Bone bioactive composition and uses thereof

Abstract

A bone bioactive composition and kits comprising the composition, means for applying it and/or a metal implant are provided. The bone bioactive composition comprises a water-based salt solution comprising sodium dihydrogen phosphate and sodium chloride, and may also comprise additional elements. The composition and the kits are useful for promoting osteogenesis, particularly when a metal implant is used but also in case of periodontal diseases.

Claims

1. A method for promoting osteogenesis, the method comprising: (a) when the osteogenesis is promoted in an implant: submerging the implant in a bone bioactive composition comprising a water based salt solution comprising disodium hydrogen phosphate in a concentration from 8 to 12 mM in the solution, sodium chloride in a concentration from 130 to 140 mM in the solution, potassium hydrogen phosphate in a concentration from 1.4 to 2.2 mM in the solution, and potassium chloride in a concentration from 2.3 to 3.1 mM in the solution, wherein the pH of the solution is between 7.0 and 7.6, and directly inserting the implant into the bone of a subject in need; and (b) when the osteogenesis is promoted in a subject in need thereof, administering an effective amount of a bone bioactive composition comprising a water-based salt solution comprising disodium hydrogen phosphate in a concentration from 8 to 12 mM in the solution, sodium chloride in a concentration from 130 to 140 mM in the solution, potassium hydrogen phosphate in a concentration from 1.4 to 2.2 mM in the solution, and potassium chloride in a concentration from 2.3 to 3.1 mM in the solution, to a subject in need thereof, wherein the pH of the solution is between 7.0 and 7.6; wherein the bone bioactive composition in (a) and (b) does not comprise a growth factor; and wherein the water-based salt solution of the bone bioactive composition in (a) and (b) is the promoter of the osteogenesis.

2. The method according to claim 1, wherein the solution further comprises a calcium salt and a salt of a divalent metal different from calcium.

3. The method according to claim 2, wherein the calcium salt is in a concentration from 7 to 15 mM in the solution and the salt of a divalent metal different from calcium is in a concentration from 2 to 12 mM in the solution.

4. The method according to claim 2, wherein the calcium salt is calcium chloride and the salt of a divalent metal different from calcium is magnesium chloride.

5. The method according to claim 1, wherein the solution further comprises a chelating agent.

6. The method according to claim 5, wherein the chelating agent is EDTA.

7. The method according to claim 1, wherein the pH of the solution is between 7.4 and 7.6.

8. The method according to claim 7, wherein the pH of the solution is 7.6.

9. The method according to claim 1, wherein the implant is a dental titanium implant.

10. A bone bioactive composition comprising a water-based salt solution comprising disodium hydrogen phosphate in a concentration from 8 to 12 mM in the solution, sodium chloride in a concentration from 130 to 140 mM in the solution, potassium hydrogen phosphate in a concentration from 1.4 to 2.2 mM in the solution, potassium chloride in a concentration from 2.3 to 3.1 mM in the solution, a calcium salt in a concentration from 7 to 15 mM in the solution, a salt of a divalent metal different from calcium in a concentration from 2 to 12 mM in the solution, and a chelating agent, wherein the pH of the solution is between 7.0 and 7.6.

11. The bone bioactive composition according to claim 10, wherein the calcium salt is calcium chloride and the salt of a divalent metal different from calcium is magnesium chloride.

12. The bone bioactive composition according to claim 11, comprising 10 mM disodium hydrogen phosphate, 137 mM sodium chloride, 1.8 mM potassium hydrogen phosphate, 2.7 mM potassium chloride, 8.4 mM magnesium chloride, 10.81 mM calcium chloride, and 68.4 mM EDTA.

13. The bone bioactive composition according to claim 10, wherein the water-based salt solution is prepared using solid forms of the following: the disodium hydrogen phosphate, the sodium chloride, the potassium hydrogen phosphate, the potassium chloride, the calcium salt, the salt of a divalent metal different from calcium, and the chelating agent.

14. A kit comprising the bone bioactive composition as defined in claim 10 and an implant.

15. A method for promoting osteogenesis, the method comprising administering an effective amount of a bone bioactive composition according to claim 10 to a subject in need thereof.

16. A method for promoting osteogenesis, the method comprising: (a) when the osteogenesis is promoted in an implant: submerging the implant in a bone bioactive composition comprising a water based salt solution comprising disodium hydrogen phosphate in a concentration from 8 to 12 mM in the solution, sodium chloride in a concentration from 130 to 140 mM in the solution, potassium hydrogen phosphate in a concentration from 1.4 to 2.2 mM in the solution, and potassium chloride in a concentration from 2.3 to 3.1 mM in the solution, wherein the pH of the solution is between 7.0 and 7.6, and directly inserting the implant into the bone of a subject in need; and (b) when the osteogenesis is promoted in a subject in need thereof, administering an effective amount of a bone bioactive composition comprising a water-based salt solution comprising disodium hydrogen phosphate in a concentration from 8 to 12 mM in the solution, sodium chloride in a concentration from 130 to 140 mM in the solution, potassium hydrogen phosphate in a concentration from 1.4 to 2.2 mM in the solution, and potassium chloride in a concentration from 2.3 to 3.1 mM in the solution, to a subject in need thereof, wherein the pH of the solution is between 7.0 and 7.6; and wherein the water-based salt solution of the bone bioactive composition in (a) and (b) is the promoter of the osteogenesis; and wherein the bone active composition does not comprise a further ingredient which promotes osteogenesis.

17. The method of claim 16, wherein the solution further comprises a calcium salt and a salt of a divalent metal different from calcium.

18. The method of claim 16, wherein the solution further comprises a chelating agent.

19. The method according to claim 16, wherein the pH of the solution is between 7.4 and 7.6.

20. The method according to claim 16, wherein the implant is a dental titanium implant.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. RT-PCR gene expression analysis of differentiation markers (OC, COL I, RUNX2, ALP and ITGa4) at the second week of cell differentiation. GAPDH was used as a housekeeping gene. A: Titanium disc Ti-6Al-4V (AB/AE) treated with bone bioactive composition. B: Titanium disc Ti-6Al-4V with Calcium phosphate (Plate) treated with bone bioactive composition.

(2) FIG. 2. Q RT-PCR analysis of osteogenic markers (COL I, BMP2 and OCN) of DPPSC at days 21 of cell differentiation. GAPDH was used as a housekeeping gene.

(3) FIG. 3. ALP activity. Calcium activity analysis of DPPSC and DPMSC at days 3, 11 and 20 of cell differentiation on titanium discs treated with bone bioactive composition. GAPDH was used as a housekeeping gene.

(4) FIG. 4. ALP activity analysis of DPPSC and DPMSC at days 3, 11 and 20 of cell differentiation on titanium discs treated with bone bioactive composition. GAPDH was used as a housekeeping gene.

(5) FIG. 5. Histomorphometric analysis of experimental rabbits with group A at 15, 30, 45 and 60 days.

(6) FIG. 6. Histomorphometric analysis of experimental rabbits with group B at 15, 30, 45 and 60 days.

(7) FIG. 7. Histomorphometric analysis of experimental rabbits with group C at 15, 30, 45 and 60 days.

(8) FIG. 8. Quantifications of new bone formation of experimental rabbits with group A, B and C at 15, 30, 45 and 60 days.

(9) FIG. 9. Q RT-PCR analysis of osteogenic markers (OC, OCN and ALP) of DPPSC at day 7 of cell differentiation on treated titanium discs. GAPDH was used as a housekeeping gene. Expression related to no treatment discs.

(10) FIG. 10. Surgical procedure for the in vivo study in dog. A. Filling of the 3 bone defects with biomaterial (Straumann XenoGraft) and the bone bioactive composition. B: Surgical area with membrane. C. Surgical area with 3/0 suture. This figure is related to Example 6.

(11) FIG. 11. Evolution of the in vivo study in dog with Straumann XenoGraft with the bone bioactive composition, 60 days after surgery. A: Sampling after 60 days using a 5 mm trephine (the lower left image corresponds to 2-month with only Straumann XenoGraft). B: RX analysis. C: Histological analysis. This figure is related to Example 6.

(12) FIG. 12. Sample radiological examination. Comparison between control (no biomaterial), Straumann XenoGraft alone and Straumann XenoGraft with Bone bioactive composition (BBL), after 2 months of surgery. This figure is related to Example 5.

(13) FIG. 13. Histological study. A. Test group: Dentum with bone bioactive composition (BBL). B. Control group: Dentum alone. This figure is related to Example 6.

(14) FIG. 14. SEM of 3D differentiation of DPPSCs at P4 using a human dental root scaffold for 21 days into periodontal tissues. DPPSC group (A1, A2, A3) treated surface with BBL. After 3 weeks of differentiation, collagen fibers (white arrows), some blood vessels (black arrows), fibrous tissue and some cemento blast-like cells (yellow arrow) was produced in the sample. Control group (B1, B2, B3) human periodontal tissue in different augmentations (5000, 15000 and 30000). Control group (C1,C2,C3) where is not shown the presence of cells or tissues. This figure is related to Example 7.

(15) FIG. 15. Histological analysis sections of the DPPSC group (A2-3; B2-3; C2-3) comparing with the control group (A1, B1, C1) with 3 different dyes: Masson's trichrome stain (A1, A2, A3); alcian blue (B1,B2,B3) and Haematoxylin and eosin (H&E) (C1, C2, C3). The DPPSC group (A2-3; B2-3; C2-3) showed the formation of collagen fibers (black arrows) inserted perpendicularly into the cementum-like tissues, which resembled Sharpey's fibers in contrast to the controls (A1, B1, C1). This figure is related to Example 7.

EXAMPLES

Example 1. Influence of the Bone Bioactive Composition in the Expression of Bone Markers in In Vitro Cell Cultures

(16) Cell Isolation:

(17) 1. Culture in DPPSC Medium

(18) Cells were cultured on 75 cm.sup.2 flask with DPPSC medium containing as base medium 60% Dulbecco modified Eagle's medium (DMEM)-low glucose (Sigma, United States) and 40% MCDB-201 (Sigma, United States) supplemented with 1 insulin-transferrin-selenium (hereinafter, ITS; Sigma, United States), 1 linoleic acid-bovine serum albumin (hereinafter, LA-BSA; Sigma, United States), dexamethasone 10.sup.9M (Sigma, United States), 10.sup.4 M ascorbic acid 2-phosphate (Sigma, United States), 100 units of penicillin 1000 units of streptomycin (PAA, Life Technologies, USA), 2% foetal bovine serum (hereinafter, FBS; Sigma, United States), 10 ng/ml of Human Platelet Derived Growth Factor-BB (hereinafter, hPDGF-BB; R & D Systems, United States) and 10 ng/ml of Epidermal Growth Factor (hereinafter, EGF; R & D Systems, United States). The flasks were previously covered with 10 ml of 100 ng/ml fibronectin (Life Technologies, USA) and incubated at 37 C., 5% CO.sub.2 concentration during 1 hour.

(19) During the two weeks of primary culture, the medium was changed every 3 days and the cells confluence was maintained at 30%, since higher rates of confluence lead to cell maturation and changes in morphology and genotype.

(20) 2. Culture in DPMSC Medium (Hereinafter, Cells Cultured Under these Conditions are Referred as DPMSCs)

(21) Cells were cultured on 75 cm.sup.2 flask with DPMSC medium containing Dulbecco modified Eagle's medium (DMEM) (Biochrom, United Kingdom) supplemented with 2 ng/ml basic Fibroblast Growth Factor (hereinafter, bFGF) and 10% FBS (Hyclone, USA). The flasks were previously covered with 10 ml of 100 ng/ml fibronectin (Life Technologies, USA) and incubated at 37 C., 5% CO2 concentration during 1 hour.

(22) Cells were seeded at 300,000 cells/cm.sup.2 density, and the medium was changed every three days. The confluence was settled at 50-80% in order to maintain cell morphology and multipotency.

(23) 3. Culture in Saos Medium (Hereinafter, Cells Cultured Under these Conditions are Referred as Saos Cells)

(24) Subculture P 12 cells were seeded at 500,000 cells/cm.sup.2 density, and the medium was changed every three days. The confluence was settled at 80% were unfreezed and seeded in 75 cm.sup.2 flasks with Saos medium containing DMEM (Invitrogen, United States), supplemented with 10% FBS ([Hyclone, USA]), 2 mm L-Glutamine (Sigma USA), 100 u/ml penicillin (Life Technologies, USA), 1000 u/ml streptomycin (Life Technologies, USA), The flasks were previously covered with 10 ml of 100 ng/mlfibronectin (Life Technologies, USA) and incubated at 37 C., 5% CO.sub.2 concentration during 1 hour.

(25) The medium was changed every three days. The subcultures were done when cells were at 80% of confluence.

(26) Preparation of the Implants:

(27) To analyze the influence of the bone bioactive composition of the present invention in the interaction between the above-mentioned cell cultures and metal implants (more precisely, dental titanium implants), discs from the implants were prepared and treated as follows:

(28) Titanium discs were obtained by cutting commercially available titanium alloy Ti.sub.6Al.sub.4V (Ti-6Al-4V), also other discs where obtained from other titanium alloys, in particular Ti-6Al-4V Eli and Ti-5Al-2.5Sn. There were no differences in behavior between discs. The discs measured 2.0 mm in thickness and had a diameter of 14.0 mm. The surface of said discs was then alumina-blasted and acid-etched (hereinafter, AB/AE) which proportioned roughness and increased the implant (disc) surface area. The form of the probes (whether discs, plates or whatever other shape) has no influence on the results.

(29) Preparation of the Bone Bioactive Composition:

(30) 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na.sub.2HPO.sub.4, 0.24 g of KH.sub.2PO.sub.4, 0.80 g of MgCl.sub.2, 1.20 g of CaCl.sub.2 and 20 g of EDTA were dissolved in 800 ml of water. After all the components were correctly dissolved the volume of the solution was brought to 1 l. Prior to contacting the above-mentioned discs with the cell cultures, the discs were treated with 100 microliters of the bone bioactive composition, incubated at room temperature (37 C. for 1 day). This surface treatment was divided into three groups: surface treatment evaluation at 1 day, 1 month of cell culture and no surface treatment.

(31) Osteoblast Differentiation:

(32) To analyze osteoblast differentiation, the three cell populations mentioned above were cultured, independently, on the titanium discs. Cells were seeded in titanium discs of Ti.sub.6Al.sub.4V discs (treated as mentioned above, i.e., discs treated AB/AE and incubated or not with the bone bioactive composition of the present invention) in 24-well plates at a density of 110.sup.3 cells per cm.sup.2. For the different cell types used, the culture conditions for osteoblast differentiation were: DPPSCs and DPMSCs: Passage five DPPSCs and DPMSCs from the same clone were used for osseous differentiation with osteogenic medium, which contained; as base medium -MEM (Gibco) and RPMI, supplemented with 10% FBS, 10 mM -glycerol phosphate (Sigma, United States), 50 mM L-ascorbic acid (Sigma, United States)), dexamethasone 0.01 mM and 1% solution of penicillin/streptomycin. The suspension was tipped out in 75 cm.sup.2 flasks including the titanium disks with the different treatments mentioned above. The medium was changed every 3 days. Saos cells were cultured under the same conditions except for the medium, which was the same as mentioned above for these cells.

(33) Bearing in mind the above cell culture conditions, the following groups were generated and analyzed to see if there were differences in the expression of several markers of osteodifferentiation, mainly OC, COL I, RUNX-2, ALP and ITG4. As housekeeping gene, the expression of GAPFH was also analyzed: DPPSCs cultured with non-treated (i.e., without the bone bioactive composition) implant disc and under non-differentiating conditions. DPMSCs cultured with non-treated (i.e., without the bone bioactive composition) implant disk and under non-differentiating conditions. Saos cells with non-treated (i.e., without the bone bioactive composition) implant disc. DPPSCs cultured with non-treated (i.e., without the bone bioactive composition) implant disk and under osteoblast differentiating conditions. DPMSCs cultured with non-treated (i.e., without the bone bioactive composition) implant disk and under osteoblast differentiating conditions. DPPSCs cultured with treated (i.e., with the bone bioactive composition) implant disc and under non-differentiating conditions during 24 hours. DPMSCs cultured with treated (i.e., with the bone bioactive composition) implant disk and under non-differentiating conditions during 24 hours. Saos cells with treated (i.e., with the bone bioactive composition) implant disc during 24 hours. DPPSCs cultured with treated (i.e., with the bone bioactive composition) implant disk and under osteoblast differentiating conditions during 24 hours. DPMSCs cultured with treated (i.e., with the bone bioactive composition) implant disk and under osteoblast differentiating conditions during 24 hours. DPPSCs cultured with treated (i.e., with the bone bioactive composition) implant disc and under non-differentiating conditions during 30 days. DPMSCs cultured with treated (i.e., with the bone bioactive composition) implant disk and under non-differentiating conditions during 30 days. Saos cells with treated (i.e., with the bone bioactive composition) implant disc during 30 days. DPPSCs cultured with treated (i.e., with the bone bioactive composition) implant disk and under osteoblast differentiating conditions during 30 days. DPMSCs cultured with treated (i.e., with the bone bioactive composition) implant disk and under osteoblast differentiating conditions during 30 days. Human bone. Same groups were also analyzed without implant disk i.e. cultivating the cells with Titanium plate discs covered by calcium phosphate (which causes calcification).

(34) To see the RNA expression of the markers mentioned above, total RNA was extracted at 1 and 30 days of differentiation (and for the controls when was RNA extracted) using Trizol (Invitrogen, United States). The sample was treated with DNAse (Promega, United States) and, RNA was isolated following manufacturer's instructions of UltraClean Tissue & Cells RNA Isolation Kit (MoBio, United States). Two (2) g of RNA aliquots were treated with DNase I (Invitrogen, United States) and reverse-transcribed using Transcriptor First Strand cDNA Synthesis Kit (Roche, Switzerland). RT-PCR was performed using the primers on the following Table 1 for the amplification of OC, COL I, RUNX-2, ALP, ITG4, and GAPDH.

(35) TABLE-US-00004 TABLE1 PrimersusedfortheamplificationofOC,COLI,RUNX-2, ALP,ITG4,andGAPDH PRODUCT Accession SIZE GENE Number FORWARDPRIMER(5-3) REVERSEPRIMER(5-3) (bp) USE ALP NM_000478 GGACATGCAGTACGAGCTGA GTCAATTCTGCCTCCTTCCA 133 RT-PCR (SEQIDNO:1) (SEQIDNO:2) ALP NM_000478 CCGTGGCAACTCTATCTTTGG GCCATACAGGATGGCAGTGA 79 qRT-PCR (SEQIDNO:3) (SEQIDNO:4) COL1 NM_000088 ACTGGTGAGACCTGCGTGTA CAGTCTGCTGGTCCATGTA 263 RT-PCR (SEQIDNO:5) (SEQIDNO:6) COL1 NM_000088 CCCTGGAAAGAATGGAGATGAT ACTGAAACCTCTGTGTCCCTTCA 139 qRT-PCR (SEQIDNO:7) (SEQIDNO:8) OC NM_199173 GTGCAGCCTTTGTGTCCA GCTCACACCTCCCTCCT 129 RT-PCR (SEQIDNO:9) (SEQIDNO:10) OC NM_199173 AAGAGACCCAGGCGCTACCT ACCTCGTCACAGTCCGGATTG 110 qRT-PCR (SEQIDNO:11) (SEQIDNO:12) RUNX2 NM_001146038 TTACTGTCATGGCGGGTAAC GGTTCCCGAGGTCCATCTA 220 RT-PCR (SEQIDNO:13) (SEQIDNO:14) RUNX2 NM_001146038 AGCAAGGTTCAACGATCTGAGAT TTTGTGAAGACGGTTATGGTCAA 81 qRT-PCR (SEQIDNO:15) (SEQIDNO:16) ITG4 NM_002204 TCCGAGTCAATGTCCACAGA GCTGGGCTACCCTATTCCTC 88 RT-PCR (SEQIDNO:17) (SEQIDNO:18) qRT-PCR GAPDH NM_002046 CTGGTAAAGTGGATATTGTTGCCAT TGGAATCATATTGGAACATGTAAACC 81 RT-PCR (SEQIDNO:19) (SEQIDNO:20) qRT-PCR

(36) Said RT-PCR amplifications were run in and agarose gel 2%. Results were visualized under UV Light and are shown in FIG. 1.

(37) In addition, FIG. 2 shows the results of relative expression for the genes COL I, BMP2 and OCN at day 0 and 30.

(38) TABLE-US-00005 BMP2(Bone Forward GCGGAAACGCCTTAAGTCCA 20 morphogeneticprotein) (SEQIDNO:21) Reverse GTGGAGTTCAGATGATCAGC 20 (SEQIDNO:22) OCN Forward GCAGACCTGACATCCAGTAC 57.7 (SEQIDNO:23) Reverse TAATCTGGACTGCTTGTGGC 57.7 (SEQIDNO:24)

(39) Primers used for COL I were the same identified in Table 1.

(40) The different expression of genes shown in FIGS. 1 and 2 is correlated with the favouring of bone formation. In addition, when the implant is treated with the bone bioactive composition of the present invention, the production of bone is increased and the quality of the produced bone is higher.

Example 2. Influence of the Bone Bioactive Composition in the Calcium Excretion and Alcaline Phosphatase (Hereinafter, ALP) Activity During Bone Formation in In Vitro Cell Cultures

(41) Calcium concentration in the cell culture medium (i.e., secreted calcium) was measured in DPPSCs and DPMSCs cultured with implant discs treated or not with bone bioactive composition under differentiation conditions, in accordance with what has previously been explained. Said secreted calcium is related with bone formation.

(42) Calcium concentration was measured by analyzing the supernatant of each cell population at days 3, 11 and 20 of differentiation. The analysis was performed using a calcium colorimetric assay kit (BioVision, United States) through a chromogenic complex (=575 nm) formed between calcium ions and 0-cresolphthalein. This analysis provides a wavelength detected at 575 nm and this value determines the calcium concentration.

(43) Results obtained for calcium concentration are summarized in FIG. 3 It can be see that in the case of cell cultures with implant discs treated with the bone bioactive composition, the peak of calcium excretion can be seen earlier (see increase in day 3), showing an earlier formation of the bone.

(44) Regarding ALP, an increase in the activity of said protein is also related with bone formation. Hence, ALP activity was measured in the supernatant of the above-mentioned cell cultures also at days 3, 11 and 20. Said activity was measured using an alkaline phosphatase kit (BioSystems, USA) according to the manufacturer's instructions. The absorbance of each sample was measured at a wavelength of 405 nm at different times (day 3, 11 and 20 during cell differentiation) wherein an increase in the ALP activity is observed in the treated group vs not treated.

(45) Results obtained for ALP activity appear summarized in FIG. 4. A similar trend as the one seen in FIG. 3 can be seen in FIG. 4, i.e. early peak on day 3 of ALP activity showing early bone formation.

(46) Therefore, results obtained for calcium concentration and ALP activity perfectly correlate and are consistent with an early bone formation induced by the bone bioactive composition of the present invention.

Example 3. Influence of the Bone Bioactive Composition in the Implant-Bone Engraftment in Rabbits

(47) For this study 60 dental implants were used divided into three groups (n=20 per group). Treatment for each of the three study groups appears described in Table 2.

(48) TABLE-US-00006 TABLE 2 Details of the additional treatment applied to the implants in the different groups of the study. Group Implant surface treatment A No additional treatment B Bone bioactive composition of Example 1, pH adjusted at 7.4 C Bone bioactive composition of Example 1, pH adjusted at 7.6

(49) The implants were treated by blasting with 50-100 m TiO.sub.2 particles, followed by ultrasonic cleaning with an alkaline solution Riozyme IV-E Neutro Gold (Indstria Farmacutica Rioqumica Ltda, So Jos do Rio Preto, Brazil), washing with distilled water and pickling with maleic acid (HO.sub.2CCH.sub.2CHOHCO.sub.2H). For the implants used in group A the above was the only treatment applied. For experimental groups B and C: the implants were treated initially using the above procedure and after with the corresponding bone bioactive composition using 100 L for 1 h.

(50) Fifteen adult New Zealand rabbits (Oryctolagus cuniculus) with approximately 4.50.5 kg were used in this study. Four implants were installed per animal (2 per tibia). The animals were sacrificed 15, 30, 45 and 60 days after surgery.

(51) For the histomosphometric analysis, bone blocks of the tibiae, with inserted implants, were removed from each animal, fixed in 10% of formaldehyde solution for 7 days, and dehydrated in increasing ethanol solutions (60%, 70%, 80%, and 99%) for 24-56 h, as previously described (Yang J et al. Effects of oestrogen deficiency on rat mandibular and tibial microarchitecture Dentomaxillofac Radiol 2003 July, 32(4):247-51). Subsequently, the samples were embedded in Technovit 7200 VLC resin (Kultzer & Co., Wehrhein, Germany) and, after curing, samples were sectioned using a metallographical cutter (Isomet 1000; Buehler, Germany). The disc samples were polished using an abrasive paper sequence (Metasery 3000; Buehler, Germany) to a 30-m thickness and analyzed using light microscopy (Nikon E200, Japan). The bone growth was measured with respect to the implant platform at the bone contact with the healing abutment, according to the scheme using Image Tool software, version 5.02 for Microsoft Windows. Two different investigators made the measurements at different times and a unique average of these values was computed. When the measured values were very different both investigators repeated measures.

(52) Obtained results are shown in FIGS. 5, 6 and 7 corresponding to groups A, B and C respectively.

(53) In addition, histological analysis of the samples to measure the Bone-to-Implant Contact (hereinafter, BIC) was performed. Results are summarized in Table 3.

(54) TABLE-US-00007 TABLE 3 Results of BIC for the three groups of the study at 15, 30, 45 and 60 days. GROUP A GROUP B GROUP C Time of BIC in % BIC in % BIC in % measurement (mean SD) (mean SD) (mean SD) 15 Days 53.8 2.3 61.7 1.1 68.92 0.3 30 Days 56.24 1.8 67.4 1.8 69.35 2.2 45 Days 60.45 1.2 68.1 1.6 70.34 1.1 60 Days 68.29 0.8 71.39 1.1 73.89 1.9

(55) As can be seen in FIGS. 5 to 7, the implants were in contact with predominantly cortical bone along the upper threads in the cortical region, while the threads in the bone marrow were in contact with either newly formed bone or with normal bone marrow. A demarcation line was consistently seen between the newly formed bone and the old bone tissue. In general terms, from said figures it can be seen that an earlier formation of bone is induced in Groups B and C (even earlier and greater in the latter). This difference was maintained all throughout the experimental time frame (i.e., until day 60).

(56) In addition, from table 3 it is also derivable an earlier and increased BIC in groups B and C compared to group A. In addition, and surprisingly, as also seen in FIGS. 5 to 7, group C showed also an increase in all time points when compared with group B.

(57) Finally, the quantity of new bone formed was measured also at 15, 30, 45 and 60 days.

(58) Results are summarized in FIG. 8 and are consistent with what has been discussed above. It can be seen an earlier formation of bone in groups B and C (group C shows an even higher bone formation in day 15 when compared with group B). In addition, group C is the only group that surprisingly showed an increase in new bone formed on day 60 (on said day, the quantity of bone formed in groups A and B had evolved to be similar).

Example 4. Comparison Between Treatments

(59) 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na.sub.2HPO.sub.4, 0.24 g of KH.sub.2PO.sub.4, 0.80 g of MgCl.sub.2, 1.20 g of CaCl.sub.2 and 20 g of EDTA were dissolved in 800 ml of water.

(60) To analyze relative osteogenic capacity of PBS, CaCl.sub.2, MgCl.sub.2 and EDTA, DPPSC (110.sup.3 cells per cm.sup.2) were seeded in titanium discs of Ti.sub.6Al.sub.4V.

(61) Group 1: treated with PBS (8 g of NaCl, 0.2 g of KCl, 1.44 g of Na.sub.2HPO.sub.4, 0.24 g of KH.sub.2PO.sub.4, dissolved in 800 ml of water).

(62) Group 2: treated with PBS+CaCl.sub.2+MgCl.sub.2 (8 g of NaCl, 0.2 g of KCl, 1.44 g of Na.sub.2HPO.sub.4, 0.24 g of KH.sub.2PO.sub.4, 0.80 g of MgCl.sub.2, 1.20 g of CaCl.sub.2 dissolved in 800 ml of water).

(63) Group 3: treated with PBS+CaCl.sub.2+MgCl.sub.2+EDTA (8 g of NaCl, 0.2 g of KCl, 1.44 g of Na.sub.2HPO.sub.4, 0.24 g of KH.sub.2PO.sub.4, 0.80 g of MgCl.sub.2, 1.20 g of CaCl.sub.2 and 20 g of EDTA were dissolved in 800 ml of water):

(64) Group 4: treated with PBS+EDTA (8 g of NaCl, 0.2 g of KCl, 1.44 g of Na.sub.2HPO.sub.4, 0.24 g of KH.sub.2PO.sub.4 and 20 g of EDTA were dissolved in 800 ml of water).

(65) Control: No treated discs.

(66) Discs were treated and incubated during one hour before seeding cells in 24-well plates at a density of 110.sup.3 cells per cm.sup.2. RT-PCR was performed at day 7 of osteoblast differentiation using OC, OCN and ALP. The differences in expression shown in FIG. 9 show that titanium discs treated with PBS with the addition of CaCl.sub.2 and MgCl.sub.2 presents more osteogenic capacity in comparison with treatment with only PBS or PBS+EDTA and that the combination of PBS, CaCl.sub.2, MgCl.sub.2 and EDTA shows and even more surprising osteogenic capacity compared to the other treatments.

(67) Values of FIG. 9 are expressed as expression related to no treated discs at day 7.

(68) Two commercial PBS were also tested and the results were similar to those of the PBS used in the above-mentioned Group 1. Said commercial PBS were: Sigma Aldrich P3813 SIGMAPhosphate buffered saline (Contents of one pouch, when dissolved in one liter of distilled or deionized water, will yield 0.01 M phosphate buffered saline (NaCl 0.138 M; KCl0.0027 M); pH 7.4, at 25 C.).

(69) Thermo Fisher CatNum 18912PBS Tablets. (Phosphate (as sodium phosphates) 10.0 mM, Potassium Chloride (KCl), 2.68 mM, Sodium Chloride (NaCl) 140.0 mM, to be dissolved with 500 ml distilled water).

Example 5. Application of the Composition

(70) Application of the composition in a patient when using an implant: For implants placement using the bone bioactive composition, the drilling sequence bone has to according to the manufacturer's recommendations subsequently implant placing and with very low insertion between 20 to 50 Newtons. This is applicable for dental implants as well as for traumatology implants.

(71) Application of the composition in a patient with periodontitis or peri-implantitis: For the periodontitis treatment using the bone bioactive composition, first of all the conventional periodontal treatment should be done; removing bacterial plaque and granulation tissue by supragingival and subgingival scrapings. In the same intervention, the area of the bone defect has to be well dry before applying the bone bioactive composition using a conventional brush; after that, bleeding is caused until the clot is formed. This process should be done more than once until recuperate all lost bone.

Example 6. In Vivo Study of the Influence of the Bioactive Bone Composition in the Use of Biomaterials in Dog

(72) Materials and Methods.

(73) Animals

(74) For this study 3 years old female dog with a weight of 12 kg was used. A specialist for veterinary surgery observed the animal. The Ethics Committee for Animal Research of the University of Murcia approved the protocol of study that followed the guidelines established by the Directive of the Council of the European Union of February, 1st 2013/53/CEE.

(75) Study Design

(76) The study was designed as an in vivo trial. Dental extraction of all posterior upper and lower molars was performed three months before the study with bone bioactive composition and biomaterials. After that, 12 bone defects were made using a 5 mm trephine, 3 in each zone: 3 defects to test Straumann XenoGraft alone, 3 for bone bioactive composition with Straumann XenoGraft, 3 defects for Dentum and 3 for Dentum with bone bioactive composition.

(77) Straumann XenoGraft is a bovine bone and slow resorption rate similar to human bone with low crystallinity, high porosity and an optimal balance of calcium and phosphate designed to achieve reliable bone volume in guided bone regeneration.

(78) Dentum is used in this description to name a biomaterial formed by autologous dentin. Autologous dentin is used in the clinical procedures as an autograft for its composition almost identical to that of human bone in calcium and phosphorus ions organized as hydroxyapatite and TCP. Dentum was obtained using the Smart Dentin Grinder (distributed by Bioner, Spain, from KometaBio, USA). The teeth extracted from the dog, after being cleaned and dried, were immediately ground using the Smart Dentin Grinder. The tooth particles that were obtained were 300-1200 m, which were subsequently sieved through a special two-compartment classification system. The particles of teeth were immersed in a basic alcohol cleaner in a sterile vessel to dissolve all organic waste and bacteria during 15 minutes. The particles were then washed with sterile saline solution for 5 minutes and dried.

(79) RX and hilling control of surgical zones was done after 15 days and 2 month of surgery (FIG. 10).

(80) Surgical Procedure

(81) The dog received a pre-anesthetic medication consisting of 0.01 mg/kg atropine (Atropuinsulfat, Braun, B. Braun Melsungen, Melsungen, Germany), 20 mg/kg ketamine hydrochloride (Ketamin 10%, Essex, Munich, Germany), and 0.1 mg/kg xylazine (Rompun, Bayer Vital, Leverkusen, Germany) intramuscularly, followed by an intravenously 2 to 4 mg/kg propofol (Propofol 1% MOT Fresenius, Fresenius Kabi, Bad Homburg, Germany) to induce anesthesia. The maintenance of anesthesia after tracheal intubation was performed by the application of isoflurane with an end-tidal concentration of 1.8% in oxygen/air and a bolus of 0.002 mg/kg/hour fentanyl citrate (Fentanyl-Janssen, Janssen-Cilag, Neuss, Germany) followed by continuous infusion of 0.001 mg/kg/hour fentanyl citrate. To reduce the postoperative pain, analgesia was induced by applying subcutaneous carprofen (Rimadyl, Pfizer, Karlsruhe, Germany) 4 mg/kg every 24 hours for 4 days, starting with the first dose after induction of anesthesia. To sacrifice the animals, an intravenous injection of 50 mg/kg thiopental (Trapanal, Nycomed, Konstanz, Germany) and 2 mmol/kg 7.45% potassium chloride (B. Braun, Melsungen, Germany) was applied.

(82) Histological Evaluation

(83) After sacrifice, samples were obtained and fixed in a 4% formaldehyde solution (Merck, Darmstadt, Germany) for 5-7 days. Following that, samples were dehydrated in an ethanol series of 70%, 80%, 90%, and 100%, remaining 24 hours in each ethanol concentration and defatted in Xylene for 24 hours (Merck, Darmstadt, Germany). For slicing the samples, they were infiltrated embedded and polymerized in Technovit 9100 (Heraeus Kulzer, Wehrheim, Germany) following the instructions manual. The obtained slices were cut to 500 m by a low-speed rotary diamond saw (Microslice, Metals Research, Cambridge, UK). The sections were placed on opaque acrylic slides (Maertin, Freiburg, Germany) and thickness was reduced to final 60 m by a rotating grinding plate (Stuers, Ballerup, Denmark). For histological and histometric analysis, incandescent and polarized light microscopy and PC based image analysis were used for the evaluation of bone density.

(84) Results:

(85) Homogeneity was detected of the bone tissue and the biomaterial with the bone bioactive composition compared to the control area without bone bioactive composition. The cortical bone consisting of primary and secondary osteons were completely formed. In addition the treated groups had more mature osteoblast and osteocytes when compared to the controls (FIG. 11).

(86) In the newly formed bone tissue, osteocytes within the lacunae could be detected. New bone was formed integrating the biomaterial and the original bone into the defect zone with a tight connection. (FIGS. 11, 12 and 13). FIG. 13 shows that in (A) the bone defect has regenerated in 80% in the test group (Dentum+bone bioactive composition (BBL)) due to the growth of bone tissue in detriment of the growth of connective tissuefibroblasts. In (B) with only Dentum, the regeneration of the defect is in a 40% and an extensive presence of connective tissuenot desirablecan be observed.

Example 7. In Vivo Study of the Influence of the Bioactive Bone Composition in Periodontitis

(87) Processing of Tooth Samples

(88) Human teeth (n=13) were cleaned and the crowns were eliminated.

(89) Transversal sections were obtained after slicing the roots. The teeth blocks were cleaned using a previously described protocol (Galler K M, et al. Bioengineering of dental stem cells in a PEGylated fibrin gel Regen Med. 2011, 6(2):191-200). The roots were then washed 3 times in sterile PBS, and then soaked again in 0.5 M EDTA for 10 min, followed by 3 more rinses in BBL. Afterwards the roots were kept incubated with DPPSC for periodontal differentiation for 21 days.

(90) Periodontal Tissue Differentiation on Tooth Surface

(91) The transversal sections of the teeth were placed in 6 well culture plates, the DPPSC were seeded at 20000 cells per well in 4 ml of osteogenic medium and incubated at 37 C. for 3 weeks. The osteogenic medium consists of -MEM (Gibco) containing 10% heat-inactivated FBS (Biochrom), 10 mM -glycerol phosphate (Sigma-Aldrich), 50 M L ascorbic acid (Sigma-Aldrich), 0.01 M dexamethasone and 1 penicillin/streptomycin solution. Medium was changed every 3 days over a period of 21 days.

(92) Scanning Electron Microscopy Analysis

(93) After 3 weeks of co-culturing the cells, teeth sheets were processed for SEM. Samples were fixed with 2.5% glutaraldehyde (Ted Pella Inc.) in 0.1 M Na-ca codylate buffer EMS, Electron Microscopy Sciences, Hatfield, Pa.) (pH 7.2) for 1 hour on ice. After fixation, samples were treated with 1% osmium tetroxide (OsO4) for 1 hour. The samples were then dehydrated in serial solutions of acetone (30-100%) with the scaffolds mounted on aluminium stubs. The samples were examined with a Zeiss 940 DSM scanning electron microscope.

(94) Histological Analysis

(95) Teeth that were cultured for 21 days, were fixed with 10% formalin for 24 hours, and then carried to the Pathology Anatomy department of the Instituto Universitario Dexeus (Barcelona, Spain). The harvested samples were embedded in paraffin, and cut into 4-m-thick sections. The sections were stained with Haematoxylin and eosin (H&E), Alcian blue and Masson's trichrome to determine the formation of new collagen fibers, blood vessels and cementoblast-like cells. An image analysis system was used (Image-Pro Plus, Media Cybernetic, SilverSprings, Md.).

(96) Results

(97) Cell Culture of DPPSC/Periodontal Tissue Differentiation

(98) After the cells were cultured in vitro for 21 days, the cell-seeded scaffolds were subjected to scanning electron microscopic (SEM) examination. SEM in different augmentations (5000, 15000 and 30000) in roots with cement showed a high-density cell mass on the surface of the root for all the samples of DPPSC (FIG. 14 A1, A2, A3), indicating that the cells adhered and grew favorably. After 3 weeks of differentiation, SEM allowed high resolution imaging of the fibrous tissue integration of collagen fibrils with the root matrices. Some blood vessels and some cementoblast-like cells were produced in the samples of DPPSC group treated with BBL which compared with positive control (human periodontal tissue) (FIG. 14 B1, B2, B3), and with negative control (teeth surface without periodontal ligament) (FIG. 14 C1, C2, C3), where there were no presence of cells nor tissues.

(99) Histological Evaluation of Tooth Roots

(100) Histological analysis using nuclear staining of non-decalcified sections further supported the SEM findings. In order to visualize early formation of cell clusters, Masson's trichrome stain (FIG. 15 A1, A2, A3); Alcian blue (FIG. 15, B1, B2, B3) and Haematoxylin and eosin (H&E) (FIG. 15 C1, C2, C3) staining were employed. Histological section of the group DPPSC (FIG. 15 A2-3; B2-3; C2-3) showed the formation of collagen fibers inserted perpendicularly into the cementum-like tissues, which resembled Sharpey's fibres in contrast to the control group (FIG. 15 A1, B1, C1). Higher magnification (FIG. 15 A3, B3, C3) revealed the homogeneity of the newly formed reparative collagen fibres that attached well onto the surfaces at 21 days.

(101) The experimental results show, due to the use of the bone bioactive composition, an improved calcification of the cementoblast-like cells together with a recuperation of the collagen fibrils of the periodontal ligament, which is the major defect in periodontitis.

BIBLIOGRAPHIC REFERENCES

Patent Literature

(102) US20070213832 (Wen Hai B)

Non-Patent Literature

(103) Albrektsson T, et al. Osseointegrated titanium implants Requirements for ensuring a long-lasting, direct bone-to-implant anchorage in man Acta Orthop Scand 1981, 52:155-170 Anselme K Osteoblast adhesion on biomaterials Biomaterials 2000, 21:667 Galler K M, et al. Bioengineering of dental stem cells in a PEGylated fibrin gel Regen Med. 2011, 6(2):191-200 Garca A J Get a grip: integrins in cell-biomaterial interactions Biomaterials 2005, 26:7525 Howlett C R, et al. Mechanism of initial attachment of cells derived from human bone to commonly used prosthetic materials during cell culture Biomaterials 1994, 15:213 Kilpadi K L, et al. Hydroxylapatite binds more serum proteins, purified integrins, and osteoblast precursor cells than titanium or steel J Biomed Mater Res 2001, 57:258 Lindahl C. Biomimetic deposition of hydroxyapatite on titanium implant materials Uppsala Univ. 1 Jan. 2012, pages 978-91 Lindberg F. et al., Hydrohylapatite growth onf single crystal rutile substrates Biomaterials, Elsevier Science Publishers BV, Barking G B, vol. 29, no 23, 1 Aug. 2008 pages 3317-23 Mohan S, et al. Bone growth factors Clin Orthop Relat Res 1991, 263:30-48 Scotchford C A, et al. Chemically patterned, metal-oxide-based surfaces produced by photolithographic techniques for studying protein- and cell-interactions. II: Protein adsorption and early cell interactions Biomaterials 2003, 24:1147 Sheikh Z, et al. Natural graft tissues and synthetic biomaterials for periodontal and alveolar bone reconstructive applications: a review Biomater Res. 2017; 21.9. Steele J G, et al. Attachment of human bone cells to tissue culture polystyrene and to unmodified polystyrene: the effect of surface chemistry upon initial cell attachment J Biomater Sci Polym Ed 1993, 5:245 Urist M R, et al. Bone cell differentiation and growth factors Science 1983, 220:680-686 Wozney J M, et al. Growth factors influencing bone development J Cell Sci Suppl 1990, 13:149-156 Yang J et al. Effects of oestrogen deficiency on rat mandibular and tibial microarchitecture Dentomaxillofac Radiol 2003 July, 32(4):247-51