NUCLEIC ACID ENZYME SENSOR

20210080392 ยท 2021-03-18

    Inventors

    Cpc classification

    International classification

    Abstract

    A method of DNAzyme activity in a fluid by a sensor that is manufactured as follows. A method of manufacturing a fiber optic surface plasmon resonance sensor tip for sensing DNAzyme activity in a fluid, the method comprising, a) providing an fiber optic surface plasmon resonance sensor (FO-SPR) tip comprising at least one first single strand DNA with distinct sequence (immobilized on the sensing surface of said the fiber optic surface plasmon resonance sensor tip, b) providing gold nanoparticles (AuNPs) comprising a second single strand DNA with distinct sequence immobilized on said the gold nanoparticles, c) providing a third distinct DNA sequence ligation template for said first and second single strand for DNA hybridizing the third distinct DNA sequence ligation template in part with said the first single strand DNA and in part with the second single strand DNA to form one FO-SPR probe and AuNP-probe complex and d) providing a selected ligase to ligate together to a selected single strand DNA construct between AuNP and FO-SPR adapted to function as a selected DNAzyme FO-SPR-AuNP-probe. An aspect of present invention is a surface plasmon resonance (SPR) real-time monitoring system of NAzyme cleavage activity manufactured by ligation of a metallic nanoparticle (NP)-labelled DNA-sequences to a SPR sensing surface and yet more particular by ligation of AuNP-labelled DNA-sequences to a FO-SPR gold surface. Furthermore, incorporation of temporary inactivating the NAzyme with an inhibitor strand or a NAzyme blocking DNA sequence, containing an internal loop for target recognition independent of the catalytic activity from the NAzyme binding arms in the SPR sensor, e.g. FO-SPR sensor, allows real-time monitoring system of NAzyme cleavage activity in function of binding of selected targets (peptides, polypeptides, protein, small molecules, nucleotides, fat groups) to the internal loop of said the inhibitor strand.

    Claims

    1-28. (canceled)

    29. A NAzyme activity surface plasmon resonance sensor, comprising a DNA probe covalently connected to a sensing surface and a DNA probe covalently connected to a nanoparticle or covalently connected to a nanoparticle cluster, wherein the DNA probe of the sensing surface and the DNA probes of the particle or particle cluster are ligated together to a selected single strand DNA construct comprising the ligation zone within a selected NAzyme substrate so that said sensor is adapted to measure DNAzyme activity by NAzyme binding at the NAzyme substrate and cleavage at the ligation zone.

    30. The NAzyme activity surface plasmon resonance sensor of claim 29, wherein the ligated single strand DNA probe that covalently binds to the sensing surface and to the nanoparticle comprises the ligation zone within the NAzyme substrate for the selected NAzyme.

    31. The NAzyme activity surface plasmon resonance sensor of claim 29, wherein the sensing surface is covered by a gold coating.

    32. The NAzyme activity surface plasmon resonance of claim 29, further comprising a selected NAzyme-substrate SPR-metallic nanoparticle-probe.

    33. A fiber optic surface plasmon resonance sensor tip of a sensor for measuring NAzyme activity or for measuring cleaving activity of enzyme on DNA substrate, the fiber optic surface plasmon resonance sensor tip comprising a sensing surface to which a single strand DNA with a NAzyme substrate and a ligation zone is covalently connected and at the same time the single strand DNA is covalently connected to a metallic nanoparticle so that the sensor is adapted to measure a selected NAzyme activity when the NAzyme substrate is recognized by the NAzyme through hybridization and the metallic nanoparticle is released by cleavage of said the single strand DNA that covalently binds to the sensing surface and to the metallic particle or the metallic particle cluster.

    34. The fiber optic surface plasmon resonance sensor tip of claim 33, wherein the ligated single strand DNA probe that covalently binds to the sensing surface and to the nanoparticle comprises the ligation zone within the NAzyme substrate for the selected NAzyme.

    35. The fiber optic surface plasmon resonance sensor tip of claim 33, wherein the sensing surface is covered by a gold coating.

    36. The fiber optic surface plasmon resonance sensor tip of claim 33, further comprising a selected NAzyme-substrate SPR-metallic nanoparticle-probe.

    37. A sensor kit comprising a NAzyme activity surface plasmon resonance sensor according to claim 29.

    38. The sensor kit of claim 37, further comprising a reversible NAzyme inhibitor.

    39. The sensor kit of claim 37, wherein the NAzyme inhibitor comprises a NAzyme blocking DNA sequence and a target recognition aptamer.

    40. The sensor kit of claim 37, further comprising an inhibitor strand or a NAzyme blocking DNA sequence, said inhibitor comprising a NAzyme binding arm and an internal loop for binding of a specific target independent of the catalytic activity from NAzyme binding arms.

    41. The sensor kit of claim 37, wherein the target is selected from the group consisting of peptides, polypeptides, sugars, proteins, small molecules, nucleotides, fat groups.

    42. The sensor kit of claim 37, wherein the metallic nanoparticle is gold nanoparticle (AuNP).

    43. The sensor kit of claim 37, wherein the sensing surface is covered by a gold coating.

    44. The sensor kit of claim 37, further comprising a selected NAzyme-substrate SPR-metallic nanoparticle-probe.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0139] The present invention will become more fully understood from the detailed description given herein below and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention, and wherein:

    [0140] FIG. 1 shows a schematic overview of the prefunctionalized FO-SPR sensor. Both the FO-SPR sensor and AuNPs surfaces were functionalized with ssDNA (FO-SPR or AuNP-probe) and backfilled with PEG-molecules prior to ligation. In step I both the immobilized FO- and AuNP-probe are mixed together to form one complex upon hybridization to the ligation template. Upon recognition of the nick by the ligase in step II, the FO-SPR and AuNP-probe are ligated together to construct a AuNP-labelled DNAzyme substrate. 1) is the FO-SPR sensor, 2) is the sensing surface, 3) are PEG-molecules, 4) is FO-SPR nucleotide probe, 5) is AuNP-nucleotide probe, 6) is ligation template, 7) is ligated FO- and AuNP-nucleotide probe, 8) is ligase and 9) is gold nanoparticle.

    [0141] FIG. 2 illustrates the formation of the hybridization complex and the ligation process in real-time for FO-SPR sensors functionalized with FO-SPR probe 1 and using different ligation template concentrations. Every measurement included five different steps: 1) baseline stabilization before ligation, 2) hybridization complex formation and ligation, 3) baseline stabilization after ligation, 4) washing steps and 5) baseline stabilization after washing. Similar measurements were obtained for FO-SPR sensors using FO-SPR probe 2 and 3, but are not shown. a) is 0 nM Template, b) is 10 nM Template, c) is 100 nM Template and d) is 1 M Template.

    [0142] FIG. 3 presents the FO-SPR shifts in function of ligation template concentration associated with the ligation process of FO-SPR sensors functionalized with one of the FO-SPR probes listed in Table 1. FO-SPR signals were normalized and consequently FO-SPR shifts were calculated based on the first and last baseline.

    [0143] FIG. 4 shows a schematic overview of the DNAzyme activity. Once prefunctionalized with AuNPs, the FO-SPR sensors were incubated with DNAzymes. In step I, a AuNP-labelled DNAzyme substrate is recognized by the DNAzyme through hybridization. Upon recognition, the DNAzyme performs its cleavage activity in step II and releases a AuNP by dehybridization. Once dehybridized, the DNAzyme can bind a next substrate as illustrated in step III. The legends refer to the following components: i) the FO-SPR sensor, ii) the sensing surface, iii) the PEG-molecules, iv) the DNAzyme substrate, v) the DNAzyme, vi) the cleaved DNAzyme substrate and vii) the gold nanoparticle.

    [0144] FIG. 5 illustrates the DNAzyme activity measurements in real-time for a control (DNAzyme reaction mixture without any DNAzyme present) and three different DNAzyme concentrations. Every measurement included four different steps: 1) baseline stabilization before sample measuring, 2) sample incubation, 3) washing steps and 4) baseline stabilization after sample measurement. The legends refer to the following: 0 nM DNAzyme, 1 nM DNAzyme, 10 nM DNAzyme and 100 nM DNAzyme.

    [0145] FIG. 6 presents the FO-SPR shifts associated with the DNAzyme activity of a control (DNAzyme reaction mixture without any DNAzyme present) and 100 nM DNAzyme for FO-SPR sensors functionalized with one of the FO-SPR probes listed in Table 1. FO-SPR signals were normalized and consequently FO-SPR shifts were calculated as the difference between baselines.

    [0146] FIG. 7 presents the FO-SPR shifts in function of different DNAzyme concentrations for FO-SPR sensors functionalized with FO-SPR probe 3. FO-SPR signals were normalized and consequently FO-SPR shifts were calculated as the difference between baselines.

    [0147] FIG. 8. Provides an illustration of (A) the ligation strategy and (B) the DNAzyme-based target detection. The following number legend are used to mark the different components 1) is the FO-SPR sensor, 8) is ligase, 9) is gold nanoparticle, 10) is gold surface on glass fiber, 11) is DNA template, 12) is NAzyme substrate, 13) is target, 13a) bound target 14) is inhibitor strand, 15) blocked NAzyme, 16) is the inhibitor strand with internal loop for target detection, 17) is NAzyme

    [0148] FIG. 9 displays optimization of the ligation temperature. A) Real-time normalized FO-SPR shifts for 3 different ligation temperatures are presented. Every measurement consisted of 4 steps: 1) first baseline, 2) hybridization and ligation, 3) washing and 4) second baseline; B) represents the hybridization and ligation shifts (filled and shaded bars respectively) and C) represents the ligation efficiency or ratio of the ligation and hybridization shifts. Error bars represent one standard deviation (n=4).

    [0149] FIG. 10 demonstrates the optimization of the ligation template concentration. A) represents the hybridization and ligation shifts (filled and shaded bars respectively), while B) represents the ligation efficiency. Error bars represent one standard deviation (n=4). C) shows SEM images of 4 different FO-SPR sensors after ligation with 0, 10, 100 and 1000 nM ligation template.

    [0150] FIG. 11 demonstrates the real-time DNAzyme FO-SPR response. A) Real-time normalized FO-SPR shifts for 6 different DNAzyme concentrations are presented: a) 0 nM, b) 3.125 nM, c) 6.25 nM, d) 12.5 nM, e) 25 nM and f) 50 nM. Every measurement consisted of 4 steps: 1) first baseline, 2) DNAzyme incubation, 3) washing and 4) second baseline and B) represents the SEM images taken after I) 0 min, II) 5 min and III) 15 min of incubation with 25 nM DNAzyme. The time spots were also indicated on figure A (.diamond-solid.).

    [0151] FIG. 12 demonstrates a DNAzyme calibration curve. A linear calibration curve was established by log-log transformation of the half-life and DNAzyme concentration. Error bars represent one standard deviation (n=3).

    [0152] FIG. 13: Optimization of the inhibitor-DNAzyme ratio for DNAzyme inactivation. Positive (PC) and negative control (NC) contained only 25 nM DNAzyme and 200 nM inhibitor respectively. Shaded bars contained 25 nM DNAzyme with increasing amount of inhibitor. Error bars represent one standard deviation (n=3).

    [0153] FIG. 14 displays a Log-log linear calibration curve of the half-life values and target concentration from 10-30 nM. Error bars represent one standard deviation (n=3).

    [0154] FIG. 15 displays a DNA probe (4) covalently bound to the sensing surface (2) and DNA probe (5) covalently bound to the metallic nanoparticle or a metallic nanoparticle cluster (9) is ligated by ligase (8) with ligation template (6) and the ligation enzyme (3) into single strand DNA probe (7) between the metallic surface (2) and the or metallic nanoparticle cluster (9) whereby the single strand DNA probe (7) incorporates the NAzyme substrate (12) for a selected NAzyme. The ligation zone (18) in between (4) and (5) is situated within the NAzyme substrate (12) hybridized to the NAzyme (17). More particular displays a surface plasmon resonance (SPR)-DNA probe (4) covalently bound to the sensing surface (2) of a SPR sensor tip (1) and a metallic nanoparticle DNA probe (5) covalently bound to the metallic nanoparticle (9) is ligated with ligation template (6) and the ligation enzyme (3) into single strand DNA probe (7) between the sensing surface (2) of the SPR sensor and the metallic nanoparticle (9) whereby the single strand DNA probe (7) incorporates the NAzyme substrate (12) for a selected NAzyme. The ligation zone (18) in between (4) and (5) is situated within the NAzyme substrate (12) hybridized to the NAzyme (17). Yet more particularly a FO-DNA probe (4) covalently bound to the sensing surface (2) of a FO-SPR sensor tip (1) and a gold nanoparticle (AuNP) DNA probe (5) covalently bound to a gold nanoparticle (9) is ligated with ligation template (6) and the ligation enzyme (3) into single strand DNA probe (7) between the sensing surface (2) of the FO-SPR sensor and the gold nanoparticle (9) whereby the single strand DNA probe (7) incorporates the DNAzyme substrate (12) for a selected DNAzyme. The ligation zone (18) in between (4) and (5) is situated within the NAzyme substrate (12) hybridized to the NAzyme (17). The numbers indicating the diverse components are as follows: 1) is the FO-SPR sensor tip, 2) is the sensing surface, 3) is the ligation enzyme, 4) is FO-probe, 5) is AuNP-probe, 6) is ligation template, 7) is ligated FO- and AuNP-probe, 8) zone available for ligation relative to the NAzyme substrate location, 9) is gold nanoparticle, 12) NAzyme substrate, 13) probe remaining on FO-probe after ligation, 14) probe remaining on AuNP after ligation, 17) DNAzyme, 18) Ligation zone.

    [0155] FIG. 16 is a drawing of a scheme that displays DNAzyme activation by target induced MNAzyme activity. A blocked Nazyme (25) is inhibited by a complementary single strand DNA presenting an internal loop (26). An MNAzyme consisting of 2 parts of a whole remains separated until a third (target) single strand DNA combines the three parts through hybridization creating an activated NAzyme complex (29). The activated NAzyme complex (29) cleaves the single strand DNA presenting an internal loop (26) and dehybridizes from the DNAzyme (17) which becomes activated.

    [0156] FIG. 17 is that drawing a scheme showing four steps displayed in FIG. 17A to FIG. 17B to FIG. 17C and to FIG. 17D, namely Step 1 NAzyme substrate complex formation, Step 2: Activated NAzyme cleaves Nazyme substrate complex which is eventually after an inhibited NAzyme is activated or a NAzyme is amplified by target, Step 3 FO-SPR hybridization and Step 4 melt analysis. FIG. 17 explains and displays a first DNA probe (4) covalently bound to the surface (19), of a solid carrier for instance a magnetic, glass, micro- or macro-object, a microcarrier or a microbead and second DNA probe (5) covalently bound to the metallic nanoparticle or a metallic nanoparticle cluster (9) is ligated with ligation template (6) and the ligation enzyme (8) into single strand DNA probe (7) between the solid separable surface (19) and the or metallic nanoparticle cluster (9) whereby the single strand DNA probe (7) incorporates or comprises the NAzyme substrate (12) for a selected NAzyme. The ligation zone (18) in between the first DNA probe (4) and the second DNA probe (5) is situated within the NAzyme substrate (12) hybridized or hybridizable to the NAzyme (17). In step 1 the Nazyme substrate complex (25) is formed. In step 2 activated Nazyme hybridizes to the Nazyme substrate complex (25) and cleaves the single strand DNA probe at the cleavage point (20). The cleaved off DNA probe (21) covalently bound to the metallic nanoparticle or a metallic nanoparticle cluster (9) bears a specific single strand DNA sequence. In step 3 the cleaved off DNA probe (21) covalently bound to the metallic nanoparticle or a metallic nanoparticle cluster (9) hybridizes to a single strand DNA probe (22) covalently bound to the sensing surface (2) resulting in an increased signal. By increasing the temperature in step 4 the hybridized cleaved off DNA probe (21) covalently bound to the metallic nanoparticle or a metallic nanoparticle cluster (9) will dehybridize or melt off the complementary single strand DNA probe (22) covalently bound to the sensing surface (2) resulting in a drop in the signal (A) at a specific temperature related to the cleaved off DNA probe (21) sequence.

    [0157] More particular displays a DNA probe (4) covalently bound to the surface of a solid microparticle, microcarrier or microbead (19) and a metallic nanoparticle DNA probe (5) covalently bound to the metallic nanoparticle (9) is ligated with ligation template (6) and the ligation enzyme (8) into single strand DNA probe (7) between separable solid microparticle (19) and the metallic nanoparticle (9) whereby the single strand DNA probe (7) incorporates the NAzyme substrate (12) for a selected NAzyme. The ligation zone (18) in between (4) and (5) is situated within the NAzyme substrate (12) hybridized to the NAzyme (17). Yet more particularly a microparticle-DNA probe (4) covalently bound to the binding surface of a solid separable microparticle (19) and a gold nanoparticle (AuNP) DNA probe (5) covalently bound to a gold nanoparticle (9) is ligated with ligation template (6) and the ligation enzyme (8) into single strand DNA probe (7) between the binding surface of the solid separable microparticle (19) and the gold nanoparticle (9) whereby the single strand DNA probe (7) incorporates the DNAzyme substrate (12) for a selected DNAzyme. The ligation zone (18) in between (4) and (5) is situated within the NAzyme substrate (12) hybridized to the NAzyme (17).

    TABLE-US-00001 TABLE1 Se- quence Name [00001]embedded image 5 Mod- ifica- tion Sequence5->3 3 Mod- ifica- tion Note 1 [00002]embedded image 31 5Phos [00003]embedded image 3Thio- MC3- D For all FO- 2 [00004]embedded image 31 5Phos [00005]embedded image 3Bio probes, bolded region is 3 [00006]embedded image 25 5Thio- TTTTTTTTTTGAGGGATTATTGTTA / bound bythe 4 Template1 25 / GGTTGTGCTGTAACAATAATCCCTC / [00007]embedded image 5 [00008]embedded image 33 5Thio- TTTTTTTTTTGAGGGATTATAGTATCAGCACAA / Forall se- MC6-D 6 [00009]embedded image 23 5Phos [00010]embedded image 3Thio- MC3-D quences, bolded 7 Template2 24 / TTGGTGACGGTTGTGCTGATACTA / region isbound bythe [00011]embedded image 8 [00012]embedded image 35 / CGGTTGGTGAGGCTAGCTACAACGAGGTTGTGCTG / Underlined 9 Inhibitor 52 / CAGCGCAACCTCGTTGATCACGCCTCGTCTCCTCCCAG / region strand TAGCCTCACCAACC forms Target GGTGAGGCTACTGGGAGGAGACGAGGCGTGATCAACGA thecat- GGTTG alytic 10 43 / / core. Regions leftand right from thecat- alytic coreare called thesub- strate arms.

    REFERENCES TO THIS APPLICATION

    [0158] 1. Knez, K.; Janssen, K. P. F.; Pollet, J.; Spasic, D.; Lammertyn, J. Small 2012, 8 (6), 868-872. [0159] 2. Knez, K.; Spasic, D.; Delport, F.; Lammertyn, J. Biosens. Bioelectron. 2015, 67, 394-399. [0160] 3. Lu, J.; Van Stappen, T.; Spasic, D.; Delport, F.; Vermeire, S.; Gils, A.; Lammertyn, J. Biosens. Bioelectron. 2016, 79, 173-179. [0161] 4. Daems, D.; Lu, J.; Delport, F.; Maridn, N.; Orbie, L.; Aernouts, B.; Adriaens, I.; Huybrechts, T.; Saeys, W.; Spasic, D.; Lammertyn, J. Anal. Chim. Acta 2017, 950, 1-6. [0162] 5. Pollet, J.; Delport, F.; Janssen, K. P. F.; Jans, K.; Maes, G.; Pfeiffer, H.; Wevers, M.; Lammertyn, J. Biosens. Bioelectron. 2009, 25 (4), 864-869. [0163] 6. Malinsk, P.; Slepika, P.; Hnatowicz, V.; Svork, V. Nanoscale Res. Lett. 2012, 7 (1), 241. [0164] 7. Breaker, R. R.; Joyce, G. F. Chem. Biol. 1994, 1, 223-229. [0165] 8. Santoro, S. W.; Joyce, G. F. Proc. Nat. Acad. Sci. 1997, 94 (9), 4262-4266. [0166] 9. Bone, S. M.; Lima, N. E.; Todd, A. V. Biosens. Bioelectron. 2015, 70, 330-337. [0167] 10. Markham, N. R.; Zuker, M. Nucleic Acids Res. 2005, 33 (Web Server), W577-W581. [0168] 11. Markham, N. R.; Zuker, M. In Bioinformatics, Volume II. Structure, Function and Applications, number 453 in Methods in Molecular Biology; Keith, J. M., Ed.; Humana Press: Totowa, N.J., 2008; pp 3-31. [0169] 12. Yurke, B.; Turberfield, A. J.; Mills, A. P.; Simmel, F. C.; Neumann, J. L. Nature 2000, 406 (6796), 605-608. [0170] 13. J. Kosman and B. Juskowiak, Anal. Chim. Acta, vol. 707, no. 1, pp. 7-17, 2011 [0171] 14. A. J. Boersma, et al. Angew. Chemie Int. Ed., vol. 48, no. 18, pp. 3346-3348, 2009 [0172] 15. Y. Li and D. Sen, Nat. Struct. Biol., vol. 3, no. 9, pp. 743-747, 1996 [0173] 16. E. Mokany, S. M. et al. Journal of the American Chemical Society, vol. 132, no. 3. pp. 1051-1059, January-2010 [0174] 17. T. Velyian et al. EP2817421