CHIMERIC ANTIGEN RECEPTOR T-CELLS EXPRESSING INTERLEUKIN-8 RECEPTOR
20210040487 ยท 2021-02-11
Inventors
Cpc classification
A61K35/17
HUMAN NECESSITIES
C07K2319/33
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
International classification
A61K35/17
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
C07K14/715
CHEMISTRY; METALLURGY
Abstract
An IL-8 receptor (e.g., CXCR1 or CXCR2) modified CAR T cell is provided, as well as a nucleic acid encoding the IL-8 modified CAR T cell and method of use.
Claims
1. A nucleic acid comprising a nucleic acid sequence encoding a recombinant protein comprising an interleukin 8 (IL-8) receptor attached to a chimeric antigen receptor (CAR) via a hinge domain, wherein the CAR comprises an antigen binding domain, a transmembrane domain, and a CD3 zeta signaling domain.
2. The nucleic acid sequence of claim 1, wherein the IL-8 receptor is CXCR1 or CXCR2.
3. The nucleic acid of claim 1, wherein the hinge domain comprises fuV5P2A.
4. The nucleic acid of claim 1, wherein the antigen binding domain is an extracellular part of CD27.
5. The nucleic acid of claim 2, wherein the antigen binding domain is an extracellular part of CD27.
6. The nucleic acid of claim 1, comprising a nucleic acid sequence at least 90% identical to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
7. The nucleic acid of claim 1, comprising the nucleic acid sequence set forth in SEQ ID NO: 1.
8. The nucleic acid of claim 1, comprising the nucleic acid sequence set forth in SEQ ID NO: 2.
9. A modified T cell comprising a nucleic acid sequence encoding a recombinant protein comprising an interleukin 8 (IL-8) receptor attached to a chimeric antigen receptor (CAR) via a hinge domain, wherein the CAR comprises an antigen binding domain, a transmembrane domain, and a CD3 zeta signaling domain.
10. The modified T cell of claim 9, wherein the modified T cell co-expresses an IL-8 receptor and a CD70 CAR on the cell surface.
11. The modified T cell of claim 9, wherein the IL-8 receptor is CXCR1 or CXCR2.
12. The modified T cell of claim 9, wherein the hinge domain comprises fuV5P2A.
13. The modified T cell of claim 10, wherein the nucleic acid sequence comprises the sequence of SEQ ID NO: 4 or SEQ ID NO: 5.
14. The modified T cell of claim 10, wherein the nucleic acid sequence comprises the sequence of SEQ ID NO: 6.
15. The modified T cell of claim 9, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO: 1.
16. The modified T cell of claim 9, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO: 2.
17. A method of treating a tumor comprising: administering a modified T cell to a subject in need thereof; wherein the modified T cell comprises a nucleic acid sequence encoding a recombinant protein comprising an interleukin 8 (IL-8) receptor attached to a chimeric antigen receptor (CAR) via a hinge domain; and wherein the CAR comprises an antigen binding domain, a transmembrane domain, and a CD3 zeta signaling domain.
18. The method of claim 17, wherein the modified T cell expresses an IL-8 receptor and a CD70 CAR, and wherein the hinge domain comprises a furin cleavage site followed by a V5 peptide tag and has an amino acid sequence set forth in SEQ ID NO: 7.
19. The method of claim 17, wherein the IL-8 receptor is CXCR1 or CXCR2.
20. The method of claim 19, wherein the nucleic acid sequence comprises the sequence of SEQ ID NO: 4 or SEQ ID NO: 5.
21. The method of claim 17, wherein the nucleic acid sequence comprises the sequence of SEQ ID NO: 6.
22. The method of claim 17, wherein the modified T cell is administered to the subject in need thereof by intravenous injection or infusion.
23. The method of claim 17, wherein the subject in need thereof has glioma.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] The accompanying drawings, which are incorporated herein and constitute part of this specification, illustrate exemplary embodiments of the disclosure, and, together with the general description given above and the detailed description given below, serve to explain the features of the disclosure.
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION
Definitions
[0035] Where the definition of terms departs from the commonly used meaning of the term, applicant intends to utilize the definitions provided below, unless specifically indicated.
[0036] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood to which the claimed subject matter belongs. In the event that there is a plurality of definitions for terms herein, those in this section prevail. All patents, patent applications, publications and published nucleotide and amino acid sequences (e.g., sequences available in Gen Bank or other databases) referred to herein are incorporated by reference. Where reference is made to a URL or other such identifier or address, it is understood that such identifiers can change and particular information on the internet can come and go, but equivalent information can be found by searching the internet. Reference thereto evidences the availability and public dissemination of such information.
[0037] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of any subject matter claimed. In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that, as used in the specification and the appended claims, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise.
[0038] For purposes of the present disclosure, a value or property is based on a particular value, property, the satisfaction of a condition, or other factor, if that value is derived by performing a mathematical calculation or logical decision using that value, property or other factor.
[0039] For purposes of the present disclosure, the term comprising, the term having, the term including, and variations of these words are intended to be open-ended and mean that there may be additional elements other than the listed elements.
[0040] For purposes of the present disclosure, it should be noted that to provide a more concise description, some of the quantitative expressions given herein are not qualified with the term about. It is understood that whether the term about is used explicitly or not, every quantity given herein is meant to refer to the actual given value, and it is also meant to refer to the approximation to such given value that would reasonably be inferred based on the ordinary skill in the art, including approximations due to the experimental and/or measurement conditions for such given value.
[0041] For purposes of the present disclosure, the term adjacent refers to next to or adjoining something else.
[0042] For purpose of the present disclosure, the term adjuvant or the term immuno-adjuvant refers to substances that enhance the production of antibodies without acting as antigens themselves. Adjuvants may be compounds added in a vaccine or therapeutic composition that increase the specific immune response to an antigen. Adjuvants may be added to vaccine to modify the immune response by boosting it such as to give a higher amount of antibodies and a longer lasting protection, thus minimizing the amount of injected foreign material. Adjuvants may also be used to enhance the efficacy of vaccine by helping to subvert the immune response to particular cells type of immune system, for example by activating the T cells instead of antibody-secreting B cells depending on the type of the vaccine.
[0043] For purpose of the present disclosure, the term adoptive cell transfer refers to the transfer of cells, most commonly immune-derived cells, back into the same patient or into a new recipient host with the goal of transferring the immunologic functionality and characteristics into the new host. For isolation of immune cells for adoptive transfer, blood is drawn into tubes containing anticoagulant and the PBM (buffy coat) cells are isolated, typically by density barrier centrifugation. In T cell-based therapies, adoptive cells are expanded in vitro using cell culture methods relying heavily on the immunomodulatory action of interleukin-2 and returned to the patient in large numbers intravenously in an activated state. The adoptive transfer of autologous immune-promoting or tolerogenic cells (often lymphocytes) to patients is an approach to promote or induce tolerance in autoimmune disease.
[0044] For purpose of the present disclosure, the term adoptive cellular therapy (ACT) or the term cellular adoptive immunotherapy or the term adoptive immunotherapy refer to a cell-based therapy with various lymphocytes and antigen-presenting cells. For example, in some situations, the therapy involves collecting T cells from a patient and growing the collected T cells in the laboratory to increase the number of T cells. These T cells are then given back to the same patient or another to help the immune system fight disease.
[0045] For purposes of the present disclosure, the term autologous cells refers to cells derived from the same individual, involving one individual as both donor and recipient. For example, lymphocytes from are the same person.
[0046] For purposes of the present disclosure, the term ameliorate and the term amelioration to any lessening of severity, delay in onset, slowing of progression, or shortening of duration, whether permanent or temporary, lasting or transient, of the symptoms of a particular disease, disorder or condition by administration of a drug or pharmaceutical composition.
[0047] For purposes of the present disclosure, the term amino acid refers to the molecules composed of terminal amine and carboxylic acid functional groups with a carbon atom between the terminal amine and carboxylic acid functional groups sometimes containing a side chain functional group attached to the carbon atom (e.g., a methoxy functional group, which forms the amino acid serine). Typically, amino acids are classified as natural and non-natural. Examples of natural amino acids include glycine, alanine, valine, leucine, isoleucine, proline, phenylananine, tyrosine, tryptophan, serine, threonine, cysteine, methionine, asparagine, glutamine, lysine, arginine, histidine, aspartate, and glutamate, among others. Examples of non-natural amino acids include L-3,4-dihydroxyphenylalanine, 2-aminobutyric acid, dehydralanine, g-carboxyglutamic acid, carnitine, gamma-aminobutyric acid, hydroxyproline, and selenomethionine, among others. In the context of this specification it should be appreciated that the amino acids may be the L-optical isomer or the D-optical isomer.
[0048] For purposes of the present disclosure, the term animal refers to humans as well as non-human animals. Preferably, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a primate, or a pig). It is also contemplated that the term animal encompasses insects and fish. An animal may be a domesticated animal. An animal may be a transgenic animal. In addition, the term subject or patient is an animal that is treated as discussed below.
[0049] For purposes of the present disclosure, the term antibody refers to a polypeptide ligand substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof, which specifically binds and recognizes an epitope (e.g., an antigen). The recognized immunoglobulin genes include the kappa and lambda light chain constant region genes, the alpha, gamma, delta, epsilon and mu heavy chain constant region genes, and the myriad immunoglobulin variable region genes. Antibodies exist, e.g., as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases. This includes, e.g., Fab and F(ab)2 fragments. The term antibody, as used herein, also includes antibody fragments either produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA methodologies. It also includes polyclonal antibodies, monoclonal antibodies, chimeric antibodies, humanized antibodies, or single chain antibodies. Fc portion of an antibody refers to that portion of an immunoglobulin heavy chain that comprises one or more heavy chain constant region domains, CH1, CH2 and CH3, but does not include the heavy chain variable region.
[0050] For purposes of the present disclosure, the term bind, the term binding, or the term bound refers to any type of chemical or physical binding, which includes but is not limited to covalent binding, hydrogen binding, electrostatic binding, biological tethers, transmembrane attachment, cell surface attachment, and expression.
[0051] For purposes of the present disclosure, the term biomolecule refers to the conventional meaning of the term biomolecule, i.e., a molecule produced by or found in living cells, e.g., a protein, a carbohydrate, a lipid, a phospholipid, a nucleic acid, etc.
[0052] For purposes of the present disclosure, the term CAR-T or the term CAR T cell refers to a genetically engineered T cell that produces a chimeric antigen receptor (CAR) on the surface of the cell. The backbone of a CAR-T or CAR T cell is a T cell, which is often collected and separated from a subject, such as a patient, who is going to receive the CAR-T or CAR T cell. A CAR T cell is usually an engineered patient's immune cell used to treat the patient's cancer.
[0053] For purposes of the present disclosure, the term CAR T therapy refers to treating a disease using CAR T cells. For example, a CAR T therapy may be an immunotherapy utilizing a subject or a patient's own immune cells that are engineered to be able to produce a particular chimeric antigen receptor(s) on their surface. In some situations, T cells are collected from the body of a subject or a patient via apheresis, a process that withdraws blood from the body and removes one or more blood components (such as plasma, platelets or white blood cells). The T cells collected from the body are then genetically engineered to produce a particular chimeric antigen receptor on their surface. After the engineering, the T cells are known as chimeric antigen receptor (CAR) T cells. The CAR T cells are expanded by growing in a laboratory and then administered to the subject or patient, or another subject or patient. The CAR T cells will recognize and kill cancer cells that express a targeted antigen on their surface.
[0054] For purposes of the present disclosure, the term chimeric antigen receptor and the term CAR refers to an engineered receptor that recognize a targeted antigen expressed on the surface of a target cell, such as an antigen expressed on a cancer cell.
[0055] For purposes of the present disclosure, the term co-administration refers to administration of two or more compositions or compounds to a single subject. Each of the two or more compositions may be administered by the same or different route of administration, at the same time or different time. Co-administration of first therapeutically effective agent and a second therapeutically effective agent, which for example, may be dissolved or intermixed in the same pharmaceutically acceptable carrier, is contemplated.
[0056] For purposes of the present disclosure, the term cognate antigen refers to an antigen used to immunize an animal and induce it to produce an antiserum.
[0057] For purposes of the present disclosure, the term cognate immune system refers to a specific and adaptive immune system.
[0058] For purposes of the present disclosure, the term complementary and the term complementarity refer to polynucleotides (e.g., a sequence of nucleotides) related by the base-pairing rules. For example, a DNA sequence 5-A-G-T-3 is complementary to a DNA sequence 3-T-C-A-5 or a RNA sequence 3-U-C-A-5.
[0059] For purposes of the present disclosure, the term control amount of a marker refers to any amount or a range of amounts which is to be compared against a test amount of a marker. For example, a control amount of a marker can be the amount of a marker in a person without cancer or neural injury and/or neuronal disorder. A control amount can be either in absolute amount (e.g., g/ml) or a relative amount (e.g., relative intensity of signals).
[0060] For purposes of the present disclosure, the term correspond and the term corresponding used in the context of a protein sequence refers to an amino acid position(s) of a protein. An amino acid at a position of a protein may be found to be equivalent or corresponding to an amino acid at a position of one or more other protein(s) based on any relevant evidence, such as the primary sequence context of the each amino acid, its position in relation to the N-terminal and C-terminal ends of its respective protein, the structural and functional roles of each amino acid in its respective protein, etc.
[0061] For purposes of the present disclosure, the term diagnosing refers to identification of the nature of a disease, illness, condition or other problem by examination of the symptoms in an individual.
[0062] For purposes of the present disclosure, the term domain with respect to a protein refers to a distinct functional or structural unit in the protein. Usually, a protein domain is responsible for a particular function or interaction, contributing to the overall role of a protein. Domains may exist in a variety of biological contexts, where similar domains may be found in proteins with different functions.
[0063] For purposes of the present disclosure, the term dosage refers to the administering of a specific amount, number, and frequency of doses over a specified period of time. Dosage implies duration. A dosage regimen is a treatment plan for administering a drug over a period of time.
[0064] For purposes of the present disclosure, the term dosage form and the term unit dose refer to an individual dose of a pharmaceutical product. Dosage forms may comprise a mixture of active drug components and nondrug components (excipients), along with other non-reusable material that may not be considered either ingredient or packaging.
[0065] For purposes of the present disclosure, the term dose refers to a specified amount of medication taken at one time.
[0066] For purposes of the present disclosure, the term drug refers to a material that may have a biological effect on a cell, including but not limited to small organic molecules, inorganic compounds, polymers such as nucleic acids, peptides, saccharides, or other biologic materials, nanoparticles, etc.
[0067] For purposes of the present disclosure, the term effective amount or effective dose or grammatical variations thereof refers to an amount of an agent sufficient to produce one or more desired effects. The effective amount may be determined by a person skilled in the art using the guidance provided herein.
[0068] For purposes of the present disclosure, the term encoding and the term encoded, when used in relation to a specified nucleic acid, means, e.g., comprising the information for translation into the specified protein. A nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or may lack such intervening non-translated sequences (e.g., as in cDNA). The information by which a protein is encoded is specified by the use of codons.
[0069] For purposes of the present disclosure, the term enhance and the term enhancing refer to increasing or prolonging, either in potency or duration, of a desired effect. By way of example, enhancing the effect of therapeutic agents singly or in combination refers to the ability to increase or prolong, either in potency, duration and/or magnitude, the effect of the agents on the treatment of a disease, disorder, or condition. When used in a patient, amounts effective for this use will depend on the severity and course of the disease, disorder or condition; previous therapy; the patient's health status and response to therapy; and the judgment of the treating physician.
[0070] For purposes of the present disclosure, the term expression cassette refers to a part of a vector DNA used for cloning and transformation. In each successful transformation, the expression cassette directs the cell's machinery to make RNA and protein. Some expression cassettes are designed for modular cloning of protein-encoding sequences so that the same cassette may easily be altered to make different proteins. Expression cassettes may also refer to a recombinantly produced nucleic acid molecule that is capable of expressing a genetic sequence in a cell. An expression cassette typically includes a regulatory region such as a promoter (allowing transcription initiation) and a sequence encoding one or more proteins or RNAs. Optionally, the expression cassette may include transcriptional enhancers, non-coding sequences, splicing signals, transcription termination signals, and polyadenylation signals. The sequences controlling the expression of the gene, i.e., its transcription and the translation of the transcription product, are commonly referred to as regulatory unit. Most parts of the regulatory unit are located upstream of coding sequence of the heterologous gene and are operably linked thereto. The expression cassette may also contain a downstream 3 untranslated region comprising a polyadenylation site. The regulatory unit of the disclosure is either directly linked to the gene to be expressed, i.e., transcription unit, or is separated therefrom by intervening DNA such as for example by the 5-untranslated region of the heterologous gene. Preferably the expression cassette is flanked by one or more suitable restriction sites in order to enable the insertion of the expression cassette into a vector and/or its excision from a vector. Thus, the expression cassette according to the present disclosure may be used for the construction of an expression vector, in particular a mammalian expression vector.
[0071] For purposes of the present disclosure, the term expression vector, otherwise known as an expression construct, refers to a plasmid or virus designed for protein expression in cells. The vector is used to introduce a specific gene into a target cell, and may commandeer the cell's mechanism for protein synthesis to produce the protein encoded by the gene. The plasmid is engineered to contain regulatory sequences that act as enhancer and promoter regions and lead to efficient transcription of the gene carried on the expression vector. The goal of a well-designed expression vector is the production of significant amount of stable messenger RNA, and therefore proteins.
[0072] For purposes of the present disclosure, the term fragment of a molecule such as a protein or nucleic acid refers to a portion of the amino acid or nucleotide sequence.
[0073] For purposes of the present disclosure, the term gene refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of an RNA or a polypeptide or its precursor. The term portion, when used in reference to a gene, refers to fragments of that gene. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide. Thus, a nucleotide comprising at least a portion of a gene may comprise fragments of the gene or the entire gene.
[0074] For purposes of the present disclosure, the term heterologous, when used in relation to a nucleic acid, includes reference to a nucleic acid that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous structural gene is from a species different from that from which the structural gene was derived or, if from the same species, one or both are substantially modified from their original form. A heterologous protein may originate from a foreign species or, if from the same species, is substantially modified from its original form by deliberate human intervention.
[0075] For purposes of the present disclosure, the term hinge domain or the term hinge region refers to a domain, a region, or a peptide fragment located between other two peptides or proteins in a recombinant protein or fusion protein. For example, in a recombinant protein comprising an IL-8 receptor connected to a CAR, a hinge domain is a peptide fragment located between the IL-8 receptor and the CAR. The hinge domain may comprise a self-cleavage site, such as found in the self-cleaving P2A peptide, which is an example of an hinge domain. Therefore, when a recombinant protein comprising an IL-8 receptor and a CAR is expressed in a cell, the recombinant protein can be cleaved at the site of the hinge domain. As a consequence, the IL-8 receptor and the CAR may be separately expressed on the surface of the cell. In one embodiment, the hinge domain is fuV5P2A, in which a furin cleavage site is followed by a V5 peptide tag introduced upstream of P2A peptide to yield optimal gene expression..sup.45 Another example of a hinge region is an internal ribosome entry site (IRES).
[0076] For purposes of the present disclosure, the term immunogen refer to a substance or material (including antigens) that is able to induce an immune response alone or in conjunction with an adjuvant. Both natural and synthetic substances may be immunogens. An immunogen is generally a protein, peptide, polysaccharide, nucleoprotein, lipoprotein, synthetic polypeptide, or hapten linked to a protein, peptide, polysaccharide, nucleoprotein, lipoprotein or synthetic polypeptide or other bacterial, viral or protozoal fractions.
[0077] For purposes of the present disclosure, the term immunogenicity refers to the ability to induce humoral and/or cell-mediated immune responses.
[0078] For purposes of the present disclosure, the term immuno-modulation or the term immuno-regulation refers to an effect on immune responsiveness. Immunomodulation may be adjustment of the immune response to a desired level, as in immunosuppression or induction of immunologic tolerance.
[0079] For purposes of the present disclosure, the term immunomodulator refers to an active agent of immunotherapy. Immunomodulators are a diverse array of recombinant, synthetic and natural preparations, such as various cytokines, cellular membrane fractions, etc.
[0080] For purposes of the present disclosure, the term immunogenic refers to the ability of a substance (antigen) to induce an immune response.
[0081] For purposes of the present disclosure, the term immunotherapy refers to the treatment of a disease by inducing, enhancing, or suppressing an immune response. Immunotherapies designed to elicit or amplify an immune response are classified as activation immunotherapies, while immunotherapies that reduce or suppress are classified as suppression immunotherapies. The active agents of immunotherapy are collectively called immunomodulators.
[0082] For purposes of the present disclosure, the term individual refers to an individual mammal, such as a human being.
[0083] For purposes of the present disclosure, the term inhibiting, when used in the context a disorder, means either lessening the likelihood of the disorder's onset, preventing the onset of the disorder entirely, or in some cases, reducing the severity of the disease or disorder after onset. In one embodiment, inhibiting the onset of a disorder means preventing its onset entirely.
[0084] For purposes of the present disclosure, the term introduce, when used in relation to a nucleic acid, refers to inserting a nucleic acid into a cell. Introducing a nucleic acid into a cell may be done by transfection, transformation, or transduction. In some situations, introducing a nucleic acid into a cell may include the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell, where the nucleic acid may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
[0085] For purposes of the present disclosure, the term isolated, isolated nucleic acid, or isolated protein includes reference to a material, such as a nucleic acid or a protein, which is substantially or essentially free from components which normally accompany or interact with it as found in its naturally occurring environment. The isolated material optionally comprises material not found with the material in its natural environment.
[0086] For purposes of the present disclosure, the term ligand refers to a substance, such as a small molecule, that forms a complex with a biomolecule to serve a biological purpose. In protein-ligand binding, the ligand is usually a signal-triggering molecule, binding to a site on a target protein. Ligand binding to a receptor protein (receptor) alters the receptor's chemical conformation (three-dimensional shape). The conformational state of a receptor determines its functional state. Ligands include substrates, inhibitors, activators, and neurotransmitters.
[0087] For purposes of the present disclosure, the term linked refers to a covalent linkage between two polypeptides in a fusion protein. The polypeptides are typically joined via a peptide bond, either directly to each other or via one or more additional amino acids.
[0088] For purposes of the present disclosure, the term linker refers to short peptide sequences that occur between functional protein domains and link the functional domains together. Linkers designed by researchers are generally classified into three categories according to their structures: flexible linkers, rigid linkers, and in vivo cleavable linkers. A flexible linker is often composed of flexible residues like glycine and serine so that the adjacent protein domains are free to move relative to one another. A linker also may play a role in releasing the free functional domain in vivo (as in in vivo cleavable linkers). Linkers may offer many other advantages for the production of fusion proteins, such as improving biological activity, increasing expression yield, and achieving desirable pharmacokinetic profiles. The composition and length of a linker may be determined in accordance with methods well known in the art and may be tested for efficacy.
[0089] For purposes of the present disclosure, the term nucleic acid and the term polynucleotide, as used interchangeably herein, include reference to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids).
[0090] For purposes of the present disclosure, the term oligonucleotide, the term polynucleotide, the term nucleotide, and the term nucleic acid refer to a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, and usually more than ten. The exact size of an oligonucleotide will depend on many factors, which in turn depends on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. When present in a DNA form, the oligonucleotide may be single-stranded (i.e., the sense strand) or double-stranded.
[0091] For purposes of the present disclosure, the term operably linked, the term operably associated, and the term functionally linked are used interchangeably and include reference to a functional relationship between two or more DNA segments. Particularly, operably linked refers to a functional linkage between a first nucleic acid sequence, such as a promoter, in a functional relationship with a second nucleic acid sequence, wherein the promoter sequence initiates and mediates transcription of the DNA corresponding to the second sequence. A promoter/enhancer sequence, including any combination of cis-acting transcriptional control elements is operably associated to a coding sequence if the promoter/enhancer sequence affects the transcription or expression of the coding sequence in an appropriate host cell or other expression system. Promoter regulatory sequences that are operably linked to the transcribed gene sequence are physically contiguous to the transcribed sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame.
[0092] For purposes of the present disclosure, the term parenteral route refers to the administration of a composition, such as a drug in a manner other than through the digestive tract. Parenteral routes include, but are not limited to, routes such as intravenous, intra-arterial, transdermal, intranasal, sub-lingual and intraosseous, etc. For example, intravenous is also known as I.V., which is giving directly into a vein with injection. As the drug directly goes into the systemic circulation, it reaches the site of action resulting in the onset the action.
[0093] For purposes of the present disclosure, the term patient and the term subject refer to an animal, which is the object of treatment, observation or experiment. By way of example only, a subject may be, but is not limited to, a mammal including, but not limited to, a human.
[0094] For purposes of the present disclosure, the term peptide linker and the term linker are interchangeable and refer to short peptide sequences that occur between functional protein domains and link the functional domains together.
[0095] For purposes of the present disclosure, the term percentage of sequence identity refers to the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
[0096] For purposes of the present disclosure, the term pharmaceutically acceptable refers to a compound or drug approved or approvable by a regulatory agency of a federal or a state government, listed or listable in the U.S. Pharmacopeia or in other generally recognized pharmacopeia for use in mammals, including humans. For example, a pharmaceutically acceptable diluent, excipient, carrier, or adjuvant is a diluent, excipient, carrier, or adjuvant which is physiologically acceptable to the subject while retaining the therapeutic properties of the pharmaceutical composition with which it is administered. One exemplary pharmaceutically acceptable carrier is physiological saline. Pharmaceutically acceptable carriers include, but are not limited to saline solutions and buffered solutions. Pharmaceutically acceptable carriers are described for example in Gennaro, Alfonso, Ed., Remington's Pharmaceutical Sciences, 18th Edition 1990. Mack Publishing Co., Easton, Pa., a standard reference text in this field. Pharmaceutical carriers may be selected in accordance with the intended route of administration and the standard pharmaceutical practice.
[0097] For purposes of the present disclosure, the term pharmaceutical composition refers to a product comprising one or more active ingredients, and one or more other components such as carriers, stabilizers, diluents, dispersing agents, suspending agents, thickening agents, and/or excipients, etc. A pharmaceutical composition includes enough of the active object compound to produce the desired effect upon the progress or condition of diseases and facilitates the administration of the active ingredients to an organism. Multiple techniques of administering the active ingredients exist in the art including, but not limited to: topical, ophthalmic, intraocular, periocular, intravenous, oral, aerosol, parenteral, and administration. By pharmaceutically acceptable, it is meant the carrier, diluent or excipient must be compatible with the other ingredients of the formulation and not deleterious to the recipient thereof, i.e., the subject.
[0098] For purposes of the present disclosure, the term pharmaceutical formulation and the term drug formulation refer to a mixtures or a structure in which different chemical substances, including the active drug, are combined to form a final medicinal product, such as a solution, an emulsion, a non-conventional product such as semi-solid, liquid, etc. Pharmaceutical formulation is prepared according to a specific procedure, a formula. The drug formed varies by the route of administration. For example, oral drugs are normally taken as tablet or capsules.
[0099] For purposes of the present disclosure, the term polynucleotide includes reference to a deoxyribopolynucleotide, ribopolynucleotide, or analogs thereof that have the essential nature of a natural ribonucleotide in that they hybridize, under stringent hybridization conditions, to substantially the same nucleotide sequence as naturally occurring nucleotides and/or allow translation into the same amino acid(s) as the naturally occurring nucleotide(s). A polynucleotide may be full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are polynucleotides as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including inter alia, simple and complex cells.
[0100] For purposes of the present disclosure, the term polypeptide and the term protein are used interchangeably herein to refer to a polymer of amino acid residues. The terms encompass amino acid polymers in which one or more amino acid residues are artificial chemical mimetic of a corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. Polypeptides may be modified, e.g., by the addition of carbohydrate residues to form glycoproteins. The terms polypeptide, peptide, and protein include glycoproteins, as well as non-glycoproteins.
[0101] For purposes of the present disclosure, the term prevent refers to stop from happening or to make something not happen.
[0102] For purposes of the present disclosure, the term purified refers to the component in a relatively pure state.
[0103] For purposes of the present disclosure, the term recombinant refers to a genetic material formed by a genetic recombination process. A recombinant protein is made through genetic engineering. A recombinant protein is coded by a DNA sequence created artificially. A recombinant protein is a protein that is coded by a recombinant nucleic acid sequence. A recombinant nucleic acid sequence has a sequence from two or more sources incorporated into a single molecule.
[0104] For purposes of the present disclosure, the term residue, the term amino acid residue, or the term amino acid are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively protein). The amino acid may be a naturally occurring amino acid and, unless otherwise limited, may encompass known analogs of natural amino acids that may function in a similar manner as naturally occurring amino acids.
[0105] For purposes of the present disclosure, the term room temperature refers to a temperature of from about 20 C. to about 25 C.
[0106] For purposes of the present disclosure, the term sample is used herein in its broadest sense. A sample comprising polynucleotides, polypeptides, peptides, antibodies, and the like and may comprise a bodily fluid; a soluble fraction of a cell preparation, or media in which cells were grown; a chromosome, an organelle, or membrane isolated or extracted from a cell; genomic DNA, RNA, or cDNA, polypeptides, or peptides in solution or bound to a substrate; a cell; a tissue; a tissue print; a fingerprint, skin or hair; and the like.
[0107] For purposes of the present disclosure, the term sequence identity or the term identity in the context of two nucleic acid or polypeptide sequences includes reference to the residues in the two sequences, which are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences, which differ by such conservative substitutions, are said to have sequence similarity or similarity. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., according to the algorithm of Meyers and Miller, (1988) Computer Applic. Biol. Sci. 4:11-17, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif., USA).
[0108] For purposes of the present disclosure, the term specifically (or selectively) binds to an antibody or specifically (or selectively) immunoreactive with, when referring to a protein or peptide, refers to a binding reaction that is determinative of the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein and do not substantially bind in a significant amount to other proteins present in the sample.
[0109] Typically, an antigen-binding domain that specifically binds an antigen will have a Kd that is 20-, 50-, 100-, 500-, 1000-, 5,000-, 10,000- or more times greater for a control molecule relative to the target antigen or epitope. Also, specific binding for a particular antigen can be exhibited, for example, by an antibody having a KA or Ka for an antigen or epitope of at least 20-, 50-, 100-, 500-, 1000-, 5,000-, 10,000- or more times greater for the epitope relative to a control, where KA or Ka refers to an association rate of a particular antibody-antigen interaction. Methods of testing antigen-binding domains for the ability to bind to a target antigen are known in the art and include, e.g., radioimmunoassay (RIA), ELISA, Western blot, immunoprecipitation, surface plasmon resonance (e.g., BIAcore), and competitive inhibition assays (see, e.g., Janeway et al. (eds.), Immunobiology, 5th Ed., Garland Publishing, New York, N.Y. (2001); U.S. Patent Publication No. 2002/0197266; and U.S. Pat. No. 7,872,106, all of which are hereby incorporated by reference in their entirety and particularly with respect to disclosure of competition assays).
[0110] For purposes of the present disclosure, the term stimulate and the term immuno-stimulate refer to inducing the activation or increasing the activity of any components in an immune system. For example, T cell activation requires at least two signals to become fully activated. The first occurs after engagement of the T cell antigen-specific receptor (TCR) by the antigen-major histocompatibility complex (MHC), and the second by subsequent engagement of co-stimulatory molecules. Once stimulated, the T cells will recognize the antigen or vaccine used during stimulation or activation of the T cells.
[0111] For purposes of the present disclosure, the term subject refers to an animal, for example, a mammal, such as a mouse, a rat, a human, etc., who is the object of treatment, observation, or experiment. A donor subject in the present disclosure refers to a mammal, such as a person, who donates antibodies, cells, or organs. A recipient subject in the present disclosure refers to a mammal, such as a person, who receives antibodies, cells, or organs donated by a donor subject or developed in vitro.
[0112] For purposes of the present disclosure, the term target refers to a living organism or a biological molecule to which some other entity, like a ligand or a drug, is directed and/or binds. For example, target protein may a biological molecule, such as a protein or protein complex, a receptor, or a portion of a biological molecule, etc., capable of being bound and regulated by a biologically active composition such as a pharmacologically active drug compound.
[0113] For purposes of the present disclosure, the term therapeutically effective amount and the term treatment-effective amount refers to the amount of a drug, compound or composition that, when administered to a subject for treating a disease or disorder, or at least one of the clinical symptoms of a disease or disorder, is sufficient to affect such treatment of the disease, disorder, or symptom. A therapeutically effective amount may vary depending, for example, on the compound, the disease, disorder, and/or symptoms of the disease or disorder, severity of the disease, disorder, and/or symptoms of the disease or disorder, the age, weight, and/or health of the subject to be treated, and the judgment of the prescribing physician. An appropriate amount in any given instance may be readily ascertained by those skilled in the art or capable of determination by routine experimentation.
[0114] For purposes of the present disclosure, the term treating and the term treatment, when being used in relating to a disease, disorder, or condition, refers to an approach for obtaining beneficial or desired results, such as clinical results. Beneficial or desired results may include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease, disorder, or condition; stabilization (i.e., not worsening) of a state of disease, disorder, or condition; prevention of spread of disease, disorder, or condition; delay or slowing the progress of the disease, disorder, or condition; amelioration or palliation of the disease, disorder, or condition; and remission (whether partial or total), whether detectable or undetectable. Treating or treatment also refers to slowing the progression of a condition, inhibiting the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both, and to inhibiting or slowing the progression of at least one physical parameter which may or may not be discernible to the subject. The term treatment as used herein also refers to any treatment of a subject, such as a human condition or disease, and includes: (1) inhibiting the disease or condition, i.e., arresting the development or progression of the disease or condition, (2) relieving the disease or condition, i.e., causing the condition to regress, (3) stopping the symptoms of the disease, and/or (4) enhancing the conditions desired.
[0115] Treating cancer or a tumor does not require a 100% abolition of cancer in the subject. Any decrease in tumor load, tumor burden, or tumor volume; inhibition of tumor cell proliferation; eradication of tumor cells; reverse of immunosuppression in the tumor microenvironment, and the like constitutes a beneficial biological effect in a subject. The progress of the method in treating a tumor (e.g., reducing tumor size or eradicating cancerous cells) can be ascertained using any suitable method, such as those methods currently used in the clinic to track tumor size and cancer progress. Tumor size can be figured using any suitable technique, such as measurement of dimensions or estimation of tumor volume. Tumor size can be determined by tumor visualization using, for example, CT, ultrasound, SPECT, spiral CT, MRI, photographs, and the like. Measurement of tumor size, detection of new tumors, biopsy, surgical downstaging, PET scans, and the like can point to the overall progression (or regression) of cancer in a human. In various aspects, the materials and methods of the disclosure inhibits metastasis; any degree of preventing, suppressing, delaying the onset, or slowing metastasis in the subject is contemplated.
Description
[0116] While the present disclosure is susceptible to various modifications and alternative forms, specific embodiment thereof has been shown by way of example in the drawings and will be described in detail below. It should be understood, however that it is not intended to limit the present disclosure to the particular forms disclosed, but on the contrary, the present disclosure is to cover all modifications, equivalents, and alternatives falling within the spirit and the scope of the disclosure.
[0117] Despite highly toxic multimodal treatments, the 5-year survival rate is less than 10% for patients with primary glioblastomas (GBMs), necessitating development of new agents that promote survival without illicit effects..sup.1,2 Cancer immunotherapy represents a promising new treatment paradigm, and patients with malignant gliomas develop immunotherapeutic response against autologous specimens..sup.3-5 Modification of patient derived T cells with chimeric antigen receptors (CARs) is a uniquely specific and promising approach for ex vivo activation of tumor-specific T cells, but remains limited by the lack of ideal or appropriate targets in solid tumors. Current Chimeric Antigen Receptor (CAR) engineered T cells face challenges when directed towards solid tumors, as localization of T cells to the tumor microenvironment is one of barriers. To date, EGFRvIII,.sup.20 IL13Ra2,.sup.38 HER2,.sup.39 EphA2,.sup.40 and Podoplanin(PDPN).sup.41 CAR T cells have demonstrated encouraging results in preclinical studies and in several clinical trials for gliomas. However, antigen escape and safety issues have been indicated.
[0118] Important features of an ideal tumor immunotherapeutic target include (i) distinct expression patterns over normal cells to avoid off-target effects, (ii) involvement in malignant propagation, and (iii) ubiquitous expression within tumor cells to limit immune escape.
[0119] The present disclosure identifies an ideal tumor immunotherapeutic target and provides a novel approach for targeting immunotherapy of cancers and tumors. The disclosure provides a modified T cell comprising a nucleic acid sequence encoding a recombinant protein comprising an interleukin 8 (IL-8) receptor attached to a chimeric antigen receptor (CAR) via a hinge domain. The CAR comprises, e.g., an antigen binding domain, a transmembrane domain, and a CD3 zeta signaling domain. The disclosure further provides a method of treating a tumor, such as a glioma (e.g., any stage of glioma, including glioblastoma), comprising administering to a patient in need thereof the modified CAR T cell in an amount effective to treat the tumor.
[0120] Interleukin 8 ((IL8) or chemokine (C-X-C motif) ligand 8, CXCL8)) is a chemokine that binds to its cognate receptors, C-X-C chemokine receptor 1 (CXCR1) and C-X-C chemokine receptor 2 (CXCR2), and is mainly expressed on neutrophils. Studies have suggested that CXCL8 and its cognate receptors, CXCR1 and CXCR2, mediate the initiation and development of various cancers including breast cancer, prostate cancer, lung cancer, colorectal carcinoma and melanoma..sup.42
[0121] The present disclosure confirms that IL-8 is expressed by glioma. It is believed that IL-8 expressed in glioma induces tumorigenesis and angiogenesis to protect the glioma itself. The highly expressed IL-8 may be utilized to guide IL-8 receptor (CXCR1 and/or CXCR2) modified CAR-T migration to tumor site and eventually enhance anti-tumor efficacy. Further, radiation is a standard care of many cancer types, including glioma. Irradiation (IR) may impact antitumor efficacy of immunotherapy; for example, tumor chemokine secretion may be enhanced by IR. According to the present disclosure, radiation (IR) upregulates the expression and secretion of IL-8 by glioma. The disclosure provides CAR T cells that are manipulated to co-express an IL-8 receptor, e.g., CXCR1 or CXCR2, whose natural expression on T cells are extremely low. Accordingly, the disclosure provides a new approach for effectively recruiting CAR engineered T cells to tumors.
[0122] An RNAseq data analysis, involving more than 100 patient samples culled from TOGA, determined that IL-8 is found to be positively correlated with CD70 gene expression upon glioblastoma's molecular subtypes. This result indicates that IL-8 receptor modification is suitable for CD70 CART therapy.
[0123] In various aspects, the CAR of the modified T cell comprises an antigen binding domain that binds Cluster of Differentiation 70 (CD70). CD70 is a type II transmembrane protein that represents the only ligand for CD27. CD70 is a glycosylated transmembrane protein of the tumor necrosis factor receptor family..sup.6,7 CD70-CD27 interactions play an important role in providing co-stimulation during the development of functional lymphocytes; strict control of CD70 expression is required for optimal signaling for immune cell activation..sup.8,9 While CD70 expression is restricted to highly activated T/B lymphocytes and a small subset of mature dendritic cells; distinct hematologic and solid tumor malignancies, including gliomas, may constitutively overexpress CD70..sup.9-13 CD70 is not only highly expressed by primary tumors, but also in recurrent tumors, which presents a consistent therapeutic target for primary and recurrent gliomas.
[0124] Although CD70 has been demonstrated to play an important role in dendritic cell-induced enhanced T-cell antitumor immunity,.sup.14,15 without adequate T-cell receptor signals provided by tumor cells, the CD27-CD70 interaction may not induce a strong immunological response, and inversely, promote apoptosis.sup.16-18 and dysregulate T cells' function.
[0125] CD70 is not detected in peripheral and brain normal tissues but is constitutively overexpressed by isocitrate dehydrogenase (IDH) wild-type primary LGGs and GBMs in the mesenchymal subgroup and recurrent tumors. CD70 expression in malignant gliomas correlates with poor patient survival in these subgroups. CD70 expression in malignant gliomas may link to its direct involvement in glioma chemokine productions and directly facilitate immune suppression by selectively inducing CD8+ T-cell death. CD70 is not only highly expressed by primary tumors, but also in recurrent tumors, which presents a consistent therapeutic target for primary and recurrent gliomas..sup.37
[0126] Both human and mouse CD70-specific CAR T cells are demonstrated to recognize primary CD70+ GBM tumors in vitro and mediate the regression of established GBM in xenograft and syngeneic models without illicit effect. These results identify a previously uncharacterized and ubiquitously expressed immunosuppressive ligand CD70 in GBMs that also holds potential for serving as a novel CAR target for cancer immunotherapy in gliomas. An RNAseq data analysis, involving more than 100 patient samples culled from TCGA, determined that IL-8 is found to be positively correlated with CD70 gene expression upon glioblastoma's molecular subtypes. This result indicates that IL-8 receptor modification is suitable for CD70 CART therapy.
[0127]
[0128] The in vitro chemotaxis studies described herein demonstrate that both CXCR1- and CXCR2-manipulated CAR T cells (e.g., CD70 CAR T cells) show enhanced migration towards the conditioned media collected from irradiated glioma cell culture. For example, CXCR1 modified CD70 CAR-T shows better tumor recognition than non-modified CD70 CAR-T in an IL-8 dependent manner. To evaluate the trafficking capability of IL-8 receptor modified T cell in vivo, Click-Beetle Luciferase was used to detect T cells and label glioma cells with Near-infrared fluorescent protein-iRFP720 to track tumor growth in vivo. IL-8 receptor modified CD70 CAR T cells eliminate glioma in vivo within 6 days. In contrast, CD70 CAR-T without IL-8 receptor modification did not show this potent anti-glioma efficacy. Overall, the IL-8 receptor modified CAR-T shows enhanced trafficking to tumor site in vivo, which lead to an improvement of anti-tumor efficacy.
[0129] Briefly speaking, radiation is a standard care for a variety of cancers and tumor types, including glioma. The IL-8 receptor modified CAR T cells of the disclosure elicit an additional benefit of radiation therapy. For example, in various aspects, the subject to be administered the IL-8R-modified CAR T cell is previously treated with radiation. While not wishing to be bound to a particular theory, radiation triggers IL-8 production, which improves the homing and anti-tumor activity of CAR T cells to the target. As such, the disclosure expands radiotherapy's benefit immunotherapy.
[0130] The materials and methods of the disclosure may be used to treat any type of cancer or tumor that is responsive to the CAR T cell. In various aspects, the CAR binds CD70. An embodiment exemplified herein comprises an IL-8R-modified CD70 CAR-T used to treat glioma, but it will be appreciated that the construct also may be used to treat other tumors or cancers that express CD70 and IL-8, including leukemia or other blood cancers, and other tumors including kidney, pancreas, larynx or pharynx, melanoma, ovary, lung adenocarcinoma, colon, breast, and other brain tumors, etc. Table 1 in
[0131] For simplicity of illustration,
[0132] Since a disclosed IL-8 receptor modified CAR-T may recognize and track a cancer cell expressing IL-8, the IL-8 receptor modified CAR-T may be administered systematically to a subject or patient in need thereof and migrate to a target tumor or a cancer cell that expresses IL-8. A tumor usually has a wall built by cancer cells around the mass of the tumor, which keeps invaders out of the growing mass. The IL-8 receptor modified CAR-T is able to penetrate into the center of a target tumor, such as the center of a glioma, and kill the cancer cells. For example, the IL-8 receptor modified CD70 CAR-T is able to penetrate into the center of a tumor expressing CD70, such the center of a glioma, and kill the cancer cells. Therefore, the IL-8 receptor modified CAR-T may be administered to a patient to treat an inoperative tumor. For example, the IL-8R modified T cell may be administered to a patient suffering from a late stage of cancer who cannot receive a surgery for resection of the tumor. The IL-8 receptor modified CAR-T also may be administered to a patient or a subject who cannot receive a surgery because a tumor is located in a life threatening location, or because the patient or the subject has multiple lesions, or because other reasons that an operation is not an option to the patient or the subject.
[0133] In one embodiment, a recombinant protein which is a modified CAR is provided. In various aspects, the modified CAR comprises an IL-8R (or fragment thereof that retains IL-8 binding) linked to a CAR, which in turn comprises an antigen-binding domain, a transmembrane domain (optionally separated by a spacer), and a signaling domain (e.g., CD3 zeta domain). In various aspects, the CAR comprises a costimulatory signal domain (e.g., CD28 or 41BB). The CAR and the IL-8R sequences are joined by a hinge domain.
[0134] The nucleic acid sequence encoding a recombinant protein comprising an interleukin 8 (IL-8) receptor attached to a chimeric antigen receptor (CAR) via a hinge domain, wherein the CAR comprises an antigen binding domain, a transmembrane domain, and a CD3 zeta signaling domain, optionally comprises any one or more of the nucleic acid sequences set forth herein, or a nucleic acid sequence comprising at least 80% identity (e.g., at least 85% identity or at least 90% identity or at least 95% identity or 100% identity) to one or more of the sequences set forth herein. In various aspects, the nucleic acid sequence comprises at least 90% identity (e.g., at least 95% or 100% identity) to one or more of the sequences set forth herein. As used herein, at least 90% identity and similar terms encompass any integer from, e.g., 90% to 100%, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% and the like.
[0135] For simplicity,
[0136] The disclosure further provides a nucleic acid encoding an IL-8 receptor-modified CAR. In one embodiment, provided is a nucleic acid comprising a nucleic acid sequence encoding a recombinant protein comprising an IL-8 receptor (CXCR1 or CXCR2) and a CAR. The IL-8 receptor and the CAR are linked via a hinge domain. The CAR comprises an antigen binding region or domain, a transmembrane domain, and a signaling domain, such as a CD3 zeta signaling domain. In one embodiment, the antigen binding region is an extracellular part of CD27. In one embodiment, the transmembrane domain is an intracellular part of 41BB. In one embodiment, the hinge domain is fuV5P2A (SEQ ID NO: 7), which comprises a furin cleavage site followed by a V5 peptide tag. It is introduced to the upstream of P2A peptide to yield optimal gene expression..sup.45 In one embodiment, the IL-8 receptor is CXCR1 or CXCR2. In one embodiment, a nucleic acid encoding a recombinant protein CD70CAR-fuV5P2A-CXCR1 (SEQ ID NO: 1) is provided. In another alternative embodiment, a nucleic acid encoding the recombinant protein CD70CAR-fuV5P2A-CXCR2 (SEQ ID NO: 2) is provided. In another alternative embodiment, a nucleic acid encoding recombinant proteinCD70CAR-fuV5P2A-EGFP (SEQ ID NO: 3) is provided.
[0137] The disclosure further provides vectors that comprise expression cassettes to express the IL-8 receptor modified CAR, as well as vectors that comprise expression cassettes encoding EGFP modified CAR, that may be used as a control. In one embodiment, the vector comprises an expression cassette for expressing CXCR1 modified CD70 CAR. In one embodiment, the expression cassette comprises a nucleic acid sequence encoding the recombinant protein CD70CAR-fuV5P2A-CXCR1 (SEQ ID NO: 1), wherein the nucleic acid sequence is operably linked to a promoter for expression. In an alternative embodiment, the vector comprises an expression cassette for expressing CXCR2 modified CD70 CAR. The expression cassette comprises a nucleic acid sequence encoding the recombinant protein CD70CAR-fuV5P2A-CXCR2 (SEQ ID NO: 2), wherein the nucleic acid sequence is operably linked to a promoter for expression. In an alternative embodiment, the vector comprises an expression cassette for expressing EGFP modified CD70 CAR, such as recombinant protein CD70CAR-fuV5P2A-EGFP (SEQ ID NO: 3), wherein a nucleic acid sequence encoding CD70CAR-fuV5P2A-EGFP is operably linked to a promoter for expression. In some embodiments, the vector is a retroviral vector, although alternative expression vectors may be used in the context of the disclosure Exemplary viral vectors include, but are not limited to, retroviral vectors, including lentivirus vectors; parvoviral vectors, such as adeno-associated viral (AAV) vectors; adenoviral vectors; adenoviral adeno-associated chimeric vectors; vaccinia viral vectors; and herpesviral vectors. Any of these expression vectors can be prepared using standard recombinant DNA techniques described in, e.g., Sambrook et al., Molecular Cloning, a Laboratory Manual, 2d edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989), and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, New York, N.Y. (1994). The nucleic acid sequences in a vector may be codon optimized. In some embodiment, the vector is pMSGV8MCS2-CD70CAR.CXCR1, which is a retroviral vector comprising a nucleic acid sequence encoding CD70CAR-fuV5P2A-CXCR1.
[0138] The disclosure also provides a genetically engineered cell carrying a vector for expressing a recombinant protein comprising an IL-8 receptor modified CAR. In one embodiment, the recombinant protein is CD70CAR-fuV5P2A-CXCR1 (encoded by SEQ ID NO: 1) or CD70CAR-fuV5P2A-CXCR2 (encoded by SEQ ID NO: 2). In one embodiment, the genetically engineered cell is a engineered T cell comprising a nucleic acid encoding a recombinant protein. The engineered T cell produces or coexpresses the IL-8 receptor and CAR on their surface. In one embodiment, the genetically engineered cell coexpresses CXCR1 (encoded by SEQ ID NO: 4) and CD70 CAR (encoded by SEQ ID NO: 6) on the cell surface. In an alternative embodiment, the genetically engineered cell coexpresses CXCR2 (encoded by SEQ ID NO: 5) and CD70 CAR (encoded by SEQ ID NO: 6) on the cell surface. In an alternative embodiment, a genetically engineered cell produces EGFP modified CD70 CAR, e.g., recombinant protein CD70CAR-fuV5P2A-EGFP (encoded by SEQ ID NO: 3).
[0139] In various aspects, the T cells are autologous with respect to the intended recipient. In this regard, in one embodiment, the genetically engineered cell is engineered based on a T cell separated or collected from a subject or patient who is going to receive the genetically engineered cell. In an embodiment, the genetically engineered cell is engineered based on a T cell separated or collected from a subject or patient who is a donor and will not receive the genetically engineered cell. Alternatively, the genetically engineered cell is engineered based on a stem cell. As used herein, genetically engineered cell or modified T cell is not limited to cells which have been directly modified; the term also encompasses progeny of cells that were modified to comprise the disclosed nucleic acid, which progeny express the IL-8R-modified CAR.
[0140] Also provided is a pharmaceutical composition comprising a genetically engineered T cell as described herein. The pharmaceutical composition further may comprise an adjuvant and/or a pharmaceutically acceptable diluent or excipient. In one embodiment, the pharmaceutical composition is formulated in liquid for injection or infusion. In one embodiment, the pharmaceutical composition comprises a genetically engineered T cell expressing an IL-8 receptor (CXCR1 or CXCR2) and a CAR (e.g., CD70 CAR), wherein the genetically engineered T cell is suspended in phosphate-buffered saline (PBS). In one embodiment, the pharmaceutical composition is formulated in powder that may be prepared into liquid before use.
[0141] The disclosure further provides a method of preparing a modified T cell for immunotherapy. The method comprises genetically modifying a T cell by introducing into the cell a vector comprising an expression cassette comprising a nucleic acid encoding the IL8 receptor-modified CAR, and expanding the T cell (i.e., allowing the T cell to replicate).
[0142] Also provided is a method of treating a tumor or cancer. The method comprises administering to a subject in need thereof a modified T cell, wherein the modified T cell comprises a nucleic acid sequence encoding a recombinant protein comprising an interleukin 8 (IL-8) receptor attached to a chimeric antigen receptor (CAR) via a hinge domain. The CAR comprises an antigen binding domain, a transmembrane domain, and a CD3 zeta signaling domain. In various aspects, the CAR includes a costimulatory domain. In various aspects, the IL-8R is CXCR1 and the CAR is a CD70 CAR. Alternatively, the IL-8R is CXCR2 and the CAR is a CD70 CAR. Alternatively, the modified T cell co-expresses EGFP and a CD70 CAR, which may be used as a control.
[0143] The subject may be a live animal, such as a human. In one embodiment, the subject is a patent having a tumor. In one embodiment, the patent has glioma. A pharmaceutical composition comprising the modified T cell may be administered systemically or regionally into the subject or the patient. In one embodiment, a pharmaceutical composition comprising the modified T cell described herein is administered to a subject by injection or infusion. In one embodiment, a pharmaceutical composition comprising the modified T cell described herein is administered to the subject by intravenous (IV) injection or infusion. In one embodiment, a pharmaceutical composition comprising the modified T cell described herein is regionally injected or infused into the brain region or ventricle of the brain. Optionally, the modified T cell is administered intrathecally. In one embodiment, the IL-8 receptor modified CAR T cell is administered to a subject after the subject has received radiotherapy.
[0144] A delivery apparatus for injecting or infusing a pharmaceutical composition comprising the modified T cell described herein to a subject is further provided. The delivery apparatus contains the pharmaceutical composition disclosed herein. This delivery apparatus may be an injectable drug delivery device containing an injectable liquid solution or suspension contained in the injectable drug delivery device, wherein the injectable liquid solution or suspension comprises at least one IL-8 receptor modified CAR T cell and (i) an adjuvant and/or (ii) a pharmaceutically acceptable diluent or excipient.
[0145] Having described the many embodiments of the present disclosure in detail, it will be apparent that modifications and variations are possible without departing from the scope of the disclosure defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure, while illustrating many embodiments of the disclosure, are provided as non-limiting examples and are, therefore, not to be taken as limiting the various aspects so illustrated.
[0146] All documents, patents, journal articles and other materials cited in the present application are incorporated herein by reference.
[0147] The many features and advantages of the disclosure are apparent from the detailed specification, and thus, it is intended by the appended claims to cover all such features and advantages of the disclosure which fall within the true spirit and scope of the disclosure. Further, since numerous modifications and variations will readily occur to those skilled in the art, it is not desired to limit the disclosure to the exact construction and operation illustrated and described, and accordingly, all suitable modifications and equivalents may be resorted to, falling within the scope of the disclosure.
[0148] The present disclosure is further defined in the following Examples. It should be understood that these Examples are given by way of illustration only. From the above discussion and these Examples, one skilled in the art may ascertain the essential characteristics of embodiments of the present invention. Without departing from the spirit and scope thereof, one skilled in the art may make various changes and modifications of the invention to adapt it to various usages and conditions. All publications, including patents and non-patent literature, referred to in this specification are expressly incorporated by reference herein.
EXAMPLES
Example 1
[0149] This example shows that IL-8 receptor modified CARs show antitumor response.
Materials and Methods
Cell Culture, In Vitro Irradiation and Human PBMC
[0150] The human U87 glioma cell line was purchased from ATCC (Manassas, USA), and Near-infrared protein iRFP720 was introduced to U87 to generate U87-i720 by retro-viral transduction. Cells were cultured in DMEM (Thermo Fisher Scientific, USA) supplemented with 10% fetal bovine serum (VWR, USA) and penicillin-streptomycin (Thermo Fisher Scientific, USA). Cells were irradiated using X-ray with X-RAD 320 system (Precision X-ray, USA) at the dose of 6 Gy. Healthy donors' and cancer patients' peripheral blood mononuclear cells (PBMC) samples were from Life South (Gainesville, USA). Institutional Review Board (IRB) and IACUC rules were followed.
Generation of Retro-Viral Vectors
[0151] New multiple clone site DNA fragment containing two clone sites was synthesized by IDT (Coralville, USA), abbreviated as MCS2, which consists of Ncol, Pacl, BstBl, Sall enzyme sites. Two clone sites were linked by a linker, which is a fuV5P2A-an optimized 2A self-cleaving peptide. MCS2 was introduced into pMSGV8 retroviral backbone using Ncol and Sall digestion. CD70 CAR was generated as described (Wang, Q J et al, Clin Cancer Res, 2017) and cloned into the upstream site. Human CXCR1 or CXCR2 or EGFP was cloned into downstream site to generate pMSGV8MCS2-CD70CAR.CXCR1 or pMSGV8MCS2-CD70CAR.CXCR2 or pMSGV8MCS2-CD70CAR.EGFP. Click Beetle Red luciferase (CBRLuc) gene was cloned into pMSGV8 to generate pMSGV8-CBRIuc. All gene fragments were codon optimized and synthesized by IDT (Coralville, USA).
CAR-T Transduction
[0152] Retroviral particles were generated by transiently transfecting GP2-293T cells (Takara Bio, USA) with transfer plasmid or vector control plasmid along with pMD2.G plasmid expressing appropriate envelopes. Lipofectemine 2000 (Thermo Fisher Scientific, USA) was used as transfection agent. The viral supernatants were collected 48 hours post transfection. PBMCs from healthy donors (110.sup.6 cells/ml) were stimulated with Dynabeads Human T-Activator CD3/CD28 (Thermo Fisher Scientific, USA) (cells to beads ratio 1:3) for 3 days. On day 3, T cells (510.sup.5 cells/well) were transduced 2 ml of the viral sup containing half CAR and half CBRIuc on RetroNectin (Clontech Laboratories, USA) coated plate in the presence of 100 IU/ml rhlL-2 (R&D Systems, USA). Transduction efficiency was determined via analysis of CXCR1 or CXCR2 or EGFP by FACS.
FACS Analysis
[0153] Anti-human CD3, CXCR1, CXCR2 (BD Biosciences, San Jose, Calif.) were used to define the transduction efficiency of IL8R modified CD70 CAR-T.
Transwell Migration Assay
[0154] Transwell inserts (Pore size 5.0 um, Corning, USA) were placed onto the 24 well-plate. 500 ul of recombinant human IL-8 (Sigma-Aldrich, USA) or conditioned media from radiated U87 cell culture was applied into the bottom of the well as attractant for T cells. 210.sup.5 T cells in 200 ul media was added to the upper chamber. In some experiments, anti-IL8 blocking antibody (BD Biosciences, San Jose, Calif.) was added to the bottom media as a control. After 1 hour incubation, cells in the bottom well were collected and counted by CountBright Absolute Counting Beads (Thermo Fisher Scientific, USA) with flow cytometer. Chemotaxis index (CI) indicates the ratio of cells migrated to the chemokine or conditioned media versus medium only. Absolute number of migrated cells were also used to evaluate chemotaxis.
Orthotopic Glioblastoma Mouse Model and In Vivo Imaging
[0155] All animal experiments followed a protocol approved by University of Florida Institutional Animal Care and Use Committee. U87-i720 was harvested and cell pellets were resuspended in PBS at the appropriate concentration of viable cells as determined by trypan blue dye exclusion, mixed with equal volume of 10% methylcellulose in Zinc Option Modified Eagle's medium(MEM) and loaded into a 250 l syringe (Hamilton, Reno, Nev.) with an attached 25-gauge needle. In NRG mice, the tip of the needle was positioned at bregma and 2 mm to the right of the cranial midline suture and 4 mm below the surface of cranium using stereotactic frame. All mice received 510.sup.4 tumor cells in a volume of 2.5 l. Local radiation and CAR-T treatment were performed as time line show. CAR-T or vector control T cells were delivered by i.v. injection with 210.sup.6 in 100 l PBS. They were regularly examined for any neurologic deficits, weight loss, or signs of stress and euthanized according to preset criteria in accordance with the University of Florida for Comparative Medicine guidelines.
[0156] Tumor growth and T cell trafficking were monitored using the IVIS system (IVIS, Xenogen, Alameda, Calif.). Mice were anesthetized with isofluorane and fluorescent signal of tumor was imaged first. Then mice were received 150 mg/kg D-luciferin (PerkinElmer) intraperitoneally for T cell bioluminescence imaging. The image was analyzed using Living Image software (Caliper Life Sciences, Hopkinton, Mass.).
Local Radiation In Vivo
[0157] Animals were anesthetized with a dose of ketamine at 100 mg/kg and 10 mg/kg xylazine. Then 4 animals were placed at 100 cm from the radiation source on the standard treatment with the radiation beam being sharply collimated to only expose the skulls to the radiation beam, and only right side of head was radiated, where tumors were inoculated. A bolus (blanket of 1 cm thickness tissue equivalent material) was placed over the mice so that it is in contact with the head. The bolus is needed to allow the radiation to build to the proper dose below the surface of the skull, i.e., within the intracranial tumor. With the bolus, the radiation dose will be uniform to within 5% of the mean head dose. A dose of 4.5 Gy to head was delivered, which takes 2-3 minutes. After radiation, mice were placed on warm heating pad to recover sufficient consciousness. Two fractionated radiations were performed as timeline show.
Statistical Analysis
[0158] Unpaired t test were used to compare the difference between each treatment groups, and log-rank test was used to analyze survival. * p<0.05, **p<0.01, ***p<0.001.
Results
[0159]
[0160]
[0161] We also evaluated the IL-8 gene expression profile using large cohorts of primary and recurrent glioma datasets culled from The Cancer Genome Atlas (TCGA). We found that the primary gliomas expressed elevated levels of IL-8 and sustained their expression in the recurrent tumors (
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168] To further evaluate the long-term tumor protection of IL-8R-modified CAR T cells, cured mice were rechallenged in the opposite hemisphere with tumor (U87.i720 on day 77 after initial implantation). While all of the control mice died from the tumor, the CXCR1 and CXCR2 CAR T cell-treated mice showed complete tumor control. (
[0169] Under these conditions, modified CAR T cells exhibit enhanced migratory and proliferative capacities leading to complete tumor regression (100% of mice were cured). Five days after tumor rechallenge, there was a surge in CAR T cells in the tumor-rejection site and long-term tumor protection was obtained. These results demonstrate the feasibility and efficacy of utilizing modified CAR T cells for homing to the tumor site.
Example 2
CD70, A Novel Target of Car T-Cell Therapy For Gliomas.SUP.37
[0170] This example provides evidence that glioma-associated CD70 expression was not detected in normal tissues from different organs but overexpressed predominantly in subgroups of patients with gliomas (i.e., IDH wild-type LGGs and mesenchymal GBMs). The overexpressed CD70 gene was associated with poor survival in patients with LGGs (69.8 mo short, P=0.0005), IDH wild-type LGGs (13.8 mo short), and mesenchymal GBMs (5.5 mo short). It is found that CD70 is directly involved in immunosuppression by mediating production of protumor chemokines (e.g., interleukin-8, chemokine C-C ligand 2, and C-X-C motif chemokine ligand 1) and selectively inducing CD8+ T-cell death. Importantly, preclinical studies show that adoptively transferring CD70 CAR T cells induces potent antitumor response in xenograft and syngeneic models without adverse effects, suggesting that CD70 may be employed to improve outcomes in patients with refractory brain tumors. This example identifies CD70 as a novel immunosuppressive ligand and glioma target for cancer immunotherapy.
Materials and Methods
[0171] In general, normal tissues derived from 52 different organs and primary and recurrent low-grade gliomas (LGGs) and glioblastomas (GBMs) were thoroughly evaluated for CD70 gene and protein expression. The association between CD70 and patients' overall survival and its impact on T-cell death was also evaluated. Human and mouse CD70-specific chimeric antigen receptors (CARs) were tested respectively against human primary GBMs and murine glioma lines. The antitumor efficacies of these CARs were also examined in orthotopic xenograft and syngeneic models.
Patient Samples
[0172] A summary of tumor samples and clinicopathological details of the patients is shown in
Immunohistochemistry and FACS Analysis
[0173] CD70 was assessed using the mouse monoclonal anti-CD70 antibody (Santa Cruz). Other immunohistochemical staining was performed for CD3, CD4, CD8 (Zhongshan), and CD27 (Abcam). Three independent pathologists counted the positive cells in 8-10 randomized high-power fields of each sample. For the fluorescence activated cell sorting (FACS) analysis, anti-human and mouse CD8, CD4, CD3, and CD70 (BD Biosciences) were used.
CD70 GBM Lines
[0174] Lentiviral gene constructs encoding human CD70 and controls (pD2109-EF1a-CD70, pD2109-EF1a vector) or CD70 short hairpin (sh)RNA and controls (pLK0.1-puro-CD70-shRNA, pLKO.1-puro-nt-shRNA).sup.14 were transduced into GBM lines. pLenti-CMV-Puro-Luc (gift from Eric Campeau, Addgene plasmid #17477) was used in the transduction of U87 (U87.Luc). Murine glioma lines GL261 and KR158B were transduced with lentiviral constructs containing mouse CD70 gene or vector control (pUltra-EGFP-CD7O-Luc or pUltra-EGFP-Luc), designated as GL70 or KR70. The CD70+ clone was achieved by single cell sorting using a flow cytometer, and the bulk CD70+ cells were from nonselected cells. The backbone Ultra was a gift from Malcolm Moore (Addgene plasmid #24129). All lentiviruses were produced with packaging plasmid psPAX2 and envelope plasmid pMD2.G (gifts from Didier Trono, Addgene plasmid #12260 and #12259).
RNA Sequencing and Data Analysis
[0175] Triplicated RNA products of 5 CD70 manipulated conditions of the pGBM#3 line were sent for RNA sequencing (RNA-seq) (Novogene). For the data analysis, clean data were provided by the company; paired-end reads were mapped to the human genome (version GRCh37/hg19) and assembled by TopHat Alignment and Cufflinks Pipeline from Illumina BaseSpace as a default setup. Data from The Cancer Genome Atlas (TCGA) used in this study were downloaded from <https://cancergenome.nih.gov/>. Gene expression by RNA-seq (IlluminaHiSeq version 2) was used.
CAR Transduction of Human and Mouse T Cells
[0176] The pMSGV8-hCAR and pMSGV8-mCAR generations and T-cell transductions were described previously..sup.19 We added a tdTomato as a CAR tracker following the CD3-zeta by employing self-cleaving 2A peptide. Nontransduced (NT) T cells were activated under the same conditions. Mouse T-cell transduction was performed using the same methodology as the human T cell transduction. T cell transduction efficiency was determined by tdTomato-positive cells.
Real-Time PCR
[0177] Real-time PCR was performed using the SsoAdvanced Universal Probes Supermix (Bio-Rad Laboratories) and run on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The primers and probes were purchased from Thermo-Fisher Scientific. RPL13A was used for normalization.
CAR T-Cell Tumor Recognition
[0178] Human or mouse CAR T cells were cocultured with human or mouse glioma cell lines, respectively. Cell culture supernatants were harvested and assayed for interferon (IFN)- 18 h later. For the specific lysis assays, luciferase expressing tumor targets were cocultured with varying amounts of mCD70 CAR T cells or NT T cells, respectively..sup.20 Luminescence was measured in a Cytation 3 Cell Imaging Multi-Mode Reader (BioTek).
Syngeneic and Xenograft Mouse Models and Bioluminescence Imaging
[0179] For the syngeneic model, KR70 tumor cells were inoculated into the brains of C57BL/6J mice (Jackson Laboratory), and mCAR or NT T cells were delivered systemically via tail-vein injection. All mice were preconditioned with 5 Gy total body irradiation to induce lymphodepletion. In the human xenograft model, U87.Luc cells were implanted into the brain of NSG-B2m mice (NOD.Cg-B2m.sup.tm1UncPrkdc.sup.scidII2rg.sup.tm1Wjl/SzJ) (Jackson Laboratory), and hCAR or NTT cells were delivered systemically via tail-vein injection. To monitor tumor growth, animals were imaged using the IVIS system (Xenogen). The bioluminescence image was analyzed using Living Image software (Caliper Life Sciences).
Statistical Methods
[0180] We considered CD70 as a continuous predictor of survival. Because of the observational nature of our study survival data, we also included variables in each model to account for possible confounding, and we included sex and age in all patient models. We used restricted cubic splines to assess possible nonlinearity in the association of continuous predictors with survival. We transformed all continuous predictors to a log base 2 scale before inclusion in our models. We used our fitted Cox models to estimate adjusted hazard ratio (HR) for CD70 and other included predictors along with 95% confidence intervals and Wald tests for the null hypothesis HR=1. We estimated median survival in a similar manner for selected levels over the range of observed CD70 levels. We used these estimates to generate a median survival trend curve for CD70. *P<0.05, **P<0.01, ***P<0.001.
Results
Overexpressed CD70 is Presented on Primary and Recurrent Gliomas, but Not on Tumor Infiltrating T Cells
[0181] We and others have shown that T-cell senescence, characterized by CD27 loss and telomere shortening, is a signature of tumor-associated immune erosion..sup.21 We sought to determine the expression profile of CD70 in patients with primary low-grade gliomas (LGGs) and GBMs. Using RNA-seq data culled from TCGA, we detected no CD70 in normal brains, but a significant CD70 upregulation was observed in both primary LGGs and GBMs; notably, primary and recurrent GBMs expressed the highest levels of CD70 (
[0182] For protein expression, regular or fluorescent immunohistochemistry staining was carried out using surgical resected primary and recurrent LGGs and GBMs. A significantly elevated expression in patients with GBM primary and recurrent tumors was observed (
CD70 Expression Correlates with Poor Survival for Patients with LGGs and Mesenchymal GBMs
[0183] To understand the effects of CD70 expression in gliomas on clinical outcomes, we utilized existing large RNA-seq datasets and determined the association between CD70 gene expression and survival based on molecular classifications..sup.22,23
[0184] In primary LGGs, CD70 was predominantly expressed by isocitrate dehydrogenase (IDH) wild-type tumors compared with IDH mutated tumors, including both chromosome 1p/19q codeletion and non-codeletion (
CD70 is Directly Involved in Chemokine/Cytokine Signaling Pathway in Primary GBM
[0185]
[0186] To better understand the mechanism of action for CD70 in gliomas, we did pathway enrichment analysis using a TOGA RNA-seq dataset, which indicated the involvement of CD70 in chemokine/cytokine signaling pathways..sup.24 Since the analysis from TOGA samples illustrated entire tumor tissues that contained immune infiltrates, we next wanted to determine if CD70 directly affects the chemokine/cytokine pathway in pure tumors. We investigated chemokine/cytokine pathway changes in a primary CD70+ line (pGBM#3) after manipulating the CD70 gene (
CD70 Associates with Enhanced Tumor T-Cell Infiltration and Induction of Selective CD8+ T-Cell Death
[0187]
[0188] Tumor-derived chemokines have been shown to recruit macrophages and T cells into the tumors..sup.25,26 Having demonstrated a direct connection between CD70 and tumor associated chemokine production, we sought to assess the association of CD70 with T-cell infiltration. We found that CD70 was moderately associated with tumor infiltrating CD3+ T cells in primary GBMs (
Glioma Recognitions of Human and Mouse CD7OCAR T Cells In Vitro
[0189] To explore whether the restricted expression of an immunosuppressive ligand on GBM tumor cells could serve as a novel target for immunotherapy, CD70-specific CAR constructs of human and mouse were made. The human CD70 CAR (hCD70-CAR, MSGV8 [(MSGV1-(Bam-)]-human CD27-4-1 BB-CD3-zeta) is a retroviral-based vector that encodes CD27 for antigen recognition and transmembrane domains followed by intracellular portions of the 4-1 BB and the CD3-zeta chain..sup.19
[0190]
[0191] We added tdTomato sequences following the CD3-zeta linked by P2A (the MSGV8 vector was used as a control). Based on tdTomato expression, we obtained >50% of T-cell transduction efficiency, and the majority of the transduced T cells were CD8+. CAR transduction did not significantly alter the ratio of CD4+/CD8+ T cells when the transduced and NT T cells were compared (a representative case is shown in
Antitumor Response of CD70 CAR T Cells Against CD70+ Gliomas In Vivo
[0192]
[0193] Next, human and mouse CARs in human xenograft and syngeneic orthotopic glioma models was tested. For hCAR, various doses (10.sup.5-10.sup.7/mouse) of the CAR T cells were adoptively transferred into tumor-bearing NSG-B2m mice 7 days after tumor inoculation. The results demonstrated a T cell dose-dependent manner: a complete regression was seen in 10.sup.7/mouse, an intermediate effect in 10.sup.6/mouse, and no effect in the 10.sup.5/mouse group in survival (
Discussion
[0194] Identifying molecular targets that contribute to tumor pathogenesis with restricted specificity to tumor expression is crucial for effective and sustained therapy. The tumor microenvironment in GBM is notoriously immunosuppressive and appears co-opted in part by CD70 tumor overexpression. We found in a recent study that CD70 is involved in promoting tumor migration and M2 macrophage infiltration in GBM..sup.24 In this report, we showed that CD70 protein was overexpressed by subgroups of primary LGG (10%) and GBM (35%). No CD70 was detected on tumor infiltrating CD3+ T cells and CD163+macrophages in these tumors..sup.24 Importantly, little to no expression was detected in all 52 types of normal tissue, including peripheral blood. These results indicate that CD70 expression is mostly restricted to tumors. The gene expression of CD70 was predominantly found in IDH wild-type LGG patients, a subgroup with strikingly similar molecular characteristics and overall survival to GBMs..sup.27 CD70 was associated with poor survival outcomes in IDH wild-type LGGs. CD70-expressing GBMs were mainly observed in the mesenchymal subgroups and were negatively associated with survival, suggesting that CD70 may have a vital role in glioma progression.
[0195] Since CD70 is the only known ligand for CD27 (a T cell co-stimulatory receptor that plays a critical role in activation, effector function, and survival of T cells), we initially thought that glioma-CD70 expression would impact tumor infiltrating T-cell function via CD27 signaling. Unexpectedly, we found no downregulation of CD27 on tumor infiltrating lymphocytes (data not shown), suggesting that a CD27-independent mechanism has taken place. Although CD70 expression on primary GBMs positively correlates with tumor infiltrating lymphocytes, several obstacles may potentially prevent these T cells from mounting a strong antitumor response. These obstacles include: (i) overwhelming presentation of M2 macrophages that may stymie T-cell function; (ii) the possibility that promoting regulatory T cells, which we have shown, act as a predictor of tumor progression (Mu L et al, manuscript submitted), will utilize the CD27/CD70 axis; and (iii) inducing CD8+ specific T-cell death through a novel mechanism involving the epiregulin-epidermal growth factor receptor pathway (unpublished data). The studies described herein provide scientific evidence that targeting CD70-expressing gliomas offset the immunosuppressive effect and promote strong and sustained antitumor responses.
[0196] Several immunotherapeutic approaches targeting CD70 in other malignancies have been reported, such as antibody blockade, antibody-dependent cell-mediated cytotoxicity, and CAR T cells for cancers such as lymphoma and renal carcinoma..sup.28,29 Due to the existence of the blood-brain barrier in gliomas, CAR T therapy is a superior strategy to other methods, as activated T cells are not only able to pass through the barrier, but are also capable of inducing a potential antitumor response..sup.30-32
[0197] Our results illustrate that CD70 is highly expressed not only by primary tumors, but also by recurrent tumors, which presents a consistent therapeutic target for primary and recurrent gliomas. In addition, irradiation enhances CD70 expression on tumors, providing good opportunity to enhance antitumor efficacy to combine standard care with CD70 CAR therapy in glioma patients. The impact of CD27 on T-cell activation depends (in part) on the extracellular domain of membrane-bound CD27 (soluble [s]CD27), such that addition of sCD27 into T-cell cultures promotes strong T-cell proliferation..sup.33 Thus, introducing the extracellular motif could potentially enhance the CAR T-cell function. Nevertheless, we demonstrated that CD70-specific human and murine CAR T cells induce complete regression/improved survival in CD70+ gliomas in both xenograft and syngeneic models without toxicity.
[0198] Toxicity is one of the great obstacles for CAR T therapy. Since inherited deficiency of CD70 (i.e., homozygous mutations in CD70) may cause impaired function in immune response to viral infections,.sup.34,35 there is concern that targeting CD70 may induce immunosuppression. However, adverse effects from CD70 deficiency may be distinct from adverse effects mediated by CD70 CAR T-cell targeting. While the effects of CD70 CAR T-cell targeting on progenitor cells remain to be determined, based on previously published data, CD70 CAR T-cell targeting does not appear to affect dendritic or T cells. CD70 expression is limited only to the most activated immune cells, which are relatively sparse in cancer patients..sup.14,36 This study showed that CD70 CAR T cells potently induce antitumor reactivity against CD70+ gliomas, both in vitro and in vivo. Taken together, our data suggest that CD70 may be harnessed as an immunotherapeutic target to improve outcomes in patients with gliomas.
Example 3
Sequences
[0199]
TABLE-US-00001 SEQIDNO:1-HumanCD70CAR-CXCR12297bp (SEQIDNO:1) 1 CCATGGCAAGACCCCACCCCTGGTGGCTGTGTGTGCTGGGCACACTGGTCGGACTGAGCG 61 CCACCCCTGCCCCTAAGAGCTGCCCCGAGAGACACTACTGGGCTCAGGGCAAGCTGTGCT 121 GCCAGATGTGCGAGCCCGGCACCTTCCTGGTGAAAGACTGCGACCAGCACCGGAAGGCCG 181 CCCAGTGCGATCCTTGCATCCCCGGCGTGTCCTTCAGCCCCGACCACCACACCAGACCCC 241 ACTGCGAGAGCTGCCGGCATTGCAACTCTGGCCTGCTGGTCCGCAACTGCACCATCACCG 301 CCAACGCCGAGTGCGCCTGCAGAAACGGCTGGCAGTGCCGGGACAAAGAATGCACCGAGT 361 GCGACCCTCTGCCCAACCCCAGCCTGACCGCCAGAAGCAGCCAGGCTCTGAGCCCTCACC 421 CTCAGCCCACCCATCTGCCCTACGTGTCCGAGATGCTGGAAGCCCGGACAGCCGGCCACA 481 TGCAGACCCTGGCCGACTTCAGACAGCTGCCCGCCAGAACCCTGAGCACCCACTGGCCTC 541 CCCAGCGGAGCCTGTGCAGCAGCGACTTCATCCGGATCCTGGTGATCTTCAGCGGCATGT 601 TCCTGGTGTTCACCCTGGCTGGCGCCCTGTTCCTGCACAAGCGGGGCAGAAAGAAGCTGC 661 TGTACATCTTCAAGCAGCCCTTCATGCGGCCCGTGCAGACCACCCAGGAAGAGGACGGCT 721 GCAGCTGCCGGTTCCCCGAGGAAGAGGAAGGCGGCTGCGAGCTGAGAGTGAAGTTCAGCA 781 GAAGCGCCGACGCCCCTGCCTACCAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACC 841 TGGGCAGACGGGAAGAGTACGACGTGCTGGACAAGCGGAGAGGCCGGGACCCTGAGATGG 901 GCGGCAAGCCCCAGAGGCGGAAGAACCCTCAGGAAGGCCTGTATAACGAACTGCAGAAAG 961 ACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGCGGCGGAGAGGCAAGG 1021 GCCACGATGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGACACCTACGACGCCCTGC 1081 ACATGCAGGCTCTGCCTCCAAGATTAATTAACCGTGCCAAGCGAGGTAAGCCTATCCCTA 1141 ACCCTCTCCTCGGTCTCGATTCTACGGGATCCGGAGCCACGAACTTCTCTCTGTTAAAGC 1201 AAGCAGGAGACGTGGAAGAAAACCCCGGTCCTTTCGAAATGAGCAACATCACGGACCCGC 1261 AGATGTGGGACTTCGACGACCTGAACTTCACCGGCATGCCTCCAGCCGACGAGGATTACA 1321 GCCCTTGCATGCTGGAAACCGAGACACTGAACAAATACGTGGTCATCATTGCCTACGCTC 1381 TGGTGTTCCTGCTGAGCCTGCTGGGCAATAGCCTGGTCATGCTGGTCATCCTGTACAGCA 1441 GAGTGGGCAGATCCGTGACCGACGTGTACCTGCTGAATCTGGCCCTGGCCGATCTGCTGT 1501 TTGCCCTGACACTGCCTATTTGGGCCGCCAGCAAAGTGAACGGCTGGATCTTCGGCACCT 1561 TCCTGTGCAAGGTGGTGTCTCTGCTGAAAGAAGTGAACTTCTACAGCGGCATCCTGCTGC 1621 TGGCCTGCATCAGCGTTGACAGATACCTGGCCATCGTGCACGCCACCAGAACACTGACCC 1681 AGAAGAGACACCTGGTCAAGTTCGTGTGCCTCGGCTGTTGGGGCCTGAGCATGAATCTGT 1741 CTCTGCCATTCTTCCTGTTCCGGCAGGCCTACCATCCTAACAACAGCAGCCCTGTGTGCT 1801 ACGAGGTGCTGGGAAACGATACAGCCAAGTGGCGGATGGTGCTGCGGATCCTGCCTCACA 1861 CCTTCGGCTTTATCGTGCCCCTGTTCGTGATGCTGTTCTGCTACGGCTTCACCCTGCGGA 1921 CCCTGTTCAAAGCCCACATGGGCCAGAAACACCGGGCCATGAGAGTGATCTTTGCCGTGG 1981 TGCTGATCTTCCTGCTGTGCTGGCTGCCCTACAACCTGGTGCTGCTTGCCGACACACTGA 2041 TGCGGACCCAAGTGATCCAAGAGAGCTGCGAGCGGCGGAACAATATCGGCAGAGCCCTGG 2101 ATGCTACCGAGATCCTGGGCTTCCTGCACAGCTGTCTGAACCCCATCATCTACGCCTTCA 2161 TCGGCCAGAACTTCCGGCACGGCTTTCTGAAGATTCTGGCCATGCACGGCCTGGTGTCCA 2221 AAGAGTTCCTGGCCAGACACAGAGTGACCAGCTACACCAGCAGCTCCGTGAACGTGTCCA 2281 GCAACCTCTGAGTCGAC
TABLE-US-00002 Element Description Location(bases) CD70CAR Extracellular CD27 + Intracellular 3-1103 41bb + CD3zeta; codon optimized fuV5P2A Furin, V5 peptide, P2A ribosomal skip 1113-1232 peptide CXCR1 Human CXCR1; codon optimized 1239-2291
TABLE-US-00003 SEQIDNO:2-HumanCD70CAR-CXCR22327bp (SEQIDNO:2) 1 CCATGGCAAGACCCCACCCCTGGTGGCTGTGTGTGCTGGGCACACTGGTCGGACTGAGCG 61 CCACCCCTGCCCCTAAGAGCTGCCCCGAGAGACACTACTGGGCTCAGGGCAAGCTGTGCT 121 GCCAGATGTGCGAGCCCGGCACCTTCCTGGTGAAAGACTGCGACCAGCACCGGAAGGCCG 181 CCCAGTGCGATCCTTGCATCCCCGGCGTGTCCTTCAGCCCCGACCACCACACCAGACCCC 241 ACTGCGAGAGCTGCCGGCATTGCAACTCTGGCCTGCTGGTCCGCAACTGCACCATCACCG 301 CCAACGCCGAGTGCGCCTGCAGAAACGGCTGGCAGTGCCGGGACAAAGAATGCACCGAGT 361 GCGACCCTCTGCCCAACCCCAGCCTGACCGCCAGAAGCAGCCAGGCTCTGAGCCCTCACC 421 CTCAGCCCACCCATCTGCCCTACGTGTCCGAGATGCTGGAAGCCCGGACAGCCGGCCACA 481 TGCAGACCCTGGCCGACTTCAGACAGCTGCCCGCCAGAACCCTGAGCACCCACTGGCCTC 541 CCCAGCGGAGCCTGTGCAGCAGCGACTTCATCCGGATCCTGGTGATCTTCAGCGGCATGT 601 TCCTGGTGTTCACCCTGGCTGGCGCCCTGTTCCTGCACAAGCGGGGCAGAAAGAAGCTGC 661 TGTACATCTTCAAGCAGCCCTTCATGCGGCCCGTGCAGACCACCCAGGAAGAGGACGGCT 721 GCAGCTGCCGGTTCCCCGAGGAAGAGGAAGGCGGCTGCGAGCTGAGAGTGAAGTTCAGCA 781 GAAGCGCCGACGCCCCTGCCTACCAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACC 841 TGGGCAGACGGGAAGAGTACGACGTGCTGGACAAGCGGAGAGGCCGGGACCCTGAGATGG 901 GCGGCAAGCCCCAGAGGCGGAAGAACCCTCAGGAAGGCCTGTATAACGAACTGCAGAAAG 961 ACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGCGGCGGAGAGGCAAGG 1021 GCCACGATGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGACACCTACGACGCCCTGC 1081 ACATGCAGGCTCTGCCTCCAAGATTAATTAACCGTGCCAAGCGAGGTAAGCCTATCCCTA 1141 ACCCTCTCCTCGGTCTCGATTCTACGGGATCCGGAGCCACGAACTTCTCTCTGTTAAAGC 1201 AAGCAGGAGACGTGGAAGAAAACCCCGGTCCTTTCGAAATGGAAGATTTCAACATGGAAA 1261 GCGACAGCTTCGAGGACTTCTGGAAAGGCGAGGACCTGAGCAACTACAGCTACAGCTCTA 1321 CCCTGCCTCCTTTCCTGCTGGATGCCGCTCCTTGTGAACCCGAGAGCCTGGAAATCAACA 1381 AGTACTTCGTGGTCATTATCTACGCCCTGGTGTTCCTGCTGAGCCTGCTGGGCAATAGCC 1441 TGGTCATGCTGGTCATCCTGTACAGCAGAGTGGGCAGATCCGTGACCGACGTGTACCTGC 1501 TGAATCTGGCCCTGGCCGATCTGCTGTTTGCCCTGACACTGCCTATTTGGGCCGCCAGCA 1561 AAGTGAACGGCTGGATCTTCGGCACCTTCCTGTGCAAGGTGGTGTCTCTGCTGAAAGAAG 1621 TGAACTTCTACTCCGGCATCCTGCTGCTGGCCTGCATCAGCGTTGACAGATACCTGGCCA 1681 TCGTGCACGCCACCAGAACACTGACCCAGAAGCGCTACCTGGTCAAGTTCATCTGCCTGA 1741 GCATCTGGGGACTGTCCCTGCTGCTTGCTCTGCCTGTGCTGCTGTTTCGGAGAACCGTGT 1801 ACAGCTCCAACGTGTCCCCTGCCTGCTACGAGGACATGGGCAACAACACCGCCAACTGGC 1861 GGATGCTGCTGAGAATCCTGCCTCAGAGCTTCGGCTTCATCGTGCCCCTGCTGATCATGC 1921 TGTTCTGCTACGGCTTCACCCTGCGGACCCTGTTCAAAGCCCACATGGGCCAGAAACACC 1981 GGGCCATGAGAGTGATCTTTGCCGTGGTGCTGATCTTCCTGCTGTGCTGGCTGCCCTACA 2041 ACCTGGTGCTTCTGGCCGACACACTGATGCGGACCCAAGTGATCCAAGAGACATGCGAGC 2101 GGCGGAACCACATCGACAGAGCCCTGGATGCCACAGAGATCCTGGGAATCCTGCACAGCT 2161 GCCTGAATCCTCTGATCTACGCCTTCATCGGACAGAAGTTCCGGCACGGCCTGCTGAAGA 2221 TTCTGGCCATCCACGGCCTGATCAGCAAGGACAGCCTGCCTAAGGACAGCAGACCTAGCT 2281 TTGTGGGCAGCAGCAGCGGCCACACAAGCACCACACTTTGAGTCGAC
TABLE-US-00004 Element Description Location(bases) CD70CAR Extracellular CD27 + Intracellular 3-1103 41bb + CD3zeta; codon optimized fuV5P2A Furin, V5 peptide, P2A ribosomal skip 1113-1232 peptide CXCR2 Human CXCR2; codon optimized 1239-2321
TABLE-US-00005 SEQIDNO:3-HumanCD70CAR-EGFP1964bp (SEQIDNO:3) 1 CCATGGCAAGACCCCACCCCTGGTGGCTGTGTGTGCTGGGCACACTGGTCGGACTGAGCG 61 CCACCCCTGCCCCTAAGAGCTGCCCCGAGAGACACTACTGGGCTCAGGGCAAGCTGTGCT 121 GCCAGATGTGCGAGCCCGGCACCTTCCTGGTGAAAGACTGCGACCAGCACCGGAAGGCCG 181 CCCAGTGCGATCCTTGCATCCCCGGCGTGTCCTTCAGCCCCGACCACCACACCAGACCCC 241 ACTGCGAGAGCTGCCGGCATTGCAACTCTGGCCTGCTGGTCCGCAACTGCACCATCACCG 301 CCAACGCCGAGTGCGCCTGCAGAAACGGCTGGCAGTGCCGGGACAAAGAATGCACCGAGT 361 GCGACCCTCTGCCCAACCCCAGCCTGACCGCCAGAAGCAGCCAGGCTCTGAGCCCTCACC 421 CTCAGCCCACCCATCTGCCCTACGTGTCCGAGATGCTGGAAGCCCGGACAGCCGGCCACA 481 TGCAGACCCTGGCCGACTTCAGACAGCTGCCCGCCAGAACCCTGAGCACCCACTGGCCTC 541 CCCAGCGGAGCCTGTGCAGCAGCGACTTCATCCGGATCCTGGTGATCTTCAGCGGCATGT 601 TCCTGGTGTTCACCCTGGCTGGCGCCCTGTTCCTGCACAAGCGGGGCAGAAAGAAGCTGC 661 TGTACATCTTCAAGCAGCCCTTCATGCGGCCCGTGCAGACCACCCAGGAAGAGGACGGCT 721 GCAGCTGCCGGTTCCCCGAGGAAGAGGAAGGCGGCTGCGAGCTGAGAGTGAAGTTCAGCA 781 GAAGCGCCGACGCCCCTGCCTACCAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACC 841 TGGGCAGACGGGAAGAGTACGACGTGCTGGACAAGCGGAGAGGCCGGGACCCTGAGATGG 901 GCGGCAAGCCCCAGAGGCGGAAGAACCCTCAGGAAGGCCTGTATAACGAACTGCAGAAAG 961 ACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGCGGCGGAGAGGCAAGG 1021 GCCACGATGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGACACCTACGACGCCCTGC 1081 ACATGCAGGCTCTGCCTCCAAGATTAATTAACCGTGCCAAGCGAGGTAAGCCTATCCCTA 1141 ACCCTCTCCTCGGTCTCGATTCTACGGGATCCGGAGCCACGAACTTCTCTCTGTTAAAGC 1201 AAGCAGGAGACGTGGAAGAAAACCCCGGTCCTTTCGAAATGGTGAGCAAGGGAGAGGAGC 1261 TGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGT 1321 TCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCA 1381 TCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACG 1441 GCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCG 1501 CCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACA 1561 AGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGG 1621 GCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACA 1681 GCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGA 1741 TCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCC 1801 CCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCC 1861 TGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCG 1921 CCGGGATCACTCTCGGCATGGATGAGCTGTACAAGTAGGTCGAC
TABLE-US-00006 Element Description Location(bases) CD70CAR Extracellular CD27 + Intracellular 3-1103 41bb + CD3zeta; codon optimized fuV5P2A Furin, V5 peptide, P2A ribosomal skip 1113-1232 peptide EGFP EGFP; codon optimized 1239-1958
TABLE-US-00007 SEQIDNO:4-HumanCXCR1 (SEQIDNO:4) CCGAGACACTGAACAAATACGTGGTCATCATTGCCTACGCTCTGGTGTTCCTGCTGAGCCTG CTGGGCAATAGCCTGGTCATGCTGGTCATCCTGTACAGCAGAGTGGGCAGATCCGTGACC GACGTGTACCTGCTGAATCTGGCCCTGGCCGATCTGCTGTTTGCCCTGACACTGCCTATT TGGGCCGCCAGCAAAGTGAACGGCTGGATCTTCGGCACCTTCCTGTGCAAGGTGGTGTCT CTGCTGAAAGAAGTGAACTTCTACAGCGGCATCCTGCTGCTGGCCTGCATCAGCGTTGAC AGATACCTGGCCATCGTGCACGCCACCAGAACACTGACCCAGAAGAGACACCTGGTCAAG TTCGTGTGCCTCGGCTGTTGGGGCCTGAGCATGAATCTGTCTCTGCCATTCTTCCTGTTC CGGCAGGCCTACCATCCTAACAACAGCAGCCCTGTGTGCTACGAGGTGCTGGGAAACGAT ACAGCCAAGTGGCGGATGGTGCTGCGGATCCTGCCTCACACCTTCGGCTTTATCGTGCCC CTGTTCGTGATGCTGTTCTGCTACGGCTTCACCCTGCGGACCCTGTTCAAAGCCCACATG GGCCAGAAACACCGGGCCATGAGAGTGATCTTTGCCGTGGTGCTGATCTTCCTGCTGTGC TGGCTGCCCTACAACCTGGTGCTGCTTGCCGACACACTGATGCGGACCCAAGTGATCCAA GAGAGCTGCGAGCGGCGGAACAATATCGGCAGAGCCCTGGATGCTACCGAGATCCTGGGC TTCCTGCACAGCTGTCTGAACCCCATCATCTACGCCTTCATCGGCCAGAACTTCCGGCAC GGCTTTCTGAAGATTCTGGCCATGCACGGCCTGGTGTCCAAAGAGTTCCTGGCCAGACAC AGAGTGACCAGCTACACCAGCAGCTCCGTGAACGTGTCCAGCAACCTCTGA SEQIDNO:5-HumanCXCR2 (SEQIDNO:5) TGGATGCCGCTCCTTGTGAACCCGAGAGCCTGGAAATCAACAAGTACTTCGTGGTCATTATC TACGCCCTGGTGTTCCTGCTGAGCCTGCTGGGCAATAGCCTGGTCATGCTGGTCATCCTG TACAGCAGAGTGGGCAGATCCGTGACCGACGTGTACCTGCTGAATCTGGCCCTGGCCGAT CTGCTGTTTGCCCTGACACTGCCTATTTGGGCCGCCAGCAAAGTGAACGGCTGGATCTTC GGCACCTTCCTGTGCAAGGTGGTGTCTCTGCTGAAAGAAGTGAACTTCTACTCCGGCATC CTGCTGCTGGCCTGCATCAGCGTTGACAGATACCTGGCCATCGTGCACGCCACCAGAACA CTGACCCAGAAGCGCTACCTGGTCAAGTTCATCTGCCTGAGCATCTGGGGACTGTCCCTG CTGCTTGCTCTGCCTGTGCTGCTGTTTCGGAGAACCGTGTACAGCTCCAACGTGTCCCCT GCCTGCTACGAGGACATGGGCAACAACACCGCCAACTGGCGGATGCTGCTGAGAATCCTG CCTCAGAGCTTCGGCTTCATCGTGCCCCTGCTGATCATGCTGTTCTGCTACGGCTTCACC CTGCGGACCCTGTTCAAAGCCCACATGGGCCAGAAACACCGGGCCATGAGAGTGATCTTT GCCGTGGTGCTGATCTTCCTGCTGTGCTGGCTGCCCTACAACCTGGTGCTTCTGGCCGAC ACACTGATGCGGACCCAAGTGATCCAAGAGACATGCGAGCGGCGGAACCACATCGACAGA GCCCTGGATGCCACAGAGATCCTGGGAATCCTGCACAGCTGCCTGAATCCTCTGATCTAC GCCTTCATCGGACAGAAGTTCCGGCACGGCCTGCTGAAGATTCTGGCCATCCACGGCCTG ATCAGCAAGGACAGCCTGCCTAAGGACAGCAGACCTAGCTTTGTGGGCAGCAGCAGCGGC CACACAAGCACCACACTTTGA SEQIDNO:6-HumanCD70CAR (SEQIDNO:6) 1TGGCAAGACCCCACCCCTGGTGGCTGTGTGTGCTGGGCACACTGGTCGGACTGAGCG 61CCACCCCTGCCCCTAAGAGCTGCCCCGAGAGACACTACTGGGCTCAGGGCAAGCTGTGCT 121GCCAGATGTGCGAGCCCGGCACCTTCCTGGTGAAAGACTGCGACCAGCACCGGAAGGCCG 181CCCAGTGCGATCCTTGCATCCCCGGCGTGTCCTTCAGCCCCGACCACCACACCAGACCCC 241ACTGCGAGAGCTGCCGGCATTGCAACTCTGGCCTGCTGGTCCGCAACTGCACCATCACCG 301CCAACGCCGAGTGCGCCTGCAGAAACGGCTGGCAGTGCCGGGACAAAGAATGCACCGAGT 361GCGACCCTCTGCCCAACCCCAGCCTGACCGCCAGAAGCAGCCAGGCTCTGAGCCCTCACC 421CTCAGCCCACCCATCTGCCCTACGTGTCCGAGATGCTGGAAGCCCGGACAGCCGGCCACA 481TGCAGACCCTGGCCGACTTCAGACAGCTGCCCGCCAGAACCCTGAGCACCCACTGGCCTC 541CCCAGCGGAGCCTGTGCAGCAGCGACTTCATCCGGATCCTGGTGATCTTCAGCGGCATGT 601TCCTGGTGTTCACCCTGGCTGGCGCCCTGTTCCTGCACAAGCGGGGCAGAAAGAAGCTGC 661TGTACATCTTCAAGCAGCCCTTCATGCGGCCCGTGCAGACCACCCAGGAAGAGGACGGCT 721GCAGCTGCCGGTTCCCCGAGGAAGAGGAAGGCGGCTGCGAGCTGAGAGTGAAGTTCAGCA 781GAAGCGCCGACGCCCCTGCCTACCAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACC 841TGGGCAGACGGGAAGAGTACGACGTGCTGGACAAGCGGAGAGGCCGGGACCCTGAGATGG 901GCGGCAAGCCCCAGAGGCGGAAGAACCCTCAGGAAGGCCTGTATAACGAACTGCAGAAAG 961ACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGCGGCGGAGAGGCAAGG 1021GCCACGATGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGACACCTACGACGCCCTGC 1081ACATGCAGGCTCTGCCTCCAAGA SEQIDNO:7-fuV5P2A (SEQIDNO:7) CGTGCCAAGCGAGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGGGAT CCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCT SEQIDNO:8-EGFP (SEQIDNO:8) GCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTG CCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGC TACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTC CAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAG TTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGAC GGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATG GCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGAC GGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTG CTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAG AAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATG GATGAGCTGTACAAGTAG
[0200] Having described many embodiments in detail, it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure, while illustrating many embodiments, are provided as non-limiting examples and are, therefore, not to be taken as limiting the various aspects so illustrated.
[0201] It is intended that the invention not be limited to the particular embodiment disclosed herein contemplated for carrying out this invention, but that the invention will include all embodiments falling within the scope of the claims.
REFERENCES
[0202] The following references are referred to above and are incorporated herein by reference: [0203] 1. Stupp R, et al. Lancet Oncol. 2009; 10(5):459-466. [0204] 2. Stupp R, et al., N Engl J Med. 2005; 352(10):987-996. [0205] 3. Mellman I, et al., Nature. 2011; 480(7378):480-489. [0206] 4. Rosenberg S A, et al., Nat Rev Cancer. 2008; 8(4):299-308. [0207] 5. Morgan R A, et al., Hum Gene Ther. 2012; 23(10):1043-1053. [0208] 6. Bowman M R, et al., J Immunol. 1994; 152(4):1756-1761. [0209] 7. Hintzen R Q, et al., J Immunol. 1994; 152(4):1762-1773. [0210] 8. Hintzen R Q, et al., J Immunol. 1995; 154(6):2612-2623. [0211] 9. Nolte M A, et al., Immunol Rev. 2009; 229(1):216-231. [0212] 10. Held-Feindt J, et al., Int J Cancer. 2002; 98(3):352-356. [0213] 11. Ryan M C, et al., Br J Cancer. 010; 103(5):676-684. [0214] 12. Wischhusen J, et al., Cancer Res. 2002; 62(9):2592-2599. [0215] 13. Adam P J, et al., Br J Cancer. 2006; 95(3):298-306. [0216] 14. Huang J, et al., J Immunol. 2006; 176(12):7726-7735. [0217] 15. Keller A M, et al., Blood. 2009; 113(21):5167-5175. [0218] 16. Chahlavi A, et al., Cancer Res. 2005; 65(12):5428-5438. [0219] 17. Diegmann J, et al., Neoplasia. 2006; 8(11):933-938. [0220] 18. Ruf M, et al., Clin Cancer Res. 2015; 21(4):889-898. [0221] 19. Wang Q J, et al., Clinical Cancer Research. 2016. [0222] 20. Johnson L A, et al., Science Translational Medicine. 2015; 7(275):275ra222-275ra222. [0223] 21. Zhou J, et al., J Immunol. 2005; 175(10):7046-7052. [0224] 22. Che J W, et al., J Virol. 2015; 89(4):2112-2120. [0225] 23. Verhaak R G, et al., Cancer Cell. 2010; 17(1):98-110. [0226] 24. Ge H, et al., Int J Cancer. 2017. doi:10.1002/ijc.30830 [0227] 25. Chanmee T, et al., Cancers (Basel). 2014; 6(3):1670-1690. [0228] 26. Oelkrug C, et al., Clin Exp Immunol. 2014; 178(1):1-8. [0229] 27. Network TCGAR. Comprehensive, integrative genomic analysis of diffuse lower-grade gliomas. N Engl J Med. 2015; 372(26):2481-2498. [0230] 28. Silence K, Dreier T, Moshir M, et al. ARGX-110, a highly potent antibody targeting CD70, eliminates tumors via both enhanced ADCC and immune checkpoint blockade. Paper presented at: MAbs2014. [0231] 29. Shaffer D R, et al., Blood. 2011; 117(16):4304-4314. [0232] 30. Engelhardt B. J Neural Transm (Vienna). 2006; 113(4):477-485. [0233] 31. Miao H, et al., PLoS One. 2014; 9(4):e94281. [0234] 32. Brown C E, et al., N Engl J Med. 2016; 375(26):2561-2569. [0235] 33. Huang J, et al., J Immunol. 2013; 190(12):6250-6258. [0236] 34. Abolhassani H, et al., J Exp Med. 2017; 214(1):91-106. [0237] 35. Izawa K, et al., J Exp Med. 2017; 214(1):73-89. [0238] 36. Huang J, et al., J Immunother. 2011; 34(4):327-335. [0239] 37. Linchun Jin, et al., Neuro-Oncology. xx(xx): 1-11, 2017 [0240] 38. Krenciute G, et al., Mol Ther 2016; 24(2):354-63 doi 10.1038/mt.2015.199. [0241] 39. Ahmed N, et al., American Association for Cancer Research 2010; 16(2):474-85 doi 10.1158/1078-0432.ccr-09-1322. [0242] 40. Chow K K, et al., Molecular Therapy. 2013 Mar. 31; 21(3):629-37. [0243] 41. Shiina S, et al., Cancer Immunology Research 2016; 4(3):259-68 doi 10.1158/2326-6066.cir-15-0060. [0244] 42. Liu Q, et al., Cytokine Growth Factor Rev. 2016 October; 31:61-71. doi: 10.1016/j.cytogfr.2016.08.002. Epub 2016 Aug. 25. [0245] 43. Trebing, J., et al. (2014). Cell Death & Disease 5(1). [0246] 44. Jacobs, J., et al. (2015). Pharmacol Ther 155: 1-10. [0247] 45. Yang, S. et al. Gene therapy 15.21 (2008): 1411-23.
[0248] All documents, patents, patent applications, journal articles and other materials cited in the present application are incorporated herein by reference.
[0249] While the present invention has been disclosed with references to certain embodiments, numerous modification, alterations, and changes to the described embodiments are possible without departing from the sphere and scope of the present invention, as defined in the appended claims. Accordingly, it is intended that the present invention not be limited to the described embodiments, but that it has the full scope defined by the language of the following claims, and equivalents thereof.