NOVEL PROMOTER AND METHOD FOR PRODUCING PURINE NUCLEOTIDE USING THE SAME

20210047665 ยท 2021-02-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure relates to a polynucleotide having a novel promoter activity, a composition for expressing a gene comprising the polynucleotide, a microorganism comprising the gene, and a method for preparing purine nucleotides using the microorganism.

    Claims

    1. A polynucleotide having an activity of a promoter, wherein, in the polynucleotide sequence of SEQ ID NO: 1, i) the 143rd nucleotide is substituted with thymine (T); ii) the 189th nucleotide is substituted with thymine (T); or iii) the 143rd nucleotide is substituted with thymine (T) and the 189th nucleotide is substituted with thymine (T).

    2. The polynucleotide according to claim 1, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

    3. A composition for gene expression comprising the polynucleotide of claim 1.

    4. A vector comprising a gene encoding the polynucleotide of claim 1 and a target protein.

    5. The vector according to claim 4, wherein the target protein is adenylosuccinate synthetase.

    6. A microorganism of the genus Corynebacterium comprising the vector of claim 4.

    7. A microorganism of the genus Corynebacterium comprising the gene encoding the polynucleotide of claim 1 and a target protein.

    8. The microorganism according to claim 7, wherein the target protein is adenylosuccinate synthetase.

    9. The microorganism according to claim 7, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis.

    10. A method for preparing purine nucleotides, comprising culturing the microorganism of the genus Corynebacterium according to claim 7 in a medium.

    11. The method according to claim 10, further comprising recovering purine nucleotides from the microorganism or cultured medium after culturing.

    12. (canceled)

    13. A microorganism of the genus Corynebacterium comprising the vector of claim 5.

    Description

    DETAILED DESCRIPTION

    [0067] Hereinafter, the present disclosure will be described in detail through exemplary embodiments. However, it will be apparent to those skilled in the art to which the present disclosure belongs that these exemplary embodiments are provided for the purpose of illustration only and are not intended to limit the scope of the present disclosure.

    Example 1: Preparation of Wild-Type Based IMP-Producing Strain

    [0068] A wild-type strain of the genus Corynebacterium cannot produce IMP at all or produce only a trace amount even if it is possible. Therefore, an IMP-producing strain was prepared based on the wild-type strain of Corynebacterium stationis ATCC6872. More specifically, a strain was prepared in which the activity of purF gene, which encodes phosphoribosylpyrophosphate amidotransferase, is enhanced and the activity of guaB, which encodes IMP is weakened.

    Example 1-1: Preparation of purF-Enhanced Strain

    [0069] To prepare a strain in which the start codon of purF gene is modified, an insertion vector containing the purF gene was first prepared. To clone the purF gene into an insertion vector, specifically, PCR was performed using the genomic DNA of Corynebacterium stationis ATCC6872 as a template and the primer sets of SEQ ID NOS: 6 and 7 and SEQ ID NOS: 8 and 9 for 30 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and extension at 72 C. for 2 min. PCR was performed again using two DNA fragments obtained by the above PCR as a template and the primer set of SEQ ID NOS: 6 and 9 for 30 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and extension at 72 C. for 2 min to obtain DNA fragments. The obtained DNA fragments were digested with restriction enzyme XbaI and cloned into the pDZ vector (Korean Patent No. 10-0924065 and International Patent Publication No. WO 2008-033001) digested with the same enzyme. The thus-prepared vector was named as pDZ-purF-gla.

    TABLE-US-00001 TABLE1 SEQIDNO Primer Sequence(5-3) 6 purFg1a-1 GCTCTAGACCACTCTAAGACGCGGCCACC 7 purFg1a-2 AAGTAGTGTTCACCATGACGCTGATTCTACTAAGTTT 8 purFg1a-3 AGTAGAATCAGCGTCATGGTGAACACTACTTTCCCCAG 9 purFg1a-4 GCTCTAGACTGTGCGCCCACGATATCCAG

    [0070] The recombinant vector pDZ-purF-gla was transformed into Corynebacterium stationis ATCC6872 by electroporation, and strains in which the vector was inserted into the chromosome by homologous recombination were selected on a medium containing 25 mg/L kanamycin. The selected primary strains were subjected to secondary crossover, and these selected strains were subjected to sequencing, and thereby the final strain into which the modification was introduced was selected. The strain was named as 6872-purF(gla) strain.

    Example 1-2: Preparation of guaB-Weakened Strain

    [0071] To prepare a strain in which the start codon of guaB gene is modified, an insertion vector containing the guaB gene was prepared. To clone the guaB gene into the insertion vector, specifically, PCR was performed using the genomic DNA of Corynebacterium stationis ATCC6872 as a template and the primer sets of SEQ ID NOS: 11 and 12 and SEQ ID NOS: 13 and 14. PCR was performed again using the PCR products obtained by the above PCR as a template and the primer set of SEQ ID NOS: 11 and 14 and the obtained DNA fragments were cloned as in Example 1-1. The thus-prepared vector was named as pDZ-guaB-alt. The vector was introduced into the 6872-purF(gla) in the same manner and the strain in which the above modification was introduced was finally selected. The finally selected strain producing IMP was named as CJI2330.

    TABLE-US-00002 TABLE2 SEQIDNO Primer Sequence(5-3) 11 guaBalt-1 GCTCTAGACTACGACAACACGGTGCCTAA 12 guaBalt-2 CACGATTTTCGGTCAATACGGGTCTTCTCCTTCGCAC 13 guaBalt-3 AGGAGAAGACCCGTATTGACCGAAAATCGTGTTTCT 14 guaBalt-4 GCTCTAGAATCGACAAGCAAGCCTGCACG

    Example 1-3: Fermentation Titer Test of CJI2330

    [0072] After dispensing a seed culture medium (2 mL) into test tubes (diameter: 18 mm), the tubes were autoclaved. Each of ATCC6872 and CJI2330 was inoculated and incubated at 30 C. for 24 hours with shaking and used as a seed culture. A fermentation medium was dispensed (29 mL each) into 250 mL shaking Erlenmeyer flasks and autoclaved at 121 C. for 15 min. The seed culture (2 mL) was inoculated to the medium and cultured for 3 days. Culture conditions were adjusted to 170 rpm, 30 C., and pH 7.5.

    [0073] After completion of the culture, the amount of IMP production was measured by HPLC (SHIMAZDU LC20A) and the culture results are as in Table 3 below. The following results suggest that CJI2330 has the ability to produce IMP.

    TABLE-US-00003 TABLE 3 Strain IMP (g/L) ATCC6872 0 CJI2330 0.50

    [0074] Seed culture medium: 1% glucose, 1% peptone, 1% meat extract, 1% yeast extract, 0.25% sodium chloride, 100 mg/L adenine, 100 mg/L guanine, pH 7.5

    [0075] Fermentation medium: 0.1% sodium glutamate, 1% ammonium chloride, 1.2% magnesium sulfate, 0.01% calcium chloride, 20 mg/L iron sulfate, 20 mg/L manganese sulfate, 20 mg/L zinc sulfate, 5 mg/L copper sulfate, 23 mg/L L-cysteine, 24 mg/L alanine, 8 mg/L nicotinic acid, 45 g/L biotin, 5 mg/L thiamine hydrochloride, 30 mg/L adenine, 1.9% phosphoric acid (85%), 2.55% glucose, 1.45% fructose

    Example 2: Discovery of Modification in which purA Promoter Activity is Weakened

    [0076] To weaken the expression of adenylosuccinate synthetase for the improvement of the purine nucleotide-producing ability, a variant library of purA gene encoding adenylosuccinate synthetase was prepared and attempts were made to discover promoter-weakened modification, in which the promoter activity was weakened, which increases the production of purine nucleotides.

    Example 2-1: Preparation of Vector Containing purA Promoter

    [0077] To prepare a variant library of purA promoter, a green fluorescent protein (GFP) expression vector containing the purA promoter of SEQ ID NO: 1 was first prepared. PCR was performed using the genomic DNA of Corynebacterium stationis ATCC6872 as a template and a primer set of SEQ ID NO: 15 and SEQ ID NO: 16 for 30 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and extension at 72 C. for 2 min. The obtained DNA fragments were digested with KpnI and EcoRV and cloned into the p117-gfp vector (Korean Patent Application Publication No. 10-0620092), which was already digested with the same restriction enzymes, and the thus-prepared vector was named as p117-PpurA-gfp.

    TABLE-US-00004 TABLE4 SEQIDNO Primer Sequence(5-3) 15 purApromoterF GGGGTACCGGCAAAATTGCCGCCGCAGCT 16 purApromoterR GGGATATCGGTTATTCACTTCCTAGATTT 17 purApromoterlibR TTATTTGTAGAGCTCATCCAT

    Example 2-2: Preparation of Variant Library of purA Promoter

    [0078] A variant library of purA gene was prepared based on the vector prepared in Example 2-1. The library was prepared using an error-prone PCR kit (Clontech Diversify PCR Random Mutagenesis Kit). Under conditions where modifications may occur, PCR was performed using a primer set of SEQ ID NOS: 15 and 17. Specifically, under conditions where 2 to 4 modifications may occur per 1,000 bp, pre-heating was performed at 94 C. for 30 seconds, followed by 25 cycles of a process of 94 C. for 30 seconds and 68 C. for 1 minute 30 seconds. A thus-obtained PCR product was subjected to PCR using a megaprimer (500 ng to 125 ng) for 25 cycles of a process of 95 C. for 50 seconds, 60 C. for 50 seconds, and 68 C. for 12 min, treated with DpnI, and transformed into E. coli DH5a and spread on an LB solid medium containing kanamycin (25 mg/L). After selecting 20 different kinds of transformed colonies, plasmids were obtained therefrom and subjected to sequencing analysis. As a result, it was confirmed that modifications were introduced at different sites at a frequency of 3.5 modifications/kb. About 10,000 transformed E. coli colonies were collected and their plasmids were extracted, and named as p117-PpurA-gfp-library.

    Example 3: Evaluation of Prepared Library and Selection of Variants

    Example 3-1: Evaluation of Library

    [0079] The p117-PpurA-gfp-library prepared in Example 2-2 was transformed into the CJI2330 strain prepared in Example 1 by electroporation, and the strain was spread on a nutrient medium containing 25 mg/L kanamycin to obtain 5,000 colonies into which the modified vector was inserted. The colonies were named as CJI2330_p117-PpurA(mt1) to CJI2330_p117-PpurA(mt5000).

    [0080] Nutrient medium: 1% peptone, 1% meat extract, 0.25% sodium chloride, 1% yeast extract, 2% agar, pH 7.2

    [0081] Each of the obtained 5,000 colonies was inoculated in 200 L of an autoclaved seed culture medium, and cultured in a 96-deep-well plate with shaking at 30 C. and 1,200 rpm for 24 hours using a microplate shaker (TAITEC), and used as a seed culture. The autoclaved fermentation medium (290 L) was dispensed into a 96-deep-well plate, and 20 L of each of the seed cultures was inoculated thereto and cultured with shaking under the same conditions as above for 72 hours to obtain the cells. Then, the collected cells were washed with 1 phosphate-buffered saline (sodium chloride (80 g), potassium chloride (2 g), sodium phosphate (14.4 g), potassium phosphate (2.4 g), and sterile water (0.8 L)), resuspended in the same buffer, and the fluorescence intensity was measured. The fluorescence intensity was measured by the irradiation of excitation light at 488 nm, and the light emitted therefrom was measured at 511 nm using the microplate reader, and thereby the expression level of the GFP gene was measured. Upon measurement, two mutant colonies were selected (i.e., PpurA(mt3) and PpurA(mt378)) in which the fluorescence intensity was weakened compared to the wild-type gfp.

    Example 3-2: Confirmation of Modification in purA Promoter

    [0082] To confirm the gene modification of the mutant strain, PCR was performed in each of the PpurA(mt3) and PpurA(mt378) strains using the primer set of SEQ ID NOS: 15 and 17, and the PCR product was subjected to sequencing, thereby confirming the presence of modification in the purA promoter.

    [0083] Specifically, it was confirmed that the PpurA(mt3) included a polynucleotide sequence in which the 189.sup.th nucleotide of the polynucleotide sequence of SEQ ID NO: 1 is substituted with thymine (T). Additionally, it was confirmed that the PpurA(mt378) included a polynucleotide sequence in which the 143.sup.rd nucleotide of the polynucleotide sequence of SEQ ID NO: 1 is substituted with thymine (T). Accordingly, in Examples hereinbelow, attempts were made to confirm whether the above modification can affect the amount of purine nucleotide production in each microorganism of the genus Corynebacterium.

    Example 4: Confirmation of Ability of IMP Production in IMP-Producing Strain Derived from ATCC6872

    [0084] An IMP-producing strain derived from ATCC6872 was prepared, and the modification confirmed in Example 3 was introduced into the strain and the ability of producing IMP of the strain was confirmed.

    Example 4-1: Selection of IMP-Producing Strain Derived from ATCC6872

    [0085] To prepare an IMP-producing strain derived from the ATCC6872 strain, the culture of ATCC6872 was suspended in a phosphate buffer (pH 7.0) or citrate buffer (pH 5.5) at a density of 10.sup.7 cells/mL to 10.sup.8 cells/mL and treated with UV at room temperature or 32 C. for 20 min to 40 min to induce a mutation. The strain was washed with a 0.85% saline solution twice and spread, after dilution, on a minimal medium containing 1.7% agar which was supplemented with a resistance-providing material at an appropriate concentration, and thereby colonies were obtained. Each colony was cultured in a nutrient medium and then cultured in a seed culture medium for 24 hours. After culturing each colony in a fermentation medium for 3 to 4 days, colonies which showed the most excellent production of IMP accumulated in the culture medium were selected. To prepare a strain producing IMP at high concentration, adenine-auxotroph, guanine-leaky type, lysozyme sensitivity, 3,4-dehydroproline resistance, streptomycin resistance, sulfaguanidine resistance, norvaline resistance, and trimethoprim resistance were provided by performing the corresponding procedures in a sequential manner. As a result, the CJI2332 strain provided with resistance to the above materials and having excellent IMP productivity was finally selected. The resistances of the CJI2332 strain relative to those of ATCC6872 were compared and the results are shown in the following Table 7.

    TABLE-US-00005 TABLE 7 Characteristic ATCC6872 CJI2332 Adenine-auxotroph Non-auxotroph Auxotroph Guanine-leaky type Non-auxotroph Leaky type Lysozyme sensitivity 80 g/mL 8 g/mL 3,4-Dehydroproline resistance 1,000 g/mL 3,500 g/mL Streptomycin resistance 500 g/mL 2,000 g/mL Sulfaguanidine resistance 50 g/mL 200 g/mL Norvaline resistance 0.2 mg/mL 2 mg/mL Trimethoprim resistance 20 g/mL 100 g/mL

    [0086] Minimal medium: 2% glucose, 0.3% sodium sulfate, 0.1% monopotassium phosphate, 0.3% dipotassium phosphate, 0.3% magnesium sulfate, 10 mg/L calcium chloride, 10 mg/L iron sulfate, 1 mg/L zinc sulfate, 3.6 mg/L manganese chloride, 20 mg/L L-cysteine, 10 mg/L calcium pantothenate, 5 mg/L thiamine hydrochloride, 30 g/L biotin, 20 mg/L adenine, 20 mg/L guanine, adjusted to pH 7.3.

    [0087] The CJI2332 strain was deposited at the Korean Culture Center of Microorganisms (KCCM) on Jun. 22, 2018, under the provisions of the Budapest Treaty and assigned accession number KCCM12277P.

    Example 4-2: Fermentation Titer Test of CJI2332

    [0088] After dispensing a seed culture medium (2 mL) into each test tube (diameter: 18 mm), the tubes were autoclaved. Each of ATCC6872 and CJI2332 was inoculated and incubated at 30 C. for 24 hours with shaking and used as a seed culture. A fermentation medium was dispensed (29 mL each) into 250 mL shaking Erlenmeyer flasks and autoclaved at 121 C. for 15 min. The seed culture (2 mL) was inoculated to the medium and cultured for 3 days. Culture conditions were adjusted to 170 rpm, 30 C., and pH 7.5.

    [0089] After completion of the culture, the amount of IMP production was measured by HPLC (SHIMAZDU LC20A), and the culture results are as in Table 8 below.

    TABLE-US-00006 TABLE 8 Strain IMP (g/L) ATCC6872 0 CJI2332 1.74

    Example 4-3: Preparation of Insertion Vector Containing purA Promoter Modification

    [0090] To introduce the modifications selected in Example 3 into the strains, an insertion vector was prepared. The processes for preparing the vector for the introduction of PpurA(c143t), PpurA(a189t), and PpurA(c143t, a1890 modifications are as follows.

    [0091] PCR was performed using the genomic DNA of the ATCC6872 strain as a template and the primer sets of SEQ ID NOS: 18 and 19 and SEQ ID NOS: 20 and 21. The PCR was performed as follows: denaturation at 94 C. for 5 min; 20 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and polymerization at 72 C. for 1 min; and polymerization at 72 C. for 5 min. PCR was performed again in the same manner using the obtained DNA fragments as a template and the primer set of SEQ ID NOS: 18 and 21, and the thus-obtained gene fragments were each digested with XbaI. Each of the DNA fragments was cloned into a linear pDZ vector digested with XbaI using T4 ligase, and thereby the pDZ-purA(c143t)-purA vector was prepared.

    [0092] Then, PCR was performed using the genomic DNA of the ATCC6872 strain as a template and the primer sets of SEQ ID NOS: 18 and 22 and SEQ ID NOS: 23 and 21. The PCR was performed as follows: denaturation at 94 C. for 5 min; 20 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and polymerization at 72 C. for 1 min; and polymerization at 72 C. for 5 min. PCR was performed again in the same manner using the obtained DNA fragments as a template and the primer set of SEQ ID NOS: 18 and 21, and the thus-obtained gene fragments were each digested with XbaI. Each of the DNA fragments was cloned into a linear pDZ vector digested with XbaI using T4 ligase, and thereby the pDZ-purA(a189t)-purA vector was prepared.

    [0093] Additionally, to examine the effect of the introduction of two simultaneous modifications, a vector in which the two modifications were introduced was prepared. Then, site-directed mutagenesis was performed using the prepared pDZ-purA(c143t) as the backbone. Specifically, PCR was performed using the primer sets of SEQ ID NOS: 24 and 25 under the following conditions: 18 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and polymerization at 68 C. for 1 min; and polymerization at 72 C. for 12 min. The obtained PCR products were each digested with DpnI, transformed into DH5a, and thereby the pDZ-PpurA(c143t, a189t)-purA vector was obtained.

    TABLE-US-00007 TABLE9 SEQIDNO Primer Sequence(5-3) 18 PDZpurAF GCTCTAGAACGGTCACGCGCAAATCAG 19 purAc143t-1R CTACCTTTATCGCCAaTGATAATGTATTTAGCCATG 20 purAc143t-2F CTAAATACATTATCAtTGGCGATAAAGGTAGAGTT 21 PDZpurAR GCTCTAGATCGTAGGCGACGCAAATAGG 22 purAa189t-1R GGTTATTCACTACCTAGATTTAAG 23 purAa189t-2F TTAAATCTAGGtAGTGAATAACC 24 Site-directed TAGCCTTAAATCTAGGTAGTGAATAACCATGGCAGCTA mutagenesisF 25 Site-directed TAGCTGCCATGGTTATTCACTACCTAGATTTAAGGCTA mutagenesisR

    Example 4-4: Introduction of purA Promoter Variants into CJI2330 and CJI2332 Strains Derived from ATCC6872 and Evaluation Thereof

    [0094] The purA promoter modification was introduced to each of the wild-type-derived IMP-producing CJI2330 strain prepared in Example 1 and the CJI2332 strain selected in Example 4-1, and the amount of IMP produced by each strain was evaluated. To confirm the presence of a modification in the purA promoter of the CJI2332 strain, the genomic DNA of the CJI2332 strain was amplified by PCR. Specifically, first, purA promoter fragments were amplified by PCR using the genomic DNA of the CJI2332 strain as a template and the primer set of SEQ ID NOS: 15 and 21, in which the PCR was performed by 28 cycles of denaturation at 94 C. for 1 min; annealing at 58 C. for 30 sec, and polymerization at 72 C. for 1 min using Taq DNA polymerase. The obtained nucleotide sequences of the amplified purA promoter fragments were analyzed, and as a result, it was confirmed that the nucleotide sequence of the purA promoter of the CJI2332 strain was the same as that of the wild-type Corynebacterium stationis ATCC6872.

    [0095] Then, the pDZ-PpurA(c143t)-purA, pDZ-PpurA(a189t)-purA, and pDZ-PpurA(c143t, a1890-purA vectors were transformed into the CJI2330 strain and the CJI2332 strain, and the strains in which each of the vectors was inserted into the chromosome by recombination of homologous sequences were selected on a medium containing kanamycin (25 mg/L). The selected primary strains were subjected to secondary crossover, and thereby the strains in which a modification in the promoter of a target gene was introduced were selected. For confirmation of the introduction of the gene modification in the final transformed strains, PCR was performed using the primer set of SEQ ID NOS: 15 and 21 and the PCR products were confirmed by analysis of these nucleotide sequences. As a result, it was confirmed that the gene modification was introduced into the strains. The thus-prepared strains were named as CJI2330_PpurA(c143t)-purA, CJI2330_PpurA(a189t)-purA, CJI2330_PpurA(c143t, a189t)-purA, CJI2332_PpurA(c143t)-purA, and CJI2332_PpurA(a189t)-purA, CJI2332_PpurA(c143t, a1890-purA.

    [0096] The CJI2332_PpurA(c143t)-purA is called CJI2352 and was deposited at the Korean Culture Center of Microorganisms (KCCM) on Sep. 10, 2018, under the provisions of the Budapest Treaty and assigned accession number KCCM12315P. Additionally, the prepared CJI2332_PpurA(a189t)-purA is called CJI2365 and was deposited at the Korean Culture Center of Microorganisms (KCCM) on Sep. 10, 2018, under the provisions of the Budapest Treaty and assigned accession number KCCM12314P.

    [0097] The IMP-producing ability of each strain was evaluated. After completion of the culture, the amount of IMP production was measured by a method using HPLC, and the culture results are as in Table 10 below.

    TABLE-US-00008 TABLE 10 Strain IMP (g/L) CJI2330 0.50 CJI2330_PpurA(c143t)-purA 0.58 CJI2330_PpurA(a189t)-purA 0.67 CJI2330_PpurA(c143t, a189t)-purA 0.72 CJI2332 1.74 CJI2332_PpurA(c143t)-purA 2.01 CJI2332_PpurA(a189t)-purA 2.29 CJI2332_PpurA(c143t, a189t)-purA 2.42

    Example 5: Confirmation of 5-Xanthylic Acid (XMP)-Producing Ability Upon Introduction of purA Promoter Variant

    Example 5-1: Selection of XMP-Producing Strains Derived from ATCC6872

    [0098] To prepare a 5-xanthosine monophosphate (XMP)-producing strain derived from ATCC6872, the Corynebacterium stationis ATCC6872 strain was suspended in the phosphate buffer (pH 7.0) or citrate buffer (pH 5.5) at a density of 10.sup.7 cells/mL to 10.sup.8 cells/mL and treated with UV at room temperature or 32 C. for 20 min to 40 min to induce a mutation. The strain was washed with a 0.85% saline solution twice and spread, after dilution, on a minimal medium containing 1.7% agar which was supplemented with a resistance-providing material at an appropriate concentration, and thereby colonies were obtained. Each colony was cultured in a nutrient medium and then cultured in a seed culture medium for 24 hours. After culturing each colony in a fermentation medium for 3 to 4 days, colonies which showed the most excellent production of XMP accumulated in the culture medium were selected. Specifically, strains were selected from those which can grow in a medium where fluorotryptophan is added according to concentrations (addition medium), and more specifically, from those which can grow in a medium with a fluorotryptophan concentration of 100 mg/L and has an improved concentration of 5-xanthylic acid. The selected strain was named as CJX1664.

    [0099] Minimal medium: glucose 20 g/L, monopotassium phosphate 1 g/L, dipotassium phosphate 1 g/L, urea 2 g/L, ammonium sulfate 3 g/L, magnesium sulfate 1 g/L, calcium chloride 100 mg/L, iron sulfate 20 mg/L, manganese sulfate 10 mg/L, zinc sulfate 10 mg/L, biotin 30 g/L, thiamine hydrochloride 0.1 mg/L, copper sulfate 0.8 mg/L, adenine 20 mg/L, guanine 20 mg/L, pH 7.2

    [0100] Addition medium: a medium where fluorotryptophan at a concentration of 10 mg/L, 20 mg/L, 50 mg/L, 70 mg/L, 100 mg/L, and 200 mg/L is added to a minimal medium

    [0101] The biochemical characteristics of the CJX1664 strain are shown in Table 11 below. Referring to Table 11, the CJX1664 strain can be grown in an addition medium where fluorotryptophan is added at a concentration of 100 mg/L.

    TABLE-US-00009 TABLE 11 Characteristic ATCC6872 CJX1664 Fluorotryptophan Resistance 10 mg/L 100 mg/L

    [0102] The CJX1664 strain was deposited at the Korean Culture Center of Microorganisms (KCCM) on Jul. 6, 2018, under the provisions of the Budapest Treaty and assigned accession number KCCM12285P.

    Example 5-2: CJX1664 Fermentation Titer Test

    [0103] After dispensing a seed culture medium (2 mL) into each of the test tubes (diameter: 18 mm), the tubes were autoclaved. Each of ATCC6872 and CJX1664 was inoculated and incubated at 30 C. for 24 hours with shaking and used as a seed culture. A fermentation medium was dispensed (29 mL each) into 250 mL shaking Erlenmeyer flasks and autoclaved at 121 C. for 15 min. The seed culture (2 mL) was inoculated to the medium and cultured for 3 days. Culture conditions were adjusted to 170 rpm, 30 C., and pH 7.5.

    [0104] After completion of the culture, the amount of XMP production was measured by a method using HPLC (SHIMAZDU LC20A), and the culture results are as in Table 12 below.

    TABLE-US-00010 TABLE 12 Strain XMP (g/L) ATCC6872 0 CJX1664 4.72

    Example 5-3: Introduction of Variants into CJX1664 Strain and Evaluation Thereof

    [0105] To confirm the presence of a modification in the purA promoter of the CJX1664 strain selected in Example 5-1, the genomic DNA PCR of the CJX1664 strain was amplified by PCR. Specifically, first, purA promoter fragments were amplified by PCR using the genomic DNA of the CJX1664 strain as a template and primers of SEQ ID NOS: 17 and 18, in which the PCR was performed by 28 cycles of denaturation at 94 C. for 1 min; annealing at 58 C. for 30 sec, and polymerization at 72 C. for 1 min using Taq DNA polymerase. The obtained nucleotide sequences of the amplified purA promoter fragments were analyzed, and as a result, it was confirmed that the nucleotide sequence of the purA promoter of the CJI2332 strain was the same as that of the wild-type Corynebacterium stationis ATCC6872.

    [0106] The vectors prepared in Example 4-3 were each transformed into the CJX1664 strain, and the strains in which each of the vectors was inserted into the chromosome by recombination of homologous sequences were selected on a medium containing kanamycin (25 mg/L). The selected primary strains were subjected to secondary crossover, and thereby the strains in which a modification in the promoter of a target gene was introduced were selected. The presence of the introduction of a gene modification in the final transformed strain was confirmed by the analysis of nucleotide sequences.

    [0107] The XMP-producing abilities of the CJX1664, CJX1664_PpurA(c143t)-purA, CJX1664_PpurA(a189t)-purA, and CJX1664_PpurA(c143t, a1890-purA strains were evaluated. After completion of the culture, the amount of XMP production was measured by a method using HPLC, and the culture results are as in Table 13 below.

    [0108] The CJX1664_PpurA(c143t)-purA is called CJX1680 and was deposited at the Korean Culture Center of Microorganisms (KCCM) on Sep. 10, 2018, under the provisions of the Budapest Treaty and assigned accession number KCCM12311P. Additionally, the prepared CJX1664_PpurA(a189t)-purA is called CJX1668 and was deposited at the Korean Culture Center of Microorganisms (KCCM) on Sep. 10, 2018, under the provisions of the Budapest Treaty and assigned accession number KCCM12310P.

    TABLE-US-00011 TABLE 13 Strain XMP (g/L) CJX1664 4.72 CJX1664_PpurA(c143t)-purA 5.47 CJX1664_PpurA(a189t)-purA 5.91 CJX1664_PpurA(c143t, a189t)-purA 6.01

    [0109] As can be seen in Table 13 above, it was confirmed that the CJX1664_PpurA(c143t)-purA, CJX1664_PpurA(a189t)-purA, and CJX1664_PpurA(c143t, a1890-purA strains showed an increase in the amount of XMP production by about 27% compared to the CJX1664 strain (i.e., an ATCC6872-based XMP-producing strain).

    [0110] From the foregoing, a skilled person in the art to which the present disclosure pertains will be able to understand that the present disclosure may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present disclosure. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure. On the contrary, the present disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present disclosure as defined by the appended claims.