METHOD FOR OVERCOMING SELF-INCOMPATIBILITY OF DIPLOID POTATOES

20210054391 ยท 2021-02-25

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed is a method for overcoming self-incompatibility of diploid potatoes, including: (1) selecting a target fragment; (2) constructing a gene-targeting recombinant vector; (3) achieving a loss-of-function mutation of the intracellular S-RNase gene; (4) regenerating a plurality of potato plants; (5) specifically amplifying a DNA segment containing the target fragment of the S-RNase gene in a regenerated plant; (6) selecting a regenerated plant in which the S-RNase gene is edited; (7) further screening the selected gene-edited plant for a diploid gene-edited plant line; (8) propagating and planting the selected gene-edited plant line, and identifying the self-compatible phenotype at the flowering stage; and (9) sequencing the gene amplification products of the harvested offspring of the self-compatible plant, and detecting the inheritance and isolation of the offspring in which the target gene is edited. The invention provides a simple, accurate and efficient method for overcoming the self-incompatibility of diploid potatoes.

    Claims

    1. A method for overcoming self-incompatibility of diploid potatoes, comprising the following steps: (1) selecting a target fragment in the gene regions of S.sub.pa and S.sub.p4 in the S-RNase gene as a potato self-incompatibility determining gene; (2) constructing a CRISPR/Cas9 recombinant vector for diploid potato S-RNase gene-targeting according to the nucleic acid sequence of the target fragment obtained in step (1); (3) introducing the recombinant vector obtained in the step (2) into potato cells, inducing the co-expression of the guide RNA expression cassette of the target fragment and the Cas9 nuclease expression cassette in the cell, cleaving the double-stranded target fragment of the S-RNase gene to trigger the DNA repair function of the potato cell itself, and causing random insertion or deletion of bases at the target site, thereby achieving a loss-of-function mutation of the intracellular S-RNase gene; (4) regenerating a plurality of potato plants from the potato cells introduced with the recombinant vector, and screening the marker gene in the selected regeneration plants; (5) specifically amplifying a DNA segment with the target fragment in the S-RNase gene of the selected regeneration plants by genomic PCR method, and sequencing the amplified products; (6) selecting a regenerated plant in which the S-RNase gene is edited; (7) detecting the ploidy of the selected gene-edited plant to select a diploid gene-edited plant line; (8) propagating and planting the selected gene-edited plant line, and identifying the self-compatible phenotype at the flowering stage; and (9) harvesting the seeds of the self-compatible plant line, extracting the genomic DNA of the offspring, and specifically amplifying a DNA segment with the target fragment in the S-RNase gene of the selected offspring by PCR method, then sequencing the amplified products and detecting the inheritance and isolation of the edited target gene in the offspring.

    2. The method for overcoming self-incompatibility of diploid potatoes according to claim 1, characterized in that in the step (1) the target fragment is located on the target gene S-RNase, and one strand of the target fragment has the nucleic acid sequence structure as shown in SEQ ID No:1.

    3. The method for overcoming self-incompatibility of diploid potato according to claim 2, wherein in the step (2) the recombinant vector comprises the target fragment, wherein the target fragment is the nucleic acid sequence of SEQ ID No:1 or a sequence complementary thereof.

    4. A potato plant, and a plant part, a tuber or tuber part, a plant cell, a pollen or a seed thereof, wherein it comprises a loss-of-function mutation of the S-RNase gene, wherein the nucleotide sequence of the S-RNase gene is the sequence shown in SEQ ID NO:2 (S.sub.p3), or a complementary sequence, a degenerate sequence, or a homologous sequence thereof; and/or the sequence shown in SEQ ID NO:3 (S.sub.p4), or a complement sequence, a degenerate sequence, or a homologous sequence thereof.

    5. The potato plant, and a plant part, a tuber or tuber part, a plant cell, a pollen or a seed thereof according to claim 4, wherein the homologous sequence has a homology of 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, or 99.9% or more.

    6. The potato plant, and a plant part, a tuber or tuber part, a plant cell, a pollen or a seed thereof according to claim 4, wherein the loss-of-function mutation of the S-RNase gene is achieved by addition and/or deletion of (one or more) nucleotides in the gene expressing the S-RNase protein.

    7. The potato plant, and a plant part, a tuber or tuber part, a plant cell, a pollen or a seed thereof according to claim 6, wherein it is achieved by addition, deletion or replacement of (one or more) nucleotides in the sequence of 5-(N).sub.X-NGG-3 structure or a complementary sequence thereof.

    8. The potato plant, and a plant part, a tuber or tuber part, a plant cell, a pollen or a seed thereof according to claim 7, wherein it is achieved by addition, deletion or replacement of (one or more) nucleotides in the sequence of ACGATTCACGGGCTTTGGCC or a complementary sequence thereof.

    9. The potato plant, and a plant part, a tuber or tuber part, a plant cell, a pollen or a seed thereof according to claim 6, wherein the addition and/or deletion of nucleotides is achieved by a CRISPR/Cas9 recombinant vector.

    10. The potato plant, and a plant part, a tuber or tuber part, a plant cell, a pollen or a seed thereof according to claim 9, wherein the nucleotide sequence of the sgRNA in the CRISPR/Cas9 recombinant vector is: S-RNase P3 (i.e., Seq ID No:4): xxxxACGATTCACGGGCTTTGGC, S-RNase P4 (i.e., Seq ID No:5): xxxxGCCAAAGCCCGTGAATCGT; wherein the portion not underlined is a sequence in above target site with deletion of NGG or a complementary sequence thereof, and the underlined portion is a cohesive end for ligation of the vector.

    11. A CRISPR/Cas9 recombinant vector for targeted knockout of S-RNase protein gene, wherein the nucleotide sequence of the S-RNase protein targeted by the CRISPR/Cas9 recombinant vector is the sequence shown in SEQ ID NO:2 (S.sub.p3), or a complementary sequence, a degenerate sequence, or a homologous sequence thereof; and/or the sequence shown in SEQ ID NO:3 (S.sub.p4), or a complement sequence, a degenerate sequence, or a homologous sequence thereof.

    12. The recombinant vector according to claim 11, wherein the nucleotide sequence of the sgRNA in the CRISPR/Cas9 recombinant vector is: S-RNase P3 (i.e., Seq ID No:4): xxxxACGATTCACGGGCTTTGGC, S-RNase P4 (i.e., Seq ID No:5): xxxxGCCAAAGCCCGTGAATCGT; wherein the portion not underlined is a sequence in above target site with deletion of NGG or a complementary sequence thereof, and the underlined portion is a cohesive end for ligation of the vector.

    13. Use of the CRISPR/Cas9 recombinant vector of claim 11 in the preparation of the knockout of S-RNase protein gene.

    14. A method for breeding a self-compatible potato, comprising the step of making the S-RNase gene in a potato unexpressed or inactivated, wherein the S-RNase gene is the sequence shown in SEQ ID NO:2 (S.sub.p3), or a complementary sequence, a degenerate sequence, or a homologous sequence thereof; and/or the sequence shown in SEQ ID NO:3 (S.sub.p4), or a complement sequence, a degenerate sequence, or a homologous sequence thereof.

    15. A method for breeding a potato, comprising utilizing the potato plant, and a plant part, a tuber or tuber part, a plant cell, a pollen or a seed thereof according to claim 4 to perform self-crossing.

    16. (canceled)

    17. (canceled)

    18. A method for breeding a potato, comprising the potato plant obtained by the breeding method according to claim 14 to perform self-crossing.

    19. A method for manufacturing a commercial plant product, which comprises: obtaining the plant or a plant part thereof according to claim 4 and manufacturing the commercial plant product from the plant or a plant part thereof, wherein the plant products are selected from the group consisting of: fresh whole potatoes, French fries, potato chips, dehydrated potato materials, potato flakes, and potato granules.

    20. A food product made from a potato plant, a tuber, or a tuber part growing from the potato plant, and a plant part, a tuber or tuber part, a plant cell, a pollen or a seed thereof according to claim 4.

    Description

    DETAILED DESCRIPTION OF THE DRAWINGS

    [0062] FIG. 1 shows the detection results of the target mutations according to an example of the present invention.

    [0063] FIG. 2 shows the ploidy detection of the regenerated plants provided by an example of the present invention, wherein panel a is a diploid; panel b is a tetraploid.

    [0064] FIG. 3 is a phenotype diagram showing elongation of pollen tubes in the style of a wild type material (A) and a genetically edited material (B) according to an example of the present invention.

    [0065] FIG. 4 is a phenotype diagram showing the fruit setting for self-crossing of a wild-type and a genetically edited plant line according to an example of the present invention.

    SPECIFIC EMBODIMENTS

    [0066] The invention will be further described in detail below with reference to a particular example and the drawings.

    Example 1: The present invention provides a method for overcoming the

    [0067] self-incompatibility of diploid potatoes, which comprises the following steps:

    [0068] (1) selecting a target fragment in the first exon region of S.sub.p3 and S.sub.p4 in the S-RNase gene as a potato self-incompatibility determining gene; the target fragment in the step (1) is located on the target gene S-RNase, and one strand of the target fragment has the nucleic acid sequence structure as shown in SEQ ID No:1. One strand of the target fragment has the nucleic acid sequence structure as shown in SEQ ID No:1. For example, wherein the target fragment is located on the target S-RNase gene, one strand of the target fragment has a 5-(N).sub.X-NGG-3 structure, and (N).sub.X represents a base sequence having the base number of X {N.sub.1, N.sub.2, . . . , N.sub.X}, and each of N.sub.1, N.sub.2, . . . N.sub.X represents any one of bases A, G, C, and T, and N in NGG is any one of A, G, C, and T.

    [0069] (2) constructing a CRISPR/Cas9 recombinant vector for diploid potato S-RNase gene-targeting according to the nucleic acid sequence of the target fragment obtained in step (1), wherein in the step (2) the recombinant vector comprises the target fragment, wherein the target fragment is the nucleic acid sequence of SEQ ID No:1 or a sequence complementary thereof;

    [0070] The specific operations are as follows:

    [0071] 2.1 selecting a completely conservative nucleotide sequence ACGATTCACGGGCTTTGGCCGG on the first exon of the two S-RNase genes (S.sub.p3 and S.sub.p4) of the diploid potato S. phureja CIP 703541 (the last CGG part is the NGG portion in the 5-(N).sub.X-NGG-3 structure) as a targeting site. The nucleotide sequence of S.sub.p3 is shown as Seq ID No:2, the nucleotide sequence of S.sub.p4 is shown as Seq ID No:3; the target nucleotide sequence of S.sub.p3 is shown as positions 154 to 172 of Seq ID No:2, and the target nucleotide sequence of S.sub.p4 is shown as positions 157 to 175 of Seq ID No:3;

    [0072] 2.2 synthesizing the forward oligonucleotide strand (S-RNase P3) and the complementary reverse oligonucleotide strand (S-RNase P4) according to the selected target site.

    [0073] The specific sequences are as follows:

    TABLE-US-00004 S-RNaseP3(i.e.,SeqIDNo:4): xxxxACGATTCACGGGCTTTGGC, S-RNaseP4(i.e.,SeqIDNo:5): xxxxGCCAAAGCCCGTGAATCGT;

    [0074] wherein the portion not underlined is a sequence in above target site with deletion of NGG or a complementary sequence thereof, and the underlined portion is a cohesive end for ligation of the vector;

    [0075] 2.3 annealing the primers S-RNase P3 and S-RNase P4, and the two strands of S-RNase P3 and S-RNase P4 are annealed to form double-stranded DNA with cohesive ends as an insert fragment for constructing a recombinant vector;

    [0076] 2.4 digesting the pKSE401 vector with BsaI endonuclease at 50 C. for 12 hours, and inactivating the enzyme digestion system at 65 C. for 10 min, as a backbone fragment of the framework recombinant vector;

    [0077] 2.5 ligating the recombinant vector backbone fragment and the insert fragment by T4 ligase, then transferring into E. coli, after verification by sequencing, the positive transformants are extracted to form a recombinant vector plasmid for targeting the diploid potato S-RNase gene by CRISPR/Cas9;

    [0078] 2.6 transferring the recombinant vector plasmid into Agrobacterium EHA105 strain, and after sequencing, then extracting the positive transformed strain after verification by sequencing.

    [0079] (3) introducing the recombinant vector obtained in the step (2) into potato cells, inducing the co-expression of the guide RNA expression cassette and the Cas9 nuclease expression cassette of the target fragment in the cell, cleaving the double-stranded target fragment of the S-RNase gene to trigger the DNA repair function of the potato cell itself, and causing random insertion or deletion of bases at the target site, thereby achieving a loss-of-function mutation of the intracellular S-RNase gene;

    [0080] (4) regenerating a plurality of potato plants from the potato cells introduced with the recombinant vector, and screening the marker gene in the selected regeneration plants;

    [0081] (5) specifically amplifying a DNA segment with the target fragment in the S-RNase gene of the selected regeneration plants by genomic PCR method, and sequencing the amplified products;

    [0082] (6) selecting a regenerated plant in which the S-RNase gene is edited;

    [0083] (7) detecting the ploidy of the selected gene-edited plant to select a diploid gene-edited plant line;

    [0084] (8) propagating and planting the selected gene-edited plant line, and identifying the self-compatible phenotype at the flowering stage; and

    [0085] (9) harvesting the seeds of the self-compatible plant line, extracting the genomic DNA of the offspring, and specifically amplifying a DNA segment with the target fragment in the S-RNase gene of the selected offspring by PCR method, then sequencing the amplified products and detecting the inheritance and isolation of the edited target gene in the offspring.

    [0086] The specific operations for detecting the gene editing of the potato S-RNase in the above steps:

    [0087] 3.1 culturing the shoot tip of the aseptically preserved donor potato material S. phureja CIP 703541 on MS30 basal medium for 3 weeks, and taking the internodes as explants to plate on P-MS20 plate medium (2 pieces of sterile filter paper are previously placed on the surface of the medium, adding 2 mL of PACM solution) and pre-culturing for 2 days, the basic medium formula is as described in MS30, the pre-medium formula is as described in P-MS20, and the PACM solution is formulated as PACM;

    [0088] 3.2 activating positive transformed strain of Agrobacterium EHA105, shaking the bacteria to OD 0.5, then dipping and dyeing the pre-cultured explants described in the above step 2.1 for 15 minutes, then plating the explants on C-MS20 plate medium (1 piece of sterile filter paper is previously placed on the surface of the medium) and co-culturing in the dark for 2 days, and the common medium formulation is as described in C-MS20;

    [0089] 3.3 transferring the co-cultured explants from the end of step 3.2 onto D-MS20 plate differentiation medium for culturing, and the medium is changed every 14 days, and the differentiation medium formula is as described in D-MS20;

    [0090] 3.4 excising the extensible shoots produced by differentiation on the explants, and transferring onto the R-MS30 medium in the tissue culture flask for the resistance screening of the positive transformant, and the resistant screening medium formula is as described in R-MS30;

    [0091] 3.5 extracting the genomic DNA of the positive transformant as a template, and amplifying the full length of the two S-RNase genes S.sub.pa and S.sub.p4 by respectively using the specific primer pairs, S.sub.p3-F: GGGGAAACTGGAAAATGGTT (i.e., Seq ID No:6), S.sub.p3-R: ATGTGAAGTTGTTCAGCGAAA (i.e., Seq ID No:7), and SwF: CAACAAAATGGCTAAATCGCAG (i.e., Seq ID No:8), S.sub.p4-R: GGTTTTCTGTTGGGTGGCAT (i.e., Seq ID No:9); then detecting the target mutation of the target gene sequence by Sanger sequencing, and the results are shown in FIG. 1;

    [0092] It can be seen from FIG. 1 that, in the present example five plants with target mutations are obtained, and all the S-RNase proteins undergo frameshift mutation.

    [0093] 3.6 detecting the positive transformants of the above target mutations by flow cytometry, and selecting the potato S-RNase gene-edited material, which still retains the diploid chromosomes. The detection results are shown in FIG. 2, wherein panel a is a diploid; panel b is a tetraploid. In the present example, five plants with target mutations are obtained, and their ploidy traits are all diploid types as shown in panel a.

    [0094] 4. Phenotypic identification of diploid potato S-RNase gene-edited material:

    [0095] 4.1 propagating and planting the diploid potato S-RNase gene-edited plant line, performing artificial self-crossing at the flowering stage;

    [0096] 4.2 48 hours after pollination, taking the pistil tissues of wild type and mutant plant lines respectively, fixing with 95% EtOH and glacial acetic acid in proportion of 3:1 for 24 hours, softening by 5M NaOH for 24 hours, and rinsing with ddH.sub.2O, staining with 0.005 mg.Math.mL.sup.1 aniline blue solution for 24 hours, and examining pollen tube dyeing under a fluorescence microscope. The detection results are shown in FIG. 3. According to the detection results, 48 hours after self-pollination, as for a group of wild-type materials S. phureja CIP 703541, the pollen tubes cannot enter the ovules, i.e., the wild type materials are self-incompatible; and 48 hours after self-pollination, as for the other group of donor material with orthomutation (S-RNase mutant), the pollen tubes successfully enter the ovules, indicating that the mutant plant line is self-compatible;

    [0097] 4.3 identifying the fruit setting phenotype of self-pollination for the wild-type and the mutant plant lines, and the detection results are shown in FIG. 4. FIG. 4A is a wild-type plant line, and FIG. 4B is a genetically edited plant line. It can be seen from FIG. 4 that, the wild type cannot bear fruits by self-crossing, and the mutant type can bear fruits by self-crossing, indicating that the mutant plant line is a self-compatible new material, and successfully overcomes the barrier of self-incompatibility;

    [0098] 4.4 harvesting the seeds of the self-compatible plant line, and sowing the seeds in the aperture disk; after the true leaves come out, extracting the genomic DNA of all the seedlings; then specifically amplifying the two DNA segments containing the target fragments in the S-RNase gene of the selected seedlings by PCR, and sequencing the amplified products to detect the inheritance and isolation of the edited target gene in the offspring. It is verified that the self-compatibility of the new material created by site-directed gene editing of the S-RNase can be passed on to the offspring. The verification results are shown in Table 1.

    TABLE-US-00005 TABLE 1 Mutation patterns of T0 and T1 generation plant lines of the gene-edited materials T.sub.0 generation T.sub.1 generation No. Sp3 Sp4 Cas9-free.sup.a Sp3Sp3.sup.b Sp3Sp4 Sp4Sp4 32 chimeric +1 bp 7/192 0 3 (Sp4).sup.c 4 (Sp4) 42 wild type 5 bp 45/192 0 17 (Sp4) 28 (Sp4) 44 4 bp chimeric 47/192 20 (Sp3) 27 (Sp3) 0 57 wild type chimeric 13/136 0 6 (Sp4) 7 (Sp4) 66 1 bp wild type 27/192 14 (Sp3) 13 (Sp3) 0 Note: .sup.aThe number before the slash represents the number of individual plants without Cas9 in the detected T.sub.1 generation, the number after the slash represents the number of individual plants in the detected T.sub.1 generation; .sup.bthe isolation of S-RNase type for the individual plants without Cas9 in the T.sub.1 generation; .sup.cindicates the S-RNase mutation type.

    [0099] The medium formulations used above are shown in the following tables: MS30 (1 L):

    TABLE-US-00006 MS 4.43 g sucrose 30 g pH 5.8 agar 8 g

    P-MS20 (1 L):

    [0100]

    TABLE-US-00007 MS 4.43 g sucrose 20 g pH 5.8 agar 8 g

    PA-MS20 (1 L):

    [0101]

    TABLE-US-00008 MS 4.43 g sucrose 20 g caseine hydrolysate 2 g 2,4-D 1 mg/L KT 0.5 mg/L pH 6.5

    C-MS20 (1 L):

    [0102]

    TABLE-US-00009 MS 4.43 g sucrose 20 g pH 5.8 agar 8 g a-napthaleneacetic acid 2 mg .Math. L.sup.1 trans-zeatin 1 mg .Math. L.sup.1 AS 40 mg .Math. L.sup.1

    D-MS20 (1 L):

    [0103]

    TABLE-US-00010 MS 4.43 g sucrose 20 g pH 5.8 agar 8 g a-napthaleneacetic acid 0.01 mg .Math. L.sup.1 trans-zeatin 2 mg .Math. L.sup.1 kanamycin 100 mg .Math. L.sup.1 temetine 200 mg .Math. L.sup.1

    R-MS30 (1 L):

    [0104]

    TABLE-US-00011 MS 4.43 g sucrose 30 g pH 5.8 agar 8 g kanamycin 50 mg .Math. L.sup.1 temetine 200 mg .Math. L.sup.1

    [0105] The above description is only the preferred example of the present invention, and is not intended to limit the present invention. For those skilled in the art, various modifications and changes can be made to the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and the scope of the present invention should be included in the scope of the present invention.