificially manufactured cannabinoids.
(249) cannabis species express at least 85 different phytocannabinoids, which are concentrated in resin produced in glandular trichomes. The phytocannabinoids are divided into subclasses based on structure, including cannabigerols, cannabichromenes, cannabidiols, tetrahydrocannabinols, cannabinols and cannabinodiols, and other cannabinoids.
(250) Cannabinoids found in cannabis include, without limitation: cannabigerol (CBG), cannabichromene (CBC), cannabidiol (CBD), tetrahydrocannabinol (THC), cannabinol (CBN) and cannabinodiol (CBDL), cannabicyclol (CBL), cannabivarin (CBV), tetrahydrocannabivarin (THCV), cannabidivarin (CBDV), cannabichromevarin (CBCV), cannabigerovarin (CBGV), cannabigerol monomethyl ether (CBGM), cannabinerolic acid, cannabidiolic acid (CBDA), cannabinol propyl variant (CBNV), cannabitriol (CBO), tetrahydrocannabinolic acid (THCA), and tetrahydrocannabivarinic acid (THCVA). Phytocannabinoids and their structures are discussed in more detail in U.S. Patent Application Pub. No. 2013/0059018, which is incorporated herein by reference in its entirety.
(251) Phytocannabinoids can occur as either the pentyl(5 carbon atoms) or propyl(3 carbon atoms) variant. The propyl and pentyl variants may have distinct properties from one another. For example, THC is a CB1 receptor agonist, whereas the propyl variant THCV is a CB1 receptor antagonist meaning that it has almost opposite effects from THC.
(252) Terpenes or terpenoids refers to a class of chemicals produced by plants, including cannabis. The term terpenoid generally refers to a chemically modified terpene (e.g., by oxidation). As used herein, the terpenes include terpenoids. Terpenes and terpenoids are often aromatic hydrocarbons and may have strong smells associated with them.
(253) Terpenes known to be produced by cannabis include, without limitation, aromadendrene, bergamottin, bergamotol, bisabolene, borneol, 4-3-carene, caryophyllene, cineole/eucalyptol, p-cymene, dihydroj asmone, elemene, farnesene, fenchol, geranylacetate, guaiol, humulene, isopulegol, limonene, linalool, menthone, menthol, menthofuran, myrcene, nerylacetate, neomenthylacetate, ocimene, perillylalcohol, phellandrene, pinene, pulegone, sabinene, terpinene, terpineol, terpineol-4-ol, terpinolene, and derivatives, isomers, enantiomers, etc. of each thereof.
(254) cannabis plants and products may also comprise other pharmaceutically relevant compounds, including flavonoids and phytosterols (e.g., apigenin, quercetin, cannflavin A, .beta.-sitosterol and the like).
(255) The terms product of cannabis, plant-derived product, Cannabis plant derived product, cannabis-derived product, or processed products as used herein refer to any products derived from the cannabis plant, including but not limited to the flower, resin (hashish), and oil (hash oil), as well as any preparations thereof. Preparations include, by way of non-limiting example, dried flower, kief, hashish, tincture, hash oil, infusions, pipe resins, edibles, and the like.
(256) As used herein, the term flower, bud, or dried flower refers to dried cannabis flowers, as well as the leaves (e.g., bracts) and stems associated therewith. This is the most widely consumed form of cannabis.
(257) The term tincture refers to cannabis extracts made using high-proof alcohol.
(258) The term cannabis oil refers to oil extracted from cannabis flower and leaves.
(259) The term infusion refers to infusion of cannabis in a variety of products. Non-limiting examples include tea, cocoa butter, dairy butter, cooking oil, glycerine, and other oils (e.g., skin moisturizers). Infusions include edibles like beer, soda, peanut butter, and the like.
(260) An edible cannabis product refers to any cannabis product that can be consumed as food. In some cases, edibles are made by infusion of the cannabis into a foodstuff. In some cases, edibles are made by combining a cannabis product (e.g., dried flower, kief, hashish, tincture, hash oil, or infusion) with other ingredients to make an edible (e.g., a cookie, chocolate, lollipop, beer, popcorn, etc.).
(261) Plants go through a vegetative stage of growth, followed by a flowering cycle. The period of growth between germination or cutting rooting and flowering is known as the vegetative phase of plant development. Vegetation is the sporophytic state of the cannabis plant. Plants do not produce flowers during the vegetative stage and are bulking up to a desired production size for flowering. During the vegetative phase, plants are busy carrying out photosynthesis and accumulating resources that will be needed for flowering and reproduction.
(262) Flowering cycle or flowering stage (also called bud cycle) refers to the period during which the plant produces buds and flowers. This is the reproductive phase of plant growth, cannabis is dioecious having female and male reproduction parts on separate plants. Flowering is the gametophytic or reproductive state of cannabis. For production, only females are selected for cultivation. For some cultivars, the switch from the vegetative stage to the flowering stage is light-dependent. Some cultivars are autoflowering, meaning they switch to the flowering stage automatically (e.g., with age).
(263) Cannabis cultivar refers to cannabis plants that have been selected for one or more desirable characteristics and propagated. Where the term cultivar is used, it is to be understood that the cultivar may be a result of breeding and/or the result of genetic manipulation. A cannabis cultivar as described herein is not naturally-occurring. Propagation may occur in any manner, including, without limitation, sexual reproduction (e.g., seed), cloning (e.g., cuttings, vegetative propagation), self-pollination, and the like.
(264) A plurality as used herein refers to more than one. For example, a plurality of cannabinoids may be two, three, four, five, or more cannabinoids.
(265) The term active cannabinoid as used herein refers to the non-acid form of the cannabinoid plus the amount of non-acid form estimated to be formed upon decarboxylation of the acid form.
(266) Cannabinoids in their acid forms (e.g., CBDA or THCA) can be converted to their non-acid forms (e.g., THC or CBD) by decarboxylation. Decarboxylation occurs when the cannabinoid is heated. In addition, cannabinoid acid forms have been shown to have therapeutic activity. Cannabinoids lose mass when they are converted from the acid to non-acid (active) form. In order to determine the estimated amount of active cannabinoid that will be present after decarboxylation, the amount of the acid form can be multiplied by 87.7%. This is a rough estimate, and the actual amount of active cannabinoid that will be produced may be dependent upon the cannabinoid, method of decarboxylation, further breakdown of the cannabinoid during the decarboxylation process (e.g., due to heat), etc.
(267) In one embodiment, therapeutically effective amount refers to that amount of a compound that results in prevention or amelioration of symptoms in a patient or a desired biological outcome, e.g., improved clinical signs, delayed onset of disease, etc. The effective amount can be determined by one of ordinary skill in the art. The selected dosage level can depend upon factors including, but not limited to, the severity of the condition being treated, and the condition and prior medical history of the patient being treated. However, it is within the skill of the art to start doses of the compound at levels lower than required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.
(268) The term modulate or modulating means any treatment of a disease or disorder in a subject, such as a mammal, including: preventing or protecting against the disease or disorder, that is, causing the abnormal biological reaction or symptoms not to develop; inhibiting the disease or disorder, that is, arresting or suppressing the development of abnormal biological reactions and/or clinical symptoms; and/or relieving the disease or disorder that is, causing the regression of abnormal biological reactions and/or clinical symptoms.
(269) As used herein, the term preventing refers to the prophylactic treatment of a patient in need thereof. The prophylactic treatment can be accomplished by providing an appropriate dose of a therapeutic agent to a subject at risk of suffering from an ailment, thereby substantially averting onset of the ailment.
(270) As used herein, the term condition refers to a disease state for which the compounds, compositions and methods provided herein are being used.
(271) As used herein, the term patient or subject refers to mammals and includes humans and non-human mammals. In particular embodiments herein, the patient or subject is a human.
(272) In one aspect, described herein is a cannabis plant that is a cannabis cultivar that produces high levels of CBD (and/or CBDA) and low levels of THC (and/or THCA). In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of about 18% to about 60% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of about 20% to about 40% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of about 20% to about 30% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of about 25% to about 35% by weight. It should be understood that any subvalue or subrange from within the values described above are contemplated for use with the embodiments described herein.
(273) In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 18% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 19% by weight. In a preferred embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 20% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 21% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 22% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 23% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 24% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 25% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 26% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 27% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 28% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 29% by weight. In one embodiment, the cannabis cultivar produces an assayable combined cannabidiolic acid and cannabidiol concentration of at least about 30% by weight.
(274) In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 3% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 2% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 1% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.3% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.1% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.09% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.08% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.07% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.06% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.05% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.04% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.03% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.02% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0% to about 0.01% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0.02% to about 3% by weight. In a preferred embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0.02% to about 2% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0.03% to about 2% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0.05% to about 2% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of between about 0.07% to about 2% by weight. It should be understood that any subvalue or subrange from within the values described above are contemplated for use with the embodiments described herein.
(275) In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 3% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 2% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 1.9% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 1.8% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 1.7% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 1.6% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 1.5% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 1.4% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 1.3% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 1.2% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 1% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.5% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.3% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.2% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetraydrocanabinol and tetrahydrocannabinolic acid concentration of less than about 0.1% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.09% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.08% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.07% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.06% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.05% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.04% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.03% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.02% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of less than about 0.01% by weight. In one embodiment, the cannabis cultivar produces an assayable combined delta-9-tetrahydrocannabinol and tetrahydrocannabinolic acid concentration of about 0.07% by weight.
(276) In one embodiment, the estimated active cannabidiol concentration is between about 18% and about 60% by weight. In one embodiment, the estimated active cannabidiol concentration is between about 20% and about 60% by weight. In one embodiment, the estimated active cannabidiol concentration is between about 20% and about 50% by weight. In one embodiment, the estimated active cannabidiol concentration is between about 20% and about 40% by weight. In one embodiment, the estimated active cannabidiol concentration is between about 20% and about 30% by weight. In one embodiment, the estimated active cannabidiol concentration is between about 20% and about 25% by weight. In one embodiment, the estimated active cannabidiol concentration is between about 25% and about 40% by weight. In one embodiment, the estimated active cannabidiol concentration is between about 25% and about 30% by weight. It should be understood that any subvalue or subrange from within the values described above are contemplated for use with the embodiments described herein.
(277) In one embodiment, the estimated active cannabidiol concentration is at least about 18% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 19% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 20% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 21% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 22% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 23% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 24% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 25% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 26% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 27% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 28% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 29% by weight. In one embodiment, the estimated active cannabidiol concentration is at least about 30% by weight.
(278) In one aspect, this invention is directed to a cannabis strain or product thereof, wherein the ratio of estimated active cannabidiol to estimated active THC is between about 400:1 and about 15:1. In one embodiment, the ratio of active cannabidiol to active THC is between about 300:1 and about 20:1. In one embodiment, the ratio of active cannabidiol to active THC is between about 300:1 and about 25:1. In one embodiment, the ratio of active cannabidiol to active THC is between about 300:1 and about 30:1. In one embodiment, the ratio of active cannabidiol to active THC is between about 300:1 and about 50:1. In one embodiment, the ratio of active cannabidiol to active THC is between about 300:1 and about 70:1. In one embodiment, the ratio of active cannabidiol to active THC is between about 300:1 and about 80:1. In one embodiment, the ratio of active cannabidiol to active THC is between about 300:1 and about 100:1. In one embodiment, the ratio of active cannabidiol to active THC is between about 300:1 and about 200:1.
(279) The concentration of cannabinoids can be determined based on a sample taken from any portion of the cannabis plant. The concentration of cannabinoids can be determined based on a sample taken at any point in the life cycle of the plant. In a preferred embodiment, the sample is taken from a flower (or inflorescence) of a cannabis plant. In one embodiment, the sample is taken from one or more flowers, leaves, stems, or a combination thereof. In one embodiment, the sample is taken during a vegetative stage of the cannabis life cycle. In one embodiment, the sample is taken during the flowering stage of the cannabis life cycle.
(280) In one aspect, the cannabinoid and/or terpene composition of a strain of cannabis is consistent between batches. In one embodiment, the cannabinoid and/or terpene composition of a particular strain is consistent between batches grown and harvested at different times. In one embodiment, the cannabinoid and/or terpene composition of a particular strain is consistent between batches grown and/or harvested at different locations (e.g., different cultivation facilities). The term consistent means that the concentration of a given cannabinoid and/or terpene present in a particular strain does not vary by more than 20%, preferably 15%, 10%, or 5%. In one embodiment, the cannabinoid is a phytocannabinoid. In one embodiment, the cannabinoid is CBD. In one embodiment, the cannabinoid is THC. In one embodiment, the cannabinoid is CBN. In one embodiment, the cannabinoid is at least one of cannabigerol (CBG), cannabichromene (CBC), cannabidiol (CBD), tetrahydrocannabinol (THC), cannabinol (CBN) and cannabinodiol (CBDL), cannabicyclol (CBL), cannabivarin (CBV), tetrahydrocannabivarin (THCV), cannabidivarin (CBDV), cannabichromevarin (CBCV), cannabigerovarin (CBGV), cannabigerol monomethyl ether (CBGM), cannabinerolic acid, cannabidiolic acid (CBDA), Cannabinol propyl variant (CBNV), cannabitriol (CBO), tetrahydrocannabinolic acid (THCA), or tetrahydrocannabivarinic acid (THCVA).
(281) In one aspect, the cannabinoid and/or terpene composition of the strain is determined by assaying the concentration of at least one cannabinoid in a subset (e.g., sample) of the harvested product. In one embodiment, THC concentration is assayed. In one embodiment, CBD concentration is assayed. In one embodiment, the cannabinoid is CBN. In one embodiment, the cannabinoid is at least one of cannabigerol (CBG), cannabichromene (CBC), cannabidiol (CBD), tetrahydrocannabinol (THC), cannabinol (CBN) and cannabinodiol (CBDL), cannabicyclol (CBL), cannabivarin (CBV), tetrahydrocannabivarin (THCV), cannabidivarin (CBDV), cannabichromevarin (CBCV), cannabigerovarin (CBGV), cannabigerol monomethyl ether (CBGM), cannabinerolic acid, cannabidiolic acid (CBDA), Cannabinol propyl variant (CBNV), cannabitriol (CBO), tetrahydrocannabinolic acid (THCA), or tetrahydrocannabivarinic acid (THCVA). In one embodiment, the concentration of one or more terpenes is assayed.
(282) Assays used heretofore to determine cannabinoid concentrations have shown significant deviation for the same plant. Such deviation is a problem for the cannabis industry as a whole, and particularly the medical cannabis industry, which requires reproducibility. After careful examination, it is contemplated that the moisture content of the assayed composition is a critical parameter in the variability of the assayed concentrations. Surprisingly, such variability can be minimized by rendering the moisture content consistent from assay to assay. In one aspect, this invention relates to a method of assaying cannabinoid concentration of a cannabis sample such that the assay provides reproducible results between different samples, e.g., batches and/or strains.
(283) In one embodiment, the moisture content of a sample to be tested (e.g., for cannabinoid content) is adjusted to a consistent level prior to performing the assay. In one embodiment, a sample to be tested is adjusted to 40% moisture or less. In one embodiment, a sample to be tested is adjusted to about 40% moisture. In one embodiment, a sample to be tested is adjusted to about 30% moisture. In one embodiment, a sample to be tested is adjusted to about 20% moisture. In one embodiment, a sample to be tested is adjusted to about 15% moisture. In one embodiment, a sample to be tested is adjusted to about 14% moisture. In one embodiment, a sample to be tested is adjusted to about 13% moisture. In one embodiment, a sample to be tested is adjusted to about 12% moisture. In one embodiment, a sample to be tested is adjusted to about 11% moisture. In one embodiment, a sample to be tested is adjusted to about 10% moisture. In one embodiment, a sample to be tested is adjusted to about 9% moisture. In one embodiment, a sample to be tested is adjusted to about 8% moisture. In one embodiment, a sample to be tested is adjusted to about 7% moisture. In one embodiment, a sample to be tested is adjusted to about 6% moisture. In one embodiment, a sample to be tested is adjusted to about 5% moisture. In yet another approach, the composition is lyophilized prior to assay. Methods for determining moisture content are well-known in the art.
(284) The moisture content of a sample to be tested can be adjusted using any method for adjusting moisture content. In one embodiment, the moisture content is adjusted by placing the sample in a hydrator or humidity chamber at a desired humidity level for a period of time before it is assayed. In one embodiment, the moisture content is adjusted by dehydrating the sample to a desired moisture content. The sample can be dehydrated using any dehydration method. In one embodiment, the moisture content is adjusted by lyophilizing the sample. In one embodiment, the moisture content of more than one sample is adjusted at the same time. In one embodiment, the moisture content of the sample is determined before the adjusting step. In one embodiment, the moisture content of the sample is not determined before the adjusting step.
(285) In one embodiment, the concentration of cannabinoids is determined irrespective of the moisture content. For example, the dry weight of the sample can be determined, and the cannabinoid content is determined relative to the dry weight.
(286) After the desired moisture content has been achieved, the cannabinoid content can be determined using any method. Methods include, without limitation, radioimmunoassay, gas chromatography/mass spectrometry, gas chromatography, liquid chromatography, liquid chromatography/mass spectrometry, and enzyme immunoassay.
EXAMPLES
(287) In view of the foregoing, those of skill in the art should appreciate that changes can be made in the specific aspects that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention. Thus, specific structural and functional details disclosed herein are not to be interpreted as limiting. It should be understood that the entire disclosure of each reference cited herein is incorporated within the disclosure of this application.
Example 1
(288) THCA Synthase Cloning and Sequencing
(289) Several Cannabis sativa THCA synthase sequences were aligned, and
(290) Alignments of 30 THCA synthase gene accessions in GenBank have identified highly conserved sequence regions (13 regions of 21 to 42 bp) from which PCR primers can be generated for DNA amplification followed by cloning into intermediate vectors. To reduce errors introduced by PCR, an editing enzyme can be used and multiple independent amplifications can provide DNA for sequencing; thus, allowing the removal of rare mutations that may arise from the process of amplification. In certain embodiments, the THCA synthase gene sequence of cannabis strains used by TWEED can be used to ensure functionality of antisense RNA (asRNA).
(291) The THCA synthase coding genes from 3 Cannabis sativa strains (DK-1, ND-1 and SH-4) were amplified by polymerase chain reaction (PCR) using proof-reading polymerase PHUSION from THERMO FISHER in order to avoid PCR mistakes and the PCR products were cloned into pGEM vector for sequencing. Two or three independent clones (in pGEM vector) from each PCR reaction were sequenced to verify sequence. DK-1 and SH-4 used for alignment in
(292) The cloned THCA synthase sequences obtained for DK-1 and SH-4 were aligned with NCBI sequences AB057805.1 (SEQ ID NO:40); AB212829.1 (SEQ ID NO:28); AB212833.1 (SEQ ID NO:24); AB292683.1 (SEQ ID NO:41); JQ437487.1 (SEQ ID NO:2); and JQ437491.1 (SEQ ID NO:13) as shown in
Example 2
(293) Design of RNA Interfering Constructs
(294) In order to avoid off-target effects by silencing unrelated genes/proteins, conserved domains were avoided when designing RNA interference constructs. Conserved protein domains were identified in the THCA synthase by searching for conserved domains in the National Center for Biotechnology Information (NCBI) database.
Example 3
(295) Design of Antisense Constructs
(296) For creating an expression cassette encoding RNAi constructs to induce RNA silencing via double-stranded RNA formation, full antisense RNA encoding DNA (SEQ ID NO:81) was amplified by PCR. The primers used for PCR were THCA-FullAS-F (SEQ ID NO:59) and THCA-FullAS-R (SEQ ID NO:60). The PCR fragment was cloned into pGEM vector and the sequence was verified.
(297) In order to create a base vector suitable for transgenic expression of antisense RNA or interfering RNA, a promoter and a suitable multiple cloning site was inserted into vector pCAMBIA1391 to create the pCAMBIA1391-35S vector, depicted in
(298) The full antisense RNA encoding DNA was excised from the intermediate pGEM vector and cloned into base plant transformation vector pCAMBIA1391-35S at a site between 35S promoter and NOS terminator (MluI-BstEII sites as shown in
Example 4
(299) Design of Small Hair Pin Constructs
(300) For creating a vector to induce RNA silencing via RNA interference, a small hair pin RNA construct was designed as a sense-loop-antisense RNA encoding DNA corresponding to the 5-end of the THCA synthase gene coding sequencing. The sense portion of the construct corresponds to about 200 base pairs (SEQ ID NO:61) and avoids all conserved domains and potential silencing of other enzymes encoding genes in Cannabis sativa. The sense portion is also located in the RNA region identified as most accessible (see
(301) The DNA encoding the small hair pin RNA was excised from the intermediate pGEM vector and cloned into base plant transformation vector pCAMBIA1391-35S at a site between 35S promoter and NOS terminator (MluI-BstEII sites as shown in
Example 5
(302) Design of Large Hair Pin Constructs
(303) For creating a vector to induce RNA silencing via RNA interference, a large hair pin RNA construct was designed as sense-loop-antisense RNA encoding DNA corresponding to the mid-portion of the THCA synthase gene coding sequencing. The sense portion of the construct corresponds to about 550 base pairs (SEQ ID NO:69) and avoids the most likely common domains (FAD binding and BBE domains), and therefore avoids potential silencing of other enzymes encoding genes in Cannabis sativa. The sense portion was amplified using primers THCA-hpRNA2-SN-F2 (SEQ ID NO:55) and THCA-hpRNA2-SN-R2 (SEQ ID NO:56) and is followed by the loop portion (SEQ ID NO:70). The loop portion is followed by the antisense portion (SEQ ID NO:71), which was amplified using THCA-hpRNA2-AS-F2 (SEQ ID NO:57) and THCA-hpRNA2-AS-R2 (SEQ ID NO:58). The sequence of the complete sense-loop-antisense RNA encoding DNA is provided as SEQ ID NO:72.
(304) The DNA encoding the small hair pin RNA was excised from the intermediate pGEM vector and cloned into base plant transformation vector pCAMBIA1391-35S at a site between 35S promoter and NOS terminator (MluI-BstEII sites as shown in
Example 6
(305) Transformation of Cannabis with the Polynucleotides
(306) Cannabis tissue cultures (callus, shoot and root induction) can be established. Transient transformations and GUS staining of cannabis after biolistic transformation will be performed to the extent needed. Then, the polynucleotides of the present invention can be transformed into cannabis plants. In particular, Agrobacterium-mediated transformation of reproductive cannabis cells can be also be performed using floral dip/vacuum infiltration methods followed by seed collection and analysis. In addition, Agrobacterium-mediated transformation of somatic cells (leaf disk and callus transformation followed by regeneration in tissue cultures) can be performed. In particular embodiments, petioles or floral organs can also be transformed. Biolistic transformation procedures using methodology selected from transient transformation experiments can be performed, and plants can be regenerated from tissue cultures. In addition, PEG-mediated protoplast transformations can be performed. In certain embodiments, a GUS reporter gene can be inserted into the vector before transformation.
(307) The transformants (generated by, e.g., Agrobacterium, biolistic, or PEG-mediated transformation) will be subjected to DNA analysis (PCR) and GUS staining.
Example 7
(308) Generation of Stable Transformants, Analysis of THCA Synthase Silencing, and Selection of Most Suitable Strains for Metabolite Analysis and Industrial Applications
(309) After regeneration of multiple transformed cannabis plants, polynucleotide analysis can be performed to confirm gene integration and to determine RNA expression levels. In addition, mRNA and protein levels of THCA synthase can be determined. The content of one or more bioactive metabolites, such as terpenes or cannabinoids in plant tissues can also be determined. For example, the content of one or more of THC, CBD, and/or Cannabichromene can be determined with well-established procedures, such as the methods described in US Patent Publication 20160139055, which is hereby incorporated in its entirety. Plants in which THCA synthase activity is reduced and which have reduced THC and/or increased CBD content will be selected.