COMPOSITIONS AND METHODS FOR FACILITATING DELIVERY OF SYNTHETIC NUCLEIC ACIDS TO CELLS
20210052706 ยท 2021-02-25
Assignee
Inventors
- Balkrishen Bhat (Carlsbad, CA)
- Jia Tay (Acton, MA, US)
- Saswata Karmakar (Waltham, MA, US)
- Nelson Chau (Needham, MA, US)
Cpc classification
A61K31/7088
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
A61K31/7125
HUMAN NECESSITIES
C12N9/1018
CHEMISTRY; METALLURGY
C12N15/87
CHEMISTRY; METALLURGY
A61K31/712
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K31/7125
HUMAN NECESSITIES
C12N2310/3231
CHEMISTRY; METALLURGY
A61K47/549
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
C12Y201/03003
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K31/712
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided herein are compositions and methods for facilitating or enhancing delivery of nucleic acids, such as synthetic mRNAs, into cells or tissues. Such compositions and methods may include use of a targeting moiety-conjugated, such as an N-acetylgalactosamine (GalNAc)-conjugated, oligonucleotide to facilitate or enhance delivery.
Claims
1. A composition comprising: (a) an oligonucleotide of up to 50 nucleotides in length covalently linked to a targeting moiety; and (b) a synthetic RNA comprising at least one binding region that is complementary to a contiguous stretch of at least 5 nucleotides of the oligonucleotide.
2. The composition of claim 1, wherein the synthetic RNA comprises at least two copies of the binding region.
3. The composition of claim 1, wherein the synthetic RNA comprises at least three copies of the binding region.
4. The composition of claim 1, wherein the synthetic RNA comprises at least four copies of the binding region.
5. The composition of claim 1, wherein the synthetic RNA comprises at least five copies of the binding region.
6. The composition of claim 1, wherein the synthetic RNA comprises at least six copies of the binding region.
7. The composition of claim 1, wherein the synthetic RNA comprises at least seven copies of the binding region.
8. The composition of any one of claims 2 to 7, wherein the copies of the binding region are separated from one another by a spacer region comprising at least one nucleotide.
9. The composition of claim 8, wherein each spacer region between each copy of the binding region is independently between 3 and 24 nucleotides in length.
10. The composition of claim 8, wherein each spacer region between each copy of the binding region is independently 3, 6, 12 or 24 nucleotides in length.
11. The composition of any one of claims 1 to 10, wherein the synthetic RNA is a synthetic mRNA.
12. The composition of claim 11, wherein the at least one binding region is located in an untranslated region (UTR) of the synthetic mRNA.
13. The composition of claim 12, wherein the UTR is a 3 UTR.
14. The composition of any one of the preceding claims, wherein the binding region comprises a microRNA sequence or a portion thereof.
15. The composition of any one of the preceding claims, wherein the binding region comprises a sequence that is not present in an endogenous human mRNA.
16. The composition of any one of the preceding claims, wherein the oligonucleotide is between 8 and 20 nucleotides in length.
17. The composition of claim 16, wherein the oligonucleotide is between 15 and 18 nucleotides in length.
18. The composition of any one of the preceding claims, wherein the oligonucleotide is a single-stranded oligonucleotide.
19. The composition of any one of the preceding claims, wherein the oligonucleotide comprises at least one modified internucleoside linkage.
20. The composition of any one of the preceding claims, wherein the oligonucleotide comprises at least one modified nucleotide.
21. The composition of claim 20, wherein at least one nucleotide comprises a 2 O-methyl.
22. The composition of any one of the preceding claims, wherein the oligonucleotide comprises at least one ribonucleotide, at least one deoxyribonucleotide, at least one 2-fluoro-deoxyribonucleotides or at least one bridged nucleotide.
23. The composition of claim 22, wherein the bridged nucleotide is a LNA nucleotide, a cEt nucleotide or a ENA modified nucleotide.
24. The composition of any one of the preceding claims, wherein each nucleotide of the oligonucleotide is a LNA nucleotide.
25. The composition of any one of the preceding claims, wherein the nucleotides of the oligonucleotide comprise alternating deoxyribonucleotides and 2-fluoro-deoxyribonucleotides, 2-O-methyl nucleotides, or bridged nucleotides.
26. The composition of any one of the preceding claims, wherein the oligonucleotide is mixmer.
27. The composition of any one of the preceding claims, wherein the targeting moiety comprises one or more ligands selected from a sugar moiety, a folate moiety, and a cell-penetrating peptide.
28. The composition of any one of the preceding claims, wherein the targeting moiety comprises one or more sugars.
29. The composition of any one of the preceding claims, wherein the targeting moiety comprises one or more mannose moieties.
30. The composition of any one of the preceding claims, wherein the targeting moiety comprises three mannose moieties.
31. The composition of any one of the preceding claims, wherein the targeting moiety comprises one or more N-acetylgalactosamine ligands.
32. The composition of any one of the preceding claims, wherein the targeting moiety comprises three N-acetylgalactosamine ligands.
33. The composition of any one of the preceding claims, wherein the targeting moiety is of one of the following formulae: ##STR00113## wherein: each instance of L.sup.A, L.sup.B, and L.sup.C is independently either absent or is a linker selected from the group consisting of optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted heteroalkenylene, optionally substituted heteroalkynylene, optionally substituted acylene, optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, and combinations thereof; and each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a ligand.
34. The composition of any one of the preceding claims, wherein the targeting moiety is of the formula: ##STR00114##
35. The composition of claim 33 or 34, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently an optionally substituted heteroalkylene linker.
36. The composition of claim 35, wherein each instance of each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the following formula: ##STR00115## wherein: L.sup.1 is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; and n is an integer from 1 to 10, inclusive.
37. The composition of claim 36, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the following formula: ##STR00116## wherein: each instance of R.sup.N is independently hydrogen, optionally substituted alkyl; optionally substituted acyl; or a nitrogen protecting group; m is an integer from 0 to 10, inclusive; and p is an integer from 0 to 10, inclusive.
38. The composition of claim 37, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the following formula: ##STR00117##
39. The composition of claim 38, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the following formula: ##STR00118##
40. The composition of claim 33 or 34, wherein each instance of L.sup.A, L.sup.B, and L.sup.C independently comprises a triazole diradical.
41. The composition of claim 40, wherein each triazole diradical independently has a structure selected from: ##STR00119##
42. The composition of claim 41, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the formula: ##STR00120## wherein: each of L and L is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; and n is an integer from 1 to 10, inclusive.
43. The composition of claim 42, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the formula: ##STR00121##
44. The composition of any one of claims 33-43, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a ligand selected from a sugar moiety, a folate moiety, or a cell-penetrating peptide.
45. The composition of claim 44, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a sugar moiety.
46. The composition of claim 45, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently an N-acetylgalactosamine moiety.
47. The composition of claim 46, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently of the following formula: ##STR00122## wherein: R.sup.N is independently hydrogen, optionally substituted alkyl; optionally substituted acyl; or a nitrogen protecting group; and each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl; or an oxygen protecting group.
48. The composition of claim 47, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently of the following formula: ##STR00123##
49. The composition of claim 45, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently of the formula: ##STR00124## wherein each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl; or an oxygen protecting group.
50. The composition of claim 49, wherein G.sup.1, G.sup.2, and G.sup.3 are independently selected from the following formulae: ##STR00125##
51. The composition of claim 34, wherein the targeting moiety comprises a group of the formula: ##STR00126## wherein: each instance of L and L is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a sugar moiety, a folate moiety, or a cell-penetrating peptide; and n is an integer from 1 to 10, inclusive.
52. The composition of claim 51, wherein the targeting moiety comprises a group of the formula: ##STR00127## wherein: each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl; or an oxygen protecting group.
53. The composition of claim 52, wherein the targeting moiety comprises a group of the formula: ##STR00128##
54. The composition of claim 53, wherein the targeting moiety comprises a group of the formula: ##STR00129##
55. The composition of claim 34, wherein the targeting moiety comprises a group of the following formula: ##STR00130## wherein: each instance of R.sup.N is independently hydrogen, optionally substituted alkyl, optionally substituted acyl, or a nitrogen protecting group; and each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl, or an oxygen protecting group.
56. The composition of claim 55, wherein the targeting moiety comprises a group of the following formula: ##STR00131## wherein: each instance of L.sup.1 is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; and n is an integer from 1 to 10, inclusive.
57. The composition of claim 56, wherein the targeting moiety comprises a group of the following formula: ##STR00132## wherein: m is an integer from 0 to 10, inclusive; and p is an integer from 0 to 10, inclusive.
58. The composition of claim 57, wherein the targeting moiety comprises a group of the following formula: ##STR00133##
59. The composition of claim 58, wherein the targeting moiety comprises a group of the following formula: ##STR00134##
60. The composition of claim 59, wherein the targeting moiety comprises a group of the following formula: ##STR00135##
61. The composition of any one of the preceding claims, wherein the synthetic RNA comprises at least one modified nucleotide and/or modified internucleotide linkage.
62. The composition of claim 61, wherein the at least one modified nucleotide is selected from the group consisting of: 2-amino-2-deoxynucleotide, 2-azido-2-deoxynucleotide, 2-fluoro-2-deoxynucleotide, 2-O-methyl-nucleotide, 2 sugar super modifier, 2-modified thermostability enhancer, 2-fluoro-2-deoxyadenosine-5-triphosphate, 2-fluoro-2-deoxycytidine-5-triphosphate, 2-fluoro-2-deoxyguanosine-5-triphosphate, 2-fluoro-2-deoxyuridine-5-triphosphate, 2-O-methyladenosine-5-triphosphate, 2-O-methylcytidine-5-triphosphate, 2-O-methylguanosine-5-triphosphate, 2-O-methyluridine-5-triphosphate, pseudouridine-5-triphosphate, 2-O-methylinosine-5-triphosphate, 2-amino-2-deoxycytidine-5-triphosphate, 2-amino-2-deoxyuridine-5-triphosphate, 2-azido-2-deoxycytidine-5-triphosphate, 2-azido-2-deoxyuridine-5-triphosphate, 2-O-methylpseudouridine-5-triphosphate, 2-O-methyl-5-methyluridine-5-triphosphate, 2-azido-2-deoxyadenosine-5-triphosphate, 2-amino-2-deoxyadenosine-5-triphosphate, 2-fluoro-thymidine-5-triphosphate, 2-azido-2-deoxyguanosine-5-triphosphate, 2-amino-2-deoxyguanosine-5-triphosphate, and N4-methylcytidine-5-triphosphate.
63. The composition of any one of the preceding claims, wherein the synthetic RNA encodes Ornithine transcarbamylase (OTC).
64. A method of delivering a synthetic RNA to a cell, the method comprising delivering the composition of any one of claims 1 to 63 to the cell.
65. The method of claim 64, wherein the cell is in vitro.
66. The method of claim 64, wherein the cell is in vivo.
67. The method of claim 64, wherein the cell is ex vivo.
68. A method of treating ornithine transcarbamylase deficiency in a subject, the method comprising administering an therapeutically effective amount of the composition of claim 49 to a subject having ornithine transcarbamylase deficiency.
69. A kit comprising: (a) an oligonucleotide as described in any one of claims 1 to 63; and (b) a synthetic RNA as described in any one of claims 1 to 63.
70. A synthetic RNA as described in any one of claims 1 to 63.
71. A pharmaceutical preparation comprising a complex, wherein the complex comprises: a single-stranded nucleic acid non-covalently associated with an oligonucleotide; wherein the single-stranded nucleic acid is substantially longer than the oligonucleotide; and wherein the oligonucleotide is covalently linked to one or more targeting moieties.
72. The pharmaceutical preparation of claim 71, wherein the complex is of the following formula: ##STR00136## wherein: NA is a single-stranded nucleic acid; OL is an oligonucleotide; represents one or more non-covalent bonds; L.sup.T is a covalent bond or a linker moiety; and T is a targeting moiety; wherein the single-stranded nucleic acid is substantially longer than the oligonucleotide.
73. The pharmaceutical preparation of claim 71 or 72, wherein the single-stranded nucleic acid is hybridized to the oligonucleotide.
74. The pharmaceutical preparation of claim 71, 72, or 73, wherein the single-stranded nucleic acid is non-covalently associated with the oligonucleotide via one or more Watson-Crick base pairing interactions.
75. The pharmaceutical preparation of any one of claims 71-74, wherein the oligonucleotide is associated with an end of the single-stranded nucleic acid.
76. The pharmaceutical preparation of any one of claims 71-75, wherein the oligonucleotide stabilizes the single-stranded nucleic acid.
77. The pharmaceutical preparation of any one of claims 71-76, wherein the complex is outside of a cell.
78. The pharmaceutical preparation of any one of claims 71-77, wherein the targeting moiety comprises one or more ligands selected from a sugar moiety, a folate moiety, and a cell-penetrating peptide.
79. The pharmaceutical preparation of claim 78, wherein the targeting moiety comprises one or more sugar ligands.
80. The pharmaceutical preparation of claim 78, wherein the targeting moiety comprises one or more mannose ligands.
81. The pharmaceutical preparation of claim 78, wherein the targeting moiety comprises three mannose ligands.
82. The pharmaceutical preparation of claim 78, wherein the targeting moiety comprises one or more N-acetylgalactosamine ligands.
83. The pharmaceutical preparation of claim 82, wherein the targeting moiety comprises three N-acetylgalactosamine ligands.
84. The pharmaceutical preparation of any one of claims 71-83, wherein the targeting moiety is of one of the following formulae: ##STR00137## wherein: each instance of L.sup.A, L.sup.B, and L.sup.C is independently either absent or is a linker selected from the group consisting of optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted heteroalkenylene, optionally substituted heteroalkynylene, optionally substituted acylene, optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, and combinations thereof; and each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a ligand.
85. The pharmaceutical preparation of claim 84, wherein the targeting moiety comprises a group of the following formula: ##STR00138##
86. The pharmaceutical preparation of claim 84 or 85, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently an optionally substituted heteroalkylene linker.
87. The pharmaceutical preparation of claim 86, wherein each instance of each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the following formula: ##STR00139## wherein: L.sup.1 is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; and n is an integer from 1 to 10, inclusive.
88. The pharmaceutical preparation of claim 87, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the following formula: ##STR00140## wherein: each instance of R.sup.N is independently hydrogen, optionally substituted alkyl; optionally substituted acyl; or a nitrogen protecting group; m is an integer from 0 to 10, inclusive; and p is an integer from 0 to 10, inclusive.
89. The pharmaceutical preparation of claim 88, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the following formula: ##STR00141##
90. The pharmaceutical preparation of claim 89, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the following formula: ##STR00142##
91. The pharmaceutical preparation of claim 84 or 85, wherein each instance of L.sup.A, L.sup.B, and L.sup.C independently comprises a triazole diradical.
92. The pharmaceutical preparation of claim 91, wherein the triazole diradical has a structure selected from: ##STR00143##
93. The pharmaceutical preparation of claim 91, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the formula: ##STR00144## wherein: each of L and L is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; and n is an integer from 1 to 10, inclusive.
94. The pharmaceutical preparation of claim 93, wherein each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the formula: ##STR00145##
95. The pharmaceutical preparation of any one of claims 84-94, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a ligand selected from a sugar moiety, a folate moiety, or a cell-penetrating peptide.
96. The pharmaceutical preparation of claim 95, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a sugar moiety.
97. The pharmaceutical preparation of claim 96, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently an N-acetylgalactosamine moiety.
98. The pharmaceutical preparation of claim 96, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently of the following formula: ##STR00146## wherein: R.sup.N is independently hydrogen, optionally substituted alkyl; optionally substituted acyl; or a nitrogen protecting group; and each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl; or an oxygen protecting group.
99. The pharmaceutical preparation of claim 98, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently of the following formula: ##STR00147##
100. The pharmaceutical preparation of claim 96, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently mannose or a mannose derivative.
101. The pharmaceutical preparation of claim 100, wherein each instance of G.sup.1, G.sup.2, and G.sup.3 is independently of the following formula: ##STR00148## wherein each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl; or an oxygen protecting group.
102. The pharmaceutical preparation of claim 101, wherein G.sup.1, G.sup.2, and G.sup.3 are independently selected from the following formulae: ##STR00149##
103. The pharmaceutical preparation of claim 85, wherein the targeting moiety comprises a group of the formula: ##STR00150## wherein: each instance of L and L is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a sugar moiety, a folate moiety, or a cell-penetrating peptide; and n is an integer from 1 to 10, inclusive.
104. The pharmaceutical preparation of claim 103, wherein the targeting moiety comprises a group of the formula: ##STR00151## wherein: each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl; or an oxygen protecting group.
105. The pharmaceutical preparation of claim 104, wherein the targeting moiety comprises a group of the formula: ##STR00152##
106. The pharmaceutical preparation of claim 105, wherein the targeting moiety comprises a group of the formula: ##STR00153##
107. The pharmaceutical preparation of claim 82, wherein the targeting moiety comprises a group of the formula: ##STR00154## wherein each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl; or an oxygen protecting group.
108. The pharmaceutical preparation of claim 85, wherein the targeting moiety comprises a group of the following formula: ##STR00155## wherein: each instance of R.sup.N is independently hydrogen, optionally substituted alkyl, optionally substituted acyl, or a nitrogen protecting group; and each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl, or an oxygen protecting group.
109. The pharmaceutical preparation of claim 108, wherein the targeting moiety comprises a group of the following formula: ##STR00156## wherein: each instance of L.sup.1 is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; and n is an integer from 1 to 10, inclusive.
110. The pharmaceutical preparation of claim 109, wherein the targeting moiety comprises a group of the following formula: ##STR00157## wherein: m is an integer from 0 to 10, inclusive; and p is an integer from 0 to 10, inclusive.
111. The pharmaceutical preparation of claim 110, wherein the targeting moiety comprises a group of the following formula: ##STR00158##
112. The pharmaceutical preparation of claim 111, wherein the targeting moiety comprises a group of the following formula: ##STR00159##
113. The pharmaceutical preparation of claim 112, wherein the targeting moiety comprises a group of the following formula: ##STR00160##
114. The pharmaceutical preparation of any one of claims 72-113, wherein L.sup.T is a linker moiety selected from the group consisting of optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted heteroalkenylene, optionally substituted heteroalkynylene, optionally substituted acylene, optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, and combinations thereof.
115. The pharmaceutical preparation of claim 114, wherein L.sup.T is of the following formula: ##STR00161## wherein: X is O or S; and each of L.sup.2, and L.sup.3 is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene.
116. The pharmaceutical preparation of claim 115, wherein L.sup.T is of the following formula: ##STR00162## wherein: R.sup.N is independently hydrogen, optionally substituted alkyl, optionally substituted acyl, or a nitrogen protecting group; q is an integer from 0 to 20, inclusive; and s is an integer from 0 to 20, inclusive.
117. The pharmaceutical preparation of claim 116, wherein L.sup.T is of the following formula: ##STR00163##
118. The pharmaceutical preparation of claim 117, wherein L.sup.T is of the following formula: ##STR00164##
119. The pharmaceutical preparation of any one of claims 71 to 118, wherein the single-stranded nucleic acid is an RNA.
120. The pharmaceutical preparation of any one of claims 71 to 118, wherein the single-stranded nucleic acid is a DNA.
121. The pharmaceutical preparation of any one of claims 71 to 120, wherein the oligonucleotide is up to 50 nucleotides in length.
122. The pharmaceutical preparation of any one of claims 71 to 121, wherein the oligonucleotide comprises at least one modified internucleoside linkage.
123. The pharmaceutical preparation of any one of claims 71 to 122, wherein the oligonucleotide comprises at least one modified nucleotide.
124. A method for treating a disease or condition in a subject in need thereof, the method comprising administering to the subject a pharmaceutical preparation of any one of claims 71 to 123.
125. The method of claim 124, wherein the disease or condition is a neurological condition, autoimmune disease, inflammatory disease, liver disease, proliferative disease, ocular condition, cardiovascular disease, metabolic condition, or hematological disease.
126. The method of claim 124 or 125, wherein the subject is a human.
127. A method of delivering a single-stranded nucleic acid to a cell, the method comprising contacting the cell with a pharmaceutical preparation of any one of claims 71 to 123.
128. The method of claim 127, wherein the cell is contacted in vivo.
129. The method of claim 127, wherein the cell is contacted in vitro.
130. The method of claim 127, wherein the cell is contacted ex vivo.
131. A method of modulating gene expression in a subject, the method comprising administering to the subject a pharmaceutical preparation of any one of claims 71 to 123.
132. The method of claim 131, wherein the subject is a human.
133. The method of claim 131 or 132, for increasing gene expression in a subject.
134. The method of claim 131 or 132, for decreasing gene expression in a subject.
135. A kit comprising a pharmaceutical preparation of any one of claims 71 to 123.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0117] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
DETAILED DESCRIPTION OF THE INVENTION
[0133] The disclosure provides compositions and methods of facilitating delivery of nucleic acids to cells, such as delivery to liver cells (particularly hepatocytes). In some embodiments, oligonucleotides are provided that are associated with (e.g., covalently linked to) one or more targeting moieties that direct the oligonucleotides and complexes containing the oligonucleotides to a particular cell or tissue. In some embodiments, such oligonucleotides are associated with (e.g., covalently linked to) one or more GalNAc-moieties that direct the oligonucleotide to hepatocytes. In some embodiments, such GalNac-modified oligonucleotides facilitate or enhance delivery of other nucleic acids associated with, e.g., complexed with or based-paired with, the oligonucleotides. In some aspects, it has been found that oligonucleotides having one or more N-acetylgalactosamine (GalNAc) moieties exhibit enhanced delivery to liver tissue or hepatocytes in vivo compared with oligonucleotides that do not have such targeting moieties. In some embodiments, use of an oligonucleotide covalently linked to one or more targeting moieties, such as a GalNAc-conjugated oligonucleotide, facilitates or enhances delivery of synthetic mRNAs that contain one or more binding sites for the oligonucleotide.
Nucleic Acids
[0134] In some aspects, nucleic acids are provided in a complex or composition with an oligonucleotide as described herein covalently linked to a targeting moiety as described herein. In some embodiments, association of a nucleic acid with an oligonucleotide covalently linked to a targeting moiety facilitates or enhances delivery of the nucleic acid to a cell, e.g., compared to delivery in the absence of the oligonucleotide.
[0135] The nucleic acid may be single-stranded or double-stranded. Single stranded nucleic acids may include secondary structures, e.g., a loop or helix structure. In some embodiments, the nucleic acid is an RNA (e.g., an mRNA, a tRNA, rRNA, snoRNA, miRNA, ncRNA, long-noncoding RNA, or shRNA). In some embodiments, the nucleic acid is a DNA. In some embodiments, the nucleic acid comprises RNA and DNA nucleotides.
[0136] In some embodiments, the nucleic acid is substantially longer than an oligonucleotide as described herein. In some embodiments, the nucleic acid is at least two times, at least three times, at least four times, at least five times, at least 10 times, at least 20 times, at least 50 times, at least 100 times, at least 200 times, at least 500 times, or at least 1000 times as long as an oligonucleotide as described herein. In some embodiments, the nucleic acid is at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, or at least 10000 nucleotides longer than an oligonucleotide as described herein.
[0137] In some embodiments, the nucleic acid is a synthetic RNA. As used herein the term, synthetic RNA refers to a RNA produced through an in vitro transcription reaction or through artificial (non-natural) chemical synthesis or through a combination thereof. In some embodiments, a synthetic RNA is an mRNA. In some embodiments, a synthetic RNA encodes a protein. In some embodiments, the synthetic RNA is a functional RNA (e.g., a tRNA, rRNA, snoRNA, miRNA, ncRNA, long-noncoding RNA, or shRNA). In some embodiments, a synthetic RNA comprises one or more modified nucleotides as described herein. In some embodiments, the synthetic RNA further comprises a poly A tail, a Kozak sequence, a 3 untranslated region, a 5 untranslated region, or any combination thereof. Poly A tails in particular can be added to a synthetic RNA using a variety of art-recognized techniques, e.g., using poly A polymerase (Yokoe, et al. Nature Biotechnology. 1996; 14: 1252-1256), using transcription directly from PCR products, or by ligating to the 3 end of a synthetic RNA with RNA ligase (see, e.g., Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1991 edition)). In one embodiment, the poly A tail, the Kozak sequence, the 3 untranslated region, the 5 untranslated region, or the any combination thereof comprises one or more modified nucleotides as described herein.
[0138] In some embodiments, a synthetic RNA (e.g., synthetic mRNA) is up to 0.5 kilobases (kb), 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 15 kb, 20 kb, kb, 30 kb or more in length. In some embodiments, a synthetic RNA is in a range of 0.1 kb to 1 kb, 0.5 kb to 2 kb, 0.5 kb to 10 kb, 1 kb to 5 kb, 2 kb to 5 kb, 1 kb to 10 kb, 3 kb to 10 kb, 5 kb to 15 kb, or 1 kb to 30 kb in length.
[0139] In some embodiments, the synthetic RNA (e.g., synthetic mRNA) comprises at least one, at least two, at least three, at least four, at least five, at least six, or at least seven binding regions, e.g., one, two three, four, five, sex, seven, or eight binding regions, that is/are complementary to a contiguous stretch of at least 5 nucleotides of an oligonucleotide provided herein. In some embodiments, copies of the binding region are separated from one another by a spacer region comprising at least one nucleotide. In some embodiments, each spacer region between each copy of the binding region is independently between 3 and 24 nucleotides (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides) in length.
[0140] In some embodiments, the synthetic RNA is a synthetic mRNA and the at least one binding region (such as at least two, at least three, at least four, at least five, at least six, or at least seven binding regions, e.g., one, two three, four, five, sex, seven, or eight binding regions) is located in an untranslated region (UTR) of the synthetic mRNA. In some embodiments, at least one binding region is included in the 5 UTR of the synthetic mRNA. In some embodiments, at least one binding region is included in the 3 UTR of the synthetic mRNA. In some embodiments, the at least one binding region includes at least a portion of the sequence from the poly A portion of the synthetic mRNA. In some embodiments, each binding region has the same sequence.
[0141] In some embodiments, the synthetic mRNA UTR that includes a binding region complementary to the oligonucleotide covently linked to the targeting moiety is a UTR sequence as described in PCT Published Application No. WO 2017/167910, WO 2017/153936, WO 2017/059902, WO 2017/001554, WO 2016/107877, or WO 2016/091391, or in U.S. Published Patent Application No. US 2017/0009244, US 2017/0252461, US 2017/0056528, US 2017/0029847, US 2015/0184195, US 2015/0218554, US 2015/0320847 or US 2007/0068265, each of which published application is herein incorporated by reference.
[0142] In some embodiments, the synthetic mRNA 5 UTR that includes a binding region is a sequence derived from cytomegalovirus, including but not limited to each of the sequences described in U.S. Pat. No. 9,061,021, which is herein incorporated by reference.
[0143] In some embodiments, the synthetic mRNA 3 UTR that includes a binding region is a sequence derived from human growth hormone, including but not limited to each of the sequences described in U.S. Pat. No. 9,061,021, which is herein incorporated by reference.
[0144] In some embodiments, at least one binding region has a different sequence than at least one other binding region. In some embodiments, each binding region has a different sequence than every other binding region. In some embodiments, the binding region comprises or consists of a non-naturally occurring sequence, e.g., a sequence that is not present in an endogenous human mRNA. In some embodiments, the binding region comprises or consists of a naturally occurring sequence, e.g., a sequence already present in a human mRNA. In some embodiments, the binding region comprises or consists of a microRNA sequence or a portion thereof, such as a miR-122 sequence or portion thereof.
[0145] In some embodiments, the synthetic RNA is unmodified. In some embodiments, the synthetic RNA is modified to include at least one modified nucleotide or modified internucleotide linkage. In some embodiments, a synthetic mRNA provided herein contains modified nucleotides in the open reading frame. In some embodiments, the modified nucleotide is selected from the group consisting of: 2-amino-2-deoxynucleotide, 2-azido-2-deoxynucleotide, 2-fluoro-2-deoxynucleotide, 2-O-methyl-nucleotide, 2 sugar super modifier, 2-modified thermostability enhancer, 2-fluoro-2-deoxyadenosine-5-triphosphate, 2-fluoro-2-deoxycytidine-5-triphosphate, 2-fluoro-2-deoxyguanosine-5-triphosphate, 2-fluoro-2-deoxyuridine-5-triphosphate, 2-O-methyladenosine-5-triphosphate, 2-O-methylcytidine-5-triphosphate, 2-O-methylguanosine-5-triphosphate, 2-O-methyluridine-5-triphosphate, pseudouridine-5-triphosphate, 2-O-methylinosine-5-triphosphate, 2-amino-2-deoxycytidine-5-triphosphate, 2-amino-2-deoxyuridine-5-triphosphate, 2-azido-2-deoxycytidine-5-triphosphate, 2-azido-2-deoxyuridine-5-triphosphate, 2-O-methylpseudouridine-5-triphosphate, 2-O-methyl-5-methyluridine-5-triphosphate, 2-azido-2-deoxyadenosine-5-triphosphate, 2-amino-2-deoxyadenosine-5-triphosphate, 2-fluoro-thymidine-5-triphosphate, 2-azido-2-deoxyguanosine-5-triphosphate, 2-amino-2-deoxyguanosine-5-triphosphate, and N4-methylcytidine-5-triphosphate. See, e.g., U.S. Pat. No. 8,278,036 or WO2011/012316 for a discussion of such residues and their incorporation into a synthetic RNA. Additional modifications may include, for example, sugar modifications or substitutions (e.g., one or more of a 2-O-alkyl modification, a locked nucleic acid (LNA)). In some embodiments, the RNAs may be complexed or hybridized with additional polynucleotides and/or peptide polynucleotides (PNA). In embodiments where the sugar modification is a 2-O-alkyl modification, such modification may include, but are not limited to a 2-deoxy-2-fluoro modification, a 2-O-methyl modification, a 2-O-methoxyethyl modification and a 2-deoxy modification.
[0146] In some embodiments, the synthetic RNA comprises a 5 cap. In some embodiments, the cap is a methyl guanosine (m7G) cap. In some embodiments, the cap is a mRNA cap analogue (e.g., mCAP (m7G(5)ppp(5)G) or Anti-Reverse Cap Analog (ARCA) (3 0-Me-m7G(5)ppp(5)G)). For mRNA capping enzymes and procedures, see, e.g., Fechter, P.; Brownlee, G. G. Recognition of mRNA cap structures by viral and cellular proteins J. Gen. Virology 2005, 86, 1239-1249; European patent publication 2 010 659 A2; U.S. Pat. No. 6,312,926. In some embodiments, a 5 cap is added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5 nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) is then added to the terminal phosphates via a guanylyl transferase, producing a 555 triphosphate linkage; and the 7-nitrogen of guanine is then methylated by a methyltransferase.
[0147] In some embodiments, the synthetic RNA comprises or consists of a sequence, or portion thereof, described in the Examples.
Targeting Moieties
[0148] Aspects of the disclosure relate to use of targeting moieties, e.g., covalently coupled to an oligonucleotide as described herein. Exemplary targeting moieties include lipids, carbohydrates (e.g., sugars, including monosaccharide, disaccharide, trisaccharide, tetrasaccharide, or oligosaccharide ligands, or sugar derivatives), cs, peptides (e.g., cell-penetrating peptides), proteins (e.g., antibodies or fragments thereof), small molecules, aptamers, particles, and combinations thereof.
[0149] In some embodiments, the targeting moiety comprises one or more sugars. The term sugar refers to monosaccharides, disaccharides, or polysaccharides (e.g., trisaccharide, tetrasaccharide, oligosaccharide). It also includes amino sugars.
[0150] Most monosaccharides can be represented by the general formula C.sub.yH.sub.2yO.sub.y (e.g., C.sub.6H.sub.12O.sub.6 (a hexose such as glucose)), wherein y is an integer equal to or greater than 3. Certain polyhydric alcohols not represented by the general formula described above may also be considered monosaccharides. For example, deoxyribose is of the formula C.sub.5H.sub.10O.sub.4 and is a monosaccharide. Monosaccharides usually consist of five or six carbon atoms and are referred to as pentoses and hexoses, receptively. If the monosaccharide contains an aldehyde it is referred to as an aldose; and if it contains a ketone, it is referred to as a ketose. Monosaccharides may also consist of three, four, or seven carbon atoms in an aldose or ketose form and are referred to as trioses, tetroses, and heptoses, respectively. Glyceraldehyde and dihydroxyacetone are considered to be aldotriose and ketotriose sugars, respectively. Examples of aldotetrose sugars include erythrose and threose; and ketotetrose sugars include erythrulose. Aldopentose sugars include ribose, arabinose, xylose, and lyxose; and ketopentose sugars include ribulose, arabulose, xylulose, and lyxulose. Examples of aldohexose sugars include glucose (for example, dextrose), mannose, galactose, allose, altrose, talose, gulose, and idose; and ketohexose sugars include fructose, psicose, sorbose, and tagatose. Ketoheptose sugars include sedoheptulose.
[0151] A sugar including two or more joined monosaccharide units is called a disaccharide or polysaccharide (e.g., a trisaccharide), respectively. The two or more monosaccharide units bound together by a covalent bond known as a glycosidic linkage formed via a dehydration reaction, resulting in the loss of a hydrogen atom from one monosaccharide and a hydroxyl group from another. Exemplary disaccharides include sucrose, lactulose, lactose, maltose, isomaltose, trehalose, cellobiose, xylobiose, laminaribiose, gentiobiose, mannobiose, melibiose, nigerose, or rutinose. Exemplary trisaccharides include, but are not limited to, isomaltotriose, nigerotriose, maltotriose, melezitose, maltotriulose, raffinose, and kestose. The term sugar also includes other natural or synthetic stereoisomers of the carbohydrates described herein.
[0152] An amino sugar is a sugar in which a hydroxyl group has been replaced with an amine group (e.g., amino group, monosubstituted amino group, or disubstituted amino group). Amino sugars include glucosamine, galactosamine, and the like. N-acetylgalactosamine (GalNAc) is an example of an amino sugar.
[0153] In some embodiments, the targeting moiety comprises one or more sugars selected from lactose, galactose, galactosamine (e.g., N-acetylgalactosamine (GalNAc)), glucosamine (e.g., N-acetylgalactosamine (GalNAc)), mannose, fucose, and the like.
[0154] In some embodiments, the targeting moiety comprises one or more (e.g., one, two, three or more) amino sugars. In some embodiments, the targeting moiety comprises one or more (e.g., one, two, three or more) N-acetylgalactosamine (GalNAc) ligands.
[0155] As used herein, a folate is folic acid, or an ester or amide thereof. Based on the natural high affinity of folate for the folate receptor protein (FR), which is commonly expressed on the surface of many cells, including those of human cancers, folate conjugates also bind tightly to the FR and trigger cellular uptake via endocytosis.
[0156] As used herein, a cell-penetrating peptide is a peptide that facilitates cellular uptake of a conjugated payload molecule. Non-limiting examples of cell-penetrating peptides include KFF (KFFKFFKFFK (SEQ ID NO: 2)), ANT (RQIKIWFQNRRMKWKK (SEQ ID NO: 3)), TAT (GRKKKRRQRRRYK (SEQ ID NO: 4)), (RXR)4XB (RXRRXRRXRRXRXB (SEQ ID NO: 5)), (RFR)4XB (RFRRFRRFRRFRXB (SEQ ID NO: 6)), PKFF (KFFKFFKFFK(SEQ ID NO: 2)-O-cgatcattcaaa (SEQ ID NO: 7)-NH2), PANT (RQIKIWFQNRRMKWKK (SEQ ID NO: 3)-O-cgatcattcaaa (SEQ ID NO: 7)-NH2), PTAT (GRKKKRRQRRRYK (SEQ ID NO: 4)-O-cgatcattcaaa (SEQ ID NO: 7)-NH2), PRXR (RXRRXRRXRRXRXB (SEQ ID NO: 5)-O-cgatcattcaaa (SEQ ID NO: 7)-NH2), and PRFR (RFRRFRRFRRFRXB (SEQ ID NO: 6)-O-cgatcattcaaa (SEQ ID NO: 7)-NH2).
[0157] Other examples of targeting moieties contemplated include those dislosed in, e.g., U.S. Pat. Nos. 8,962,580; 8,828,956; 9,198,972; 9,181,549; International Publication No. WO 2015/006740; International Publication No. WO 2013/166121; and International Publication No. WO 2014/172698; the entire contents of each of which is incorporated herein by reference.
[0158] In some embodiments, the targeting moiety comprises a group of one of the following formulae:
##STR00053##
wherein: [0159] each instance of L.sup.A, L.sup.B, and L.sup.C is independently either absent or is a linker selected from the group consisting of optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted heteroalkenylene, optionally substituted heteroalkynylene, optionally substituted acylene, optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, and combinations thereof; and [0160] each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a ligand.
[0161] In some embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C is independently either absent or is an optionally substituted heteroalkylene linker. In some embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C is independently a C.sub.1-30 alkylene linker. In some embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C is independently a C.sub.10-20 alkylene linker. In some embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C is independently a heteroalkylene linker comprising 1-20 carbon atoms. In some embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C is independently a heteroalkylene linker comprising 10-20 carbon atoms. In some embodiments, L.sup.A, L.sup.B, and L.sup.C independently comprise a polyethylene glycol (PEG) moiety. In some embodiments, each instance of each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the following formula:
##STR00054##
wherein: [0162] L.sup.1 is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; and [0163] n is an integer from 1 to 10, inclusive.
[0164] In certain embodiments, n is 1. In certain embodiments, n is 2. In certain embodiments, n is 3. In certain embodiments, n is 4. In certain embodiments, n is 5. In certain embodiments, n is 6. In certain embodiments, n is 7. In certain embodiments, n is 8. In certain embodiments, n is 9. In certain embodiments, n is 10.
[0165] In some embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C is independently either absent or is of the following formula:
##STR00055##
wherein: [0166] each instance of R.sup.N is independently hydrogen, optionally substituted alkyl;
optionally substituted acyl; or a nitrogen protecting group; [0167] m is an integer from 0 to 10, inclusive; and [0168] p is an integer from 0 to 10, inclusive.
[0169] In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 4. In certain embodiments, m is 5. In certain embodiments, m is 6. In certain embodiments, m is 7. In certain embodiments, m is 8. In certain embodiments, m is 9. In certain embodiments, m is 10.
[0170] In certain embodiments, p is 0. In certain embodiments, p is 1. In certain embodiments, p is 2. In certain embodiments, p is 3. In certain embodiments, p is 4. In certain embodiments, p is 5. In certain embodiments, p is 6. In certain embodiments, p is 7. In certain embodiments, p is 8. In certain embodiments, p is 9. In certain embodiments, p is 10.
[0171] In some embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C is either absent or is independently of the following formula:
##STR00056##
[0172] In some embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C is independently either absent or is of the following formula:
##STR00057##
[0173] In some embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C independently comprises a triazole diradical. In certain embodiments, each triazole diradical independently has a structure selected from:
##STR00058##
[0174] In certain embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C is independently of the formula:
##STR00059##
wherein each of L and L is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; and n is an integer from 1 to 10, inclusive.
[0175] In certain embodiments, each instance of L.sup.A, L.sup.B, and L.sup.C is independently either absent or is of the formula:
##STR00060##
[0176] As described herein, each of G.sup.1, G.sup.2, and G.sup.3 is independently a ligand. In some embodiments, each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a sugar ligand. Examples of sugars (e.g., sugar ligands) are provided herein. In some embodiments, each instance of G.sup.1, G.sup.2, and G.sup.3 is independently an N-acetylgalactosamine (GalNAc) ligand. Other examples of ligands contemplated include those disclosed in, e.g., U.S. Pat. Nos. 8,962,580; 8,828,956; 9,198,972; 9,181,549; International Publication No. WO 2015/006740; International Publication No. WO 2013/166121; and International Publication No. WO 2014/172698; the entire contends of each of which is incorporated herein by reference.
[0177] In certain embodiments, each instance of G.sup.1, G.sup.2, and G.sup.3 is independently of the formula:
##STR00061##
wherein each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl; or an oxygen protecting group. In certain embodiments, at least one instance of R.sup.O is hydrogen. In certain embodiments, each instance of R.sup.O is hydrogen. In certain embodiments, at least one instance of R.sup.O is optionally substituted alkyl. In certain embodiments, at least one instance of R.sup.O is optionally substituted acyl. In certain embodiments, at least one instance of R.sup.O is an oxygen protecting group.
[0178] In particular embodiments, G.sup.1, G.sup.2, and G.sup.3 are independently selected from the formulae:
##STR00062##
[0179] In some embodiments, each instance of G.sup.1, G.sup.2, and G.sup.3 is independently of the following formula:
##STR00063##
wherein: [0180] R.sup.N is independently hydrogen, optionally substituted alkyl; optionally substituted acyl; or a nitrogen protecting group; and [0181] each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl; or an oxygen protecting group.
[0182] As generally defined herein, Ac is C(O)CH.sub.3.
[0183] In certain embodiments, at least one instance of R.sup.O is hydrogen. In certain embodiments, each instance of R.sup.O is hydrogen. In certain embodiments, at least one instance of R.sup.O is optionally substituted alkyl. In certain embodiments, at least one instance of R.sup.O is optionally substituted acyl. In certain embodiments, at least one instance of R.sup.O is an oxygen protecting group.
[0184] In certain embodiments, at least one instance of R.sup.N is hydrogen. In certain embodiments, at least one instance of R.sup.N is optionally substituted alkyl. In certain embodiments, at least one instance of R.sup.N is optionally substituted acyl. In certain embodiments, at least one instance of R.sup.N is a nitrogen protecting group. In certain embodiments, each instance of R.sup.N is hydrogen.
[0185] In some embodiments, each instance of G.sup.1, G.sup.2, and G.sup.3 is independently N-acetylgalactosamine (GalNAc), of the following formula:
##STR00064##
[0186] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00065##
wherein: [0187] each instance of L.sup.A, L.sup.B, and L.sup.C is independently either absent or is a linker selected from the group consisting of optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted heteroalkenylene, optionally substituted heteroalkynylene, optionally substituted acylene, optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, and combinations thereof; and [0188] each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a ligand.
[0189] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00066## [0190] wherein each instance of L and L is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; each instance of G.sup.1, G.sup.2, and G.sup.3 is independently a sugar moiety, a folate moiety, or a cell-penetrating peptide; and n is an integer from 1 to 10, inclusive.
[0191] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00067## [0192] wherein each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl; or an oxygen protecting group.
[0193] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00068##
[0194] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00069##
[0195] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00070##
wherein: [0196] each instance of R.sup.N is independently hydrogen, optionally substituted alkyl, optionally substituted acyl, or a nitrogen protecting group; and [0197] each instance of R.sup.O is independently hydrogen, optionally substituted alkyl, optionally substituted acyl, or an oxygen protecting group.
[0198] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00071##
wherein: [0199] each instance of L.sup.1 is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene; and [0200] n is an integer from 1 to 10, inclusive.
[0201] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00072##
wherein: [0202] m is an integer from 0 to 10, inclusive; and [0203] p is an integer from 0 to 10, inclusive.
[0204] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00073##
[0205] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00074##
[0206] In some embodiments, the targeting moiety comprises a group of the following formula:
##STR00075##
[0207] As generally defined herein, L.sup.1, L, L are each independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene.
[0208] In certain embodiments, at least one instance of L.sup.1 is optionally substituted alkylene. In certain embodiments, at least one instance of L.sup.1 is optionally substituted C.sub.1-20 alkylene. In certain embodiments, at least one instance of L.sup.1 is optionally substituted C.sub.1-10 alkylene. In certain embodiments, at least one instance of L.sup.1 is optionally substituted heteroalkylene. In certain embodiments, at least one instance of L.sup.1 is optionally substituted C.sub.1-20 heteroalkylene.
[0209] In certain embodiments, at least one instance of L.sup.1 is optionally substituted C.sub.1-10 heteroalkylene. An optionally substituted heteroalkylene linker may contain one or more esters, amides, carbonates, carbamates, ureas, or other heteroatom-containing groups, in the linker. For example, in certain embodiments, at least one instance of L.sup.1 is of the formula:
##STR00076##
wherein R.sup.N, m, and p are as defined herein. In certain embodiments, at least one instance of L.sup.1 is of the formula:
##STR00077##
In certain embodiments, at least one instance of L.sup.1 is of the formula:
##STR00078##
For example, in certain embodiments, each instance of L.sup.1 is of the formula:
##STR00079##
[0210] In certain embodiments, L and L are independently a bond, optionally substituted alkylene (e.g., optionally substituted C.sub.1-20 alkylene, optionally substituted C.sub.1-10 alkylene, optionally substituted C.sub.1-6 alkylene, or unsubstituted alkylene). In certain embodiments, at least one instance of L and L is optionally substituted heteroalkylene. In certain embodiments, at least one instance of L and L is optionally substituted C.sub.1-20 heteroalkylene. In certain embodiments, at least one instance of L and L is optionally substituted C.sub.1-10 heteroalkylene. In certain embodiments, at least one instance of L and L is optionally substituted C.sub.1-6 heteroalkylene. An optionally substituted heteroalkylene linker may contain one or more esters, amides, carbonates, carbamates, phosphodiesters, phosphorothioates, ureas, or other heteroatom-containing groups, in the linker. In certain embodiments, at least one instance of L and L is substituted C.sub.1-20 heteroalkylene. In certain embodiments, at least one instance of L and L is substituted C.sub.1-10 heteroalkylene. In certain embodiments, at least one instance of L and L is substituted C.sub.1-6 heteroalkylene. For example, in certain embodiments, at least one instance of L and L is of the formula:
##STR00080##
wherein R.sup.N, m, and p are as defined herein. In certain embodiments, at least one instance of L and L is of the formula:
##STR00081##
In certain embodiments, at least one instance of L and L is of the formula:
##STR00082##
In certain embodiments, at least one instance of L and L is of the formula:
##STR00083##
In certain embodiments, at least one instance of L and L is of the formula:
##STR00084##
In certain embodiments, at least one instance of L and L is of the formula:
##STR00085##
In certain embodiments, at least one instance of L and L is of the formula:
##STR00086##
In certain embodiments, at least one instance of L and L is of the formula:
##STR00087##
In certain embodiments, at least one instance of L and L is of the formula:
##STR00088##
In certain embodiments, at least one instance of L and L is of the formula:
##STR00089##
In certain embodiments, each instance of L and L is of the formula:
##STR00090##
[0211] In some embodiments of the invention, the oligonucleotide (OL) is linked to the targeting moiety (T) via a linker (L.sup.T). In some embodiments, L.sup.T is a bond (i.e., covalent bond). In some embodiments, L.sup.T is a linker moiety selected from the group consisting of optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted heteroalkenylene, optionally substituted heteroalkynylene, optionally substituted acylene, optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, and combinations thereof.
[0212] In some embodiments, L.sup.T comprises optionally substituted alkylene. In some embodiments, L.sup.T comprises optionally substituted C.sub.1-20 alkylene. In some embodiments, L.sup.T comprises optionally substituted heteroalkylene. In some embodiments, L.sup.T comprises optionally substituted heteroalkylene comprising 1-20 carbon atoms. In some embodiments, L.sup.T comprises optionally substituted heterocyclyl ene. In some embodiments, L.sup.T comprises optionally substituted heteroarylene. In some embodiments, L.sup.T comprises optionally substituted alkylene and optionally substituted heteroarylene. In some embodiments, L.sup.T comprises optionally substituted alkylene, optionally substituted heteroalkylene, and/or optionally substituted heteroarylene.
[0213] In some embodiments, the oligonucleotide (OL) can be linked to the targeting moiety (T) via bioconjugation. In some embodiments, the bioconjugation technique is a click chemistry technique. Click chemistry is a chemical approach introduced by Sharpless in 2001 and describes chemistry tailored to generate substances quickly and reliably by joining units together. See, e.g., Kolb, Finn and Sharpless Angewandte Chemie International Edition 2001 40, 2004-2021; Evans, Australian Journal of Chemistry 2007 60, 384-395). Exemplary coupling reactions (some of which may be classified as click chemistry) include, but are not limited to, formation of esters, thioesters, amides (e.g., such as peptide coupling) from activated acids or acyl halides; nucleophilic displacement reactions (e.g., such as nucleophilic displacement of a halide or ring opening of strained ring systems); azide-alkyne Huisgen cycloaddition; thiol-yne addition; imine formation; Michael additions (e.g., maleimide addition); and Diels-Alder reactions (e.g., tetrazine [4+2] cycloaddition). Examples of click chemistry reactions can be found in, e.g., Kolb, H. C.; Finn, M. G. and Sharpless, K. B. Angew. Chem. Int. Ed. 2001, 40, 2004-2021. Kolb, H. C. and Shrapless, K. B. Drug Disc. Today, 2003, 8, 112-1137; Rostovtsev, V. V.; Green L. G.; Fokin, V. V. and Shrapless, K. B. Angew. Chem. Int. Ed. 2002, 41, 2596-2599; Tomoe, C. W.; Christensen, C. and Meldal, M. J. Org. Chem. 2002, 67, 3057-3064. Wang, Q. et al. J. Am. Chem. Soc. 2003, 125, 3192-3193; Lee, L. V. et al. J. Am. Chem. Soc. 2003 125, 9588-9589; Lewis, W. G. et al. Angew. Chem. Int. Ed. 2002, 41, 1053-41057; Manetsch, R. et al., J. Am. Chem. Soc. 2004, 126, 12809-12818; Mocharla, V. P. et al. Angew. Chem., Int. Ed. 2005, 44, 116-120.
[0214] Therefore, in some embodiments, L.sup.T is a linker comprising a moiety formed by click chemistry (e.g., any moiety described above). For example, in some embodiments, L.sup.T comprises a triazole moiety.
[0215] In some embodiments, L.sup.T is of the following formula:
##STR00091##
wherein: [0216] X is O or S; [0217] each of L.sup.2, and L.sup.3 is independently a bond, optionally substituted alkylene, or optionally substituted heteroalkylene;
[0218] In certain embodiments, L.sup.2 is optionally substituted alkylene. In certain embodiments, L.sup.2 is optionally substituted C.sub.1-20 alkylene. In certain embodiments, L.sup.2 is optionally substituted C.sub.1-10 alkylene. In certain embodiments, L.sup.2 is optionally substituted heteroalkylene. In certain embodiments, L.sup.2 is optionally substituted C.sub.1-20 heteroalkylene. In certain embodiments, L.sup.2 is optionally substituted C.sub.1-10 heteroalkylene. An optionally substituted heteroalkylene linker may contain one or more esters, amides, carbonates, carbamates, ureas, or other heteroatom-containing groups, in the linker. For example, in certain embodiments, L.sup.2 is of the formula:
##STR00092##
wherein R.sup.N and q are as defined herein. In certain embodiments, L.sup.2 is of one of the following formulae:
##STR00093##
In certain embodiments, L.sup.2 is of the formula:
##STR00094##
In certain embodiments, L.sup.2 is of the formula:
##STR00095##
In certain embodiments, L.sup.2 is of the formula:
##STR00096##
[0219] In certain embodiments, L.sup.3 is a bond. In certain embodiments, L.sup.3 is optionally substituted alkylene. In certain embodiments, L.sup.3 is optionally substituted C.sub.1-20 alkylene. In certain embodiments, L.sup.3 is optionally substituted C.sub.1-10 alkylene. In certain embodiments, L.sup.3 is optionally substituted C.sub.1-6 alkylene. In certain embodiments, L.sup.3 is unsubstituted alkylene. In certain embodiments, L.sup.3 is unsubstituted C.sub.1-20 alkylene. In certain embodiments, L.sup.3 is unsubstituted C.sub.1-10 alkylene. In certain embodiments, L.sup.3 is unsubstituted C.sub.1-6 alkylene. In certain embodiments, L.sup.3 is optionally substituted heteroalkylene. In certain embodiments, L.sup.3 is optionally substituted C.sub.1-20 heteroalkylene. In certain embodiments, L.sup.3 is optionally substituted C.sub.1-10 heteroalkylene. In certain embodiments, L.sup.3 is optionally substituted C.sub.1-6 heteroalkylene. For example, in certain embodiments, L.sup.3 is of the formula:
##STR00097##
wherein s is as defined herein. In certain embodiments, L.sup.3 is of one of the following formulae:
##STR00098##
In certain embodiments, L.sup.3 is of the following formula:
##STR00099##
[0220] In some embodiments, L.sup.T is of the following formula:
##STR00100##
wherein: [0221] R.sup.N is independently hydrogen, optionally substituted alkyl, optionally substituted acyl, or a nitrogen protecting group;
[0222] q is an integer from 0 to 20, inclusive; and
[0223] s is an integer from 0 to 20, inclusive.
[0224] In some embodiments, L.sup.T is of the following formula:
##STR00101##
[0225] In some embodiments, L.sup.T is of the following formula:
##STR00102##
[0226] Other examples of linkers (e.g., for groups LA, LB, L.sup.C, L.sup.1, L.sup.2, L.sup.3, and L.sup.T) contemplated include those disclosed in, e.g., U.S. Pat. Nos. 8,962,580; 8,828,956; 9,198,972; 9,181,549; and International Publication No. WO 2015/006740; International Publication No. WO 2013/166121; and International Publication No. WO 2014/172698; the entire contends of each of which is incorporated herein by reference.
[0227] For example, in certain embodiments, the group -L.sup.T-T is of the following formulae:
##STR00103## ##STR00104## ##STR00105##
wherein G.sup.1, G.sup.2, G.sup.3, L.sup.1, L.sup.2, L.sup.3, L, L, R.sup.O, R.sup.N, X, m, n, p, q and s are as defined herein.
Oligonucleotides
[0228] In one aspect of the disclosure, oligonucleotides are provided, e.g., covalently linked to one or more targeting moieties as described herein, e.g., a GalNAc moiety as described herein. In some embodiments, oligonucleotides are provided for facilitating delivery of a nucleic acid (e.g., a synthetic mRNA) as described herein into a cell or tissue, such as a liver cell or liver tissue.
[0229] In some embodiments, oligonucleotides described herein are provided in a complex with, e.g., non-covalently associated with, a nucleic acid (e.g., a synthetic mRNA) as described herein. In some embodiments, the complex is outside of a cell. In some embodiments, the complex is inside of a cell. In some embodiments, the complex is represented by the following formula:
##STR00106##
wherein: [0230] NA is a nucleic acid as described herein; [0231] OL is an oligonucleotide; [0232] represents one or more non-covalent bonds; [0233] L.sup.T is a covalent bond or a linker moiety as described herein; and [0234] T is a targeting moiety as described herein.
[0235] As described herein, the oligonucleotides are non-covalently associated to the nucleic acid via one or more non-covalent bonds (represented by ). In some embodiment, the oligonucleotides described herein are non-covalently associated with the nucleic acid via one or more Watson-Crick base pairing interactions. In some embodiments, the nucleic acid is hybridized to the oligonucleotide, e.g., under stringent hybridization conditions. In some embodiments, the oligonucleotides contain a region of complementarity that is complementary to a sequence a nucleic acid (e.g., a synthetic mRNA) as described herein. In some embodiments, the oligonucleotide contains a region of complementarity that is complementary to at least 5 (e.g., at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20) contiguous nucleotides of the nucleic acid (e.g., the synthetic mRNA) as described herein.
[0236] The oligonucleotide may be single-stranded or double-stranded. Single-stranded oligonucleotides may include secondary structures, e.g., a loop or helix structure. In some embodiments, the oligonucleotide comprises at least one modified nucleotide or modified internucleoside linkage as described herein.
[0237] The oligonucleotide may have a sequence that does not contain guanosine nucleotide stretches (e.g., 3 or more, 4 or more, 5 or more, 6 or more consecutive guanosine nucleotides). In some embodiments, oligonucleotides having guanosine nucleotide stretches have increased non-specific binding and/or off-target effects, compared with oligonucleotides that do not have guanosine nucleotide stretches.
[0238] The oligonucleotide may have a sequence that has less than a threshold level of sequence identity with every sequence of nucleotides, of equivalent length, that map to a genomic position encompassing or in proximity to an off-target gene. For example, an oligonucleotide may be designed to ensure that it does not have a sequence that maps to genomic positions encompassing or in proximity with all known genes (e.g., all known protein coding genes) other than a sequence within the nucleic acid (e.g., the synthetic mRNA) as described herein). The threshold level of sequence identity may be 50%, 60%, 70%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity.
[0239] The oligonucleotide may have a sequence that is has greater than 30% G-C content, greater than 40% G-C content, greater than 50% G-C content, greater than 60% G-C content, greater than 70% G-C content, or greater than 80% G-C content. The oligonucleotide may have a sequence that has up to 100% G-C content, up to 95% G-C content, up to 90% G-C content, or up to 80% G-C content. In some embodiments in which the oligonucleotide is 8 to 10 nucleotides in length, all but 1, 2, 3, 4, or 5 of the nucleotides of the complementary sequence are cytosine or guanosine nucleotides. In some embodiments, the sequence to which the oligonucleotide is complementary comprises no more than 3 nucleotides selected from adenine and uracil.
[0240] In some embodiments, the region of complementarity of the oligonucleotide is complementary with 8 to 15, 8 to 30, 8 to 40, or 10 to 50, or 5 to 50, or 5 to 40, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 consecutive nucleotides of a nucleic acid (e.g., a synthetic mRNA) as described herein. In some embodiments, the region of complementarity is complementary with at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive nucleotides of a nucleic acid (e.g., a synthetic mRNA) as described herein, optionally wherein the oligonucleotide is 8 to 30 nucleotides in length.
[0241] Complementary, as the term is used in the art, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a target sequence as described herein, then the oligonucleotide and the target sequence are considered to be complementary to each other at that position. The oligonucleotide and target sequence are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases. Thus, complementary is a term which is used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and target sequence. For example, if a base at one position of an oligonucleotide is capable of hydrogen bonding with a base at the corresponding position of target sequence, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required.
[0242] The oligonucleotide may be at least 70% complementary to (optionally one of at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) the consecutive nucleotides of a target sequence as described herein. In some embodiments the oligonucleotide may contain 1, 2 or 3 base mismatches compared to the portion of the consecutive nucleotides of the target sequence. In some embodiments the oligonucleotide may have up to 3 mismatches over 15 bases, or up to 2 mismatches over 10 bases.
[0243] It is understood in the art that a complementary nucleotide sequence need not be 100% complementary to that of its target to be specifically hybridizable or specific for a target molecule. In some embodiments, a complementary nucleic acid sequence for purposes of the present disclosure is specifically hybridizable or specific for the target sequence when binding of the complementary nucleic acid sequence to a target sequence interferes with the normal function of the target by causing a loss of activity and/or expression and there is a sufficient degree of complementarity to avoid non-specific binding of the complementary nucleic acid sequence to non-target sequences under conditions in which avoidance of non-specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed under suitable conditions of stringency.
[0244] In some embodiments, the oligonucleotide is up to 7, up to 8, up to 9, up to 10, up to 11, up to 12, up to 13, up to 14, up to 15, up to 16, up to 17, up to 18, up to 19, up to 20, up to 21, up to 22, up to 23, up to 24, up to 25, up to 26, up to 27, up to 28, up to 29, up to 30, up to 35, up to 40, up to 45, or up to 50 nucleotides in length. In some embodiments, the oligonucleotide is 5 to 50, 6 to 50, 7 to 50, 8 to 50, 9 to 50, 10 to 50, 12 to 50, 5 to 30, 6 to 30, 7 to 30, 8 to 30, 9 to 30, 10 to 30, 12 to 30, 5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20, 12 to 20, 5 to 15, 6 to 15, 7 to 15, 8 to 15, 9 to 15, 10 to 15 or 12 to 15 nucleotides in length. In some embodiments, the oligonucleotide is 8 to 30 or 8 to 20 nucleotides in length.
[0245] Base pairings may include both canonical Watson-Crick base pairing and non-Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). It is understood that for complementary base pairings, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), that cytosine-type bases (C) are complementary to guanosine-type bases (G), and that universal bases such as 3-nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T. Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U or T.
[0246] In some embodiments, any one or more thymidine (T) nucleotides (or modified nucleotide thereof) or uridine (U) nucleotides (or a modified nucleotide thereof) in a sequence provided herein, including a sequence provided in the sequence listing, may be replaced with any other nucleotide suitable for base pairing (e.g., via a Watson-Crick base pair) with an adenosine nucleotide. In some embodiments, any one or more thymidine (T) nucleotides (or modified nucleotide thereof) or uridine (U) nucleotides (or a modified nucleotide thereof) in a sequence provided herein, including a sequence provided in the sequence listing, may be suitably replaced with a different pyrimidine nucleotide or vice versa. In some embodiments, any one or more thymidine (T) nucleotides (or modified nucleotide thereof) in a sequence provided herein, including a sequence provided in the sequence listing, may be suitably replaced with a uridine (U) nucleotide (or a modified nucleotide thereof) or vice versa.
[0247] In some embodiments, GC content of the oligonucleotide is preferably between about 30-60%. Contiguous runs of three or more Gs or Cs may not be preferable in some embodiments. Accordingly, in some embodiments, the oligonucleotide does not comprise a stretch of three or more guanosine nucleotides.
Oligonucleotide Structure and Modifications
[0248] The oligonucleotides described herein (e.g., covalently linked to a targeting moiety such as a GalNAc moiety) may be modified, e.g., comprise a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and/or combinations thereof. In addition, the oligonucleotides may exhibit one or more of the following properties: do not mediate alternative splicing; are not immune stimulatory; are nuclease resistant; have improved cell uptake compared to unmodified oligonucleotides; are not toxic to cells or mammals; or have improved endosomal exit. The nucleic acids described herein (e.g., synthetic mRNAs) may also be modified, e.g., comprise a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and/or combinations thereof.
[0249] Any of the oligonucleotides disclosed herein may be linked to one or more other oligonucleotides disclosed herein by a linker, e.g., a cleavable linker.
[0250] Oligonucleotides and nucleic acids as described herein can be stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification. For example, nucleic acid sequences of the disclosure may include a phosphorothioate at least the first, second, or third internucleoside linkage at the 5 or 3 end of the nucleotide sequence. As another example, the nucleic acid sequence can include a 2-modified nucleotide, e.g., a 2-deoxy, 2-deoxy-2-fluoro, 2-O-methyl, 2-O-methoxyethyl (2-O-MOE), 2-O-aminopropyl (2-O-AP), 2-O-dimethylaminoethyl (2-O-DMAOE), 2-O-dimethylaminopropyl (2-O-DMAP), 2-O-dimethylaminoethyloxyethyl (2-O-DMAEOE), or 2-ON-methylacetamido (2-ONMA). As another example, the nucleic acid sequence can include at least one 2-O-methyl-modified nucleotide, and in some embodiments, all of the nucleotides include a 2-O-methyl modification. In some embodiments, the nucleic acids are locked, i.e., comprise nucleic acid analogues in which the ribose ring is locked by a methylene bridge connecting the 2-O atom and the 4-C atom.
[0251] Any of the modified chemistries or formats of oligonucleotides described herein can be combined with each other, and that one, two, three, four, five, or more different types of modifications can be included within the same molecule.
[0252] In some embodiments, an oligonucleotide or nucleic acid as described herein may comprise one or more modified nucleotides (also referred to herein as nucleotide analogs). In some embodiments, the oligonucleotide may comprise at least one ribonucleotide, at least one deoxyribonucleotide, and/or at least one bridged nucleotide. In some embodiments, the oligonucleotide or nucleic acid may comprise a bridged nucleotide, such as a locked nucleic acid (LNA) nucleotide, a constrained ethyl (cEt) nucleotide, or an ethylene bridged nucleic acid (ENA) nucleotide. Examples of such nucleotides are disclosed herein and known in the art. In some embodiments, the oligonucleotide comprises a nucleotide analog disclosed in one of the following U.S. patent or patent application Publications: U.S. Pat. Nos. 7,399,845, 7,741,457, 8,022,193, 7,569,686, 7,335,765, 7,314,923, 7,335,765, and 7,816,333, US 2011/0009471, the entire contents of each of which are incorporated herein by reference for all purposes. The oligonucleotide may have one or more 2 O-methyl nucleotides. The oligonucleotide may consist entirely of 2 O-methyl nucleotides.
[0253] In some embodiments, the oligonucleotide or nucleic acid has one or more nucleotide analogues. For example, the oligonucleotide may have at least one nucleotide analogue that results in an increase in T.sub.m of the oligonucleotide in a range of 1 C., 2 C., 3 C., 4 C., or 5 C. compared with an oligonucleotide that does not have the at least one nucleotide analogue. The oligonucleotide may have a plurality of nucleotide analogues that results in a total increase in T.sub.m of the oligonucleotide in a range of 2 C., 3 C., 4 C., 5 C., 6 C., 7 C., 8 C., 9 C., 10 C., 15 C., 20 C., 25 C., 30 C., 35 C., 40 C., 45 C. or more compared with an oligonucleotide that does not have the nucleotide analogue.
[0254] The oligonucleotide may be of up to 50 nucleotides in length in which 2 to 10, 2 to 15, 2 to 16, 2 to 17, 2 to 18, 2 to 19, 2 to 20, 2 to 25, 2 to 30, 2 to 40, 2 to 45, or more nucleotides of the oligonucleotide are nucleotide analogues. The oligonucleotide may be of 8 to 30 nucleotides in length in which 2 to 10, 2 to 15, 2 to 16, 2 to 17, 2 to 18, 2 to 19, 2 to 20, 2 to 25, 2 to 30 nucleotides of the oligonucleotide are nucleotide analogues. The oligonucleotide may be of 8 to 15 nucleotides in length in which 2 to 4, 2 to 5, 2 to 6, 2 to 7, 2 to 8, 2 to 9, 2 to 10, 2 to 11, 2 to 12, 2 to 13, 2 to 14 nucleotides of the oligonucleotide are nucleotide analogues. Optionally, the oligonucleotides may have every nucleotide except 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides modified.
[0255] The oligonucleotide or nucleic acid may consist entirely of bridged nucleotides (e.g., LNA nucleotides, cEt nucleotides, ENA nucleotides). The oligonucleotide or nucleic acid may comprise alternating deoxyribonucleotides and 2-fluoro-deoxyribonucleotides. The oligonucleotide or nucleic acid may comprise alternating deoxyribonucleotides and 2-O-methyl nucleotides. The oligonucleotide or nucleic acid may comprise alternating deoxyribonucleotides and ENA nucleotide analogues. The oligonucleotide may comprise alternating deoxyribonucleotides and LNA nucleotides. The oligonucleotide or nucleic acid may comprise alternating LNA nucleotides and 2-O-methyl nucleotides. The oligonucleotide or nucleic acid may have a 5 nucleotide that is a bridged nucleotide (e.g., a LNA nucleotide, cEt nucleotide, ENA nucleotide). The oligonucleotide or nucleic acid may have a 5 nucleotide that is a deoxyribonucleotide.
[0256] The oligonucleotide or nucleic acid may comprise deoxyribonucleotides flanked by at least one bridged nucleotide (e.g., a LNA nucleotide, cEt nucleotide, ENA nucleotide) on each of the 5 and 3 ends of the deoxyribonucleotides. The oligonucleotide may comprise deoxyribonucleotides flanked by 1, 2, 3, 4, 5, 6, 7, 8 or more bridged nucleotides (e.g., LNA nucleotides, cEt nucleotides, ENA nucleotides) on each of the 5 and 3 ends of the deoxyribonucleotides. The 3 position of the oligonucleotide or nucleic acid may have a 3 hydroxyl group. The 3 position of the oligonucleotide or nucleic acid may have a 3 thiophosphate.
[0257] The oligonucleotide or nucleic acid may be conjugated with a label. For example, the oligonucleotide may be conjugated with a biotin moiety, cholesterol, Vitamin A, folate, sigma receptor ligands, aptamers, peptides, such as CPP, hydrophobic molecules, such as lipids, ASGPR or dynamic polyconjugates and variants thereof at its 5 or 3 end.
[0258] In some embodiments, the oligonucleotide or nucleic acid comprises one or more modifications comprising: a modified sugar moiety, and/or a modified internucleoside linkage, and/or a modified nucleotide and/or combinations thereof. It is not necessary for all positions in a given oligonucleotide or nucleic acid to be uniformly modified, and in fact more than one of the modifications described herein may be incorporated in a single oligonucleotide or nucleic acid or even at within a single nucleoside within an oligonucleotide or nucleic acid.
[0259] In some embodiments, the oligonucleotides or nucleic acids are chimeric oligonucleotides that contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides or nucleic acids typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. Chimeric oligonucleotides or nucleic acids of the disclosure may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference.
[0260] In some embodiments, the oligonucleotide or nucleic acid comprises at least one nucleotide modified at the 2 position of the sugar, preferably a 2-O-alkyl, 2-O-alkyl-O-alkyl or 2-fluoro-modified nucleotide. In other preferred embodiments, RNA modifications include 2-fluoro, 2-amino and 2 O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3 end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than 2-deoxyoligonucleotides against a given target.
[0261] A number of nucleotide modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides or nucleic acids include those comprising modified backbones, for example, modified internucleoside linkages such as phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. In some embodiments, oligonucleotides or nucleic acids may have phosphorothioate backbones; heteroatom backbones, such as methylene(methylimino) or MMI backbones; amide backbones (see De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374); morpholino backbones (see Summerton and Weller, U.S. Pat. No. 5,034,506); or peptide nucleic acid (PNA) backbones (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al., Science 1991, 254, 1497).
[0262] Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3-5 linkages, 2-5 linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3-5 to 5-3 or 2-5 to 5-2; see U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.
[0263] In some embodiments, the oligonucleotide is an oligonucleotide mimetic. Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991. In some embodiments, the morpholino-based oligomeric compound is a phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in Iverson, Curr. Opin. Mol. Ther., 3:235-238, 2001; and Wang et al., J. Gene Med., 12:354-364, 2010; the disclosures of which are incorporated herein by reference in their entireties).
[0264] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602.
[0265] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
[0266] Modified oligonucleotides are also known that include oligonucleotides that are based on or constructed from arabinonucleotide or modified arabinonucleotide residues. Arabinonucleosides are stereoisomers of ribonucleosides, differing only in the configuration at the 2-position of the sugar ring. In some embodiments, a 2-arabino modification is 2-F arabino. In some embodiments, the modified oligonucleotide is 2-fluoro-D-arabinonucleic acid (FANA) (as described in, for example, Lon et al., Biochem., 41:3457-3467, 2002 and Min et al., Bioorg. Med. Chem. Lett., 12:2651-2654, 2002; the disclosures of which are incorporated herein by reference in their entireties). Similar modifications can also be made at other positions on the sugar, particularly the 3 position of the sugar on a 3 terminal nucleoside or in 2-5 linked oligonucleotides and the 5 position of 5 terminal nucleotide.
[0267] PCT Publication No. WO 99/67378 discloses arabinonucleic acids (ANA) oligomers and their analogues for improved sequence specific inhibition of gene expression via association to complementary messenger RNA.
[0268] Other preferred modifications include ethylene-bridged nucleic acids (ENAs) (e.g., International Patent Publication No. WO 2005/042777, Morita et al., Nucleic Acid Res., Suppl 1:241-242, 2001; Surono et al., Hum. Gene Ther., 15:749-757, 2004; Koizumi, Curr. Opin. Mol. Ther., 8:144-149, 2006 and Horie et al., Nucleic Acids Symp. Ser (Oxf), 49:171-172, 2005; the disclosures of which are incorporated herein by reference in their entireties). Preferred ENAs include, but are not limited to, 2-0,4-C-ethylene-bridged nucleic acids.
[0269] Examples of LNAs are described in WO/2008/043753 and include compounds of the following general formula.
##STR00107## [0270] where X and Y are independently selected among the groups O, S, N(H), N(R), CH.sub.2 or CH (if part of a double bond), CH.sub.2O, CH.sub.2S, CH.sub.2N(H), CH.sub.2N(R), CH.sub.2CH.sub.2 or CH.sub.2CH (if part of a double bond), CHCH, where R is selected from hydrogen and C.sub.1-4-alkyl; Z and Z* are independently selected among an internucleoside linkage, a terminal group or a protecting group; B constitutes a natural or non-natural nucleotide base moiety; and the asymmetric groups may be found in either orientation.
[0271] In some embodiments, the LNA used in the oligonucleotides or nucleic acids described herein comprises at least one LNA unit according any of the formulas
##STR00108## [0272] wherein Y is O, S, NH, or N(R.sup.H); Z and Z* are independently selected among an internucleoside linkage, a terminal group or a protecting group; B constitutes a natural or non-natural nucleotide base moiety, and RH is selected from hydrogen and C.sub.1-4-alkyl.
[0273] In some embodiments, the Locked Nucleic Acid (LNA) used in the oligonucleotides or nucleic acids described herein comprises at least one Locked Nucleic Acid (LNA) unit according any of the formulas shown in Scheme 2 of PCT/DK2006/000512.
[0274] In some embodiments, the LNA used an oligonucleotide or nucleic acid as described herein comprises internucleoside linkages selected from OP(O).sub.2O, OP(O,S)O, OP(S).sub.2O, SP(O).sub.2O, SP(O,S)O, SP(S).sub.2O, OP(O).sub.2S, OP(O,S)S, SP(O).sub.2S, OPO(R.sup.H)O, OPO(OCH.sub.3)O, OPO(NR.sup.H)O, OPO(OCH.sub.2CH.sub.2SR)O, OPO(BH.sub.3)O, OPO(NHR.sup.H)O, OP(O).sub.2NR.sup.H, NR.sup.HP(O).sub.2O, NR.sup.HCOO, where R.sup.H is selected from hydrogen and C.sub.1-4-alkyl.
[0275] Specifically preferred LNA units are shown below:
##STR00109##
[0276] The term thio-LNA comprises a locked nucleotide in which at least one of X or Y in the general formula above is selected from S or CH.sub.2S. Thio-LNA can be in both beta-D and alpha-L-configuration.
[0277] The term amino-LNA comprises a locked nucleotide in which at least one of X or Y in the general formula above is selected from N(H), N(R), CH.sub.2N(H), and CH.sub.2N(R) where R is selected from hydrogen and C.sub.1-4-alkyl. Amino-LNA can be in both beta-D and alpha-L-configuration.
[0278] The term oxy-LNA comprises a locked nucleotide in which at least one of X or Y in the general formula above represents O or CH.sub.2O. Oxy-LNA can be in both beta-D and alpha-L-configuration.
[0279] The term ena-LNA comprises a locked nucleotide in which Y in the general formula above is CH.sub.2O (where the oxygen atom of CH.sub.2O is attached to the 2-position relative to the base B).
[0280] LNAs are described in additional detail herein.
[0281] One or more substituted sugar moieties can also be included, e.g., one of the following at the 2 position: OH, SH, SCH.sub.3, F, OCN, OCH.sub.3 OCH.sub.3, OCH.sub.3 O(CH.sub.2)n CH.sub.3, O(CH.sub.2)n NH.sub.2 or O(CH.sub.2)n CH.sub.3 where n is from 1 to about 10; C.sub.1 to C.sub.10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF.sub.3; OCF.sub.3; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH.sub.3; SO.sub.2 CH.sub.3; ONO.sub.2; NO.sub.2; N.sub.3; NH.sub.2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2-methoxyethoxy [2-O-CH.sub.2CH.sub.2OCH.sub.3, also known as 2-O-(2-methoxyethyl)] (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other preferred modifications include 2-methoxy (2-O-CH.sub.3), 2-propoxy (2-OCH.sub.2 CH.sub.2CH.sub.3) and 2-fluoro (2-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3 position of the sugar on the 3 terminal nucleotide and the 5 position of 5 terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
[0282] Oligonucleotides and nucleic acids described herein can also include, additionally or alternatively, nucleobase (often referred to in the art simply as base) modifications or substitutions. In some embodiments, an oligonucleotide described herein includes at least one nucleobase that is not an unmodified or natural nucleobase. As used herein, unmodified or natural nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2 deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, isocytosine, pseudoisocytosine, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 5-propynyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine, 6-aminopurine, 2-aminopurine, 2-chloro-6-aminopurine and 2,6-diaminopurine or other diaminopurines. See, e.g., Kornberg, DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp 75-77; and Gebeyehu, G., et al. Nucl. Acids Res., 15:4513 (1987)). A universal base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 C. (Sanghvi, in Crooke, and Lebleu, eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and may be used as base substitutions.
[0283] In some embodiments, both a sugar and an internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with modified groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.
[0284] Oligonucleotides and nucleic acids can also include one or more nucleobase (often referred to in the art simply as base) modifications or substitutions. As used herein, unmodified or natural nucleobases comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases comprise other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
[0285] Further, nucleobases comprise those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia of Polymer Science And Engineering, pages 858-859, Kroschwitz, ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandle Chemie, International Edition, 1991, 30, page 613, and those disclosed by Sanghvi, Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, and Lebleu, eds., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligonucleotides described herein. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 C. (Sanghvi, et al., eds, Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2-O-methoxyethyl sugar modifications. Modified nucleobases are described in U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,750,692, and 5,681,941, each of which is herein incorporated by reference.
[0286] In some embodiments, the oligonucleotides or nucleic acids are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. For example, one or more oligonucleotides, of the same or different types, can be conjugated to each other; or oligonucleotides can be conjugated to targeting moieties with enhanced specificity for a cell type or tissue type. Such moieties include, but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al, Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937). See also U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference. Additional targeting moieties are discussed in more detail herein.
[0287] These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the disclosure include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this disclosure, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this disclosure, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present disclosure. Representative conjugate groups are disclosed in International Patent Application No. PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, which are incorporated herein by reference. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.
[0288] In some embodiments, oligonucleotide or nucleic acid modification includes modification of the 5 or 3 end of the oligonucleotide or nucleic acid. In some embodiments, the 3 end of the oligonucleotide or nucleic acid comprises a hydroxyl group or a thiophosphate. It should be appreciated that additional molecules (e.g. a biotin moiety or a fluorophor) can be conjugated to the 5 or 3 end of the oligonucleotide or nucleic acid. In some embodiments, the oligonucleotide or nucleic acid comprises a biotin moiety conjugated to the 5 nucleotide.
[0289] In some embodiments, the oligonucleotide or nucleic acid comprises locked nucleic acids (LNA), ENA modified nucleotides, 2-O-methyl nucleotides, or 2-fluoro-deoxyribonucleotides. In some embodiments, the oligonucleotide comprises alternating deoxyribonucleotides and 2-fluoro-deoxyribonucleotides. In some embodiments, the oligonucleotide or nucleic acid comprises alternating deoxyribonucleotides and 2-O-methyl nucleotides. In some embodiments, the oligonucleotide or nucleic acid comprises alternating deoxyribonucleotides and ENA modified nucleotides. In some embodiments, the oligonucleotide or nucleic acid comprises alternating deoxyribonucleotides and locked nucleic acid nucleotides. In some embodiments, the oligonucleotide or nucleic acid comprises alternating locked nucleic acid nucleotides and 2-O-methyl nucleotides. In some embodiments, the oligonucleotide or nucleic acid comprises locked nucleic acid nucleotides flanked by 2-O-methyl nucleotides on the 5 and/or 3 end.
[0290] In some embodiments, the 5 nucleotide of the oligonucleotide or nucleic acid is a deoxyribonucleotide. In some embodiments, the 5 nucleotide of the oligonucleotide or nucleic acid is a locked nucleic acid nucleotide. In some embodiments, the nucleotides of the oligonucleotide or nucleic acid comprise deoxyribonucleotides flanked by at least one locked nucleic acid nucleotide on each of the 5 and 3 ends of the deoxyribonucleotides. In some embodiments, the nucleotide at the 3 position of the oligonucleotide or nucleic acid has a 3 hydroxyl group or a 3 thiophosphate.
[0291] In some embodiments, the oligonucleotide or nucleic acid comprises phosphorothioate internucleoside linkages. In some embodiments, the oligonucleotide or nucleic acid comprises phosphorothioate internucleoside linkages between at least two nucleotides. In some embodiments, the oligonucleotide or nucleic acid comprises phosphorothioate internucleoside linkages between all nucleotides.
[0292] It should be appreciated that the oligonucleotide or nucleic acid can have any combination of modifications as described herein.
Oligonucleotide Types
[0293] In some aspects, oligonucleotides described herein may be of a specific type or chemistry pattern such as a mixmer, a single stranded RNA, a single stranded DNA, an aptamer, or an oligonucleotide mimetic. In some embodiment, oligonucleotides described herein are not gapmers, siRNAs, ribozymes or microRNAs, or any other type of oligonucleotide that results in degradation of the target nucleic acid once delivered to a cell or tissue.
[0294] In some embodiments, an oligonucleotide described herein may be a mixmer or comprise a mixmer sequence pattern. The term mixmer refers to oligonucleotides which comprise both naturally and non-naturally occurring nucleotides or comprise two different types of non-naturally occurring nucleotides. Mixmers are generally known in the art to have a higher binding affinity than unmodified oligonucleotides and may be used to specifically bind a target molecule, e.g., to block a binding site on the target molecule. Generally, mixmers do not recruit an RNAse to the target molecule and thus do not promote cleavage of the target molecule.
[0295] In some embodiments, the mixmer comprises or consists of a repeating pattern of nucleotide analogues and naturally occurring nucleotides, or one type of nucleotide analogue and a second type of nucleotide analogue. However, it is to be understood that the mixmer need not comprise a repeating pattern and may instead comprise any arrangement of nucleotide analogues and naturally occurring nucleotides or any arrangement of one type of nucleotide analogue and a second type of nucleotide analogue. It is to be understood that a pattern, in general, refers to a pattern of modifications or lack thereof, and not to a pattern of A, T, C, G, or U nucleotides. The repeating pattern, may, for instance be every second or every third nucleotide is a nucleotide analogue, such as LNA, and the remaining nucleotides are naturally occurring nucleotides, such as DNA, or are a 2 substituted nucleotide analogue such as 2-O-methyl, 2MOE or 2 fluoro analogues, or any other nucleotide analogues described herein. It is recognized that the repeating pattern of nucleotide analogues, such as LNA units, or 2-O-methyl, 2MOE or 2 fluoro analogues, may be combined with nucleotide analogues at fixed positionse.g. at the 5 or 3 termini.
[0296] In some embodiments, the mixmer does not comprise a region of more than 5, more than 4, more than 3, or more than 2 consecutive naturally occurring nucleotides, such as DNA nucleotides. In some embodiments, the mixmer comprises at least a region consisting of at least two consecutive nucleotide analogues, such as at least two consecutive LNAs. In some embodiments, the mixmer comprises at least a region consisting of at least three consecutive nucleotide analogue units, such as at least three consecutive LNAs.
[0297] In some embodiments, the mixmer does not comprise a region of more than 7, more than 6, more than 5, more than 4, more than 3, or more than 2 consecutive nucleotide analogues, such as LNAs. It is to be understood that the LNA units may be replaced with other nucleotide analogues, such as those referred to herein.
[0298] In some embodiments, the mixmer contains a modified nucleotide, e.g., an LNA, at the 5 end. In some embodiments, the mixmer contains a modified nucleotide, e.g., an LNA, at the first two positions, counting from the 5 end.
[0299] In some embodiments, the mixmer is incapable of recruiting RNAseH. Oligonucleotides that are incapable of recruiting RNAseH are well known in the literature, in example see WO2007/112754, WO2007/112753, or PCT/DK2008/000344. Mixmers may be designed to comprise a mixture of affinity enhancing nucleotide analogues, such as in non-limiting example LNA nucleotides and 2-O-methyl nucleotides. In some embodiments, the mixmer comprises modified internucleoside linkages (e.g., phosphorothioate internucleoside linkages or other linkages) between at least two, at least three, at least four, at least five or more nucleotides.
[0300] In some embodiments, a mixmer is 4 to 40 nucleotides (e.g., 4 to 40, 4 to 35, 4 to 30, 4 to 25, 4 to 20, 4 to 15, 4 to 10, 5 to 40, 5 to 35, 5 to 30, 5 to 25, 5 to 20, 5 to 15, or 5 to 10), in length having the general formula:
(X.sub.p.sup.1X.sub.q.sup.2).sub.r, [0301] wherein each instance of X.sup.4 is a modified or unmodified nucleotide described herein (e.g., a modified or unmodified ribonucleotide described herein), wherein each instance of X.sup.5 is a deoxyribonucleotide, wherein p and q are independently 0 or 1, reflecting the number of instances of X.sup.1 and X.sup.2, respectively, wherein at least one of X.sup.1 and X.sup.2 is present in each instance of the unit, (X.sub.p.sup.1X.sub.q.sup.2), wherein r is an integer from 2 to 20 reflecting the number of instances of the unit, (X.sub.p.sup.1X.sub.q.sup.2), linked together through internucleotide linkages, wherein the protecting oligonucleotide or region does not contain a sequence of more than 5 consecutive deoxyribonucleotides, and wherein the symbol - denotes an internucleotide linkage.
[0302] A mixmer may be produced using any method known in the art or described herein. Representative U.S. patents, U.S. patent publications, and PCT publications that teach the preparation of mixmers include U.S. patent publication Nos. US2006/0128646, US2009/0209748, U52009/0298916, U52011/0077288, and U52012/0322851, and U.S. Pat. No. 7,687,617.
[0303] In some embodiments, the oligonucleotide is an oligonucleotide mimetic, such as a morpholino-based oligomeric compound, a cyclohexenyl nucleic acid oligonucleotide mimetics, or peptide nucleic acid (PNA) compound. In some embodiments, the oligonucleotide is a morpholino. Morpholinos are described, e.g., in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991.
Producing Candidate Oligonucleotides
[0304] In some embodiments, methods are provided for producing candidate oligonucleotides that may be useful for facilitating delivery of nucleic acid as described herein. Generally, the oligonucleotides contain a region of complementarity (e.g., at least 5 nucleotides) that is complementary to a target sequence within a nucleic acid (e.g., a synthetic mRNA) as described herein.
[0305] In some embodiments, the oligonucleotides are designed by determining a region of a target sequence; producing an oligonucleotide that has a region of complementarity that is complementary with a plurality of (e.g., at least 5) contiguous nucleotides of the region of the target sequence; and determining whether associating the oligonucleotide with a nucleic acid (e.g., a synthetic mRNA) as described herein facilitates or enhances delivery of the nucleic acid to a cell or tissue, e.g., a liver cell or liver tissue.
[0306] In some embodiments, methods are provided for obtaining one or more oligonucleotides for facilitating delivery of a nucleic acid (e.g., a synthetic mRNA) as described herein that further involve producing a plurality of different oligonucleotides, in which each oligonucleotide has a region of complementarity that is complementary with a plurality of (e.g., at least 5) contiguous nucleotides in one or more target sequences in the nucleic acid (e.g., a synthetic mRNA); covalently linking a targeting moiety (e.g., a GalNAc moiety) to the oligonucleotide and subjecting each of the different oligonucleotides to an assay that assesses whether use of one or more oligonucleotides from the plurality facilitates or enhances delivery of a nucleic acid (e.g., synthetic mRNA) when the one or more oligonucleotides are associated with the nucleic acid; and obtaining one or more oligonucleotides that facilitate or enhance delivery of the nucleic acid in the assay.
Methods for Delivery to Subjects
[0307] Other aspects of the disclosure relate to methods of treating a disease or condition in a subject (e.g. a human) by administering a complex, composition or pharmaceutical preparation comprising an oligonucleotide and a nucleic acid (e.g., a synthetic mRNA) as described herein to the subject. In some embodiments, the disease or condition is a neurological condition, autoimmune disease, inflammatory disease, liver disease, proliferative disease, ocular condition, cardiovascular disease, metabolic condition, or hematological disease.
[0308] Other aspects of the disclosure relate to method of modulating (e.g., increasing or decreasing) gene expression in a subject (e.g. a human) by administering a complex, composition or pharmaceutical preparation comprising an oligonucleotide and a nucleic acid (e.g., a synthetic mRNA) as described herein to the subject. In some embodiments, methods comprise administering to a subject (e.g. a human) a complex, composition or pharmaceutical preparation comprising an oligonucleotide and a nucleic acid (e.g., a synthetic mRNA) as described herein to increase mRNA and/or protein levels of a target gene in the subject. In some embodiments, the target gene is a gene encoding a protein that is endogenously found in the subject and/or endogenously found in a healthy subject. In some embodiments, the target gene is synthetic and encodes a protein that is not endogenously found in the subject (e.g., a fusion protein or other synthetic protein). In some embodiments, the increase in mRNA and/or protein levels is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, or more, higher than the amount of a mRNA and/or protein in the subject before administering.
[0309] In some embodiments, the methods involve treating a disease associated with decreased levels of expression or activity of a target gene in a subject, the method comprising administering a complex, composition or pharmaceutical preparation comprising an oligonucleotide and a nucleic acid (e.g., a synthetic mRNA) as described herein. In some embodiments, the disease is ornithine transcarbamylase (OTC) deficiency and the method comprises administering a complex, composition or pharmaceutical preparation comprising an oligonucleotide as described herein and a synthetic mRNA that encodes a OTC protein.
[0310] A subject can include a non-human mammal, e.g. mouse, rat, guinea pig, rabbit, cat, dog, goat, cow, or horse. In preferred embodiments, a subject is a human. In certain embodiments, the non-human animal is a mammal (e.g., primate (e.g., cynomolgus monkey or rhesus monkey), commercially relevant mammal (e.g., cattle, pig, horse, sheep, goat, cat, or dog), or bird (e.g., commercially relevant bird, such as chicken, duck, goose, or turkey)). Oligonucleotides and other nucleic acids such as synthetic mRNAs have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Oligonucleotides and other nucleic acids such as synthetic mRNAs can be useful therapeutic modalities that can be configured to be useful in treatment regimens for the treatment of cells, tissues and animals, especially humans.
Route of Delivery
[0311] The oligonucleotides and compositions described herein can be delivered to a subject by a variety of routes. Exemplary routes include: intrathecal, intraneural, intracerebral, intramuscular, oral, intravenous, intradermal, topical, rectal, parenteral, anal, intravaginal, intranasal, pulmonary, or ocular. In some embodiments, oligonucleotides and compositions described herein are delivered subcutaneously to a subject as described herein. The term therapeutically effective amount is the amount of active agent(s) (e.g., oligonucleotide and a nucleic acid as described herein) present in the composition that is needed to provide the desired level of gene expression in a cell or to provide a treatment effect in the subject to be treated, e.g., treatment of OTC deficiency. The term physiologically effective amount is that amount delivered to a subject to give the desired palliative or curative effect. The term pharmaceutically acceptable carrier means that the carrier can be administered to a subject with no significant adverse toxicological effects to the subject.
[0312] The oligonucleotides and nucleic acids and related complexes as described herein can be incorporated into pharmaceutical compositions (also referred to herein as a pharmaceutical preparation) suitable for administration. The terms preparation, composition and formulation are used interchangeably herein. Such compositions typically include one or more species of oligonucleotide, one or more species of nucleic acid, and a pharmaceutically acceptable carrier. As used herein the language pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
[0313] The pharmaceutical compositions of the present disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration. The route and site of administration may be chosen to enhance targeting.
[0314] Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, intrathecal or intraventricular administration. In some embodiments, parental administration involves administration directly to the site of disease.
[0315] Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir. For intravenous use, the total concentration of solutes should be controlled to render the preparation isotonic.
[0316] Pulmonary delivery compositions can be delivered by inhalation by the patient of a dispersion so that the composition, preferably oligonucleotides, within the dispersion can reach the lung where it can be readily absorbed through the alveolar region directly into blood circulation. Pulmonary delivery can be effective both for systemic delivery and for localized delivery to treat diseases of the lungs.
[0317] The types of pharmaceutical excipients that are useful as carrier include stabilizers such as human serum albumin (HSA), bulking agents such as carbohydrates, amino acids and polypeptides; pH adjusters or buffers; salts such as sodium chloride; and the like. These carriers may be in a crystalline or amorphous form or may be a mixture of the two.
[0318] Suitable pH adjusters or buffers include organic salts prepared from organic acids and bases, such as sodium citrate, sodium ascorbate, and the like; sodium citrate is preferred. Pulmonary administration of a micellar oligonucleotide formulation may be achieved through metered dose spray devices with propellants such as tetrafluoroethane, heptafluoroethane, dimethylfluoropropane, tetrafluoropropane, butane, isobutane, dimethyl ether and other non-CFC and CFC propellants.
[0319] Exemplary devices include devices which are introduced into the vasculature, e.g., devices inserted into the lumen of a vascular tissue, or which devices themselves form a part of the vasculature, including stents, catheters, heart valves, and other vascular devices. These devices, e.g., catheters or stents, can be placed in the vasculature of the lung, heart, or leg.
[0320] In some embodiments, an oligonucleotide and nucleic acid as described herein (e.g., in a complex) are delivered naked or unpackaged. In some embodiments, an oligonucleotide and nucleic acid as described herein (e.g., in a complex) are delivered with a carrier. Exemplary carriers include polymer based carriers, such as polyethyleneimine (PEI) and multi-domain-block polymers, lipid nanoparticles and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, both natural and synthetically-derived exosomes, natural, synthetic and semi-synthetic lamellar bodies, nanoparticulates, calcium phosphor-silicate nanoparticulates, calcium phosphate nanoparticulates, silicon dioxide nanoparticulates, nanocrystalline particulates, semiconductor nanoparticulates, dry powders, poly(D-arginine), nanodendrimers, starch-based delivery systems, micelles, emulsions, sol-gels, niosomes, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, peptide conjugates, small-molecule targeted conjugates, and other vectorial tags. Also contemplated is the use of bionanocapsules and other viral capsid proteins assemblies as a suitable carrier. (Hum. Gene Ther. 2008 September; 19(9):887-95).
[0321] In some embodiments, an oligonucleotide and nucleic acid as described herein (e.g., in a complex) is formulated with a nanoparticle, such as a lipid nanoparticle. In some embodiments, the oligonucleotide is contained within or attached to a nanoparticle. In some embodiments, the lipid nanoparticle includes: (a) one or more cationic lipids, (b) one or more non-cationic lipids, (c) one or more conjugated lipids that inhibits aggregation of particles, or a combination thereof. Exemplary nanoparticles suitable for use with oligonucleotides are disclosed in PCT application number PCT/US2016/058842.
Dosage
[0322] In one aspect, the disclosure features a method of administering an oligonucleotide and nucleic acid as described herein (e.g., in a complex or composition) to a cell or a subject. In some embodiments, the cell is in vivo, such as a liver cell in vivo. In some embodiments, the cell is in vitro, such as a liver cell in vitro. In some embodiments, the cell is ex vivo, such as an ex vivo liver cell.
[0323] For oligonucleotides, the defined amount delivered can be an amount effective to facilitate or enhance delivery of a nucleic acid (e.g., a synthetic mRNA) as described herein into a cell or a tissue, such as a liver cell or tissue. For a nucleic acid (e.g., a synthetic mRNA) as described herein, the defined amount delivered can be an amount effective to result in a biological effect in a cell or tissue, such as increasing levels of an mRNA and/or protein in a cell. For a composition as described herein, e.g., comprising a nucleic acid as described herein and an oligonucleotide as described herein, the defined amount delivered can be an amount to modulate target gene expression in a cell or subject or to treat or prevent a disease or condition is a subject, e.g., a disease or condition associated with or caused by a decreased level of expression of a target gene in a subject, such as OTC deficiency.
[0324] In some embodiments, the unit dose is administered or delivered daily. In some embodiments, less frequently than once a day, e.g., less than every 2, 4, 8 or 30 days. In some embodiments, a unit dose is administered once per month, once per two months, once per three months or once per four months. In another embodiment, the unit dose is not administered or delivered with a frequency (e.g., not a regular frequency). For example, the unit dose may be administered or delivered a single time. In some embodiments, the unit dose is administered or delivered more than once a day, e.g., once an hour, two hours, four hours, eight hours, twelve hours, etc. Further, the treatment regimen may last for a period of time which will vary depending upon the nature of the particular disease, its severity and the overall condition of the patient. Following treatment, the subject can be monitored for changes in his condition and for alleviation of the symptoms of the disease state. The dosage may either be increased in the event the subject does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disease state is observed, if the disease state has been ablated, or if undesired side-effects are observed.
[0325] The effective dose can be administered in a single dose or in two or more doses, as desired or considered appropriate under the specific circumstances. If desired to facilitate repeated or frequent infusions, implantation of a delivery device, e.g., a pump, semi-permanent stent (e.g., intravenous, intraperitoneal, intracisternal or intracapsular), or reservoir may be advisable.
[0326] Certain factors may influence the dosage required to effectively treat a subject, including but not limited to the severity of the disease or condition, previous treatments, the general health and/or age of the subject, and other diseases present. It will also be appreciated that the effective dosage may increase or decrease over the course of a particular treatment.
[0327] Optimum dosages may vary depending on the relative potency of individual compounds, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In one embodiment, the administration of a composition is parenteral, e.g. intravenous (e.g., as a bolus or as a diffusible infusion), intradermal, intraperitoneal, intramuscular, intrathecal, intraventricular, intracranial, subcutaneous, transmucosal, buccal, sublingual, endoscopic, rectal, oral, vaginal, topical, pulmonary, intranasal, urethral, ocular, intraneuronal, intrathecal, or intracerebral. Administration can be provided by the subject or by another person, e.g., a health care provider.
Kits
[0328] In certain aspects of the disclosure, kits are provided, comprising one or more containers housing a composition, complex, oligonucleotide and/or nucleic acid (e.g., synthetic mRNA) as described herein. In some embodiments, the composition is a pharmaceutical composition comprising an oligonucleotide and/or a nucleic acid (e.g., synthetic mRNA) as described herein and a pharmaceutically acceptable carrier. In some embodiments, the individual components of the pharmaceutical composition may be provided in one container. Alternatively, it may be desirable to provide the components of the pharmaceutical composition separately in two or more containers, e.g., one container for oligonucleotides, and at least another for a carrier compound. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition. The kit can also include a delivery device.
Chemical Definitions
[0329] Definitions of specific functional groups and chemical terms are described in more detail below.
[0330] Moieties described herein can comprise one or more asymmetric centers, and thus can exist in various stereoisomeric forms, e.g., enantiomers and/or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, E. L. Stereochemistry of Carbon Compounds (McGraw-Hill, N Y, 1962); and Wilen, S. H., Tables of Resolving Agents and Optical Resolutions, p. 268 (E. L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, Ind. 1972). The invention additionally encompasses compounds as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers. Unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms.
[0331] When a range of values is listed, it is intended to encompass each value and sub-range within the range. For example C.sub.1-6 alkyl is intended to encompass, C.sub.1, C.sub.2, C.sub.3, C.sub.4, C.sub.5, C.sub.6, C.sub.1-6, C.sub.1-5, C.sub.1-4, C.sub.1-3, C.sub.1-2, C.sub.2-6, C.sub.2-5, C.sub.2-4, C.sub.2-3, C.sub.3-6, C.sub.3-5, C.sub.3-4, C.sub.4-6, C.sub.4-5, and C.sub.5-6 alkyl.
[0332] The term aliphatic refers to alkyl, alkenyl, alkynyl, and carbocyclic groups. Likewise, the term heteroaliphatic refers to heteroalkyl, heteroalkenyl, heteroalkynyl, and heterocyclic groups.
[0333] The term alkyl refers to a radical of a straight-chain or branched saturated hydrocarbon group having from 1 to 10 carbon atoms (C.sub.1-10 alkyl). Examples of C.sub.1-6 alkyl groups include methyl (C.sub.1), ethyl (C.sub.2), propyl (C.sub.3) (e.g., n-propyl, isopropyl), butyl (C.sub.4) (e.g., n-butyl, tert-butyl, sec-butyl, iso-butyl), pentyl (C.sub.5) (e.g., n-pentyl, 3-pentanyl, amyl, neopentyl, 3-methyl-2-butanyl, tertiary amyl), and hexyl (C.sub.6) (e.g., n-hexyl). Additional examples of alkyl groups include n-heptyl (C.sub.7), n-octyl (C.sub.8), and the like. Unless otherwise specified, each instance of an alkyl group is independently unsubstituted (an unsubstituted alkyl) or substituted (a substituted alkyl) with one or more substituents (e.g., halogen, such as F).
[0334] The term haloalkyl is a substituted alkyl group, wherein one or more of the hydrogen atoms are independently replaced by a halogen, e.g., fluoro, bromo, chloro, or iodo. Examples of haloalkyl groups include CF.sub.3, CF.sub.2CF.sub.3, CF.sub.2CF.sub.2CF.sub.3, CCl.sub.3, CFCl.sub.2, CF.sub.2Cl, and the like.
[0335] The term heteroalkyl refers to an alkyl group, which further includes at least one heteroatom (e.g., 1, 2, 3, or 4 heteroatoms) selected from oxygen, nitrogen, or sulfur within (i.e., inserted between adjacent carbon atoms of) and/or placed at one or more terminal position(s) of the parent chain.
[0336] The term alkenyl refers to a radical of a straight-chain or branched hydrocarbon group having from 2 to 10 carbon atoms and one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 double bonds). Examples of C.sub.2-6 alkenyl groups include the aforementioned C.sub.2-4 alkenyl groups as well as pentenyl (C.sub.5), pentadienyl (C.sub.5), hexenyl (C.sub.6), and the like. Additional examples of alkenyl include heptenyl (C.sub.7), octenyl (C.sub.8), octatrienyl (C.sub.8), and the like.
[0337] The term heteroalkenyl refers to an alkenyl group, which further includes at least one heteroatom (e.g., 1, 2, 3, or 4 heteroatoms) selected from oxygen, nitrogen, or sulfur within (i.e., inserted between adjacent carbon atoms of) and/or placed at one or more terminal position(s) of the parent chain.
[0338] The term alkynyl refers to a radical of a straight-chain or branched hydrocarbon group having from 2 to 10 carbon atoms and one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 triple bonds) (C.sub.2-10 alkynyl).
[0339] The term heteroalkynyl refers to an alkynyl group, which further includes at least one heteroatom (e.g., 1, 2, 3, or 4 heteroatoms) selected from oxygen, nitrogen, or sulfur within (i.e., inserted between adjacent carbon atoms of) and/or placed at one or more terminal position(s) of the parent chain.
[0340] The term carbocyclyl or carbocyclic refers to a radical of a non-aromatic cyclic hydrocarbon group having from 3 to 14 ring carbon atoms (C.sub.3-14 carbocyclyl) and zero heteroatoms in the non-aromatic ring system.
[0341] In some embodiments, carbocyclyl is a monocyclic, saturated carbocyclyl group having from 3 to 14 ring carbon atoms (C.sub.3-14 cycloalkyl).
[0342] The term heterocyclyl or heterocyclic refers to a radical of a 3- to 14-membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (3-14 membered heterocyclyl).
[0343] In some embodiments, a heterocyclyl group is a 5-10 membered non-aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (5-10 membered heterocyclyl).
[0344] The term aryl refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 electrons shared in a cyclic array) having 6-14 ring carbon atoms and zero heteroatoms provided in the aromatic ring system (C.sub.6-14 aryl). The term heteroaryl refers to a radical of a 5-14 membered monocyclic or polycyclic (e.g., bicyclic, tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 electrons shared in a cyclic array) having ring carbon atoms and 1-4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (5-14 membered heteroaryl).
[0345] Affixing the suffix -ene to a group indicates the group is a divalent moiety, e.g., alkylene is the divalent moiety of alkyl, alkenylene is the divalent moiety of alkenyl, alkynylene is the divalent moiety of alkynyl, heteroalkylene is the divalent moiety of heteroalkyl, heteroalkenylene is the divalent moiety of heteroalkenyl, heteroalkynylene is the divalent moiety of heteroalkynyl, carbocyclylene is the divalent moiety of carbocyclyl, heterocyclylene is the divalent moiety of heterocyclyl, arylene is the divalent moiety of aryl, and heteroarylene is the divalent moiety of heteroaryl.
[0346] A group is optionally substituted unless expressly provided otherwise. The term optionally substituted refers to being substituted or unsubstituted. In certain embodiments, alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl groups are optionally substituted.
[0347] The term hydroxyl or hydroxy refers to the group OH. The term substituted hydroxyl or substituted hydroxyl, by extension, refers to a hydroxyl group wherein the oxygen atom directly attached to the parent molecule is substituted with a group other than hydrogen.
[0348] The term amino refers to the group NH.sub.2. The term substituted amino, by extension, refers to a monosubstituted amino, a disubstituted amino, or a trisubstituted amino.
[0349] In certain embodiments, the substituted amino is a monosubstituted amino or a disubstituted amino group. An amine group can be an amino or substituted amino group.
[0350] The term sulfinyl refers to the group S(O)R.sup.aa, wherein R.sup.aa is as defined herein.
[0351] The term acyl refers to a group having the general formula C(O)R.sup.X1, C(O)OR.sup.X1, C(O)OC(O)R.sup.X1, C(O)SR.sup.X1, C(O)N(R.sup.X1).sub.2, C(S)R.sup.X1, C(S)N(R.sup.x1).sub.2, and C(S)S(R.sup.X1), C(NR.sup.X1)R.sup.X1, C(NR.sup.X1)OR.sup.X1, C(NR.sup.X1)SR.sup.X1, and C(NR.sup.X1)N(R.sup.X1).sub.2, wherein R.sup.X1 is hydrogen; halogen; substituted or unsubstituted hydroxyl; substituted or unsubstituted thiol; substituted or unsubstituted amino; substituted or unsubstituted acyl, cyclic or acyclic, substituted or unsubstituted, branched or unbranched aliphatic; cyclic or acyclic, substituted or unsubstituted, branched or unbranched heteroaliphatic; cyclic or acyclic, substituted or unsubstituted, branched or unbranched alkyl; cyclic or acyclic, substituted or unsubstituted, branched or unbranched alkenyl; substituted or unsubstituted alkynyl; substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, aliphaticoxy, heteroaliphaticoxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy, aliphaticthioxy, heteroaliphaticthioxy, alkylthioxy, heteroalkylthioxy, arylthioxy, heteroarylthioxy, mono- or di-aliphaticamino, mono- or di-heteroaliphaticamino, mono- or di-alkylamino, mono- or di-heteroalkylamino, mono- or di-arylamino, or mono- or di-heteroarylamino; or two R.sup.X1 groups taken together form a 5- to 6-membered heterocyclic ring. Exemplary acyl groups include aldehydes (CHO), carboxylic acids (CO.sub.2H), ketones, acyl halides, esters, amides, imines, carbonates, carbamates, and ureas.
[0352] The term carbonyl refers a group wherein the carbon directly attached to the parent molecule is sp.sup.2 hybridized, and is substituted with an oxygen, nitrogen or sulfur atom.
[0353] Nitrogen atoms can be substituted or unsubstituted as valency permits, and include primary, secondary, tertiary, and quaternary nitrogen atoms.
[0354] Whereas the compounds and compositions described herein are represented with formulae depicting a formal negative charge, it is understood that said compounds and compositions further comprises a suitable cationic counterion such that the net charge of compound or composition is zero. Suitable cationic counterions are known in the art and include, for example, hydronium (H.sub.30O.sup.+), sodium, potassium, calcium, magnesium, ammonium and the like.
[0355] In certain embodiments, the substituent present on the nitrogen atom is an nitrogen protecting group (also referred to herein as an amino protecting group). Nitrogen protecting groups are well known in the art and include those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3.sup.rd edition, John Wiley & Sons, 1999, incorporated herein by reference. Nitrogen protecting groups include, but are not limited to, amide, carbamate, and sulfonamide groups. A nitrogen protecting group may be an acyl group, as defined herein. In certain embodiments, the substituent present on an oxygen atom is an oxygen protecting group (also referred to herein as an hydroxyl protecting group). Oxygen protecting groups are well known in the art and include those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3.sup.rd edition, John Wiley & Sons, 1999, incorporated herein by reference. A hydroxyl protecting group may be an acyl group, as defined herein. As used herein, use of the phrase at least one instance refers to 1, 2, 3, 4, or more instances, but also encompasses a range, e.g., for example, from 1 to 4, from 1 to 3, from 1 to 2, from 2 to 4, from 2 to 3, or from 3 to 4 instances, inclusive.
[0356] The invention is not intended to be limited in any manner by the above exemplary listing of substituents.
[0357] The present invention is further illustrated by the following Examples, which in no way should be construed as further limiting.
EXAMPLES
Example 1: Synthesis of N-Acetylgalactosamine (GalNAc)-Conjugated Oligonucleotides Synthesis of Trivalent GalNAc-Conjugated RaNA-Oligonucleotides
[0358] ##STR00110##
Synthesis of acetylated GalNAc [2]
[0359] See, e.g., Guo, et. al. Bioconjug. Chem. 2006, 17, 1537-1544. GalNAc (10 g, 45.2 mmol) was dissolved in pyridine (100 mL). DMAP (1.4 g, 11.3 mmol) was added in it. Acetic anhydride (46.2 mL, 452 mmol) was added into the reaction mixture and stirred for next three hours. Reaction was completed within three hours based on TLC. After completion of reaction the crude mixture was evaporated off to dryness and purified via column chromatography (0-100% Ethyl acetate in Pet ether). The product comes at 100% Ethyl acetate. Pure product (17 g, 97%) was isolated as white foam and characterized based on Mass analysis. Results: ESI-MS analysis: Calculated C.sub.16H.sub.23NO.sub.10. Na.sup.+, [M+Na.sup.+]=412.13, Observed=412.12.
Synthesis of Oxazoline [3]
[0360] See, e.g., Guo, et. al. Bioconjug. Chem. 2006, 17, 1537-1544; Manoharan, et. al. J. Am. Chem. Soc. 2014, 136, 16958-16961. Compound 2 (17 g, 43.7 mmol) was dissolved in anhydrous acetonitrile (100 mL). 4 molecular sieves were added in to the reaction mixture to keep it under complete anhydrous condition. Reaction mixture was cooled to zero degree and TMSOTf (11.84 mL, 65.5 mmol) was added in it. Reaction was then slowly warmed up to room temperature and then heated to 65 C. over night. After completion of reaction, triethylamine (17 mL) was added to quench the reaction. Molecular sieves were filtered off and the reaction mixture was evaporated off to dryness. It was then diluted with ethyl acetate (250 mL). Organic layer was washed with sodium bicarbonate (3100 mL) and with brine solution (2100 mL). Organic layer was dried over anhydrous sodium sulfate and evaporated off to obtain a crude product (12.6 g) as brown color foam. MS analysis confirmed the formation of desired oxazoline derivative 3. The crude mixture was taken into the next step without further purification. Results: ESI-MS analysis: Calculated C.sub.14H.sub.19NO.sub.8, [M+H]=329.10, Observed=329.0.
Synthesis of [4]
[0361] See, e.g., Guo, et. al. Bioconjug. Chem. 2006, 17, 1537-1544; Manoharan, et. al. J. Am. Chem. Soc. 2014, 136, 16958-16961. Compound 3 (9.0 g, 27.3 mol) was co-evaporated with 1,2-dichloroethane (350 mL) and then re-dissolved in to the same solvent (250 mL). Reaction mixture was then stirred with 4 molecular sieves (2 g) for 5 min at room temperature. Azido-dPEG4-OH (6.59 g, 30.1 mmol) was added and stirring was continued for 30 min. TMS-triflate (2.5 mL, 13.7 mmol) was added drop-wise under constant stirring over 10 min. Stirring was continued over night at 45 C. followed by quenching with saturated NaHCO.sub.3 solution (100 mL). The organic layer was separated, diluted with dichloromethane 200 mL, and washed with water (2100 mL) and brine (2100 mL) solution. Finally, the organic layer was dried over anhydrous Na.sub.2SO.sub.4, and evaporated to dryness under reduced pressure. The crude product was purified via column chromatography (1-2% methanol in dichloromethane). Pure product 4 (10.5 g, 70%) was isolated as light yellow oil and characterized based on Mass and .sup.1HNMR analysis. Results: ESI-MS analysis: Calculated C.sub.22H.sub.36N.sub.4O.sub.12. Na.sup.+, [M+Na.sup.+]=571.22, Observed=571.20.
Synthesis of [5]
[0362] To a stirred solution of compound 4 (2.3 g, 41.9 mmol) in dichloromethane (50 mL), polymer bound triphenylphosphine (6.60 g, 83.9 mmol, loading 3 mmol/g) was added at room temperature and stirred for 2 h. Water (2.3 mL, 126 mmol) was added into the reaction mixture and continued for another 3 h at room temperature. After completion of reaction the crude mixture was filtered off and evaporated to complete dryness under high vacuum to obtain compound 5 (1.9 g, 87%) as a pale yellow sticky solid. Compound 5 was taken to the next step almost immediately without further purification. Compound 5 was characterized based on mass analysis. Results: ESI-MS analysis: Calculated C.sub.22H.sub.39N.sub.2O.sub.12, [M+H]=523.25, Observed=523.20.
##STR00111##
Synthesis of [7]
[0363] See, e.g., Biessen, et. al. J. Med. Chem. 1999, 42, 609-618. HBTU (7.95 g, 7.0 mmol) was added to a mixture of azido hexanoicacid (3.0 g, 19.1 mmol) and compound 6 (8.82 g, 7.0 mmol) in anhydrous dichloromethane (150 mL) under argon atmosphere at room temperature. DIPEA (13.2 mL, 25.5 mmol) was added in to the reaction mixture slowly and dropwise. Reaction was completed within six hours based on TLC. After the completion of reaction, crude mixture was evaporated off and diluted with ethylacetate (200 mL). Organic layer was washed with water (250 mL), brine solution (250 mL) and then dried over anhydrous sodium sulphate. Organic layer was further evaporated to dryness and purified via column chromatography (0-100% Ethyl acetate in Pet ether). The product comes at 30-50% ethyl acetate. Pure product 7 (10 g, 94%) was isolated as a colorless liquid and characterized based on NMR and Mass analysis. Results: ESI-MS analysis: Calculated C.sub.25H.sub.44N.sub.4O.sub.10. Na.sup.+, [M+Na.sup.+]=583.30, Observed=583.30.
Synthesis of [8]
[0364] See, e.g., Biessen, et. al. J. Med. Chem. 1999, 42, 609-618. Compound 7 (3.4 g, 6.07 mmol) was dissolved in a mixture (3:1) of doxane (150 mL) and water (50 mL) at room temperature. Aqueous sodium hydroxide (4M, 12 mL) was added into the reaction mixture and continued overnight at same temperature. Reaction mixture was neutralized and acidified further with excess acetic acid and extracted with ethyl acetate (5100 mL). Combined organic layer was dried over sodium sulfate and evaporated to dryness to obtain compound 8 (2.2 g, 76%) as a colorless oil. Formation of compound 8 was confirmed based on MS analysis. Results: ESI-MS analysis: Calculated C.sub.19H.sub.31N.sub.4O.sub.10, [MH]=475.20, Observed=475.10
##STR00112##
Synthesis of [9]
[0365] See, e.g., Manoharan, et. al. J. Am. Chem. Soc. 2014, 136, 16958-16961. To a solution of compound 8 (0.5 g, 1.05 mmol) and 5 (2.74 g, 5.25 mmol) in DMF (30 mL) were added HOBt (0.57 g, 4.20 mmol) and HBTU (1.99 g, 5.25 mmol) followed by slow addition of DIEA (1.83 mL, 10.5 mmol). The reaction was stirred overnight at room temperature and diluted with water. The mixture was extracted with ethyl acetate (2100 mL). The water phase was separated, extracted with DCM (4100 mL); and the combined organic layers were washed consecutively with saturated NaHCO.sub.3 (250 mL), water (250 mL), and brine (50 mL). After drying over anhydrous Na.sub.2SO.sub.4, the solvent was evaporated under reduced pressure, and the residue was purified by silica gel chromatography (eluent: 10-15% MeOH in DCM) to obtain the compound 9 as a pale yellow foam (1.3 g, 62%). Isolation of pure trivalent GalNAc compound 9 was confirmed based on MS and NMR analysis. Results: ESI-MS analysis: Calculated C.sub.85H.sub.140N.sub.10O.sub.43.Na.sup.+, [M+Na.sup.+]=2011.89, Observed=2011.60.
Synthesis of [10]
[0366] Compound 9 (1.3 g, 0.65 mmol) was dissolved in methanolic ammonia (7M, 50 mL) in a sealed vial and left over night inside the oven at 56 C. Reaction mixture was then evaporated to dryness and washed with ether (310 mL) and left on a high vacuum pump to obtain pale yellow sticky solid compound 10 (1.1 g, 95%). Formation of pure compound 10 was confirmed based on mass and NMR analysis. Results: ESI-MS analysis: Calculated C.sub.67H.sub.122N.sub.10O.sub.34 Na.sup.+, [M+Na.sup.+]=1633.80, Observed=1633.60. .sup.1H NMR (DMSO-d.sub.6): 7.91-7.94 (m, 2H), 7.59-7.61 (m, 2H), 7.27 (s, 3H), 6.67 (s, 3H), 4.49-4.60 (m, 7H), 4.26-4.28 (m, 2H), 3.16-3.79 (m, 65H), 2.27-2.30 (m, 3H), 2.06-2.08 (m, 2H), 1.74-1.79 (m, 14H), 1.44-1.52 (m, 2H), 1.22-1.29 (m, 2H).
[0367] Synthesis of trivalent GalNAc conjugated oligonucleotides (at the 5-end of a fully phosphothioated oligonucleotides)
General Protocol
[0368] For a general scheme, see
[0369] 5-alkyne modified fully phosphothioated oligo nucleotides were synthesized using AKTA oligopilot 100 on a 245 M scale following standard solid phase oligo synthesis protocol. 5-hexyl-1-yl-cyanoethyl amidite was purchased from Glen Research Corporation, USA and was incorporated on to the 5-end of the oligonucleotides. Oligonucleotides were cleaved from the solid support using 30% aq. ammonium hydroxide (45 mL) at 56 C. overnight inside the oven. Crude oligonucleotide was purified via Hi Prep Q HP 16/10 column [with a solvent gradient 10-100% of eluent B, where, eluent A: 10 mM aq. NaOH and eluent B: aq. NaCl (2.5 M)+NaOH (10 mM)] and then desalted (via Sephadex G25) on an AKTA pure system. Finally, the mass and purity of purified oligonucleotides were identified using Agilent 6130 Quadrupole LC/MS system. 5-alkyne functionalized oligos were reacted with Trivalent GalNAc azides (GalNAc.sub.3-N.sub.3; e.g., compound 10) following click reaction conditions. See, e.g., Manoharan, et. al. Org. let. 2010, 12, 5410-5413; Manoharan, et. al. ACS Chem. Biol. 2015, 10, 1181-1187. Finally, trivalent GalNAc-conjugated oligos were purified, desalted using AKTA pure system and characterized by LCMS analysis.
Example 2: GalNAc Conjugation Increases Uptake of Oligonucleotides in the Liver and Decreases Kidney Excretion
Methods
Oligonucleotide Design
[0370] A single-stranded anti-miR122 oligonucleotide was designed to bind to and sterically inhibit miR122, a microRNA expressed in the liver that is involved in regulation of genes such as CD320 and AldoA and in the regulation of cholesterol levels. The sequence of the oligonucleotide was CCATTGTCACACTCC (SEQ ID NO: 1) with the following modification pattern: lnamCs;dCs;lnaAs;dTs;dTs;lnaGs;lnaTs;dCs;dAs;lnamCs;dAs;lnamCs;dTs;lnamCs;lnamC. The key for the modifications are shown in Table 1 below. The oligonucleotide was then conjugated to a trivalent GalNAc moiety as described in Example 1. The structure of the oligonucleotide conjugated to the GalNAc moiety is shown in
TABLE-US-00001 TABLE 1 A listing of nucleotides and nucleotide modifications Symbol Feature Description dAs adenosine DNA w/3 phosphorothioate dCs cytosine DNA w/3 phosphorothioate dGs guanosine DNA w/3 phosphorothioate dTs thymidine DNA w/3 phosphorothioate InaAs adenosine LNA w/3' phosphorothioate InamCs 5-methyl cytosine LNA w/3 phosphorothioate InaGs guanosine LNA w/3 phosphorothioate InaTs thymidine LNA w/3 phosphorothioate InaA adenosine LNA InamC 5-methyl cytosine LNA InaG guanosine LNA InaT thymidine LNA omeAs 2-O-methyl adenosine nucleotide w/3 phosphorothioate omeCs 2-O-methyl cytosine nucleotide w/3 phosphorothioate omeGs 2-O-methyl guanosine nucleotide w/3 phosphorothioate omeUs 2-O-methyl thymidine nucleotide w/3 phosphorothioate omeA 2-O-methyl adenosine nucleotide omeC 2-O-methyl cytosine nucleotide omeG 2-O-methyl guanosine nucleotide omeU 2-O-methyl uracil nucleotide
In Vivo Delivery of Oligonucleotides
[0371] 0.3 mg/kg, 1 mg/kg, 3 mg/kg, or 10 mg/kg of GalNAc-conjugated anti-miR122 oligonucleotide or unconjugated anti-miR122 oligonucleotide or an equivalent control volume of PBS was delivered subcutaneously to 8 week old male C57BL6 mice. The mice were then euthanized at day 6 after administration and both liver and kidney tissue was harvested from each animal.
Tissue Concentration
[0372] Mouse liver and kidney blank tissues were weighed, homogenized and digested by proteinase K, RNase and DNase at a tissue to nuclease buffer ratio of one to four. This digested matrix blank was used to build a calibration standard. Tissue study samples were digested the same way as the blank matrix, then extracted by phenol, chloroform and dried down and then re-extracted by solid phase extraction (SPE). Ions at m/z of 2459.4696, 1654.4873 and 1684.4877 were monitored for the GalNAc-conjugated anti-miR122 oligonucleotide, the unconjugated anti-miR122 oligonucleotide, and a control oligonucleotide analogue respectively on Agilent TOF 6230 mass-spectrometer. A reverse phase chromatographic condition was developed on a Thermo DNAPac RP column and the eluates from the SPE were analyzed by LC/MS instrumentation. The calibration standard curve ranged from 0.5 to 50.0 ug/g (0.1 to 10 ug/mL in homogenized matrix) in both matrices and a linear regression curve fitting model was used. The oligonucleotide analogue was utilized as internal standard for quantitation of the two oligonucleotides.
Expression Analysis
[0373] Levels of AldoA and CD320 mRNA were measured in liver tissue using qPCR. Briefly, a small piece (<100 mg) of liver from the left medial lobe of each animal was individually transferred into 0.7 mL Qiazol lysis reagent (Qiagen) for ALDOA and CD320 gene expression analysis. RNA was extracted from liver samples by a miReasy 96-kit (Qiagen) according to the manufacturer's instructions. RNA (400 ng total) was reverse transcribed using a high-capacity cDNA reverse transcription kit (Cat. 4368813, Life Technologies Inc.) according to the manufacturer's instructions at a total volume of 20 L. cDNA was diluted 1 to 4 with water, and 2 L were used for qPCR (in duplicate) with the TaqMan Universal Master Mix II, no UNG (Cat. 4440040, Life Technologies) using the Viia7 system (Life Technologies). Primer/probe sets specific for ALDOA and CD320 (Integrated DNA Technologies) were used in the qPCR. Gene expression analysis was performed as follows: The Ct (Cycle threshold) value output was translated to fold change using a standard delta-delta Ct method; that is, values were normalized to the house-keeping gene, GAPDH, and baseline (fold change=1) was set to expression from saline-treated animals using the mean of all saline-treated animals.
[0374] For total cholesterol measurements, serum was obtained by centrifuging whole blood samples collected in BD Microtainer Serum Separator tubes (Ref #365978, Becton, Dickinson and Company) for 10 minutes at 2000g. The serum was then analyzed on a Vet Axcel Clinical Chemistry Analyzer (Alfa Wasserman Diagnostic Technologies LLC.) using Cholesterol kit (#SA1010).
Results
[0375] A GalNAc-conjugated anti-miR122 oligonucleotide was assessed for the ability of the GalNAc moiety to increase uptake in liver in vivo as well as increase the in vivo activity of the oligonucleotide. Delivery in vivo of the GalNAc-conjugated version of the anti-miR122 oligonucleotide resulted in both increased liver uptake and decreased kidney excretion compared to the unconjugated version of the same oligonucleotide (
Example 3: Use of GalNAc-Conjugated Oligonucleotides as Carrier Molecules for Synthetic mRNAs
[0376] Without wishing to be bound by theory, it was hypothesized that GalNAc-conjugated oligonucleotides complementary to sequences on a modified or unmodified 3 UTR of a synthetic mRNA may act as carrier molecules for delivery of the synthetic mRNA to liver cells (
[0377] The OTC (ornithine transcarbamylase) mRNA was chosen as a model mRNA for testing because OTC activity in the liver is important for urea cycle function. Urea cycle disorders include OTC deficiency, which has an incidence of about 1 in 63,000 births in the United States and a mortality rate of about 11% (see, e.g., Summar et al. The incidence of urea cycle disorders. Mol. Genet. Metab. 2013). Loss of enzyme activity involved in the urea cycle, like OTC activity, results in build-up of ammonia, which can become highly toxic to the central nervous system, eventually leading to cerebral edema and neurological damage (see, e.g., Caldovic et al. Genotype-Phenotype Correlations in Ornithine Transcarbamylase Deficiency: A Mutation Update J. Genet. Genom. 2015).
[0378] The human ornithine transcarbamylase enzyme is expressed by the OTC gene in the liver and forms a homotrimer. There are at least 417 disease-causing mutations in the OTC gene that have been identified to date (see, e.g., Caldovic et al. Genotype-Phenotype Correlations in Ornithine Transcarbamylase Deficiency: A Mutation Update J. Genet. Genom. 2015). These disease-causing mutations include loss-of-function mutations, amino acid replacement mutations, and intronic mutations, which can result in a decrease or complete loss of OTC function in the liver and lead to OTC deficiency. OTC deficiency is an x-lined disease that occurs in two forms, a neonatal form, which affects approximately 30% of individuals and a delayed onset form which effects approximately 70% of individuals. The neonatal form is severe, occurs primarily in males, and has a 24% mortality rate. The neonatal form is characterized by extremely low or a complete loss of OTC enzymatic activity. The current treatment for the neonatal form is liver transplantation, which if done before six months of age is typically curative. The delayed onset form is generally milder, with onset of hyperammonemia dependent on stress triggers. The delayed onset form is typically characterized by retention of at least some OTC enzymatic activity.
[0379] In order to address OTC deficiency, synthetic mRNA sequences containing coding sequences for human OTC are designed with binding sites within the 3UTR for binding to GalNAc-conjugated oligonucleotides. Binding sites may be present within a naturally-occurring 3UTR, such as the human OTC 3UTR, or may be designed and included within a synthetic UTR sequence. For example, tiling may be used to identify binding sites present in the human OTC 3 UTR that are acceptable or optimal for oligonucleotide design (
Example 4: Synthetic OTC mRNA Construct with Naturally-Occurring UTR Sequence for Binding to GalNAc-Conjugated Oligonucleotides
[0380] A synthetic OTC mRNA sequence was designed to include a Kozak consensus sequence, a mouse leader peptide, human OTC exons 2 to 10 and the human OTC 3UTR (
TABLE-US-00002 FEATURES Location/Qualifier 5UTR 1...14 /note=Kozakconsensusseq mat_peptide 15...1076 /note=OTC exon 15...116 /note=MouseLeaderPeptide exon 117...1076 /note=huOTCExon2-10 CDS 1077...1106 /codon_start=1 /product=Myc(humanc-Myconcogene)epitopetag /note=Myc /translation=EQKLISEEDL CDS 1107...1130 /codon_start=1 /product=FLAG(R)epitopetag,followedbyan Enterokinasecleavagesite /note=FLAG /translation=DYKDDDDK misc_feature 1134...1243 /note=huOTC_3UTR misc_feature 1145...1164 /note=OligoBindSite#1 misc_feature 1165...1170 /note=6NSpacing misc_feature 1171...1190 /note=OligoBindSite#2 misc_feature 1191...1202 /note=12NSpacing misc_feature 1203...1222 /note=OligoBindSite#3 polyA_site 1244...1363 /note=PolyA (SEQIDNO:8) 1 gccgccgcgatcgcatgctgagcaacctgaggatcctgctgaacaacgccgccctgagga 61 agggccacaccagcgtggtgaggcacttctggtgcggcaagcccgtgcagagccaggtgc 121 agctgaagggccgtgaccttctcactctaaaaaactttaccggagaagaaattaaatata 181 tgctatggctatcagcagatctgaaatttaggataaaacagaaaggagagtatttgcctt 241 tattgcaagggaagtccttaggcatgatttttgagaaaagaagtactcgaacaagattgt 301 ctacagaaacaggctttgcacttctgggaggacatccttgttttcttaccacacaagata 361 ttcatttgggtgtgaatgaaagtctcacggacacggcccgtgtattgtctagcatggcag 421 atgcagtattggctcgagtgtataaacaatcagatttggacacccttgctaaagaagcat 481 ccatcccaattatcaatgggctgtcagatttgtaccatcctatccagatcctggctgatt 541 acctcacgctccaggaacactatagctctctgaaaggtcttaccctcagctggatcgggg 601 atgggaacaatatcctgcactccatcatgatgagcgcagcgaaattcggaatgcaccttc 661 aggcagctactccaaagggttatgagccggatgctagtgtaaccaagttggcagagcagt 721 atgccaaagagaatggtaccaagctgttgctgacaaatgatccattggaagcagcgcatg 781 gaggcaatgtattaattacagacacttggataagcatgggacaagaagaggagaagaaaa 841 agcggctccaggctttccaaggttaccaggttacaatgaagactgctaaagttgctgcct 901 ctgactggacatttttacactgcttgcccagaaagccagaagaagtggatgatgaagtct 961 tttattctcctcgatcactagtgttcccagaggcagaaaacagaaagtggacaatcatgg 1021 ctgtcatggtgtccctgctgacagattactcacctcagctccagaagcctaaatttgagc 1081 agaaactcatctcagaagaggatctggattacaaggatgacgacgataagtaatgttgtg 1141 ttacttgtcaagaaagaagcaatgttcttcagtaacagaatgagttggtttatggggaaa 1201 agagaagagaatctaaaaaataaacaaatccctaacacgtggtaaaaaaaaaaaaaaaaa 1261 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1321 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
[0381] Three oligonucleotide binding sites were chosen within the 3UTR sequence and single-stranded oligonucleotide sequences were designed to bind to those sites. The sites were chosen based on an in silico analysis of the 3UTR and the oligonucleotides were designed to avoid microRNA seed sequences present in the 3UTR. Oligonucleotide sequences for binding to these sites are shown below and are conjugated to GalNAc. The key for abbreviations of the chemistry of each oligonucleotide are provided in Table 1.
Oligo Sequences for Targeting Binding Site #1:
[0382]
TABLE-US-00003 Name Basesequence Oligonucleotidechemistrypattern Oligo41 CATTGCTTCTTTCTTG omeCs;lnaAs;lnaTs;dTs;lnaGs;dCs;lnaTs;dTs;lnamCs; ACAA(SEQIDNO:9) dTs;lnaTs;dTs;lnamCs;dTs;lnaTs;dGs;lnaAs;dCs;lnaAs; omeA Oligo42 CATUGCTUCUTUCUT omeCs;lnaAs;lnaTs;omeUs;lnaGs;omeCs;lnaTs;omeUs; GACAA(SEQIDNO: lnaCs;omeUs;lnaTs;omeUs;lnamCs;omeUs;lnaTs;omeGs; 10) lnaAs;omeCs;lnaAs;omeA
Oligo Sequences for Targeting Binding Site #2:
[0383]
TABLE-US-00004 Name Basesequence Oligonucleotidechemistrypattern Oligo43 AACCAACTCATTCTGT omeAs;lnaAs;lnamCs;dCs;lnaAs;dAs;lnaCs;dTs;lnaCs; TACU(SEQIDNO:11) dAs;lnaTs;dTs;lnaCs;dTs;lnaGs;dTs;lnaTs;dAs;lnamCs; omeU Oligo44 AACCAACUCATUCUG omeAs;lnaAs;lnamCs;omeCs;lnaAs;omeAs;lnamCs; UTACU(SEQIDNO: omeUs;lnamCs;omeAs;lnaTs;omeUs;lnamCs;omeUs; 12) lnaGs;omeUs;lnaTs;omeAs;lnamCs;omeU
[0384] Oligo Sequences for Targeting Binding Site #3:
TABLE-US-00005 Name Basesequence Oligonucleotidechemistrypattern Oligo45 UATTTTTTAGATTCTC omeUs;lnaAs;lnaTs;dTs;lnaTs;dTs;lnaTs;dTs;lnaAs;dGs; TTCU(SEQIDNO:13) lnaAs;dTs;lnaTs;dCs;lnaTs;dCs;lnaTs;dTs;lnamCs; omeU Oligo46 UATUTUTUAGAUTCT omeUs;lnaAs;lnaTs;omeUs;lnaTs;omeUs;lnaTs;omeUs; CTUCU(SEQIDNO:14) lnaAs;omeGs;lnaAs;omeUs;lnaTs;omeCs;lnaTs;omeCs; lnaTs;omeUs;lnamCs;omeU
Example 5: Synthetic OTC mRNA Construct with Synthetic UTR Sequence for Binding to GalNAc-Conjugated Oligonucleotides
[0385] A synthetic OTC mRNA sequence was designed to include a Kozak consensus sequence, a mouse leader peptide, human OTC exons 2 to 10, the Hba-a1 3UTR, and a synthetic UTR sequence with oligonucleotide binding sites (
TABLE-US-00006 FEATURES Location/Qualifiers 5UTR 1...14 /note=Kozakconsensusseq mat_peptide 15...1076 /note=OTC exon 15...116 /note=MouseLeaderPeptide exon 117...1076 /note=huOTCExon2-10 CDS 1077...1106 /codonstart=1 /product=Myc(humanc-Myconcogene)epitopetag /note=Myc /translation=EQKLISEEDL CDS 1107...1130 /codonstart=1 /product=FLAG(R)epitopetag,followedbyan enterokinasecleavagesite /note=FLAG /translation=DYKDDDDK misc_feature 1134...1226 /note=Hba-a13UTR polyA_site 1374...1493 /note=PolyA repeat_unit 1239...1253 /note=OligoBindingSite repeat_unit 1266...1280 /note=OligoBindingSite repeat_unit 1293...1307 /note=OligoBindingSite repeat_unit 1320...1334 /note=OligoBindingSite repeat_unit 1347...1361 /note=OligoBindingSite misc_feature 1227...1238 /note=12spacer misc_feature 1254...1265 /note=12spacer misc_feature 1281...1292 /note=12spacer misc_feature 1308...1319 /note=12spacer misc_feature 1335...1346 /note=12spacer misc_feature 1362...1373 /note=12spacer ORIGIN (SEQIDNO:15) 1 gccgccgcgatcgcatgctgagcaacctgaggatcctgctgaacaacgccgccctgagga 61 agggccacaccagcgtggtgaggcacttctggtgcggcaagcccgtgcagagccaggtgc 121 agctgaagggccgtgaccttctcactctaaaaaactttaccggagaagaaattaaatata 181 tgctatggctatcagcagatctgaaatttaggataaaacagaaaggagagtatttgcctt 241 tattgcaagggaagtccttaggcatgatttttgagaaaagaagtactcgaacaagattgt 301 ctacagaaacaggctttgcacttctgggaggacatccttgttttcttaccacacaagata 361 ttcatttgggtgtgaatgaaagtctcacggacacggcccgtgtattgtctagcatggcag 421 atgcagtattggctcgagtgtataaacaatcagatttggacacccttgctaaagaagcat 481 ccatcccaattatcaatgggctgtcagatttgtaccatcctatccagatcctggctgatt 541 acctcacgctccaggaacactatagctctctgaaaggtcttaccctcagctggatcgggg 601 atgggaacaatatcctgcactccatcatgatgagcgcagcgaaattcggaatgcaccttc 661 aggcagctactccaaagggttatgagccggatgctagtgtaaccaagttggcagagcagt 721 atgccaaagagaatggtaccaagctgttgctgacaaatgatccattggaagcagcgcatg 781 gaggcaatgtattaattacagacacttggataagcatgggacaagaagaggagaagaaaa 841 agcggctccaggctttccaaggttaccaggttacaatgaagactgctaaagttgctgcct 901 ctgactggacatttttacactgcttgcccagaaagccagaagaagtggatgatgaagtct 961 tttattctcctcgatcactagtgttcccagaggcagaaaacagaaagtggacaatcatgg 1021 ctgtcatggtgtccctgctgacagattactcacctcagctccagaagcctaaatttgagc 1081 agaaactcatctcagaagaggatctggattacaaggatgacgacgataagtaagctgcct 1141 tctgcggggcttgccttctggccatgcccttcttctctcccttgcacctgtacctcttgg 1201 tctttgaataaagcctgagtaggaagATTACGTTGCACGGAGTGTGACAATGGATTACGT 1261 TGCACGGAGTGTGACAATGGATTACGTTGCACGGAGTGTGACAATGGATTACGTTGCACG 1321 GAGTGTGACAATGGATTACGTTGCACGGAGTGTGACAATGGATTACGTTGCACaaaaaaa 1381 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1441 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
[0386] A portion of the miR-122 sequence (a portion of the sequence of the microRNA not of a miR-122 binding site as would normally be found in naturally-occurring UTRs) was used as the GalNAc-conjugated oligonucleotide binding site in the synthetic UTR. The binding site was repeated 5 times with a 12 nucleotide spacer between each binding site. A single-stranded anti-miR122 oligonucleotide was designed to bind to the site. The sequence of the oligonucleotide is shown below. The oligonucleotide was conjugated to a GalNAc moiety as described in Example 1 (
Oligo Sequence for miR-122 Sequence-Containing Binding Site
TABLE-US-00007 Oligonucleotide Name Basesequence chemistrypattern Oligo CCATTGTCACACTCC lnamCs;dCs;lnaAs;dTs;dTs; 28 (SEQIDNO:16) lnaGs;lnaTs;dCs;dAs;lnamCs; dAs;lnamCs;dTs;lnamCs;lnamC
Example 6: Assessment of Spacing and Number of Oligonucleotide Binding Sites in Synthetic mRNA Constructs
[0387] The spacing of the binding sites within a synthetic 3UTR is assessed for GalNAc-conjugated oligonucleotide binding efficacy and accessibility. The spacer sequence is designed to have a GC content of less than 40, a melting temperature (T.sub.m) of less than 60 degrees Celsius, and minimal RNA structure as predicted from an RNA folding algorithm (minimum free energy). The RNA folding algorithm was RNAfold (University of Vienna, rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi).
[0388] An in vitro translation system is used to generate the 3UTR containing five copies of a GalNAc-conjugated oligonucleotide binding site, with varying spacer lengths (3, 6, 12, or 24 nucleotide lengths per spacer) between each binding site (
[0389] Spacer lengths identified as having sufficient binding efficiency by RNA gel shift are then tested with a varying numbers of GalNAc-conjugated oligonucleotide binding sites to determine binding efficiency of different numbers of binding sites. An in vitro translation system is used to generate the 3UTR containing 1, 3, 5 or 7 copies of a GalNAc-conjugated oligonucleotide binding site with the spacer lengths. Each 3UTR binding site variant is contacted with different concentrations of GalNAc-conjugated oligonucleotide under annealing or non-annealing conditions and is analyzed by RNA gel analysis to assess binding efficiency as indicated by the magnitude of the shift of the 3UTR in the presence of the GalNAc-conjugated oligonucleotide.
Example 7: In Vitro Testing of Synthetic OTC mRNA Constructs
[0390] Synthetic OTC mRNA constructs such as those described in Examples 4 and 5 are assessed for their ability to express OTC protein in vitro. Constructs containing synthetic UTRs such as those described in Example 5 are compared to constructs lacking the synthetic UTR (
Example 8: In Vivo Testing of Synthetic OTC mRNA Constructs
[0391] Synthetic OTC mRNA constructs such as those described in Examples 4 and 5 are assessed for their ability to express OTC protein in the liver in vivo. Wild-type C57Bl/6 mice are given a single subcutaneous injection of the synthetic OTC mRNA constructs (either with or without GalNAc-conjugated oligonucleotides bound to the 3UTR of the construct). The mice are euthanized at day 2, day 3 or day 7 post injection and the amount of synthetic mRNA present and the level of OTC protein is measured in the liver tissue of each mouse (
[0392] Without further elaboration, it is believed that one skilled in the art can, based on the description provided herein, utilize the present invention to its fullest extent. The specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.
[0393] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0394] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
[0395] While several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and/or methods, if such features, systems, articles, materials, and/or methods are not mutually inconsistent, is included within the scope of the present invention.
[0396] The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
[0397] The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified unless clearly indicated to the contrary. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A without B (optionally including elements other than B); in another embodiment, to B without A (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0398] As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0399] As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B, or, equivalently at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0400] In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.
[0401] Use of ordinal terms such as first, second, third, etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements.