Glyphosate-resistant gene screening method, EPSPS mutant gene and deficient strain and use

10961546 ยท 2021-03-30

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are a glyphosate-resistant gene screening method, an EPSPS mutant gene having glyphosate resistance screened by the method, an EPSPS and C-P Lyase deficient strain and a use thereof.

Claims

1. A method for screening glyphosate-resistant genes, comprising: knocking out interference genes of a source strain by a gene knockout technology to obtain a knock-out strain, wherein the source strain is one of E. coli DH5a, E. coli TOP10 and E. coli BL21, the interference genes comprise EPSPS gene and C-P lyase genes, and the knock-out strain is an EPSPS gene-and-C-P lyase genes-deleted strain; cloning an exogenous EPSPS gene into the knock-out strain for screening of glyphosate resistance, wherein the exogenous EPSPS gene is a wild-type or mutated EPSPS gene coming from a target plant; culturing the knock-out strain with cloned exogenous EPSPS on at least one screening culture medium containing glyphosate, to identify resistant strains having resistance to glyphosate; and isolating individual colonies of the resistant strains having resistance to glyphosate and sequencing the cloned EPSPS genes from the resistant strains, so as to obtain one or more glyphosate-resistant EPSPS mutant genes, wherein a method for knocking out the C-P lyase genes in E. coli comprises the step of transferring the nucleotide fragment as shown in SEQ ID NO.16 into E. coli to obtain an E. coli with the C-P lyase genes being knocked out.

2. The method for screening glyphosate-resistant gene according to claim 1, wherein the mutated EPSPS gene is obtained by chemical mutagenesis treatment or radiation-induced mutagenesis treatment.

3. The method for screening glyphosate-resistant gene according to claim 1, wherein the mutated EPSPS gene is obtained by conducting a PCR by mismatch PCR method or DNA Shuffling method using the exogenous EPSPS gene as a template, so as to obtain the mutated EPSPS gene.

4. The method for screening glyphosate-resistant gene according to claim 1, wherein the target plant is rice, soybean, wheat, corn, barley, sorghum, tobacco, cotton, sweet potato, poplar, potato, Chinese cabbage, cabbage or green pepper.

5. A glyphosate-resistant EPSPS mutant gene obtained by the method according to claim 1, wherein the EPSPS mutant gene encodes a glyphosate-resistant EPSPS having the amino acid sequence as encoded by the nucleotide sequence as shown in SEQ ID NO.4 or SEQ ID NO.10.

6. The glyphosate-resistant EPSPS mutant gene according to claim 5, wherein the glyphosate-resistant EPSPS mutant gene enables a plant to becomes resistant to glyphosate by transforming the plant.

7. The glyphosate-resistant EPSPS mutant gene according to claim 5, wherein the mutated EPSPS gene is obtained by chemical mutagenesis treatment or radiation-induced mutagenesis treatment.

8. The glyphosate-resistant EPSPS mutant gene according to claim 5, wherein the mutated EPSPS gene is obtained by conducting a PCR by mismatch PCR method or DNA Shuffling method using the exogenous EPSPS gene as a template, so as to obtain the mutated EPSPS gene.

9. The glyphosate-resistant EPSPS mutant gene according to claim 5, wherein the target plant is rice[, soybean, wheat, corn, barley, sorghum, tobacco, cotton, sweet potato, poplar, potato, Chinese cabbage, cabbage or green pepper].

10. The glyphosate-resistant EPSPS mutant gene according to claim 7, wherein the glyphosate-resistant EPSPS mutant gene enables a plant to becomes resistant to glyphosate by transforming the plant.

11. The glyphosate-resistant EPSPS mutant gene according to claim 8, wherein the glyphosate-resistant EPSPS mutant gene enables a plant to becomes resistant to glyphosate by transforming the plant.

12. The glyphosate-resistant EPSPS mutant gene according to claim 9, wherein the glyphosate-resistant EPSPS mutant gene enables a plant to becomes resistant to glyphosate by transforming the plant.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) In order to more clearly illustrate the technical solutions provided in the embodiments of the present disclosure, drawings necessary for the embodiments are briefly described below. It should be understood that the following drawings merely show some embodiments of the disclosure and thus should not be construed as limiting the scope. Other related drawings can be obtained by those ordinarily skilled in the art according to these drawings without paying any creative effort.

(2) FIG. 1 is a structural diagram of pADV5 vector according to an example of the present disclosure;

(3) FIG. 2 is a structural diagram of pKD46 vector according to an example of the present disclosure;

(4) FIG. 3 shows the result of comparative analysis between the sequences of Oryza sativa EPSPS mutant gene (SEQ. ID. NO. 4) and wild type Oryza sativa EPSPS gene (SEQ. ID. NO. 1) according to Example 1 of the present disclosure; and

(5) FIG. 4 shows the result of comparative analysis between the sequences of Glycine max EPSPS mutant gene (SEQ. ID. NO, 10) and wild type Glycine max EPSPS gene (SEQ. ID. NO. 5) according to Example 2 of the present disclosure.

DETAILED DESCRIPTION OF EMBODIMENTS

(6) To make the purposes, technical solutions and advantages of the present disclosure more clear, the technical solutions in the examples of the present disclosure will be clearly and completely described below. Examples for which no specific condition is indicated should be done under conventional conditions or conditions as recommended by the manufacturer. All those agents or instruments for which no manufacturer is indicated are all conventional products which are commercially available.

(7) Now provided is a detailed description of the method for screening glyphosate-resistant genes, EPSPS mutant gene and knock-out strain and use thereof of the present disclosure.

(8) A method for screening glyphosate-resistant gene, including followings.

(9) Step S1: Construction of a Knock-Out Strain

(10) Interference genes of a source strain are knocked out by a gene knockout technology to give a knock-out strain. The source strain is one of E. coli DH5, TOP10 and BL21. The interference genes comprise EPSPS gene and C-P lyase genes. The knock-out strain is an EPSPS gene-and-C-P lyase genes-deleted strain.

(11) That is to say, the EPSPS gene-and-C-P lyase genes-deleted strain is a knock-out strain obtained by knocking out the EPSPS gene and the C-P lyase genes of one of E. coli DH5, TOP10 and BL21. Such EPSPS gene-and-C-P lyase genes-deleted strain is characterized in that it cannot grow on a basal culture medium free of amino acid or protein, also known as limiting culture medium, but can grow on a basal culture medium that contains only glucose as organic source after an exogenous EPSPS gene is introduced.

(12) The functions of the knocking-out of source strain, i.e. knocking-out of EPSPS gene and C-P lyase genes from wild type E. coli, are described below.

(13) The endogenous EPSPS gene of E. coli can express 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) and C-P lyase genes can express C-P lyase that lyses C-P bond and thus could lyse glyphosate. Therefore, if wild type E. coli is used as a host strain, in the subsequent step of mutagenesis treatment, mutation may also occur in the endogenous EPSPS gene and C-P lyase genes of the host strain, producing endogenous EPSPS mutant gene resistant to glyphosate and C-P lyase mutant gene with improved lysis ability, and providing the host strain with resistance to glyphosate. This makes it impossible to tell whether the glyphosate resistance of the monoclonal resistant strain obtained by screening is to provided by the exogenous EPSP mutant gene or by their endogenous EPSPS mutant gene and C-P lyase mutant gene. Therefore, if E. coli is used as a host strain, its endogenous EPSPS gene and C-P lyase genes have to be knocked-out, so as to ensure that the finally obtained glyphosate resistance of the monoclonal resistant strain comes from the exogenous EPSPS mutant gene and that the screening result would be more scientific, reasonable and reliable.

(14) Sure, there are various gene knockout technologies to knock out the EPSPS gene and C-P lyase genes in E. coli, e.g. FRT method, pCas system, pKD46 system or direct knockout using homologous PCR fragment. Where the genomic sequence information of E. coli is known, it is relatively easy to knock out the EPSPS gene and the C-P lyase genes on its genome using any of the above methods.

(15) Step S2: Construction of Exogenous EPSPS Gene Mutant Library

(16) One construction strategy is to first introduce, using a knock-out strain as a host strain, an exogenous EPSPS gene into the knock-out strain which is then subjected to mutagenesis treatment, so as to obtain first mutant strain containing an exogenous EPSPS mutant gene. Preferably, the mutagenesis treatment is chemical mutagenesis treatment or radiation-induced mutagenesis treatment. Chemical mutagenesis treatment uses chemical mutagens e.g. EMS or DES to induce mutation in the first mutant strain so that mutation occurs in the exogenous EPSPS gene along with the proliferation of the host strain.

(17) Another construction strategy is to first mutate the exogenous EPSPS gene to obtain an exogenous EPSPS mutant gene, and then introduce the exogenous EPSPS mutant gene into a knock-out strain to obtain second mutant strain. Mutagenesis treatment is done by PCR based on mismatch PCR method or DNA Shuffling method using exogenous EPSPS gene as a template, and the resulted PCR product is exogenous EPSPS mutant gene.

(18) It is to be noted that both the first mutant strain and the second mutant strain contain exogenous EPSPS mutant genes, and both the first mutant strain and the second mutant strain are exogenous EPSPS gene mutant libraries.

(19) Terms like first and second are merely used for purpose of discriminative description, but should not be construed as indicating or implying relative importance.

(20) The exogenous EPSPS gene used in the above step comes from a target plant which is rice, soybean, wheat, corn, barley, sorghum, tobacco, cotton, sweet potato, poplar, potato, Chinese cabbage, cabbage or green pepper. One may choose as actually required in an actual screening process.

(21) Step S3: Resistance Screening

(22) The exogenous EPSPS gene mutant library, i.e. the first mutant strain or the second mutant strain, obtained from Step S2 is placed on screening culture media containing glyphosate, followed by culturing for screening, so as to obtain a monoclonal resistant strain having resistance to glyphosate. It is to be noted that the monoclonal resistant strain, i.e. the colonies growing on the screening culture media, may also be called as positive transformant. Sure, there may be various numbers of positive transformants, for example, there may be one positive transformant or a plurality of positive transformants.

(23) The screening culture media are M9 basal culture media containing different concentrations of glyphosate.

(24) Step S4: Sequencing and Verification

(25) The monoclonal resistant strain obtained from Step S3 are sequenced and verified, so as to obtain EPSPS mutant genes resistant to glyphosate.

(26) Now the characteristics and effects of the present disclosure will be further described in details with reference to examples.

Example 1

(27) The screening method provided by the present disclosure is further described in details in the present example wherein Oryza sativa was used as the target plant, the exogenous EPSPS gene was Oryza sativa EPSPS gene (see SEQ ID NO.1 for its nucleotide sequence), and an EPSPS gene-and-C-P lyase genes-deleted strain obtained by knocking out the EPSPS gene and C-P lyase genes in wild type E. coli DH5 using homologous PCR fragments was adopted as a host strain. See Table 1 for the names and their nucleotide sequences of primers used in the present example.

(28) Step 1, is to directly knock out the EPSPS gene and C-P lyase genes in E. coli DH5 using homologous PCR fragments.

(29) 1. Knocking Out the C-P Lyase Genes in E. coli DH5

(30) (1) Amplification of Homologous PCR Fragment

(31) Forward primer CPF2 and reverse primer CP5HA3 (see Table 1) were used to conduct PCR with wild type E. coli DH5 being used as a template. The gel was used to purify the PCR product, named as CP5HA fragment, with a length of 525 bp. See SEQ ID NO.13 for its nucleotide sequence.

(32) TABLE-US-00001 TABLE1 Primersandtheirnucleotidesequencesusedin thepresentexample SEQ Primer ID. name Nucleotidesequence(5-3) NO CPF2 agctgtaacaggcgttcagcctcc 23 CP5HA3 gcagatgtacatgccgttatcttc 24 CP3HA5 ggacgcatgttacgtctcaccgg 25 CPR2 aatacgccgttcgagacgcatctc 26 SPE35 gcccagtatcagcccgtcatacttg 27 CPR0 ctcatgccgaataccagcccgtag 28 SPEC5 ctccgaatacacttacgaagataacggcatgtacatct 29 gctaatacgactcactatagggagaatg SPEC3 cttcggcaatgcccgcgccggtgagacgtaacatgcgt 30 ccttatttgccgactaccttggtg EE5-1K tagttctggtccggcaatgctacc 31 ES5HA3 gcagattaatagtgccatcgacacg 32 ES3HA5 cggattagccaggcagcctgaatg 33 EE3-1K gcttgggccatcaatggtaataacc 34 GM5L ctgacgttacaacccatcgctcgtgtcgatggcactatt 35 aatctgcagaggcggtttgcgtattgggcgc GM3L gctatttattgcccgttgttcattcaggctgcctggcta 36 atccgtgatctcggcttgaacgaattgttag ECES35U tgattatatttcctgcacgcgtggt 37 PV325 tgagcgcaacgcaattaatgtgag 38 PV323 cgtaaggagaaaataccgcatcagg 39 2M1H ttacgtacgttaattaatggcgtccaacgccgcggctgcg 40 2M1T ttacgtacgtcctgcaggtcagttcctgacgaaagtgctt 41 agaacg

(33) Forward primer CP3HA5 and reverse primer CPR2 were used to conduct PCR with E. coli DH5 being used as a template. The gel was used to purify the PCR product, named as CP3HA fragment, with a length of 503 bp. See SEQ ID NO.14 for its nucleotide sequence.

(34) Forward primer SPEC5 and reverse primer SPEC3 were used to conduct PCR with a vector named pCPSG7 containing the nucleotide sequence as shown in SEQ ID NO.2 being used as a template. The gel was used to purify the PCR product, named as SPEC fragment, with a length of 900 bp. See SEQ ID NO.15 for its nucleotide sequence.

(35) CPF2 and CPR2, as primers, were used to conduct PCR with CP5HA fragment, SPEC fragment and CP3HA fragment being used as templates (conducted in the same reaction system). The gel purified PCR product was named as CP5HA-SPEC-CP3HA fragment, with a length of 1849 bp. See SEQ ID NO.16 for its nucleotide sequence. Located on site 1 to site 525 were 5 terminal of E. coli PhnA gene and its upstream sequence. The nucleotide sequence from site 526 to site 1346 consisted of Spectinomycin resistant gene and its promoter. Located on site 1347 to site 1849 were 3 terminal of E. coli PhnH gene and its downstream sequence.

(36) (2) Transformation by Heat Shock

(37) E. coli DH5 competent cells were prepared by a conventional method. 100 L of E. coli DH5 competent cells were gently blended with 5 L of CP5HA-SPEC-CP3HA fragment. Then they were left on ice for 10 min, heat-shocked for 90 s at 42 C. and then immediately transferred to ice and standing for 2 min.

(38) Then they were quickly added to 1 mL of LB liquid culture medium (containing 50 g/mL of Spec (spectinomycin)), cultured at 37 C. for 1 hr, then spread on an plate of LB solid culture medium (containing 50 g/mL of Spec) and then cultured overnight at 37 C.

(39) After the cultured E. coli DH5 was tested with forward primer SPE35 and reverse primer CPR0, the strain was named as EDC, which is E. coli DH5 with C-P lyase genes being knocked out.

(40) 2. Knocking Out the EPSPS Genes in EDC (E. coli DH5 with C-P Lyase Genes being Knocked Out)

(41) (1) Amplification of Homologous PCR Fragment

(42) Forward primer EE5-1K and reverse primer ES5HA3 were used to conduct PCR with wild type E. coli DH5 being used as a template. The gel purified PCR product was named as ES5HA fragment, with a length of 1194 bp. See SEQ ID NO.17 for its nucleotide sequence.

(43) Forward primer ES3HA5 and reverse primer EE3-1K were used to conduct PCR with E. coli DH5 being used as a template. The gel purified PCR product was named as ES3HA fragment, with a length of 1168 bp. See SEQ ID NO.18 for its nucleotide sequence.

(44) Forward primer GM5L and reverse primer GM3L were used to conduct PCR with a vector named pCPSG5 containing the nucleotide sequence as shown in SEQ ID NO.3 being used as a template. The gel purified PCR product was named as GM fragment, with a length of 1050 bp. See SEQ ID NO.19 for its nucleotide sequence.

(45) Forward primer EE5-1K and reverse primer EE3-1K were used to conduct PCR with the ES5HA fragment, GM fragment and ES3HA fragment being used as templates. The gel purified PCR product was named as ES5HA-GM-ES3HA fragment, with a length of 3322 bp. See SEQ ID NO.20 for its nucleotide sequence. Located on site 1 to site 1194 was the upstream sequence of E. coli EPSPS gene. The nucleotide sequence from site 1195 to site 2154 consisted of gentamicin resistant gene and its promoter. Located on site 2155 to site 3322 was the downstream sequence of E. coli EPSPS gene.

(46) (2) Transformation by Heat Shock

(47) EDC competent cells were prepared with a conventional method. 100 L of EDC competent cells were gently blended with 5 L of ES5HA-GM-ES3HA fragment. Then they were left on ice for 10 min, heat-shocked at 42 C. for 90 s and then immediately transferred to ice and standing for 2 min. Then they were quickly added to 1 mL of LB liquid culture medium, cultured at 37 C. for 1 hr, spread on a plate of LB solid culture medium containing Spec (50 g/mL) and Gm (50 g/ml) (containing 50 g/ml of Spec and 50 g/ml of Gm) and then cultured overnight at 37 C.

(48) The cultured strain was tested with forward primers EE5-1K and GM3L and reverse primers EE3-1K and ECES35U and was named as EDCE, which was E. coli DH5 with its EPSPS gene and C-P lyase genes being knocked out, i.e. an EPSPS gene-and-C-P lyase genes-deleted strain.

(49) Sure, other conventional knock-in or knock-out methods may also be used. E.g., pCas system is used to knock out the EPSPS gene and C-P lyase genes in E. coli DH5 or pKD46 system is used to knock out the EPSPS gene and C-P lyase genes in E. coli DH5.

(50) Step 2, is to, using the EPSPS gene-and-C-P lyase genes-deleted strain obtained in step 1 as a host strain, introduce EPSPS gene from Oryza sativa into the host strain, so as to obtain mutant strain, i.e. Oryza sativa EPSPS gene mutant library. Specifically, the operation is described below.

(51) 1. Constructing an EPSP Gene Mutant Library with Mismatch PCR Method

(52) The mRNA of Oryza sativa EPSPS gene was reverse transcribed into cDNA by a conventional method and the cDNA was cloned to pADV5 vector (see FIG. 1 for its structure).

(53) Forward primer PV325 and reverse primer PV323 were used to conduct a first round of mismatch PCR with pADV5 vector carrying Oryza sativa EPSPS gene being used as a template. The PCR reaction system comprises 25.3 L of H.sub.2O, 4 L or error-prone PCR MIX, 4 L of error-prone PCR dNTP, 4 L of MnCl.sub.2, 0.8 L of PV325, 0.8 L of PV323, 0.1 L of Taq enzyme and 2 L of template. The PCR reaction was conducted in the following procedure: 95 C. for 30 s; 60 C. for 30 s; 72 C. for 2 min. After 40 cycles, the PCR product was subjected to electrophoresis with 1% agarose. Then the gel was cut and recovered. The first round PCR product was obtained.

(54) Forward primer 2M1H and reverse primer 2M1T were used to conduct a second round of PCR with the first round PCR product being used as a template. The PCR system consisted of 31.9 L of H.sub.2O, 2.5 L of DMSO, 5 L of 10PCR buffer, 5 L of dNTP, 4 L of MgCl.sub.2, 0.5 L of 2M1H, 0.5 L of 2M1T, 0.1 L of Taq enzyme and 0.5 L of template. The PCR reaction was conducted in the following procedure: 95 C. for 30 s; 60 C. for 30 s; 72 C. for 2 min; 60 cycles.

(55) The resulted PCR product was subjected to electrophoresis with 1% agarose and those bands having a size identical to the target band (1.5 kb) were subjected to gel recovery and purification. The purified product was digested by double enzymes, i.e. Pacl and Sbfl, and then ligated to a new pADV5 vector which was also digested by the double enzymes, so as to give a ligation product. The ligation product obtained in this step was pADV5 vector carrying Oryza sativa EPSPS mutant gene.

(56) Sure, also, DNA Shuffling method may be used to obtain pADV5 vector carrying Oryza sativa EPSPS mutant gene. Specifically, the operation is described below.

(57) pADV5 vectors carrying gene mutants of Oryza sativa EPSPS gene was obtained by DNA Shuffling method. 1) PCR amplification was conducted on Oryza sativa EPSPS gene sequence, the amplification product was subjected to electrophoresis with 1% agarose, and then gel recovery and purification were conducted; 2) the recovered product was digested by DNase enzyme, and then subjected to electrophoresis with 1.2% agarose after digestion, fragments with a size of 100 bp, 200 bp or 300 bp were cut off for gel recovery and purification; 3) a first round of PCR of gene shuffling was conducted using 3 L of the gel recovery product from step 2) as a template, without any primer in this round of PCR, and then 60 cycles of amplification were done; 4) 10 L of PCR products from step 3) were subjected to electrophoresis to see if there were big fragments with a continuous range. If it was as expected, the remaining PCR products were used as templates for the next round of PCR; 5) 0.5 L of PCR products from step 3) were used as the template for the next round of PCR, in which primers designed to have enzyme cutting sites were used as PCR primers, and 60 cycles of amplification were done; 6) the PCR products from step 5) was subjected to electrophoresis with 1% agarose gel, single bands bigger than 500 bp were cut off for gel recovery and purification; 7) double enzyme digestion was conducted on the gel recovery products from step 6) using restriction endonucleases, electrophoresis was conducted with 1% agarose gel after double enzyme digestion, the target fragments were cut off and frozen with liquid nitrogen and the gel was removed, then they were ligated with pADV5 vectors which were also subjected to the same double enzyme digestion. Thus, a plurality of pADV5 vectors carrying gene mutants of Oryza sativa EPSPS gene were obtained.

(58) (2) Transforming EDCE (E. coli DH5 with EPSPS Gene and C-P Lyase Genes being Knocked Out)

(59) EDCE competent cells were prepared with a conventional method. The above ligation product (pADV5 vectors carrying Oryza sativa EPSPS mutant gene) was added to 50 L EDCE competent cells. They were fully mixed and left on ice for 30 min, then heat-shocked at 42 C. for 90 s, and left in ice bath for 2 min. Then they were added to 500 L of LB liquid culture medium and cultured under shaking at a low speed (150 r/min) at 37 C. for 90 min.

(60) pADV5 vectors carrying Oryza sativa EPSPS mutant gene were transformed into EDCE to give mutant strain, i.e. Oryza sativa EPSPS gene mutant library. The Oryza sativa EPSPS gene mutant library contains numerous Oryza sativa EPSPS mutant genes. Every single mutant strain is equivalent to an Oryza sativa EPSPS gene mutant plant. Therefore, when used to screen the same order of magnitude of Oryza sativa EPSPS mutant genes, compared with the existing screening methods, the present screening method skips the culture period of Oryza sativa and saves the acreage to be occupied, with much less time and high efficiency, and convenient and easy operations, especially, requiring a very small space and enabling screening just on culture media.

(61) Step 3, is to inoculate the above mutant strain on screening culture media for resistance screening.

(62) A plurality of the above obtained mutant strains were inoculated on a plurality of screening culture media with different concentrations of glyphosate, respectively (the screening culture media contained different concentrations of glyphosate, and the glyphosate concentrations contained in them were 10 mM, 20 mM, 50 mM, etc., respectively, having a gradient in glyphosate concentrations, and of course, the glyphosate concentration may be set as required), and cultured at 37 C. overnight. The screening culture media were obtained by using M9 as a basal medium, to which certain concentrations of antibiotics, including Specs (Spectinomycin), Gen (Gentamycin) and Amp (Ampicillin), and different concentrations of glyphosate were added. M9 culture medium consists of the following ingredients: 1314 g/L of Na.sub.2HPO.sub.4, 5.76.3 g/L of KH.sub.2PO.sub.4, 0.91.1 g/L of NaCl, 1.82.2 g/L of NH.sub.4Cl, 3743 g/L of glucose, 4852 g/L of MgSO.sub.4.7H.sub.2O and 2123 g/L of CaCl.sub.2.

(63) Step 4, is sequencing and verification.

(64) Monoclonal resistant strains growing on the screening culture media were selected and separated so as to check for their glyphosate resistance, and they were sequenced and verified, giving glyphosate-resistant Oryza sativa EPSPS mutant gene sequences. One of the Oryza sativa EPSPS mutant genes is taken as an example for explanation. As can be seen in SEQ ID NO.4, its nucleotide sequence consists of 1365 bases. This Oryza sativa EPSPS mutant gene (which was named as OsEM gene) was compared with wild type Oryza sativa EPSPS gene (which was named as OsE gene) in terms of their nucleotide sequences (as shown in SEQ ID NO.1) and the amino acid sequences they coded. FIG. 3 shows the result. In the Oryza sativa EPSPS mutant gene, in a direction from 5 terminal to 3 terminal, the base on site 209 mutates from C to G, the base on site 240 mutates from T to C, two consecutive bases on site 346 and site 347, mutate from CT to TC, the base on site 396 mutates from T to C, the base on site 453 mutates from A to G, the base on site 606 mutates from C to T, and the base on site 831 mutates from A to G. Only the base on site 209 mutates from C to G, causing site 70 (from the amino terminal to the carboxyl terminal) in the amino acid residue sequence it codes to mutate from alanine residue to glycine residue. And two consecutive bases on site 346 and site 347 mutate from CT to TC, causing site 116 in the amino acid residue sequence it codes to mutate from leucine residue to serine residue. The remaining mutation of bases does not cause changes of amino acid residues they code.

(65) For glyphosate resistance testing of Oryza sativa EPSPS mutant gene, E. coli (EPSPS gene-and-C-P lyase genes-deleted strain) respectively transformed with OsEM gene (experimental group) and OsE gene (control group) were inoculated to culture media containing 0 mM, 1 mM, 5 mM, 10 mM, 20 mM, 50 mM and 100 mM glyphosate to see the growth of E. coli (indicated by growth saturation index: saturation index=0, no growth; saturation index=1, minor growth; saturation index=2, growth to half-saturation; saturation index=3, vigorous growth, but still not saturated; saturation index=4, rapid growth, meaning the strains have reached the maximum (saturation) concentration or the growth has reached the limit). Table 2 shows the result.

(66) TABLE-US-00002 TABLE 2 Growth saturation index of E. coli transformed with OsEM gene and OsE gene in culture media with different concentrations of glyphosate Growth saturation index 0 1 5 10 20 50 100 Gene mM mM mM mM mM mM mM OsE 4 0 0 0 0 0 0 OsEM 4 4 4 4 4 4 0

(67) As can be seen from Table 2, both the experimental group (containing OsEM gene) and the control group (containing OsE gene) show normal growth (the saturation index of both being 4) on the culture medium containing 0 mM glyphosate; on culture media containing 1 mM, 5 mM, 10 mM, 20 mM and 50 mM glyphosate, the strains of control group cannot grow (the saturation index being 0), whereas the experimental group shows normal growth (the saturation index being 4); on the culture medium containing 100 mM glyphosate, neither the experimental group nor the control group shows normal growth (the saturation index being 0). This indicates that the Oryza sativa EPSPS mutant gene (see SEQ ID NO.4 for its nucleotide sequence) screened in the present example can provide EPSPS gene-and-C-P lyase genes-deleted E. coli with glyphosate resistance so that the E. coli can grow on a culture medium containing up to 50 mM glyphosate.

(68) The glyphosate-resistant mutant gene, e.g. Oryza sativa EPSPS mutant gene, obtained by screening with the method for screening glyphosate-resistant gene provided by the present example of the present disclosure is resistant to 50 mM glyphosate. See SEQ ID NO.4 for its nucleotide sequence.

(69) Directly using the glyphosate-resistant mutant gene, e.g. Oryza sativa EPSPS mutant gene, (see SEQ ID NO.4 for its nucleotide sequence) obtained by screening by the method for screening glyphosate-resistant gene provided by the present example of the present disclosure to transform rice or soybean or other plants provides the transformed plants with glyphosate resistance. Sure, transformation methods commonly used in the field of gene engineering may be used, e.g. Agrobacterium-mediated method, gene gun-mediated transformation, protoplast-mediated method, or electroporation, to transform rice or soybean or other plants so that the transformed plants get resistance to glyphosate.

Example 2

(70) The screening method provided by the present disclosure is described in the present example wherein Glycine max was used as the target plant, the exogenous gene was Glycine max EPSPS gene (see SEQ ID NO.5 for its nucleotide sequence), an EPSPS gene-and-C-P lyase genes-deleted strain obtained by directly knocking out the EPSPS gene and C-P lyase genes in wild E. coli DH5 using homologous FRT method was used as a host strain. See Table 3 for the names of primers used in the present example and their nucleotide sequences.

(71) Step 1, is to knock out the C-P lyase genes of the E. coli DH5.

(72) The EPSPS gene and C-P lyase genes in E. coli DH5 strain were knocked out using FRT method. The knock-out was carried out in two steps. The C-P lyase genes was knocked out first, and then the EPSPS gene was knocked out.

(73) 1. Preparation of E. coli DH5 Competent Cells Containing pKD46 Plasmid

(74) 0.5 L of pKD46 plasmid (see FIG. 2 for its structure) was used to transform E. coli DH5 competent cells. Positive colonies were screened on an LB culture medium plate (containing Amp 00).

(75) Positive monoclonal colonies were selected to be inoculated in small amount of M9-sucrose liquid culture medium (containing sucrose), and cultured overnight at shaking speed of 180 rpm and temperature of 30 C.

(76) After culturing, they were inoculated in larger amount of M9-sucrose liquid culture medium (containing sucrose+100 g/mL Amp+10 mM L-arabinose) at a ratio of 1:10, and cultured at 30 C. until OD600 of the culture reaches about 0.7.

(77) The above strain culture was cooled on ice for 20 min. The microbial cells were recovered by centrifuging at 4 C. and 4000 rpm, resuspended with 40 mL of pre-cooled 10% (v/v) glycerol, and repeatedly washed for 3 times. The supernatant was discarded. Then the residues were resuspended with 400 L of pre-cooled 10% glycerol and divided and packed by 100 L/tube, thus giving DH5 resistant to Amp.

(78) 2. Knocking Out the C-P Lyase Genes in E. coli DH5

(79) Forward primer C-P lyase_P15 and reverse primer C-P lyase_P13 (see Table 3) were used to conduct PCR amplification with E. coli DH5 genome being used as a template. P1 fragment was obtained. See SEQ ID NO.6 for the nucleotide sequence of P1 fragment.

(80) Forward primer C-P lyase_P25 and reverse primer C-P lyase_P23 were used to conduct PCR amplification with E. coli DH5 genome being used as a template. P2 fragment was obtained. See SEQ ID NO.7 for the nucleotide sequence of P2 fragment.

(81) P1 and P2 were purified through 1% agarose electrophoresis. Thereby, purified PCR products were obtained. They were added to plasmid containing Gen resistant fragments in proportion to make a mixing pool which was used as a template for PCR amplification using forward primer C-P lyase_P15 and reverse primer C-P lyase_P23. Thereby, PRC fragment with a length of 1586 bp was obtained. See SEQ ID NO.21 for its nucleotide sequence.

(82) 50 L of E. coli DH5 competent cells (Amp-resistant DH5) were gently mixed with 30 L of purified PRC fragments. Then they were placed in a 0.1 cm pre-cooled electroporation cuvette and subjected to electroporation by Bio-Rad electroporator at 1.8 kV.

(83) They were quickly added to 1 mL of M9-sucrose liquid culture medium containing 10 mM of arabinose, cultured at 30 C. for 1 h and then spread on a plate of LB solid culture medium (containing 100 g/mL of Amp and 30 g/mL of Gen) so as to screen recombinant strains resistant to both Amp and Gen, which were then cultured at 30 C. overnight.

(84) After the culture, forward primer C-P lyase_5UTR and reverse primer C-P lyase_Gen3 were used to screen positive clones containing Gen gene to prove the presence of Gen gene.

(85) The positive clones were inoculated on an LB+Amp liquid culture medium and cultured at 30 C. overnight (12 hr), then transferred to a fresh LB liquid culture medium and further cultured at 30 C. for 12 hr.

(86) The culture solution was diluted to a proper concentration and then spread on an LB plate. Forward primer C-P lyase_5UTR and reverse primer lyase_3DSR were used to screen clones without Gen gene.

(87) The monoclones were selected to be sequenced. The strain were preserved and named as DH46C-P lyase. DH46C-P lyase is E. coli DH5 with C-P lyase genes being knocked out.

(88) TABLE-US-00003 TABLE3 Nameofprimersusedinthepresentexample andtheirnucleotidesequences SEQ. ID. Primername Nucleotidesequence(5-3) NO C-Plyase_P15 ccgaccagctacccaacacgctatc 42 C-Plyase_Pl3 ggggatcctctagagtcgacgcagacgc 43 cctgacggcgctgta C-Plyase_P25 gggtaccgagctcgaattctcagaattg 44 ccttcgcggtgacggatgagg C-Plyase_P23 tcagcacacctccacatgagtggttc 45 C-Plyase_5UTR tgctggatttcctctctcaacg 46 C-Plyase_Gen3 atttaacataatatacattatgcgcacc 47 C-Plyase_3DSR gctatcctcttcaaacttcgccagc 48 EcEPSPS_P35 tccctgacgttacaacccatcgc 49 EcEPSPS_P33 ggggatcctctagagtcgacgcactcca 50 gggcaccttctgcgtg EcEPSPS_P45 ggtaccgagctcgaattctcagaattgc 51 gaccatttgctggggcga EcEPSPS_P43 cggaggagtgatacgaatgtaatcg 52 EcES25 gcgctgacagacttcatggttg 53 EcES23 caacttacattgacaagcgacgc 54

(89) 3. Knocking Out the EPSPS Gene of DH46C-P Lyase (E. coli DH5 with C-P Lyase Genes being Knocked Out)

(90) (1) Preparation of DH46C-P Lyase Competent Cells

(91) The preserved DH46C-P lyase was subjected to streaking on an LB+Amp plate, and cultured at 30 C. overnight. Positive monoclonal colonies were selected and inoculated in small amount of M9-sucrose liquid culture medium and cultured at shaking speed of 180 rpm and temperature of 30 C. overnight.

(92) After culturing, they were inoculated in larger amount of M9 liquid culture medium (containing sucrose+100 g/mL Amp+10 mM L-arabinose) at a ratio of 1:10, and cultured at 30 C. until OD600 of the culture reaches 0.7.

(93) The above strain solution (containing DH46C-P lyase) was cooled on ice for 20 min. The microbial cells were recovered by centrifuging at 4 C. and 4000 rpm, resuspended with 40 mL of pre-cooled 10% (v/v) glycerol, and repeatedly washed for 3 times. The supernatant was discarded. Then the residues were resuspended with 400 L of pre-cooled 10% glycerol and divided and packed by 100 L/tube.

(94) (2) Amplification of Homologous PCR Fragment

(95) Forward primer EcEPSPS_P35 and reverse primer EcEPSPS_P33 were used to conduct amplification with the genome DNA of the DH46C-P lyase strain being used as a template. Product P3 fragment was obtained. See SEQ ID NO.8 for the nucleotide sequence of P3 fragment.

(96) Forward primer EcEPSPS_P45 and reverse primer EcEPSPS_P43 were used to conduct amplification with the genome DNA of the DH46C-P lyase being used as the template. Product P4 fragment was obtained. See SEQ ID NO.9 for the nucleotide sequence of P4 fragment.

(97) P3 fragment and P4 fragment were purified through 1% agarose electrophoresis. Then they were added to plasmid containing Gen-resistant fragments in proportion to make a mixing pool which was used as a template for amplification using EcEPSPS_P35 and EcEPSPS_P43 as primers. Product PRE fragment with a length of 1607 bp was obtained. See SEQ ID NO.22 for its nucleotide sequence.

(98) (3) Transformation by Heat Shock

(99) 50 L of DH46C-P lyase competent cells were gently mixed with 35 L of purified PRE fragments. Then they were placed in a 0.1 cm pre-cooled electroporation cuvette and subjected to electric shock by Bio-Rad electroporator at 1.8 kV.

(100) They were quickly added to 1 mL of M9-sucrose liquid culture medium containing 10 mM arabinose, cultured at 37 C. for 1 hr and then spread on LB solid culture medium so as to screen the recombinant strains which were at 30 C. cultured overnight. The next day, primers EcEPSPS_P35 and EcEPSPS_P43 were used to screen positive clones containing Gen gene to prove the presence of Gen gene.

(101) The positive clones were inoculated in LB liquid culture medium and cultured at 37 C. overnight (12 hr), then transferred to fresh LB liquid culture medium and further cultured at 37 C. for 12 hr.

(102) The culture solution was diluted to a proper concentration and then coated on a LB plate. Forward primer EcES25 and reverse primer EcES23 were used to screen clones without GM gene.

(103) Monoclones were selected to be sequenced. The strain was preserved and named as DH5PhnFGHEPSPS. DH5PhnFGHAEPSPS is a E. coli DH5 strain with C-P lyase genes and EPSPS gene being knocked out, i.e. EPSPS gene-and-C-P lyase genes-deleted strain.

(104) It is to be noted that DH5PhnFGHEPSPS is a knock-out strain without antibiotic gene. Most of PhnF genes, all PhnG genes and part of PhnH genes and those genes which degrade phosphonates, typically glyphosate, in E. coli DH5 were knocked out. See SEQ ID NO.11 for the nucleic acid sequence fragments of the nucleic acid fragments of the upstream sequence connected to 5 terminal and the downstream sequence connected to 3 terminal of FRT DNA fragment. Located on site 1 to site 318 were 5 terminal of E. coli PhnF gene and its upstream sequence. The nucleotide sequence from site 319 to site 347 was FRT fragment. Located on site 348 to site 1021 were 3 terminal of E. coli PhnH gene and its downstream sequence. In addition, most of the EPSPS genes in DH5PhnFGHEPSPS were replaced with FRT fragments, as shown in SEQ ID NO.12. Located on site 1 to site 357 was 5 terminal sequence of E. coli EPSPS gene. Located on site 358 to site 386 was FRT fragment. Located on site 387 to site 818 was terminal sequence of E. coli EPSPS gene 3.

(105) Step 2, is to, using the EPSPS gene-and-C-P lyase genes-deleted strain obtained in step 1 of the present example as a host strain, introduce Glycine max EPSPS gene from Glycine max into the host strain, so as to obtain mutant strain, i.e. Glycine max EPSPS gene mutant library.

(106) A conventional method was used to clone the Glycine max EPSPS gene to pADV5 vector which was then used to transform the host strain DH5PhnFGHEPSPS.

(107) The transformed DH5PhnFGHEPSPS were inoculated to MA liquid culture medium (M9 basal culture medium+100 g/mL Amp) and cultured at 37 C. and 300 r/min overnight.

(108) The strain solution, which had become turbid, was subjected to radiation-induced mutagenesis, e.g. exposure to ultraviolet for 2-5 min, for the Glycine max EPSPS gene to mutate, so as to obtain corresponding Glycine max EPSPS mutant gene, and thus mutant strain is Glycine max EPSPS gene mutant library. Sure, this step may also be done by chemical mutagenesis, i.e. adding a chemical mutagen e.g. EMS or DES to a MA culture medium for the Glycine max EPSPS gene to mutate.

(109) Step 3, is screening culture.

(110) Five L of the above strain solution containing mutant strain was added to screening culture medium and further cultured at 300 r/min and 37 C. overnight.

(111) Step 4, is sequencing and verification.

(112) Monoclonal resistant strains growing on the screening culture medium were screened and separated so as to check for glyphosate resistance, and they were sequenced and verified, giving glyphosate-resistant Glycine max EPSPS mutant gene sequences.

(113) One of the Glycine max EPSPS mutant genes is taken as an example for explanation. As can be seen in SEQ ID NO.10, its nucleotide sequence consists of 1368 bases. This Glycine max EPSPS mutant gene (which is named as GmEM gene) is compared with wild type Glycine max EPSPS gene (which is named as GmE gene) in terms of their nucleotide sequences (as shown in SEQ ID NO.5) and the amino acid sequences they code. FIG. 4 shows the result. In this Glycine max EPSPS mutant gene, in a direction from 5 terminal to 3 terminal, a base G is inserted between site 6 and site 8, and a base A is deleted between site 45 and site 46, causing frameshift mutation on the bases from site 7 to site 44. Accordingly, mutation happens on bases from site 3 to site 15 (from amino acid terminal and carboxyl terminal) in the amino acid residue sequence coded by this fragment (as shown in FIG. 4). In addition, the base on site 629 mutates from A to T, causing the amino acid residue on site 210 in the amino acid residue sequence to mutate from glutamic acid residue to valine residue. The base on site 1110 mutates from A to G, while base on site 1125 mutates from T to C, on both of which the mutation of the bases does not cause mutation of the corresponding amino acid residue they code.

(114) For glyphosate resistance testing of Glycine max EPSPS mutant gene, E. coli (EPSPS gene-and-C-P lyase genes-deleted strain) respectively transformed with GmEM gene (experimental group) and GmE gene (control group) were inoculated to culture media containing 0 mM, 1 mM, 5 mM, 10 mM, 20 mM, 50 mM and 100 mM glyphosate to see the growth of E. coli. Table 4 shows the result.

(115) TABLE-US-00004 TABLE 4 Growth saturation index of E. coli transformed with GmEM gene and GmE gene in culture media with different concentrations of glyphosate Growth saturation index 0 1 5 10 20 50 100 Gene mM mM mM mM mM mM mM GmE 4 0 0 0 0 0 0 GmEM 4 4 4 4 4 3 0

(116) As can be seen from Table 4, on the culture medium containing 0 mM glyphosate, both the experimental group (containing GmEM gene) and the control group (containing GmE gene) show normal growth (saturation index being 4); but on culture media containing 1 mM, 5 mM, 10 mM and 20 mM glyphosate, the strains in the control group cannot grow normally, whereas the experimental group shows normal growth (the saturation index being 4); on the culture medium containing 50 mM glyphosate, the strains in the control group cannot grow normally, whereas the experimental group shows vigorous growth (the saturation index being 3); on the culture medium containing 100 mM glyphosate, neither the experimental group nor the control group shows normal growth (the saturation indexes of both being 0). This indicates that the Glycine max EPSPS mutant gene (see SEQ ID NO.10 for its nucleotide sequence) obtained by screening in the present example can provide EPSPS gene-and-C-P lyase genes-deleted E. coli with glyphosate resistance so that the E. coli can grow on a culture medium containing up to 50 mM glyphosate.

(117) The glyphosate-resistant Glycine max EPSPS mutant gene obtained by screening with the method for screening glyphosate-resistant mutant genes provided by the present example of the present disclosure is resistant to 50 mM glyphosate. See SEQ ID NO.10 for its nucleotide sequence.

(118) Directly using the glyphosate-resistant Glycine max EPSPS mutant gene (see SEQ ID NO.10 for its nucleotide sequence) obtained by screening with the method for screening glyphosate-resistant mutant genes provided by the present example of the present disclosure to transform soybean or rice or other plants provides the transformed plants with glyphosate resistance.

Example 3

(119) The present example provides a knock-out strain. Specifically, the knock-out strain is an EPSPS gene-and-C-P lyase genes-deleted strain. The EPSPS gene-and-C-P lyase genes-deleted strain is obtained by knocking out the EPSPS gene and C-P lyase genes in any one of E. coli DH5, TOP10 and BL21 by a gene knock-out technology. Specifically, the gene knock-out method used in the present example is same as that used in Example 1 or Example 2.

(120) The EPSPS gene-and-C-P lyase genes-deleted strain provided by the present example may be applied in testing the functions of EPSPS gene from a target plant. Specifically, the EPSPS gene-and-C-P lyase genes-deleted strain of the present example is used as a host strain. The EPSPS gene from the target plant is introduced into the host strain which are then placed on basal culture media being free of amino acid or protein i.e. limiting culture media for culture. It is demonstrated that the EPSPS gene from the target plant is capable of expressing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) and the EPSPS has normal biological activity, If normal growth of colonies are observed on the limiting culture media.

(121) The EPSPS gene-and-C-P lyase genes-deleted strain provided by the present example may also be applied in testing the glyphosate resistance of the EPSPS gene from a target plant. Specifically, the EPSPS gene-and-C-P lyase genes-deleted strain of the present example is used as a host strain. The EPSPS gene of the target plant is introduced to the host strain which is then placed on M9 culture media containing different concentrations of glyphosate for culture, e.g. on M9 culture media containing 10 mM, 20 mM and 50 mM glyphosate, so as to test the glyphosate resistance of the EPSPS gene from the target plant.

(122) The EPSPS gene-and-C-P lyase genes-deleted strain provided by the present example may be applied in screening glyphosate-resistant EPSPS mutant gene from a target plant. See the method for screening glyphosate-resistant EPSPS mutant genes provided in Example 1 or Example 2.

(123) To sum up, by the screening method provided by the examples of the present disclosure, an EPSPS gene-and-C-P lyase genes-deleted strain is constructed, an exogenous EPSPS gene from a target plant is introduced into the EPSPS gene-and-C-P lyase genes-deleted strain which is used as a host strain, so as to obtain mutant strain containing an exogenous EPSPS mutant gene, i.e. an exogenous EPSPS gene mutant library, and then glyphosate-resistant EPSPS mutant genes are screened from the exogenous EPSPS gene mutant library. Due to fast reproduction speed and small size of E. coli, the screening method of the present disclosure overcomes the problems of long period and large acreage needed in the current field screening methods. Therefore, the screening method of the present disclosure is characterized by short period, very small space, simple operation, in term of operation of directed screening of glyphosate-resistant EPSPS mutant gene. Furthermore, using EPSPS gene-and-C-P lyase genes-deleted E. coli as a host strain, the screening method provided of the present disclosure effectively avoids the situation where resistance to glyphosate is developed as a result of mutation of the EPSPS genes and C-P lyase genes of the host strain themselves. Therefore, the screening results are more scientific and reliable. The screened gene mutant of EPSPS gene from plants can substantially improve the screening speed and shorten the time. Normally, it takes only 1-2 weeks to finish the screening and obtain mutant genes resistant to glyphosate, reducing the cost of screening. In addition, the glyphosate-resistant mutant gene obtained by the screening method provided by the present disclosure can be also used to transform corresponding plant species. The present method breaks through the bottleneck of most existing methods, only resistant genes from microorganism can be transformed to crops, helping elimination of the bias that the public have against transgenic plants, and thus facilitating the development and promotion of transgenic technology. Furthermore, the EPSPS gene-and-C-P lyase genes-deleted strain provided by the present disclosure can be applied in testing the functions of an EPSPS gene from a plantand also in testing the glyphosate resistance of an EPSPS gene from a plant. The application is convenient and the result is more scientific and reliable.

(124) The above description only shows the preferable embodiments of the present disclosure and is not intended to limit the present disclosure. Various modifications and variations of the present disclosure will occur to those skilled in the art. Any modifications, equivalent replacements and improvements made within the spirit and principle of the present disclosure shall be encompassed by the scope of protection of the present disclosure.