PROMOTER AND CARRIER COMPOSED OF SAME AND APPLICATION THEREOF

Abstract

An improved promoter and a use thereof. An improvement is to mutate a nucleic acid sequence between 35 region and 10 region in a promoter region into recognition sites for an endonuclease. The improvement can overcome the problem that a strong promoter in a vector based on blue-white screening initiates the transcription or translation of foreign genes and a transcription or translation product might be toxic to a host and cannot be cloned, avoid the deficiency that frameshift mutation of a gene due to a lack of 1-2 bp of the vector at digestion sites results in false positive clones, and eliminate a false negative phenomenon that a plate is rich in blue spots due to a small fragment of foreign DNA and a reading frame of the gene which is unchanged by inserting the foreign DNA.

Claims

1. An improved promoter, obtained by mutating a nucleic acid sequence between 35 region and 10 region in a promoter region into recognition sites for an endonuclease.

2. The improved promoter of claim 1, obtained by mutating a nucleic acid sequence between 35 region and 10 region in a promoter region of a -galactosidase into the recognition sites for the endonuclease.

3. The improved promoter of claim 2, wherein the nucleic acid sequence between 35 region and 10 region in the promoter region of the -galactosidase is shown by SEQ ID NO.1-2.

4. The improved promoter of claim 2, wherein the endonuclease is any one or a combination of at least two of EcoRV, AleI, BamHI, XhoI and PmlI.

5. The improved promoter of claim 2, wherein a nucleic acid sequence between 35 region and 10 region of the improved promoter is shown by SEQ ID NO.3-10.

6. A cloning vector, comprising the improved promoter of claim 1.

7. The vector of claim 6, wherein a lacZ gene on the vector is replaced with a gene toxic to a host.

8. The vector of claim 7, wherein the gene toxic to the host is a gene whose transcription or translation product is capable of causing the host to fail to grow or proliferate; preferably, the gene toxic to the host is a lethal gene and/or a restriction enzyme gene; preferably, the lethal gene is a ccdB gene, wherein a nucleic acid sequence of the ccdB gene is shown by SEQ ID NO.11; preferably, the cloning vector is any one or a combination of at least two of pUC18, pUC19, pUC57, pCA, pCK, pCC and pCC1; preferably, the vector further comprises a foreign gene operably ligated to the vector; and optionally, the foreign gene is a lacI expression element, wherein a nucleic acid sequence of the lacI expression element is shown by SEQ ID NO.12.

9. A T vector, obtained by linearizing the vector of claim 6 to produce a linearized vector, and adding one dideoxythymidine nucleotide to a 3 end of the linearized vector.

10. A recombinant vector, obtained by inserting a foreign gene into the T vector of claim 9; wherein preferably, the foreign gene is operably ligated between recognition sites for an endonuclease of an improved promoter.

11. A method for preparing the T vector of claim 9, comprising the following steps: (1) replacing a lacZ gene on a vector with a gene toxic to a host; (2) designing a primer according to recognition sites for an endonuclease to be mutated into, and using an original promoter and an expression-regulating gene of the original promoter as a template for PCR amplification, to obtain a product with an improved promoter; (3) cyclizing the product in step (2) by a Gibson recombination method to obtain a vector with the promoter; and (4) linearizing the vector in step (3), and adding one dideoxythymidine nucleotide to a 3 end of the linearized vector, to obtain the T vector.

12. The method of claim 11, wherein a nucleic acid sequence of the primer in step (2) is shown by SEQ ID NO.13-28; preferably, the linearizing in step (4) is performed through endonuclease digestion and/or the PCR amplification; preferably, the adding one dideoxythymidine nucleotide in step (4) is performed with a terminal transferase and/or a Taq DNA polymerase; preferably, before step (1), the method further comprises performing codon optimization on the gene toxic to the host; and preferably, after step (1), the method further comprises inserting a foreign gene into the vector.

13. A host cell, comprising a cloning vector, said cloning vector comprising an improved promoter obtained by mutating a nucleic acid sequence between 35 region and 10 region in a promoter region into recognition sites for an endonuclease, and/or the recombinant vector of claim 10; wherein preferably, the host cell is wild Escherichia coli.

14. A method for preparing a protein of interest, comprising: adding 1 A base to a 3 end of a foreign gene, ligating the foreign gene added with the A base to the T vector of claim 4 to be introduced into a host cell, and cultivating the host cell under appropriate conditions, to obtain a positive clone; wherein preferably, the host cell is wild Escherichia coli.

15. A kit, comprising any one or a combination of at least two of (a) an improved promoter, said promoter obtained by mutating a nucleic acid sequence between 35 region and 10 region in a promoter region into recognition sites for an endonuclease, (b) a cloning vector comprising the improved promoter of (a), (c) a T vector, obtained by linearizing the cloning vector of (b) to produce a linearized vector, and adding one dideoxythymidine nucleotide to a 3 end of the linearized vector, (d) a recombinant vector, obtained by inserting a foreign gene into the T vector of (c); wherein preferably, the foreign gene is operably ligated between recognition sites for an endonuclease of an improved promoter, and (e) and the host cell of claim 13; wherein preferably, the kit is used for gene cloning.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0064] FIG. 1 is an electrophoresis diagram of colony PCR identification in Example 1 of the present application, where a size of a DNA marker is 0.1 kb, 0.25 kb, 0.5 kb, 0.75 kb, 1 kb, 1.5 kb, 2 kb, 3 kb and 5 kb;

[0065] FIG. 2 is an electrophoresis diagram of colony PCR identification in Example 3 of the present application, where a size of a DNA marker is 0.1 kb, 0.25 kb, 0.5 kb, 0.75 kb, 1 kb, 1.5 kb, 2 kb, 3 kb and 5 kb; and

[0066] FIG. 3 is an electrophoresis diagram of colony PCR identification in Example 4 of the present application, where a size of a DNA marker is 0.1 kb, 0.25 kb, 0.5 kb, 0.75 kb, 1 kb, 1.5 kb, 2 kb, 3 kb and 5 kb.

DETAILED DESCRIPTION

[0067] To further elaborate on the technical means adopted and the effects achieved in the present application, the technical solutions of the present application are further described below through specific embodiments, but the present application is not limited to the scope of the embodiments.

[0068] The present application adopts conventional techniques and methods in the fields of genetic engineering and molecular biology, and general reference literature provides definitions and methods known to those skilled in the art. However, those skilled in the art may adopt other conventional methods, experimental schemes and reagents in the art on the basis of the technical solutions described in the present application without being limited by specific examples of the present application.

[0069] Experiments without specific techniques or conditions noted in the examples are conducted according to techniques or conditions described in the literature in the art or a product specification. The reagents or instruments used without manufacturers are conventional products commercially available through proper channels.

Explanation of Terms:

[0070] LacZ gene: a gene widely used in gene expression regulation researches. An encoded 3-galactosidase (-gal) is a tetramer composed of 4 subunits and can catalyze a hydrolysis of lactose. The -gal is relatively stable, appears blue when stained with X-Gal as a substrate, and is easy to detect and observe. Many advantages of the LacZ gene make it a commonly-used marker gene in genetic engineering experiments such as screening of transformed strains and -galactosidase color test method, that is, blue-white screening.

[0071] LacZ gene: an N-terminal -fragment for encoding the -galactosidase (lacZ). The -galactosidase with enzymatic activity may be formed through -complementation and cleave a colorless compound, X-gal(5-bromo-4-chloro-3-indole--D-galactoside), into galactose and a dark blue substance, 5-bromo-4-indigo.

[0072] Endonuclease: an enzyme that can hydrolyze a phosphodiester bond inside a molecular chain to generate oligonucleotides among nucleic acid hydrolases.

[0073] PCR technology: a polymerase chain reaction, in which DNA is denatured in vitro at a high temperature of 95 C. to be single-stranded, a primer combines with a single strand at a low temperature (generally about 60 C.) based on a principle of complementary base pairing, the temperature is adjusted to an optimal reaction temperature of a DNA polymerase (about 72 C.) at which the DNA polymerase synthesizes a complementary strand along a direction from phosphate to five-carbon sugar (5-3). A PCR instrument based on polymerases is in fact a temperature control device and can control the temperature well between a denaturation temperature, a renaturation temperature and an extension temperature.

Materials:

[0074]

TABLE-US-00003 Kanamycin-resistant pUC57 plasmid Genewiz Inc. Suzhou pCK plasmid Genewiz Inc. Suzhou Chloramphenicol-resistant pCC1TM plasmid EPICENTRE Top10F competent cell Invitrogen Restriction enzymes: EcoRV, AleI NEB T4 DNA ligase NEB lambdaDNA NEB Gibson Assembly Master Mix kit NEB Primer synthesis Genewiz Inc. Suzhou

Example 1 Construction and Function Verification of a High-Copy Cloning Vector

[0075] This example provides a method for constructing the high-copy cloning vector, which includes specific steps described below.

[0076] (I) The lacZ gene of pUC57 (kanamycin resistance) was replaced with a ccdB gene, specifically including steps described below.

[0077] (1) The ccdB gene was synthesized (by Genewiz Inc. Suzhou) through a full gene synthesis, and its nucleotide sequence is shown by SEQ ID NO.11:

TABLE-US-00004 ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTT TGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACGGATGGTGA TCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTT TACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGA TATGGCCAGTGTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCA GCCACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGA ATATAA.

[0078] (2) The kanamycin-resistant pUC57 plasmid was used as a template and SEQ ID NO.29-30 were used as primers for PCR amplification. Specific sequences are as follows:

TABLE-US-00005 (forwardprimer): SEQIDNO.29 TTATAGGTGTAAACCTTAAACTGCATAGCTGTTTCCTGTGTGAAATTGTT ATCC; (reverseprimer): SEQIDNO.30 ATTAACCTGATGTTCTGGGGAATATAATTAAGCCAGCCCCGACACCCGCC AACAC.

[0079] A PCR system is shown in Table 1.

TABLE-US-00006 TABLE 1 Template About 50 ng, 0.5 L.sup. Forward primer 10 pM, 0.5 L Reverse primer 10 pM, 0.5 L dNTP 5 mM each, 0.5 L 5 PCR buffer 10 L pfu DNA polymerase 5 U/L, 0.5 L H.sub.2O 37.5 L

[0080] One group uses water as a sample for negative control.

[0081] Reaction conditions are listed in Table 2.

TABLE-US-00007 TABLE 2 Reaction Program Number of Cycles Amplification program 95 C. 4 min 1 94 C. 30 s 25 58 C. 30 s 72 C. 2 min 72 C. 5 min 1 4 C. 1

[0082] (3) A PCR solution obtained in step (2) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product.

[0083] (4) The Gibson Assembly Master Mix kit was used for ligating a PCR purified product obtained in step (3) and the ccdB gene. A ligation system is shown in Table 3.

TABLE-US-00008 TABLE 3 PCR amplification product About 200 ng, 5 L ccdB gene About 120 ng, 5 L Gibson Assembly Master Mix 10 L Sterilized and deionized H.sub.2O 0 L

[0084] A ligation condition was a ligation reaction of 1 h at 50 C.

[0085] (5) A ligation product obtained in step (4) was transformed into Top10F competent cells which were finally coated with a kanamycin-resistant LB plate and cultivated overnight at 37 C. A single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and named pUC57-ccdB.

[0086] (II) An expressible lacI element was inserted into the pUC57-ccdB plasmid, specifically including steps described below.

[0087] (1) The pUC57-ccdB plasmid successfully constructed in step (I) was used as a template, and primers F-vector-Insert and R-vector-Insert (SEQ ID NO.31-32) were used as primers for the PCR amplification.

TABLE-US-00009 (forwardprimer): SEQIDNO.31 CAGCTGCATTAATGAATCGGCCAACGCGC; (reverseprimer): SEQIDNO.32 GCACGACAGGTTTCCCGACTGGAAAGCGG.

[0088] A PCR system is shown in Table 1, and reaction conditions are listed in Table 2.

[0089] (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product.

[0090] (3) A lacI expression element was synthesized (by Genewiz Inc. Suzhou) through a gene synthesis, and its nucleotide sequence is shown by SEQ ID NO.12:

TABLE-US-00010 CCCGCTTTCCAGTCGGGAAACCTGTCGTGCTTGACACCATCGAATGGTGC AAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAG GGTGGTGAATATGAACGTGAAACCAGTAACGTTATACGATGTCGCAGAGT ATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGC CACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCT GAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGT TGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAA ATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGT GGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGC ACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTG GATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGC GTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCT CCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGT CACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCG TCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGC CGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAA ACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGC CAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGC TGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGAC AGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCT GCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGG CGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACC ACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTC ATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAT GCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAG AAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGA GTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACT GGGCCTTGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCGCA GAAAGTCAAAAGCCTCCGACCGGAGGCTTTTGACTATTAGCACAGCTGCA TTAATGAATCGGCCAACGCGCG.

[0091] (4) The Gibson Assembly Master Mix (NEB) kit was used for ligating a PCR purified product obtained in step (2) and the lacI expression element obtained through the gene synthesis in step (3). A ligation system is shown in Table 4.

TABLE-US-00011 TABLE 4 PCR amplification product About 270 ng, 5 L lacI expression element About 150 ng, 5 L Gibson Assembly Master Mix 10 L Sterilized and deionized H.sub.2O 0 L

[0092] A ligation condition was a ligation reaction of 1 h at 50 C.

[0093] (5) A ligation product obtained in step (4) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate and cultivated overnight at 37 C. A single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and named pUC57-ccdB-lacI.

[0094] (III) A sequence, 5-CTTTATGCTTCCGGCTCG-3, between 35 region and 10 region in a promoter region of the -galactosidase of the pUC57-ccdB-lacI plasmid was mutated into a sequence that can be digested by the endonuclease to form blunt ends, which specifically includes steps described below.

[0095] (1) The pUC57-ccdB-lacI plasmid successfully constructed in step (II) was used as a template, and primers F1-EcoRV, R1-EcoRV, F2-EcoRV, R2-EcoRV, F3-EcoRV, R3-EcoRV, F4-EcoRV and R4-EcoRV (SEQ ID NO.13-SEQ ID NO.20) were used as primers for the PCR amplification. Specific sequences are listed in Table 5.

TABLE-US-00012 TABLE5 No. Sequence SEQIDNO.13 CCGGAAGCGATATCTGTAAAGCCTGGGGTGCCTAA (F1-EcoRV) TGAGTG SEQIDNO.14 CCCCAGGCTTTACAGATATCGCTTCCGGCTCGTAT (R1-EcoRV) GTTGTGTGGAATT SEQIDNO.15 GAGCCGGAGATATCAAGTGTAAAGCCTGGGGTGCC (F2-EcoRV) TAATGAG SEQIDNO.16 CAGGCTTTACACTTGATATCTCCGGCTCGTATGTT (R2-EcoRV) GTGTGGAATTGTG SEQIDNO.17 TACGAGCCGATATCATAAAGTGTAAAGCCTGGGGT (F3-EcoRV) GCCTAAT SEQIDNO.18 GCTTTACACTTTATGATATCGGCTCGTATGTTGTG (R3-EcoRV) TGGAATTGTGAGC SEQIDNO.19 ACATACGAGATATCAGCATAAAGTGTAAAGCCTGG (F4-EcoRV) GGTGCCT SEQIDNO.20 TTACACTTTATGCTGATATCTCGTATGTTGTGTGG (R4-EcoRV) AATTGTGAGCGGA

[0096] A specific PCR system is shown in Table 1, and reaction conditions are listed in Table 2.

[0097] (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The Gibson Assembly Master Mix kit was used for a ligation reaction. A ligation system is shown in Table 6.

TABLE-US-00013 TABLE 6 PCR amplification product About 300 ng, 10 L Gibson Assembly Master Mix 10 L Sterilized and deionized H.sub.2O 0 L

[0098] A ligation condition was a ligation reaction of 1 h at 50 C.

[0099] (3) Each ligation product obtained in step (2) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate and cultivated overnight at 37 C. A single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and separately named pUC57-ccdB-lacI-Mu-1 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-GATATCGCTTCCGGCTCG-3, and the plasmid was constructed with primers F1-EcoRV+R1-EcoRV), pUC57-ccdB-lacI-Mu-2 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-CTTGATATCTCCGGCTCG-3, and the plasmid was constructed with primers F2-EcoRV+R2-EcoRV), pUC57-ccdB-lacI-Mu-3 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-CTTTATGATATCGGCTCG-3, and the plasmid was constructed with primers F3-EcoRV+R3-EcoRV), and pUC57-ccdB-lacI-Mu-4 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-CTTTATGCTGATATCTCG-3, and the plasmid was constructed with primers F4-EcoRV+R4-EcoRV).

[0100] (IV) Vector Cloning Experiments

[0101] (1) The correct plasmids pUC57-ccdB-lacI-Mu-1, pUC57-ccdB-lacI-Mu-2, pUC57-ccdB-lacI-Mu-3 and pUC57-ccdB-lacI-Mu-4 constructed in step (III) were digested with a restriction enzyme EcoRV. Digestion products were subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified.

[0102] (2) Two strands of primers of 24 bp and 48 bp were synthesized and annealed to form double-stranded DNA. Nucleotide sequences of the reversely complementary primers of 24 bp and 48 bp are shown by SEQ ID NO.33-SEQ ID NO.36, specifically:

TABLE-US-00014 SEQIDNO.33: TTCATACAGCAGGCTATGTTTAGG; SEQIDNO.34: CCTAAACATAGCCTGCTGTATGAA; SEQIDNO.35: TAAGCCGATACTGTATTTTTTATCCATAGCTGTTTCCTGTGTGAAATT; SEQIDNO.36: AATTTCACACAGGAAACAGCTATGGATAAAAAATACAGTATCGGCTTA.

[0103] (3) DNA was used as a template, and F-DNA-200 bp+R-DNA-200 bp were used as primers for the PCR amplification. Nucleotide sequences of the primers F-DNA-200 bp and R-DNA-200 bp are shown by SEQ ID NO.37-SEQ ID NO.38, specifically:

TABLE-US-00015 (F-DNA-200bp): SEQIDNO.37 GTTGAATGGGCGGATGCTAATTACTATCTCCCG; (R-DNA-200bp): SEQIDNO.38 TTATGCTCTATAAAGTAGGCATAAACACCCAGC.

[0104] A PCR system is shown in Table 1, and a PCR amplification program is shown in Table 7.

TABLE-US-00016 TABLE 7 Reaction Program Number of Cycles Amplification program 95 C. 4 min 1 94 C. 30 s 25 58 C. 30 s 72 C. 15 s 72 C.3 min 1 4 C. 1

[0105] (4) A PCR solution obtained in step (3) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product.

[0106] (5) Fragments of 24 bp and 48 bp formed after annealing in step (2) and a PCR product purified in step (4) were ligated to the prepared vectors in step (1), pUC57-ccdB-lacI-Mu-1, pUC57-ccdB-lacI-Mu-2, pUC57-ccdB-lacI-Mu-3 and pUC57-ccdB-lacI-Mu-4, separately. A ligation system is shown in Table 8.

TABLE-US-00017 TABLE 8 Foreign DNA About 90 ng, 3 L Digested vector About 30 ng, 1 L 10 buffer 1 L T4 DNA ligase 1 L Sterilized and deionized H.sub.2O 4 L

[0107] A ligation condition was a ligation reaction of 1 h at 22 C.

[0108] (6) Each ligation product obtained in step (5) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate and cultivated overnight at 37 C. 12 single clones were picked on each plate of the cloned DNA fragment of about 200 bp for colony PCR identification on the next day. The PCR system is shown in Table 9.

TABLE-US-00018 TABLE 9 PCR system Bacterium solution template 3 L F-DNA-200 bp 10 pM, 0.5, L R-DNA-200 bp .sup.10 pM, 0.5 L dNTP 5 mM each, 0.5 L 10 Taq buffer 5 L Taq DNA polymerase .sup.5 U/L, 0.5 L H.sub.2O 40 L

[0109] A PCR amplification program is shown in Table 10.

TABLE-US-00019 TABLE 10 Reaction Program Number of Cycles Amplification program 95 C. 6 min 1 94 C. 30 s 25 58 C. 30 s 72 C. 15 s 72 C. 3 min 1 4 C. 1

[0110] A PCR identification result is shown in FIG. 1. The result in FIG. 1 shows that all colonies are positive clones. 12 single clones separately selected from the plates of the cloned foreign DNA fragments of 24 bp and 48 bp and single clones that were positive after colony identification were subjected to Sanger sequencing. Sequencing results show that all clones have correct sequences. Experimental results show that the vector of the present application may be used for cloning foreign DNA of 24 bp or more.

Example 2 Experimental Verification of the Cloning Vector of the Present Application to Overcome False Positive Clones

[0111] Three mutant plasmids of pUC57-ccdB-lacI-Mu-4 (pUC57-ccdB-lacI-Mu-4A, pUC57-ccdB-lacI-Mu-4B and pUC57-ccdB-lacI-Mu-4C) were constructed to simulate the self-ligation of the pUC57-ccdB-lacI-Mu-4 plasmid due to a lack of 1-2 bases at two ends of a digestion site after it is digested with EcoRV. Construction steps are described below.

[0112] (1) The plasmid pUC57-ccdB-lacI-Mu-4 constructed in Example 1 was used as a template, and F1-del+R1-del, F2-del+R2-del and F3-del+R3-del were used as primers for PCR amplification. Nucleotide sequences of the primers F1-del, R1-del, F2-del, R2-del, F3-del and R3-del are shown by SEQ ID NO.39-SEQ ID NO.44, specifically:

TABLE-US-00020 (F1-del): SEQIDNO.39 ACAACATACGAGATTCAGCATAAAGTGTAAAGCCTGGGGTGC; (R1-del): SEQIDNO.40 CTTTATGCTGAATCTCGTATGTTGTGTGGAATTGTGAGC; (F2-del): SEQIDNO.41 CACAACATACGAGAATCAGCATAAAGTGTAAAGCCTGGGGTG; (R2-del): SEQIDNO.42 CACTTTATGCTGATTCTCGTATGTTGTGTGGAATTGTGAGCG; (F3-del): SEQIDNO.43 ACACAACATACGAGATCAGCATAAAGTGTAAAGCCTGGGGTG; (R3-del): SEQIDNO.44 ACACTTTATGCTGATCTCGTATGTTGTGTGGAATTGTGAGCGG.

[0113] A PCR system is shown in Table 1 in Example 1, and a PCR amplification program is shown in Table 2 in Example 1.

[0114] (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The Gibson Assembly Master Mix (NEB) kit was used for a ligation reaction. A ligation system is shown in Table 6 in Example 1. A ligation condition was a ligation reaction of 1 h at 50 C.

[0115] (3) Each ligation product obtained in step (2) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate and cultivated overnight at 37 C. 5 single clones were picked from each plate and subjected to Sanger sequencing on the next day, and plasmids with correct sequences were reserved. The three mutant plasmid of pUC57-ccdB-lacI-Mu-4 are named pUC57-ccdB-lacI-Mu-4A, pUC57-ccdB-lacI-Mu-4B and pUC57-ccdB-lacI-Mu-4C, separately. An EcoRV site of pUC57-ccdB-lacI-Mu-4A was mutated into GAATC, that is, the sequence was mutated from 5-CTTTATGCTGATATCTCG-3 to 5-CTTTATGCTGAATCTCG-3. An EcoRV site of pUC57-ccdB-lacI-Mu-4B was mutated into GATTC, that is, the sequence was mutated from 5-CTTTATGCTGATATCTCG-3 to 5-CTTTATGCTGATTCTCG-3. An EcoRV site of pUC57-ccdB-lacI-Mu-4C was mutated into GATC, that is, the sequence was mutated from 5-CTTTATGCTGATATCTCG' to 5 -CTTTATGCTGATCTCG-3.

[0116] (4) Correct plasmids pUC57-ccdB-lacI-Mu-4A, pUC57-ccdB-lacI-Mu-4B and pUC57-ccdB-lacI-Mu-4C in step (3) each were transformed into Top10F competent cells, and finally the recovered bacterium solutions each were equally divided into two parts which were coated with the kanamycin-resistant LB plate containing IPTG and the kanamycin-resistant LB plate containing no IPTG and cultivated overnight at 37 C. It was found on the next day that no colonies are formed on the plate containing IPTG, and colonies on the plate containing no IPTG are all normal in morphology and number.

[0117] Experimental results show that -galactosidase promoters of the three mutant plasmids of pUC57-ccdB-lacI-Mu-4 (pUC57-ccdB-lacI-Mu-4A, pUC57-ccdB-lacI-Mu-4B and pUC57-ccdB-lacI-Mu-4C), when induced by IPTG, still have strong activity and can express ccdB in large quantities, so that colonies cannot grow, that is, the vector of the present application, when induced by IPTG, will not generate false positive clones in the case of the self-ligation for the lack of 1-2 bases at two ends of the site.

Example 3 Construction and Function Verification of a Low-Copy T Vector

[0118] This example provides a method for constructing the low-copy T vector, which includes steps described below.

[0119] (I) The lacZ gene of pCK (kanamycin resistance) was replaced with a ccdB gene, specifically including steps described below.

[0120] (1) The kanamycin-resistant pCK plasmid was used as a template and SEQ ID NO.45-46 were used as primers for PCR amplification. Specific sequences are as follows:

TABLE-US-00021 (forwardprimer): SEQIDNO.45 TTATAGGTGTAAACCTTAAACTGCATAGCTGTTTCCTGTGTGAAATTGT TATCC; (reverseprimer): SEQIDNO.46 TTAACCTGATGTTCTGGGGAATATAATTAAGCCAGCCCCGAGTAGCTAG ACAGG.

[0121] A PCR system is shown in Table 1 in Example 1, and reaction conditions are shown in Table 2 in Example 1.

[0122] (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product.

[0123] (3) The Gibson Assembly Master Mix kit was used for ligating a PCR purified product obtained in step (2) and the ccdB gene obtained through a gene synthesis in step (1) in Example 1. A ligation system is shown in Table 3 in Example 1. A ligation condition was a ligation reaction of 1 h at 50 C.

[0124] (4) A ligation product obtained in step (3) was transformed into Top10F competent cells which were finally coated with a kanamycin-resistant LB plate and cultivated overnight at 37 C. A single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and named pCK-ccdB.

[0125] (II) A sequence, 5-CTTTATGCTTCCGGCTCG-3, between 35 region and 10 region in a promoter region of the -galactosidase of the pCK-ccdB plasmid was mutated into a sequence recognizable by the endonuclease, which specifically includes steps described below.

[0126] (1) The pCK-ccdB plasmid successfully constructed in step (I) was used as a template, and primers F1-EcoRV, R1-EcoRV, F2-EcoRV, R2-EcoRV, F3-EcoRV, R3-EcoRV, F4-EcoRV and R4-EcoRV (SEQ ID NO.13-SEQ ID NO.20) were used as primers for the PCR amplification. Specific sequences are listed in Table 5 in Example 1. A specific PCR system is shown in Table 1 in Example 1, and reaction conditions are shown in Table 2 in Example 1.

[0127] (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The Gibson Assembly Master Mix kit was used for a ligation reaction. A ligation system is shown in Table 6 in Example 1. A ligation condition was a ligation reaction of 1 h at 50 C.

[0128] (3) Each ligation product obtained in step (2) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate and cultivated overnight at 37 C. A single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and separately named pCK-ccdB-Mu-1 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-GATATCGCTTCCGGCTCG-3, and the plasmid was constructed with primers F1-EcoRV+R1-EcoRV), pCK-ccdB-Mu-2 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-CTTGATATCTCCGGCTCG-3, and the plasmid was constructed with primers F2-EcoRV+R2-EcoRV), pCK-ccdB-Mu-3 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-CTTTATGATATCGGCTCG-3, and the plasmid was constructed with primers F3-EcoRV+R3-EcoRV), and pCK-ccdB-Mu-4 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-CTTTATGCTGATATCTCG-3, and the plasmid was constructed with primers F4-EcoRV+R4-EcoRV).

[0129] (III) Vector cloning experiments

[0130] (1) The correct plasmids pCK-ccdB-Mu-1, pCK-ccdB-Mu-2, pCK-ccdB-Mu-3 and pCK-ccdB-Mu-4 constructed in step (II) were digested with a restriction enzyme EcoRV. Digestion products were subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified.

[0131] (2) Two strands of primers of 24 bp and 48 bp were synthesized and annealed to form double-stranded DNA. Nucleotide sequences of the reversely complementary primers of 24 bp and 48 bp are shown by SEQ ID NO.33-SEQ ID NO.36 in Example 1.

[0132] (3) DNA was used as a template, and F-DNA-200 bp+R-DNA-200 bp were used as primers for the PCR amplification. Nucleotide sequences of the primers F-DNA-200 bp and R-DNA-200 bp are shown by SEQ ID NO.37-SEQ ID NO.38. A PCR system is shown in Table 1 in Example 1, and a PCR amplification program is shown in Table 7 in Example 1.

[0133] (4) A PCR solution obtained in step (3) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product.

[0134] (5) Fragments of 24 bp and 48 bp formed after annealing in step (2) and a PCR product purified in step (4) were ligated to the prepared vectors in step (1), pCK-ccdB-Mu-1, pCK-ccdB-Mu-2, pCK-ccdB-Mu-3 and pCK-ccdB-Mu-4, separately. A ligation system is shown in Table 8 in Example 1, and a ligation condition was a ligation reaction of 1 h at 22 C.

[0135] (6) Each ligation product obtained in step (5) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate and cultivated overnight at 37 C. 12 single clones were picked on each plate of the cloned DNA fragment of about 200 bp for colony PCR identification on the next day.

[0136] A PCR system is shown in Table 9 in Example 1, and a PCR amplification program is shown in Table 10 in Example 1.

[0137] A PCR identification result is shown in FIG. 2. The result in FIG. 2 shows that all colonies are positive clones. 12 single clones separately selected from the plates of the cloned foreign DNA fragments of 24 bp and 48 bp and single clones that were positive after colony identification were subjected to Sanger sequencing. Sequencing results show that all clones have correct sequences. Experimental results show that the vector of the present application may be used for cloning foreign DNA of 24 bp or more.

Example 4 Construction and Function Verification of a Single-Copy T Vector

[0138] This example provides a method for constructing the single-copy T vector, which includes specific steps described below.

[0139] (I) The lacZ gene of pCC1 (chloramphenicol resistance) was replaced with a ccdB gene, specifically including steps described below.

[0140] (1) The chloramphenicol-resistant pCC1 plasmid was used as a template and SEQ ID NO.47-48 were used as primers for PCR amplification. Specific sequences are as follows:

TABLE-US-00022 (forwardprimer): SEQIDNO.47 ATGCAGGCTCGGTTCCAGCATGGTCATAGCTGTTTCCTGTGTGAAATTG TTATCC; (reverseprimer): SEQIDNO.48 AGCACCATTTGCAGCGATGCCGCCTAATTAAGCCAGCCCCGACACCCGC CAACAC.

[0141] A PCR system is shown in Table 1 in Example 1, and reaction conditions are shown in Table 11.

TABLE-US-00023 TABLE 11 Reaction Program Number of Cycles Amplification program 95 C. 4 min 1 94 C. 30 s 25 58 C. 30 s 72 C. 5 min 72 C. 8 min 1 4 C. 1

[0142] (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product.

[0143] (3) The Gibson Assembly Master Mix kit was used for ligating a PCR purified product obtained in step (2) and the ccdB gene obtained through a gene synthesis in Example 1. A ligation system is shown in Table 12.

TABLE-US-00024 TABLE 12 PCR amplification product About 440 ng, 10 L Gibson Assembly Master Mix 10 L Sterilized and deionized H.sub.2O 0 L

[0144] A ligation condition was a ligation reaction of 1 h at 50 C.

[0145] (4) A ligation product obtained in step (3) was transformed into Top10F competent cells which were finally coated with a chloramphenicol-resistant LB plate and cultivated overnight at 37 C. A single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and named pCC1-ccdB.

[0146] (II) A sequence, 5-CTTTATGCTTCCGGCTCG-3, between 35 region and 10 region in a promoter region of the -galactosidase of the pCC1-ccdB plasmid was mutated into a sequence that can be digested by the endonuclease to form blunt ends, which specifically includes steps described below.

[0147] (1) The pCC1-ccdB plasmid successfully constructed in step (I) was used as a template, and primers F1-PmlI+R1-PmlI, F2-PmlI+R2-PmlI, F3-PmlI+R3-PmlI and F4-PmlI+R4-PmlI (SEQ ID NO.21-SEQ ID NO.28) were used as primers for the PCR amplification. Specific sequences are listed in Table 13.

TABLE-US-00025 TABLE13 No. Sequence SEQIDNO.21 CCGGAAGCCACGTGTGTAAAGCCTGGGGTGCCTAA (F1-PmlI) TGAGTG SEQIDNO.22 CCCCAGGCTTTACACACGTGGCTTCCGGCTCGTAT (R1-PmlI) GTTGTGTGGAATT SEQIDNO.23 GAGCCGGACACGTGAAGTGTAAAGCCTGGGGTGCC (F2-PmlI) TAATGAG SEQIDNO.24 CAGGCTTTACACTTCACGTGTCCGGCTCGTATGTT (R2-Pml1I) GTGTGGAATTGTG SEQIDNO.25 TACGAGCCCACGTGATAAAGTGTAAAGCCTGGGGT (F3-PmlI) GCCTAAT SEQIDNO.26 GCTTTACACTTTATCACGTGGGCTCGTATGTTGTG (R3-PmlI) TGGAATTGTGAGC SEQIDNO.27 ACATACGACACGTGAGCATAAAGTGTAAAGCCTGG (F4-PmlI) GGTGCCT SEQIDNO.28 TTACACTTTATGCTCACGTGTCGTATGTTGTGTGG (R4-PmlI) AATTGTGAGCGGA

[0148] A specific PCR system is shown in Table 1 in Example 1, and reaction conditions are shown in Table 11.

[0149] (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The Gibson Assembly Master Mix kit was used for a ligation reaction. A ligation system is shown in Table 14.

TABLE-US-00026 TABLE 14 PCR amplification product About 490 ng, 10 L Gibson Assembly Master Mix 10 L Sterilized and deionized H.sub.2O 0 L

[0150] A ligation condition was a ligation reaction of 1 h at 50 C.

[0151] (3) Each ligation product obtained in step (2) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate and cultivated overnight at 37 C. A single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and separately named pCC1-ccdB-Mu-1 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-CACGTGGCTTCCGGCTCG-3, and the plasmid was constructed with primers F1-PmlI+R1-PmlI), pCC1-ccdB-Mu-2 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-CTTCACGTGTCCGGCTCG-3, and the plasmid was constructed with primers F2-PmlI+R2-PmlI), pCC1-ccdB-Mu-3 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-CTTTATCACGTGGGCTCG-3, and the plasmid was constructed with primers F3-PmlI+R3-PmlI), and pCC1-ccdB-Mu-4 (5-CTTTATGCTTCCGGCTCG-3 was mutated into 5-CTTTATGCTCACGTGTCG-3, and the plasmid was constructed with primers F4-PmlI+R4-PmlI).

[0152] (III) Vector cloning experiments

[0153] (1) The correct plasmids pCC1-ccdB-Mu-1, pCC1-ccdB-Mu-2, pCC1-ccdB-Mu-3 and pCC1-ccdB-Mu-4 constructed in step (II) were digested with a restriction enzyme PmlI. Digestion products were subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified.

[0154] (2) Reversely complementary primers of 24 bp and 48 bp were synthesized and annealed to form double-stranded DNA. Nucleotide sequences of the reversely complementary primers of 24 bp and 48 bp are shown by SEQ ID NO.33-SEQ ID NO.36 in Example 1.

[0155] (3) DNA was used as a template, and F-DNA-200 bp+R-DNA-200 bp were used as primers for the PCR amplification. Nucleotide sequences of the primers F-DNA-200 bp and R-DNA-200 bp are shown by SEQ ID NO.37-SEQ ID NO.38 in Example 1. A PCR system is shown in Table 1 in Example 1, and a PCR amplification program is shown in Table 7 in Example 1.

[0156] (4) A PCR solution obtained in step (3) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product.

[0157] (5) Fragments of 24 bp and 48 bp formed after annealing in step (2) and a PCR product purified in step (4) were ligated to the prepared vectors in step (1), pCC1-ccdB-Mu-1, pCC1-ccdB-Mu-2, pCC1-ccdB-Mu-3 and pCC1-ccdB-Mu-4, separately. A ligation system is shown in Table 8 in Example 1, and a ligation condition was a ligation reaction of 1 h at 22 C.

[0158] (6) Each ligation product obtained in step (5) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate and cultivated overnight at 37 C. 12 single clones were picked on each plate of the cloned DNA fragment of about 200 bp for colony PCR identification on the next day.

[0159] A PCR system is shown in Table 9 in Example 1, and a PCR amplification program is shown in Table 10 in Example 1.

[0160] A PCR identification result is shown in FIG. 3. The result in FIG. 3 shows that all colonies are positive clones. 12 single clones separately selected from the plates of the cloned foreign DNA fragments of 24 bp and 48 bp and single clones that were positive after colony identification were subjected to Sanger sequencing. Sequencing results show that all clones have correct sequences. Experimental results show that the vector of the present application may be used for cloning foreign DNA of 24 bp or more.

[0161] To conclude, the T vector of the present application clones the foreign DNA fragment between 10 region and 35 region in a promoter region of the -galactosidase of the vector during TA cloning, so that even when induced by IPTG, the promoter of the -galactosidase still has extremely low activity, and an expression amount of a gene toxic to a host is extremely small. In this way, a host of a recombinant vector containing the foreign DNA fragment can grow normally. However, since a strong promoter of an empty vector that is self-ligated and not ligated to the foreign DNA fragment due to the lack of 1-2 bases at the end of the vector still has strong activity, and the frameshift mutation of a screening gene does not occur, the expression in large quantities of the gene toxic to the host can be initiated, so that a host carrying a vector containing no foreign DNA fragment cannot grow. Therefore, the T vector of the present application can avoid false positive clones due to the frameshift mutation of the screening gene.

[0162] The applicant has stated that although the detailed method of the present application is described through the examples described above, the present application is not limited to the detailed method described above, which means that implementation of the present application does not necessarily depend on the detailed method described above. It should be apparent to those skilled in the art that any improvements made to the present application, equivalent replacements of raw materials of the product of the present application, additions of adjuvant ingredients to the product of the present application, and selections of specific manners, etc., all fall within the protection scope and the disclosed scope of the present application.