1. Patent Search
  2. Details

LOW GLUCOSINOLATE PENNYCRESS MEAL AND METHODS OF MAKING

20210084936 ยท 2021-03-25

    Inventors

    Cpc classification

    International classification

    Abstract

    Pennycress (Thlaspi arvense) seed, seed lots, seed meal, and compositions with reduced glucosinolate content as well as plants that yield such seed, seed lots, seed meal, and compositions are provided. Methods of making and using the pennycress plants and/or seed that provide such seed, seed lots, seed meal, and compositions are also provided.

    Claims

    1. A composition comprising non-defatted pennycress seed meal that comprises less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    2. The composition of claim 1, wherein said seed meal comprises about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    3. The composition of claim 1 or 2, wherein said composition has an oil content of about 30% or 35% to about 40% or 50% by dry weight.

    4. The composition of claims 1 to 2, wherein said composition further comprises a preservative, a dust preventing agent, a bulking agent, a flowing agent, or any combination thereof.

    5. The composition of claim 1 or 2, wherein said pennycress seed meal is obtained from pennycress seeds that have been crushed, ground, macerated, expelled, extruded, or any combination thereof.

    6. The composition of claim 1 or 2, wherein said composition comprises: (i) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof; (ii) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207; or (iii) crushed, ground, and/or macerated seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    7. A non-defatted pennycress seed meal that comprises less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    8. The seed meal of claim 7, wherein said seed meal comprises about 1, 2.5, 5, or 10 to about 15, 20, or 25 micromoles sinigrin per gram by dry weight.

    9. The seed meal of claim 7 or 8, wherein said composition has an oil content of 30% or 35% to 40% or 50% by dry weight.

    10. The seed meal of claim 7 or 8, wherein said seed meal comprises: (i) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof; (ii) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207; or (iii) crushed, ground, and/or macerated seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    11. A pennycress seed comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    12. The pennycress seed of claim 11, wherein the seed comprises about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    13. The pennycress seed of claim 11 or 12, wherein the seed comprises: (i) at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof; (ii) at least one transgene or genome rearrangement that suppresses expression of at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof; or (iii) seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    14. The pennycress seed of claim 11 or 12, wherein the seed comprises at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof.

    15. The pennycress seed of claim 11 or 12, wherein the seed comprises at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a sinigrin biosynthetic enzyme and/or at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a sinigrin transporter.

    16. The pennycress seed of claim 15, wherein: (i) the sinigrin biosynthetic enzyme comprises a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 21, 24, 27, 94, 164, 167, 170, 173, 176, and allelic variants thereof; or (ii) the pennycress seed comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 21 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 24 or an allelic variant thereof.

    17. The pennycress seed of claim 15, wherein: (i) the sinigrin transporter comprises a polypeptide selected from the group consisting of SEQ ID NO: 15, 17 and allelic variants thereof; (ii) the pennycress seed comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 15 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 17 or an allelic variant thereof; or (iii) the pennycress seed comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 15 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 24 or an allelic variant thereof.

    18. A seed lot comprising a population of pennycress seeds comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    19. The seed lot of claim 18, wherein the pennycress seeds comprise 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    20. The seed lot of claim 18 or 19, wherein the seed comprises: (i) at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof; (ii) at least one transgene or genome rearrangement that suppresses expression of at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof; or (iii) seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    21. The seed lot of claim 18 or 19, wherein the seed comprises at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof.

    22. The seed lot of claim 18 or 19, wherein the seed comprises at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a sinigrin biosynthetic enzyme and/or at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a sinigrin transporter.

    23. The seed lot of claim 22, wherein: (i) the sinigrin biosynthetic enzyme comprises a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 21, 24, 27, 94, 164, 167, 170, 173, 176, and allelic variants thereof; or (ii) the pennycress seed lot comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 21 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 24 or an allelic variant thereof.

    24. The seed lot of claim 22, wherein: (i) the sinigrin transporter comprises a polypeptide selected from the group consisting of SEQ ID NO: 15, 17 and allelic variants thereof; (ii) the pennycress seed lot comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 15 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 17 or an allelic variant thereof; or (iii) the pennycress seed lot comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 15 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 24 or an allelic variant thereof.

    25. The seed lot of claim 18 or 19, wherein said population of pennycress seeds comprise seeds having at least one loss-of-function mutation in an endogenous pennycress gene that encodes SEQ ID NO:2 or an allelic variant thereof.

    26. The seed lot of claim 25, wherein the loss-of-function mutation in the gene encoding SEQ ID NO:2 or the allelic variant thereof comprises an insertion, deletion, or substitution of one or more nucleotides.

    27. The seed lot of claim 25, wherein the loss-of-function mutation in the gene encoding SEQ ID NO:2 or the allelic variant thereof comprises a mutation that introduces a pre-mature stop codon or frameshift mutation at codon positions 1-108 of SEQ ID NO:1 or an allelic variant thereof.

    28. The seed lot of claim 27, wherein the loss-of-function mutation is in a polynucleotide encoding MYB28, MYB29, MYB76, or any combination thereof.

    29. The seed lot of claim 18 or 19, wherein the population comprises at least 10 seeds comprising less than 25 micromoles sinigrin per gram by dry weight or 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    30. The seed lot of claim 18 or 19, wherein at least 95% of the pennycress seeds in the seed lot are seeds comprising less than 25 micromoles sinigrin per gram by dry weight or 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    31. The seed lot of claim 18 or 19, wherein less than 5% of the seeds in said seed lot have greater than 25 or 30 micromoles sinigrin per gram by dry weight.

    32. The seed lot of claim 18 or 19, wherein said seeds further comprise an agriculturally acceptable excipient or adjuvant.

    33. The seed lot of claim 18 or 19, wherein said seeds further comprise a fungicide, a safener, or any combination thereof.

    34. A method of making non-defatted pennycress seed meal comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight or 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight, comprising the step of grinding, macerating, extruding, and/or crushing the seed lot of claim 18 or 19, thereby obtaining the non-defatted seed meal.

    35. A method of making defatted pennycress seed meal comprising less than 30 micromoles sinigrin per gram by dry weight or about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 micromoles sinigrin per gram by dry weight, comprising the steps of solvent extracting the seed lot of claim 18 or 19, and separating the extracted seed meal from the solvent, thereby obtaining the defatted seed meal.

    36. Pennycress seed meal comprising less than 30 micromoles sinigrin per gram by dry weight or about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 micromoles sinigrin per gram by dry weight, wherein the seed meal is defatted.

    37. The seed meal of claim 25, wherein said seed meal has an oil content of about 0% or 0.5% to about 12% or 15% by dry weight.

    38. The pennycress seed meal of claim 36 or 37, wherein said meal comprises a detectable amount of a polynucleotide comprising: (i) at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof; (ii) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207; or (iii) crushed; ground, and/or macerated seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    39. The pennycress seed meal of claim 36 or 37, wherein said meal comprises ground and/or macerated seed of a population of pennycress seeds comprising seeds having at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof.

    40. The pennycress seed meal of claim 36 or 37, wherein said meal comprises ground and/or macerated seed of a population of pennycress seeds comprising seeds having at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof.

    41. The pennycress seed meal of claim 36 or 37, wherein said meal comprises ground and/or macerated seed of a population of pennycress seeds comprising seeds having at least one transgene or genome rearrangement that suppresses expression of at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof.

    42. A composition comprising defatted pennycress seed meal that comprises less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    43. The composition of claim 42, wherein said seed meal comprises about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 micromoles sinigrin per gram by dry weight.

    44. The composition of claim 42 or 43, wherein said composition has an oil content of about of about 0% or 0.5% to about 12% or 15% by dry weight.

    45. The composition of claim 42 or 43, wherein said composition further comprises a preservative, a dust preventing agent, a bulking agent, a flowing agent, or any combination thereof.

    46. The composition of claim 42 or 43, wherein said composition comprises: (i) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof; (ii) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207; or (iii) crushed, ground, and/or macerated seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    47. Pennycress seed cake comprising 30 micromoles sinigrin per gram by dry weight or about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 micromoles sinigrin per gram by dry weight.

    48. The seed cake of claim 47, wherein said seed cake has an oil content of about 0% or 0.5% to about 12% or 15% by dry weight.

    49. The pennycress seed cake of claim 48, wherein the cake comprises crushed or expelled seed of the seed lot of claim 18 or 19.

    50. The pennycress seed cake of claim 18 or 19, wherein the cake comprises a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof; (ii) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207; or (iii) seed cake obtained from seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    51. A method of making a pennycress seed lot comprising the steps of: (a) introducing at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof; (b) selecting germplasm that is homozygous for said loss-of-function mutation; and, (c) harvesting seed from the homozygous germplasm, thereby obtaining a seed lot, wherein said seed lot comprises a population of pennycress seed having less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    52. The method of claim 51, wherein the harvested seed of the seed lot comprise 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    53. The method of claim 51, wherein said harvested seed of the seed lot comprises the seed lot of claim 18 or 19.

    54. A method of making a pennycress seed lot comprising the steps of: (a) introducing at least one transgene or genome rearrangement that suppresses expression of at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176 and allelic variants thereof into a pennycress plant genome; (b) selecting a transgenic plant line that comprises said transgene or genome rearrangement; and, (c) harvesting seed from the transgenic plant line, thereby obtaining a seed lot, wherein said seed lot comprises a population of pennycress seed having less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    55. The method of claim 54, wherein the harvested seed of the seed lot comprise 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    56. The method of claim 54, wherein said harvested seed comprise a seed lot of claim 18 or 19.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0015] The accompanying drawings, which are incorporated in and form a part of the specification, illustrate the embodiments of the present disclosure and together with the description, serve to explain the principles of the disclosure. In the drawings:

    [0016] FIG. 1A, B illustrate glucosinolate (GSL) biosynthetic pathways for many Brassica plants. Panel A: A schematic diagram of aliphatic GSL pathway which begins with amino acid methionine as the precursor and is relevant for GSL modification in pennycress seed. Panel B: Various GSL forms found in Brassica are shown.

    [0017] FIG. 2 A, B, C, illustrates pARV1 (SS32_GTR1), Agrobacterium CRISPR-Cas9 vector and its gene editing sgRNA cassette, for targeting pennycress homolog of Glucosinolate transporter 1 (GTR1 or Glut1) gene. Panel A: Plasmid map of pARV1 (SS32_GTR1). Panel B: sgRNA cluster in pARV1, targeting nucleotides 2503-2522 and 2538-2557 of SEQ ID NO: 14. Panel C: Sequence example of one of gRNA cassettes targeting pennycress homolog of Glucosinolate transporter 1 (GTR1 or Glut1) gene.

    [0018] FIG. 3A, B illustrates pDe-SpCas9 and pDe-SaCas9, Agrobacterium CRISPR-Cas9 base vectors for editing plant genome. gRNA cassette stuffers are inserted at the multiple cloning site between the Cas9 and HygR cassettes, replacing a small fragment of the vector with synthetic gRNA cassette.

    [0019] FIG. 4A, B, C, illustrates pARV145, Agrobacterium CRISPR-Cas9 vector and its gene editing sgRNA cassettes, for targeting pennycress homolog of MYB28 (HAG1) gene. Panel A: Plasmid map of pARV145. Panel B: sgRNA cluster in pARV145, targeting nucleotides 719-738 and 793-812 of SEQ ID NO: 20. Panel C: Sequence examples of gRNA cassettes targeting pennycress homolog of MYB28 (HAG1) gene.

    [0020] FIG. 5 illustrates pARV187, Agrobacterium CRISPR-FnCpf1 base vector for editing plant genome. gRNA cassette stuffers are inserted at the dual AarI site, replacing a small fragment of the vector with synthetic gRNA cassette.

    [0021] FIG. 6 illustrates pARV190, Agrobacterium CRISPR-SmCms1 base vector for editing plant genome. gRNA cassette stuffers are inserted at the dual AarI site, replacing a small fragment of the vector with synthetic gRNA cassette.

    [0022] FIG. 7 A, B, C, D, E, F, G, H, I, J, K, gRNA cassettes targeting pennycress homologs of multiple genes in glucosinolate biosynthetic/metabolic pathway. FIG. 5A illustrates a gRNA cassette stuffer, designed for insertion into the AarI-digested plant genome editing vector (such as pARV187 or pARV190) for targeting pennycress AOP2 gene, nucleotides 2367-2389 and 2419-2441 of SEQ ID NO: 2; FIG. 5B: gRNA cassette stuffer for targeting pennycress BCAT4 gene, nucleotides 2984-3006 and 3048-3070 of SEQ ID NO: 5; FIG. 5C: gRNA cassette stuffer for targeting pennycress BCAT6 gene, nucleotides 1932-1954 and 2387-2409 of SEQ ID NO: 8; FIG. 5D: gRNA cassette stuffer for targeting pennycress CYP79 gene, nucleotides 2914-2936 and 2968-2990 of SEQ ID NO: 11; FIG. 5E: gRNA cassette stuffer for targeting pennycress GTR1 gene, nucleotides 2483-2505 and 2541-2563 of SEQ ID NO: 14; FIG. 5F: gRNA cassette stuffer for targeting pennycress GTR2 gene, nucleotides 2317-2339 and 2404-2426 of SEQ ID NO: 18; FIGS. 5G and 5H: gRNA cassette stuffers for targeting pennycress MYB28 gene, nucleotides 948-970, 1001-1023, 1045-1067 and 1315-1337 of SEQ ID NO: 20; FIG. SI: gRNA cassette stuffer for targeting pennycress MYB29 gene, nucleotides 2573-2595 and 2625-2647 of SEQ ID NO: 23; FIG. 5J: gRNA cassette stuffer for targeting pennycress MYB76 gene, nucleotides 1539-1561 and 1570-1592 of SEQ ID NO: 26; FIG. 5K: gRNA cassette stuffer for targeting pennycress TFP gene, nucleotides 2170-2192 and 2559-2581 of SEQ ID NO: 29.

    DETAILED DESCRIPTION

    [0023] The term and/or where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term and/or as used in a phrase such as A and/or B herein is intended to include A and B, A or B, A (alone), and B (alone). Likewise, the term and/or as used in a phrase such as A, B, and/or C is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

    [0024] As used herein, the terms include, includes, and including are to be construed as at least having the features to which they refer while not excluding any additional unspecified features.

    [0025] Where a term is provided in the singular, other embodiments described by the plural of that term are also provided.

    [0026] To the extent to which any of the preceding definitions is inconsistent with definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the preceding definition will be used herein.

    [0027] Reductions in sinigrin content of various pennycress plants, seeds, seed lots, seed meals, and compositions obtained therefrom as well as associated methods of obtaining and using such plants, seeds, seed lots, seed meals, and compositions is provided herein by suppression of certain endogenous pennycress genes. The endogenous pennycress genes that can be suppressed to provide such reductions in sinigrin content include, but are not limited to, endogenous pennycress genes set forth in the following Table 1 and allelic variants of those genes.

    [0028] Suppression of certain endogenous pennycress gene expression to provide for reductions in sinigrin content can be affected by a variety of techniques including, but not limited to, loss-of-function (LOF) mutations in endogenous genes, with transgenes, or by using gene-editing- or mutagenesis-mediated genome rearrangements. In certain embodiments, the pennycress plants, seeds, seed lots, seed meals (which can be defatted or non-defatted), and related compositions can comprise one or more LOF mutations that suppress or otherwise alter expression and/or function of one or more genes, coding sequences, and/or proteins, thus resulting in reduced sinigrin content in comparison to control or wild-type pennycress seed, seed lots, and plant lots. Such LOF mutations include, but are not limited to, INDELS (insertions, deletions, and/or substitutions or any combination thereof), translocations, inversions, duplications, or any combination thereof in a promoter, and/or other regulatory elements including enhancers, a 5 untranslated region, coding region, an intron of a gene, and/or a 3 UTR of a gene. Such INDELS can introduce one or more mutations including, but not limited to, frameshift mutations, missense mutations, pre-mature translation termination codons, splice donor and/or acceptor mutations, regulatory mutations, and the like that result in a LOF mutation. In certain embodiments, the LOF mutation will result in: (a) a reduction in the enzymatic, transport, or other biochemical activity associated with the encoded polypeptide in the plant comprising the LOF mutation in comparison to a wild-type control plant; or (b) both a reduction in the enzymatic, transport or other biochemical activity (e.g., transcription factor) and a reduction in the amount of a transcript (e.g., mRNA) or polypeptide in the plant comprising the LOF mutation in comparison to a wild-type control plant. Such reductions in activity or activity and transcript levels can, in certain embodiments, comprise a reduction of at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of activity or activity and transcript levels in the LOF mutant in comparison to the activity or transcript levels in a wild-type control plant. In certain embodiments, the pennycress plants, seeds, seed lots, seed meals (which can be defatted or non-defatted), and related compositions will comprise one or more transgenes or genetic modifications that suppress or otherwise alter expression of one or more genes, coding sequences, and/or proteins, thus resulting in reduced sinigrin content in comparison to control or wild-type pennycress seed lots. Transgenes or genetic modifications that can provide for such suppression or alteration include, but are not limited to, transgenes or genome rearrangements introduced via gene editing or other mutagenesis techniques that produce small interfering RNAs (siRNAs), miRNA, or artificial miRNAs targeting a given gene or gene transcript for suppression. Such genome rearrangements include, but are not limited to, deletions, duplications, insertions, inversions, translocations, and combinations thereof. Useful genome rearrangements include, but are not limited to, rearrangements that place an endogenous promoter and/or transcriptional enhancer in proximity to 3 end of a target gene or coding sequence (e.g., a gene or coding sequence of Table 1) or within the target gene or coding sequence such that the endogenous promoter and/or enhancer drive expression of an siRNA or miRNA that suppresses or otherwise alters expression of the target gene. In certain embodiments, the transgenes or genetic modifications that suppress expression will result in: (a) a reduction in the enzymatic, transport, or other biochemical activity associated with the encoded polypeptide in the plant comprising the transgene or genome rearrangement in comparison to a wild-type control plant; or (b) both a reduction in the enzymatic or other biochemical activity and a reduction in the amount of a transcript (e.g., mRNA) or polypeptide in the plant comprising the transgene or genome rearrangement in comparison to a wild-type control plant. Such reductions in activity and transcript levels can in certain embodiments comprise a reduction of at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of activity and/or transcript levels in the transgenic plant in comparison to the activity or transcript levels in a wild-type control plant. In certain embodiments, certain genes, coding sequences, and/or proteins that can be targeted for introduction of LOF mutations or that are targeted for transgene- or genome rearrangement-mediated suppression are provided in the following Table 1 and accompanying Sequence Listing. In certain embodiments, allelic variants of the wild-type genes, coding sequences, and/or proteins provided in Table 1 and the sequence listing are targeted for introduction of LOF mutations or are targeted for transgene- or genome rearrangement-mediated suppression. Allelic variants found in distinct pennycress isolates or varieties that exhibit wild-type seed sinigrin content can be targeted for introduction of LOF mutations or are targeted for transgene- or genome rearrangement-mediated suppression to obtain seed lots having reduced sinigrin content in comparison to sinigrin content of the control seed lots of wild-type pennycress. Such allelic variants can comprise polynucleotide sequences that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity across the entire length of the polynucleotide sequences of the wild-type coding regions or wild-type genes of Table 1 and the sequence listing. Such allelic variants can comprise polypeptide sequences that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity across the entire length of the polypeptide sequences of the wild-type proteins of Table 1 and the sequence listing. Pennycress seed lots having reduced sinigrin content as described herein can comprise one or more LOF mutations in one or more genes that encode polypeptides involved in GSL biosynthesis, in GSL transport, in GSL hydrolysis, regulating expression of genes encoding GSL biosynthetic and/or transport genes (e.g., transcription factors) or can comprise transgenes or genome rearrangements that suppress expression of those biosynthetic, transporter, hydrolysis, or expression regulator (e.g., transcription factor) encoding genes. Polypeptides affecting these traits include, without limitation, AOP2, BCAT4, BCAT6, CYP79F1, CYP83A1, GTR1, GTR2, MYB28 (HAG1), MYB29, MYB76, TFP, BHLH05, IMD1, CYP79B3, MAM1, FMO-GS-Ox1, and UGT74B-1 polypeptides disclosed in Table 1 and allelic variants thereof. In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can comprise one or more LOF mutations found in the pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207 germplasm. Compositions comprising defatted or non-defatted seed meal obtained from any of the aforementioned seed lots, and seed cakes obtained from any of the aforementioned seed lots are also provided herein. Methods of making any of the aforementioned seed lots, compositions, seed meals, or seed cakes are also provided herein. As used herein, the phrase seed cake refers to the material obtained after the seeds are crushed, ground, heated, and expeller pressed or extruded prior to solvent extraction.

    [0029] In certain embodiments, reductions in sinigrin content of seed lots, seed meal compositions, seed meal, or seed cake are in comparison to sinigrin content of control or wild-type seed lots, seed meal compositions, seed meal, or seed cake. Such controls include, but are not limited to, seed lots, seed meal compositions, seed meal, or seed cake obtained from control plants that lack the LOF mutations or transgene- or genome rearrangement-mediated gene suppression. In certain embodiments, control plants that lack the LOF mutations or transgene or genome rearrangement mediated gene suppression will be otherwise isogenic to the plants that contain the LOF mutations or transgene- or genome rearrangement-mediated gene suppression. In certain embodiments, the controls will comprise seed lots, seed meal compositions, seed meal, or seed cake obtained from plants that lack the LOF mutations or transgene or genome rearrangement mediated gene suppression and that were grown in parallel with the plants having the LOF mutations or transgene or genome rearrangement-mediated gene suppression. In certain embodiments, the pennycress seed lots, plants, seeds, as well as the defatted or non-defatted seed meals and compositions obtained therefrom, can comprise a less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight or about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 micromoles sinigrin per gram by dry weight.

    [0030] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include at least one loss-of-function mutation in a GSL biosynthetic coding sequence or gene (e.g., SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 92, 93, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, or allelic variant thereof) and/or at least one loss-of-function mutation in a GSL transport (SEQ ID NO: 13, 14, 16, 18, or allelic variant thereof), in a GSL hydrolysis (SEQ ID NO: 28, 29, or allelic variant thereof), and/or in an expression regulator (e.g., transcription factor; SEQ ID NO: 19, 20, 22, 23, 25, 26, 159, 160, allelic variant thereof) coding sequence or gene. In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include at least one loss-of-function mutation in a GSL transport coding sequence or gene (e.g., SEQ ID NO: 13, 14, 16, 18, or allelic variant thereof) and at least one loss-of-function mutation in a GSL hydrolysis (SEQ ID NO: 28, 29, or allelic variant thereof), and/or in a expression regulator (e.g., transcription factor; SEQ ID NO: 19, 20, 22, 23, 25, 26, allelic variant thereof) coding sequence or gene. In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include at least one loss-of-function mutation in a GSL hydrolysis (SEQ ID NO: 28, 29, or allelic variant thereof) coding sequence or gene and/or at least one loss-of-function mutation in an expression regulator (e.g., transcription factor; SEQ ID NO: 19, 20, 22, 23, 25, 26, allelic variant thereof) coding sequence or gene. In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can be obtained from pennycress plants comprising the mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207 germplasm.

    TABLE-US-00001 TABLE1 Wild-type(WT)codingregions,encodedproteins,andgenesthatcanbe targetedforintroductionofLOFmutationsortransgene-orgenomerearrangement- mediatedsuppression,theirmutantvariantsandrepresentativegeneticelements forachievingsuppressionofgeneexpression. NamesUsedand/or SEQ Sequence Function/ RepresentativePennycressLOF IDNO: Name Type Natureofthemutation MutantsDisclosedHerein 1 AOP2-CDS WTCoding Playsaroleinthe ALKENYLHYDROXALKYL region secondarymodificationof PRODUCING2-CAPEVERDE 2 AOP2-Genomic WTGene aliphatic(methionine- ISLANDS,AOP2-CVI,GSL,ALK locus derived)GSLs,namelythe enzyme,AOP(2-oxoglutarate- 3 AOP2-PRT WTProtein conversionofmethyl- dependentdioxygenase) sulfinylalkylGSLstoform alkenylGSLs,andalso influencesaliphaticGSL accumulation 4 GCAT4-CDS WTCoding Involvedinthe BCAT4(BRANCHED-CHAIN region methioninechainelongation AMINOTRANSFERASE4) 5 BCAT4-Genomic WTGene pathwaythatleadstothe locus ultimatebiosynthesisof 6 BCAT4-PRT WTProtein methionine-derived glucosinolates 7 BCAT6-CDS WTCoding Encodesacytosolic BCAT6(BRANCHEDCHAIN region branched-chain AMINOTRANSFERASE6) 8 BCAT6- WTGene aminotransferasethatacts Genomiclocus onLeu,Ile,Valandalso 9 BCAT6-PRT WTProtein onMet.TogetherwithBCAT4 andBCAT3,itisinvolved inmethioninesalvageand glucosinolatebiosynthesis 10 CYP79F1-CDS WTCoding Catalyzesthefirst CYP79F1 region committedstepin (CYTOCHROMEP45079F1), 11 CYP79F1- WTGene biosynthesisofthecore BUS1,BUSHY1,SPS1, Genomiclocus structureofGSLs, SUPERSHOOT1 12 CYP79F1-PRT WTProtein Modulatesthelevelofshort chainmethioninederived aliphaticGSLs 13 GTR1-CDS WTCoding GTR1encodeshigh-affinity, GTR1(Glucosinolate region proton-dependentGSL- Transporter1),NPF2.10, 14 GTR1-Genomic WTGene specifictransporter NRT1/PRTFAMILY2.10 locus essentialforthe 15 GTR1-PRT WTProtein accumulationofGSLsin seeds 16 GTR2-CDS WTCoding GTR2encodeshigh-affinity, GTR2(Glucosinolate region proton-dependentGSL- Transporter2),NPF2.11, 17 GTR2-PRT WTProtein specifictransporter NRT1/PRTFAMILY2.11 18 GTR2-Genomic WTGene essentialforthe locus accumulationofGSLsin seeds 19 MYB28-CDS WTCoding Principalregulatorof HAG1(HighAliphatic region aliphaticglucosinolate Glucosinolate1),MYB 20 MYB28-Genomic WTGene biosynthesisandaffects DOMAINPROTEIN28,PMG1 locus theproductionofboth (ProductionofMethionine- 21 MYB28-PRT WTProtein short-andlong-chain derivedGlucosinolate1) aliphaticglucosinolates 22 MYB29-CDS WTCoding MYBDOMAINPROTEIN29,a HAG3(HighAliphatic region Mybtranscriptionfactor Glucosinolate3),PMG2 23 MYB29-Genomic WTGene affectsbiosynthesisof (ProductionofMethionine- locus short-chainaliphatic derivedGlucosinolate2), 24 MYB29-PRT WTProtein glucosinolates RAO7,(Regulatorof AlternativeOxidase1A7) 25 MYB76-CDS WTCoding MYBDOMAINPROTEIN76,aMyb HAG2(HighAliphatic region transcriptionfactoraffects Glucosinolate2),PMG2, 26 MYB76-Genomic WTGene biosyntesisofshort-chain (ProductionofMethionine- loucs sliphaticglucosinolates. derivedGlucosinolate2), 27 MYB76-PRT WTProtein RAO7(Regulatorof AlternativeOxidase1A7) 28 TFP-CDS WTCoding Promotestheformationof Thiocyanate-formingprotein region allylthiocyanateaswellas (TFP) 29 TFP-Genomic WTGene theepithionitrileupon locus myrosinase-catalyzed 30 TFP-PRT WTProtein hydrolysisofallylgluco- sinolate,themajor glucosinolate 31 AOP2_scaffold_ Oligonucleotide AOP2CDStargetedfor 16_117170_ cleavagebyCpf1enzyme; 125481__ partofgRNAcassette CRISPR_64 32 AOP2_scaffold_ Oligonucleotide AOP2CDStargetedfor 16_117170_ cleavagebyCpf1enzyme; 125481__ partofgRNAcassette Cfp1_226 33 AOP2_scaffold_ Oligonucleotide AOP2CDStargetedfor 16_117170_ cleavagebyCpf1enzyme; 125481__ partofgRNAcassette Cfp1_627 34 AOP2_scaffold_ Oligonucleotide AOP2CDStargetedfor 16_117170_ cleavagebyCpf1enzyme; 125481__ partofgRNAcassette CRISPR_66 35 BACT4_ Oligonucleotide BCAT4CDStargetedfor scaffold_7_ cleavagebyCpf1enzyme; 1484532_ partofgRNAcassette 1492822_+_ Cfp1_566 36 BACT4_ Oligonucleotide BCAT4CDStargetedfor scaffold_7_ cleavagebyCpf1enzyme; 1484532_ partofgRNAcassette 1492822_+_ CRISPR_184 37 BACT4_ Oligonucleotide BCAT4CDStargetedfor scaffold_7_ cleavagebyCpf1enzyme; 1484532_ partofgRNAcassette 1492822_+_ CRISPR_185 38 BACT4_ Oligonucleotide BCAT4CDStargetedfor scaffold_7_ cleavagebyCpf1enzyme; 1484532_ partofgRNAcassette 1492822_+_ Cfp1_172 39 BCAT6_ Oligonucleotide BCAT6CDStargetedfor scaffold_18_ cleavagebyCpf1enzyme; 731862_ partofgRNAcassette 739845_+_ CRISPR_63 40 BCAT6_ Oligonucleotide BCAT6CDStargetedfor scaffold_18_ cleavagebyCpf1enzyme; 731862_ partofgRNAcassette 739845_+_ CRISPR_64 41 BCAT6_ Oligonucleotide BCAT6CDStargetedfor scaffold_18_ cleavagebyCpf1enzyme; 731862_ partofgRNAcassette 739845_+_ Cfp1_558 42 BCAT6_ Oligonucleotide BCAT6CDStargetedfor scaffold_18_ cleavagebyCpf1enzyme; 731862_ partofgRNAcassette 739845_+_ Cfp1_577 43 CYP79F1_ Oligonucleotide CYP79F1CDStargetedfor scaffold_1_ cleavagebyCpf1enzyme; 3018995_ partofgRNAcassette 3027106_+_ CRISPR_86 44 CYP79F1_ Oligonucleotide CYP79F1CDStargetedfor scaffold_1_ cleavagebyCpf1enzyme; 3018995_ partofgRNAcassette 3027106_+_ Cfp1_493 45 CYP79F1_ Oligonucleotide CYP79F1CDStargetedfor scaffold_1_ cleavagebyCpf1enzyme; 3018995_ partofgRNAcassette 3027106_+_ CRISPR_87 46 CYP79F1_ Oligonucleotide CYP79F1CDStargetedfor scaffold_1_ cleavagebyCpf1enzyme; 3018995_ partofgRNAcassette 3027106_+_ Cfp1_495 47 GTR1_scaffold_ Oligonucleotide GTR1CDStargetedfor 63_146888_ cleavagebyCpf1enzyme; 155577__ partofgRNAcassette Cfp1_88 48 GTR1_scaffold_ Oligonucleotide GTR1CDStargetedfor 63_146888_ cleavagebyCpf1enzyme; 155577__ partofgRNAcassette Cfp1_92 49 GTR1_scaffold_ Oligonucleotide GTR1CDStargetedfor 63_146888_ cleavagebyCpf1enzyme; 155577__ partofgRNAcassette Cfp1_506 50 GTR1_scaffold_ Oligonucleotide GTR1CDStargetedfor 63_146888_ cleavagebyCpf1enzyme; 155577__ partofgRNAcassette Cfp1_525 51 GTR1_scaffold_ Oligonucleotide GTR1CDStargetedfor 63_146888_ cleavagebyCpf1enzyme; 155577__ partofgRNAcassette Cfp1_574 52 GTR1_scaffold_ Oligonucleotide GTR1CDStargetedfor 63_146888_ cleavagebyCpf1enzyme; 155577__ partofgRNAcassette Cfp1_214 53 GTR1_scaffold_ Oligonucleotide GTR2CDStargetedfor 0_1964427_ cleavagebyCpf1enzyme; 1972843_+_ partofgRNAcassette Cfp1_513 54 GTR1_scaffold_ Oligonucleotide GTR2CDStargetedfor 0_1964427_ cleavagebyCpf1enzyme; 1972843_+_ partofgRNAcassette Cfp1_537 55 GTR1_scaffold_ Oligonucleotide GTR2CDStargetedfor 0_1964427_ cleavagebyCpf1enzyme; 1972843_+_ partofgRNAcassette Cfp1_174 56 GTR1_scaffold_ Oligonucleotide GTR2CDStargetedfor 0_1964427_ cleavagebyCpf1enzyme; 1972843_+_ partofgRNAcassette Cfp1_265 57 GTR1_scaffold_ Oligonucleotide GTR2CDStargetedfor 0_1964427_ cleavagebyCpf1enzyme; 1972843_+_ partofgRNAcassette Cfp1_267 58 MYB28_ Oligonucleotide MYB28CDStargetedfor scaffold_0_ cleavagebyCpf1enzyme; 2473389_ partofgRNAcassette 2480758_+_ CRISPR_170 59 MYB28_ Oligonucleotide MYB28CDStargetedfor scaffold_0_ cleavagebyCpf1enzyme; 2473389_ partofgRNAcassette 2480758_+_ CRISPR_172 60 MYB28_ Oligonucleotide MYB28CDStargetedfor scaffold_0_ cleavagebyCpf1enzyme; 2473389_ partofgRNAcassette 2480758_+_ Cfp1_569 61 MYB28_ Oligonucleotide MYB28CDStargetedfor scaffold_0_ cleavagebyCpf1enzyme; 2473389_ partofgRNAcassette 2480758_+_ Cfp1_147 62 MYB28_ Oligonucleotide MYB28CDStargetedfor scaffold_0_ cleavagebyCpf1enzyme; 2473389_ partofgRNAcassette 2480758_+_ Cfp1_573 63 MYB28_ Oligonucleotide MYB28CDStargetedfor scaffold_0_ cleavagebyCpf1enzyme; 2473389_ partofgRNAcassette 2480758_+_ Cfp1_157 64 MYB29_ Oligonucleotide MYB29CDStargetedfor scaffold_3_ cleavagebyCpf1enzyme; 2545596_ partofgRNAcassette 2553101__ CRISPR_156 65 MYB29_ Oligonucleotide MYB29CDStargetedfor scaffold_3_ cleavagebyCpf1enzyme; 2545596_ partofgRNAcassette 2553101__ Cfp1_606 66 MYB29_ Oligonucleotide MYB29CDStargetedfor scaffold_3_ cleavagebyCpf1enzyme; 2545596_ partofgRNAcassette 2553101__ CRISPR_161 67 MYB29_ Oligonucleotide MYB29CDStargetedfor scaffold_3_ cleavagebyCpf1enzyme; 2545596_ partofgRNAcassette 2553101__ Cfp1_247 68 MYB76_ Oligonucleotide MYB76CDStargetedfor scaffold_3_ cleavagebyCpf1enzyme; 2536681_ partofgRNAcassette 2543895__ CRISPR_55 69 MYB76_ Oligonucleotide MYB76CDStargetedfor scaffold_3_ cleavagebyCpf1enzyme; 2536681_ partofgRNAcassette 2543895__ Cfp1_493 70 MYB76_ Oligonucleotide MYB76CDStargetedfor scaffold_3_ cleavagebyCpf1enzyme; 2536681_ partofgRNAcassette 2543895__ CRISPR_56 71 MYB76_ Oligonucleotide MYB76CDStargetedfor scaffold_3_ cleavagebyCpf1enzyme; 2536681_ partofgRNAcassette 2543895__ Cfp1_495 72 Ta_TFP_ Oligonucleotide TFPCDStargetedfor scaffold_1_ cleavagebyCpf1enzyme; 4920343_ partofgRNAcassette 4927356_+_ CRISPR_164 73 Ta_TFP_ Oligonucleotide TFPCDStargetedfor scaffold_1_ cleavagebyCpf1enzyme; 4920343_ partofgRNAcassette 4927356_+_ Cfp1_482 74 Ta_TFP_ Oligonucleotide TFPCDStargetedfor scaffold_1_ cleavagebyCpf1enzyme; 4920343_ partofgRNAcassette 4927356_+_ CRISPR_167 75 Ta_TFP_ Oligonucleotide TFPCDStargetedfor scaffold_1_ cleavagebyCpf1enzyme; 4920343_ partofgRNAcassette 4927356_+_ Cfp1_198 76 GTR1_115 Oligonucleotide GTR1CDStargetedfor cleavagebySpCAS9enzyme; partofgRNAcassette 77 GTR1_116 Oligonucleotide GTR1CDStargetedfor cleavagebySpCAS9enzyme; partofgRNAcassette 78 GTR2_scaffold_ Oligonucleotide GTR2CDStargetedfor 0_1966458_ cleavagebySpCAS9enzyme; 1970958_+_ partofgRNAcassette CRISPR_43 79 GTR2_scaffold_ Oligonucleotide GTR2CDStargetedfor 0_1966458_ cleavagebySpCAS9enzyme; 1970958_+_ partofgRNAcassette CRISPR_46 80 MYB28-m1-CDS MutantCoding Mutanthag1-1allele hag1-1 region (Gdeletion) 81 MYB28-m1-PRT MutantProtein Mutanthag1-1allele (Gdeletion) 82 MYB28-m2-CDS MutantCoding Mutanthag1-2allele hag1-2,2172A region (+Ainsertion) 83 MYB28-m2-PRT MutantProtein Mutanthag1-2protein (+Ainsertion) 84 MYB28-m3-CDS MutantCoding Mutanthag1(allele region (+Ginsertion) 85 MYB28-m3-PRT MutantProtein Mutanthag1protein (+Ginsertion) 86 MYB28-m4-CDS MutantCoding Mutanthag1allele region (A>Gmutation) 87 MYB28-m4-PRT MutantProtein Mutanthag1allele (A>Gmutation) 88 MYB28-m6-CDS MutantCoding Mutanthag1allele region (+Ainsertion) 89 MYB28-m5-PRT MutantProtein Mutanthag1protein (+Ainsertion) 90 MYB28-m6-CDS MutantCoding Mutanthag1allele region (AGdeletion) 91 MYB28-m6-CDS MutantProtein Mutanthag1allele (AGdeletion) 92 CYP81A1-CDS WTCoding Biosyntheticenzymeanda REF2 region memberofcytochromeP450 93 CYP81A1- WTGene family.Catayzlesconversion Genomiclocus ofaliphaticaldoximesto 94 CYP81A1-PRT WTProtein nitrileoxidesoraci-nitro compounds 95 CYP83A1-m1-CDS MutantCoding Mutantcyp83a1allele region (Ginsertion) 96 CYP83A1-m1-PRT MutantProtein Mutantcyp83a1allele (Ginsertion) 97 CYP83A1-m2-CDS MutantCoding Mutantcyp83a1allele region (T>Gmutation) 98 CYP83A1-m2-PRT MutantProtein Mutantcyp83a1allele (T>Gmutation) 99 AOP2_sp_PS3 Oligonucleotide AOP2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 100 AOP2_sp_PS1 Oligonucleotide AOP2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 101 AOP2_sp_PS4 Oligonucleotide AOP2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 102 AOP2_sp_PS2 Oligonucleotide AOP2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 103 AOP2_sp_PS6 Oligonucleotide AOP2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 104 AOP2_sp_PS1 Oligonucleotide AOP2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 105 AOP2_sp_PS2 Oligonucleotide AOP2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 106 HAG1_513 Oligonucleotide HAG1CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 107 HAG1_sp_PS1_F Oligonucleotide HAG1CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 108 HAG1/3_sp_R Oligonucleotide HAG1/HAG3CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 109 HAG1/2_sa_ Oligonucleotide HAG1/HAG2CDStargetedfor PS1_F cleavagebySpCas9enzyme; partofgRNAcassette 110 HAG1/3_sp_R Oligonucleotide HAG2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 111 HAG2_sp_PS2_F Oligonucleotide HAG2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 112 HAG2_sp_PS3_F Oligonucleotide HAG2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 113 HAG3_sp_PS2_F Oligonucleotide HAG3CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 114 HAG3_431 Oligonucleotide HAG3CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 115 HAG3_sp_ Oligonucleotide HAG3CDStargetedfor knockout_1 cleavagebySpCas9enzyme; partofgRNAcassette 116 HAG3_sp_ Oligonucleotide HAG3CDStargetedfor knockout_2 cleavagebySpCas9enzyme; partofgRNAcassette 117 CYP83A1_sp_ Oligonucleotide CYP83A1CDStargetedfor PS3_F cleavagebySpCas9enzyme; partofgRNAcassette 118 GTR1_sp_PS1 Oligonucleotide GTR1CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 119 GTR1/2_sp_PS1 Oligonucleotide GTR1/GTR2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 120 GTR1/2_sp_PS2 Oligonucleotide GTR1/GTR2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 121 GTR1/2_sa_PS1 Oligonucleotide GTR1/GTR2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 122 GTR1/2_sa_PS2 Oligonucleotide GTR1/GTR2CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 123 GTR1_sp_PS2_F Oligonucleotide GTR1CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 124 GTR1_sp_PS3_F Oligonucleotide GTR1CDStargetedfor cleavagebySpCas9enzyme; partofgRNAcassette 125 GTR1_sp_ Oligonucleotide GTR1CDStargetedfor knockout_1 cleavagebySpCas9enzyme; partofgRNAcassette 126 GTR1_sp_ Oligonucleotide GTR1CDStargetedfor knockout_2 cleavagebySpCas9enzyme; partofgRNAcassette 127 MYB76-m1ARV- MutantCoding TAAAGAAAGGAGCATGGACGT A427A CDS Region (nt35-55ofSEQIDNO: 25).fwdarw.TAAAGAAAGG-GCATGGACGT (nt35-54ofSEQIDNO:127) 128 MYB76-m1ARV- MutantProtein Frameshiftcausedby1bp PRT deletion 129 MYB76-m2ARV- MutantCoding CTGTATCGGAGAAGGGTTAAAGAAAGG A430B CDS Region AGCAT(nt18-50ofSEQID NO:25).fwdarw.CT--------------- ------------AT(nt18-21of SEQIDNO:129) 130 MYB76-m2ARV- MutantProtein Presumedlossoffunction PRT causedby27bpdeletion 131 MYB29-m1ARV- MutantCoding (nt86-690ofSEQIDNO:22) A264A,A296A,A316B,A329B CDS Region TCCATGAA---598bpdeletion ---AAGGAACC(nt72-82of SEQIDNO:131) 132 MYB29-m1ARV- MutantProtein Truncatedproteincausedby PRT largedeletion 133 MYB29-m2ARV- MutantCoding (nt72-709ofSEQIDNO:22) A361B CDS Region ACTCATCT---603bpdeletion ---ACCGCACTG(nt72-87of SEQIDNO:133) 134 MYB29-m2ARV- MutantProtein Truncatedproteincausedby PRT largedeletion 135 MYB29-m3ARV- MutantCoding ATCCATGAACATGGCGAAG(nt A262A,A275A CDS Region 85-103ofSEQIDNO:22).fwdarw. ATCCATGAA(A)CATGGCGAAG(nt 85-104ofSEQIDNO:135), andTCAGCGTCCATGGAAGGAACCTT (nt670-692ofSEQIDNO: 22).fwdarw.TCAGCGTCCATGGAA(A)GGA ACCTT(nt670-693ofSEQ IDNO:135) 136 MYB29-m3ARV- MutantProtein Frameshiftcausedby1bp PRT insertion(secondeditalso 1bpinsertion) 137 MYB29-m4ARV- MutantCoding TCAGCGTCCATGGAAGGAACCTT(nt A261C CDS Region 670-692ofSEQIDNO:22).fwdarw. TCAGCGTCCA---AAGGAACCTT(nt 670-689ofSEQIDNO:137) 138 MYB29-m4ARV- MutantProtein MissingM227,E228>K PRT 139 MYB29-m5ARV- MutantCoding TCAGCGTCCATGGAAGGAACCTT(nt A268A CDS Region 670-692ofSEQIDNO:22).fwdarw. TCAGCGTCC----AAGGAACCTT(nt 670-689ofSEQIDNO:139) 140 MYN29-m5ARV- MutantProtein Frameshiftcausedby4bp PRT deletion 141 MYB29-m6ARV- MutantCoding TCAGCGTCCATGGAAGGAACCTT(nt A263A,A347D CDS Region 670-692ofSEQIDNO:22).fwdarw. TCAGCGTCCATGGA-GGAACCTT(nt 670-691ofSEQIDNO:141) 142 MYB29-m6ARV- MutantProtein Frameshiftcausedby1bp PRT deletion 143 GTR1-m1ARV- MutantCoding CCTCTGCGACACTTACTTTG(nt A382A CDS Region 321-340ofSEQIDNO:13).fwdarw. CCT-------------TTTG(nt 321-327ofSEQIDNO:143) 144 GTR1-m1ARV- MutantProtein Frameshiftcausedby13bp PRT deletion 145 GRT2-m1ARV- MutantCoding AGTGCATTGTGAGAGTGCT(nt A412A CDS Region 1037-1055ofSEQIDNO: 16).fwdarw.AGTGCATT(T)GTGAGAGTGC T(nt1037-1056ofSEQID NO:145) 146 GTR2-m1ARV- MutantProtein Frameshiftcausedby1bp PRT insertion 147 AOP2-m1ARV- MutantCoding TTTCCGAGAGTATGGGGATC(nt A368A CDS Region 275-294ofSEQIDNO:1).fwdarw. TTTCCGAGAG(A)TATGGGGATC(nt 275-295ofSEQIDNO:147) 148 AOP2-m1ARV- MutantProtein Frameshiftcausedby1bp PRT insertion 149 AOP2-m2ARV- MutantCoding TTTCCGAGAGTATGGGGATC(nt A377A CDS Region 275-294ofSEQIDNO:1).fwdarw. TTTCCGAGA--ATGGGGATC(nt 275-292ofSEQIDNO:149) 150 AOP2-m2ARV- MutantProtein Frameshiftcausedby2bp PRT deletion 151 AOP2-m3ARV- MutantCoding TTTCCGAGAGTATGGGGATC(nt A390A CDS Region 275-294ofSEQIDNO:1).fwdarw. TTTCCGAGAGT--GGGGATC(nt 275-292ofSEQIDNO:151) 152 AOP2-m3ARV- MutantProtein Frameshiftcausedby2bp PRT deletion 153 AOP2-m4ARV- MutantCoding TTTCCGAGAGTATGGGGATC(nt A402A CDS Region 275-294ofSEQIDNO:1).fwdarw. TTTCCGAGAGT----GGATC(nt 275-290ofSEQIDNO:153) 154 AOP2-m4ARV- MutantProtein Frameshiftcausedby4bp PRT deletion 155 AOP2-m5ARV- MutantCoding TTTCCGAGAGTATGGGGATC(nt A378A,A379A,A385A,A394A, CDS Region 275-294ofSEQIDNO:1).fwdarw. A403B TTTCCGAGAGT(T)ATGGGGATC(nt 275-295ofSEQIDNO:155) 156 AOP2-m5ARV- MutantProtein Frameshiftcausedby1bp PRT deletion 157 AOP2-m6ARV- MutantCoding TTTCCGAGAGTATGGGGATC(nt CDS Region 275-294ofSEQIDNO:1).fwdarw. TTTC--------TGGGGATC(nt 275-286ofSEQIDNO:157) 158 AOP2-m6ARV- MutantProtein Frameshiftcausedby8bp PRT deletion 159 BHLH05-WT-CDS WTCoding basichelix-loop-helix BHLH05,MYC3,bHLH05 region transcriptionfactor05 160 BHLH05-WT- WTGene (bHLH05)transcription GenomicLocus factoraffectsthe 161 BHLH05-WT-PRT WTProtein biosynthesisof glucosinolates 162 IMD1-WT-CDS WTCoding ISOPROPYLMALATE IMD1,ISOPROPYLMALATE region DEHYDROGENASE1(IMD1)is DEHYDROGENASE1 163 IMD1-WT- WTGene involvedinleucine GenomicLocus biosynthesisandmethionine 164 IMD1-WT-PRT WTProtein chainelongationrequired forglucosinolate biosynthesis 165 CYP79B3-WT-CDS WTCoding EncodescytochromeP450 CYP79B3,CYTOCHROMEP450, region family79andisinvolvedin FAMILY79,SUBFAMILYB, 166 CYP79B3-WT- WTGene biosynthesisof POLYPEPTIDE3 Genomiclocus glucosinolates 167 CYP79B3-WT- WTGene PRT 168 MAM1-WT-CDS WTCoding EncodesMETHYLTHIOALKYL MAM1,METHYLTHIOALKYL region MALATESYNTHASE1is MALALTESYNTHASE1,gsm1 169 MAM1-WT- WTGene involvedinbiosynthesisof GenomicLocus glucosinolates 170 MAM1-WT-PRT WTProtein 171 Ta_FMO-GS-Ox1- WTCoding FLAVIN-MONOOXYGENASE FMOGS-Ox1,FLAVIN- WT-CDS region GLUCOSINOLATES-OXYGENASE1 MONOOXYGENASEGLUCOSINOLATE 172 Ta_FMO-GS-Ox1- WTGene catalyzestheconversionof S-OXYGENASE1, WT-Genomic methylthioalkylglucosino- Locus latestomethylsulfinylalkyl 173 Ta_FMO-GS-Ox1- WTProtein glucosinolates WT-PRT 174 Ta_UGT74B1- WTCoding UDP-glucose: UGT74B1,UDP-GLUCOSYL WT-CDS region thiohydroximate TRANSFERASE74B1 175 Ta_UGT74B1- WTGene S-glucosyltransferase WT-Genomic involvedinglucosinolate Locus biosynthesis 176 Ta_UGT74B1- WTProtein WT-PRT 177 Ta_FMO-GS-Ox1- MutantCoding TTGAGCCTCGTCTAGCTGAA(nt 1-CDS Region 653-672ofSEQIDNO: 171).fwdarw.TTGAGCCTC<A>TCTAGCTG AA(nt653-672ofSEQID NO:177) 178 Ta_FMO-Gs-Ox1- MutantProtein Aminoacidchange 1-PRT 179 Ta_MAM1-1-CDS MutantCoding GCAAACATAGAGACATTGAG(nt E5543 Region 464-483ofSEQIDNO: 168).fwdarw.GCAAACATA<A>AGACATTG AG(nt464-483ofSEQID NO:179) 180 Ta_MAM1-1-PRT MutantProtein Aminoacidchange 181 Ta_MAM1-2-CDS MutantCoding TGTGTGTGCTGGAGCAAGAC(nt D0956 Region 891-910ofSEQIDNO: 168).fwdarw.TGTGTGTGCTGGA<A>CAAG AC(nt891-910ofSEQID NO:181) 182 Ta_MAM1-2-PRT MutantProtein Aminoacidchange 183 Ta_AOP2-like- MutantCoding CCGAGAGTATGGGGATCCAG(nt E3196,Nutty,aop2-1 1MAR-CDS Region 278-297ofSEQIDNO:1).fwdarw. CCGAGAGTATG<A>GGATCCAG(nt 278-297ofSEQIDNO:183) 184 Ta_AOP2-like- MutantProtein Aminoacidchange 1MAR-PRT 185 Ta_bhlh05-1- MutantCoding AGAAGGCTGGACCTACGCGA(nt D3N13P3 CDS Region 189-208ofSEQIDNO: 159).fwdarw.AGAAGGCTG<A>CCTACGCG A(nt189-208ofSEQID NO:185) 186 Ta_bhlh05-1- MutantProtein Truncatedproteincaused PRT byprematurestopcodon 187 Ta_bhlh05-2- MutantCoding CGGAGACAACACAGTGATTCT(nt E5202P2 CDS Region 246-266ofSEQIDNO: 159).fwdarw.CGGAGACAAC-CAGTGATTC T(nt246-265ofSEQID NO:187) 188 Ta_bhlh05-2- MutantProtein Frameshiftcausedby1bp PRT deletion 189 Ta_bhlh05-3- MutantCoding GGCGGAACCGGAGTTTCCGA(nt E5133P2,fad2-2 CDS Region 394-413ofSEQIDNO: 159).fwdarw.GGCGGAACCG<A>AGTTTCC GA(nt394-413ofSEQID NO:189) 190 Ta_bhlh05-3- MutantProtein Aminoacidchange PRT 191 Ta_myb28-5SED- MutantCoding CATCCACGAGCACGGTGAA(nt CDS Region 84-103ofSEQIDNO:22).fwdarw. CATCCACG-GCACGGTGAA(nt 84-102ofSEQIDNO:191) 192 Ta_myb28-5SED- MutantProtein Frameshiftdueto1bp PRT deletion 193 myb76-1SED- MutantCoding TAAAACGGTGTGGAAAGAG(nt CDS Region 137-157ofSEQIDNO:25).fwdarw. TAAAACGGT(T)GTGGAAAGAG(nt 137-156ofSEQIDNO:193) 194 myb76-1SED- MutantProtein Frameshiftdueto1bp PRT insertion 195 myb29-1SED- MutantCoding GCCACTTGCCCCTAGCCCTAGTCCGGC 2172A CDS Region CACGCTA(nt381-413ofSEQ IDNO:22).fwdarw.GCCACTTG------ -------TCCGGCCACGCT(nt 381-400ofSEQIDNO:195) 196 myb29-1SED- MutantProtein Frameshiftdueto1bp PRT deletion 197 myb29-2SED- MutantCoding TAGCCCTAGTCCGGCCACGCTC(nt 2180A CDS Region 393-414ofSEQIDNO:22).fwdarw. TAGCCCTA------CCACGCTC(nt 393-408ofSEQIDNO:197) 198 myb29-2SED- MutantProtein Presumedlossoffunction PRT dueto6bpdeletion 199 Ta_imd1-1-CDS MutantCoding AGAGCCCAGAGGCATTAAGA(nt A795,tt4-1 Region 663-682ofSEQIDNO: 162).fwdarw.AGAGCCCA<A>AGGCATTAA GA(nt663-682ofSEQID NO:199) 200 Ta_imd1-1-PRT MutantProtein Aminoacidchange 201 Ta_imd1-2-CDS MutantCoding TCGGTGTATCGGGACCTGGA(nt D322 Region 1040-1059ofSEQIDNO: 162).fwdarw.TCGGTGTAT<T>GGGACCTG GA(nt1040-1059ofSEQID NO:201) 202 Ta_imd1-2-PRT MutantProtein Aminoacidchange 203 Ta_cyp79b3-1- MutantCoding CTTTCCAACGGCTACAAAAC(nt I87207 CDS Region 412-431ofSEQIDNO: 165).fwdarw.CTTTCCAAC<A>GCTACAAA AC(nt412-431ofSEQID NO:203) 204 Ta_cyp79b3-1- MutantProtein Aminoacidchange PRT 205 Ta_cyp79b3-2- MutantCoding GGTCTGATCCACTTAGCTTT(nt E5519 CDS Region 1328-1347ofSEQIDNO: 165).fwdarw.GGTCTGAT<T>CACTTAGCT TT(nt1328-1347ofSEQID NO:205) 206 Ta_cyp79b3-2- MutantProtein Aminoacidchange PRT 207 Ta_cyp83a1-1- MutantCoding TTCAGGCCCGAGAGGTTTC(nt A766 CDS Region 1240-1258ofSEQIDNO: 97).fwdarw.TTCAGGCCC<A>AGAGGTTTC (nt1240-1258ofSEQID NO:207) 208 Ta_cyp83a1-1- MutantProtein Aminoacidchange PRT 209 Ta_cyp83a1-2- MutantCoding TTATCATACAAGATAGGAAA(nt CDS Region 196-215ofSEQIDNO:97).fwdarw. TTATCATACAA(A)GATAGGAAA(nt 196-216ofSEQIDNO:209) 210 Ta_cyp83a1-2- MutantProtein Frameshiftcausedby1bp PRT insertion 211 Ta_cyp83a1-3- MutantCoding TTATCATACAAGATAGGAAA(nt CDS Region 196-215ofSEQIDNO:97).fwdarw. TTATCATACAA(T)GATAGGAAA(nt 196-216ofSEQIDNO:211) 212 Ta_cyp83a1-3- MutantProtein Frameshiftcausedby1bp PRT insertion 213 Ta_AOP2-like MutantCoding (nt270-318ofSEQIDNO: aop2-2SED-CDS Region 1).fwdarw.CGGTCTTT--35bp deletion--TGGACAAA(nt 270-285ofSEQIDNO:213) 214 Ta_AOP2-like MutantProtein Presumedlossoffunction aop2-2SED-PRT dueto33bpdeletion 215 Ta_AOP2-like MutantCoding TCCTCATGTTTTGGACAAAGTTTA aop2-3SED-CDS Region (nt300-323ofSEQIDNO: 1).fwdarw.TCCTCAT--TTTGGACAAAGTT A(nt300-319ofSEQID NO:215) 216 Ta_AOP2-like MutantProtein Frameshiftcausedby2bp aop2-3SED-PRT deletion 217 Ta_AOP2-like MutantCoding TCCTCATGTTTTGGACAAAGTTTA aop2-4SED-CDS Region (nt300-323ofSEQIDNO: 1).fwdarw.TCCTCATGTTT-GACAAAGTTT A(nt300-322ofSEQID NO:217) 218 Ta_AOP2-like MutantProtein Frameshiftcausedby1bp aop2-4SED-PRT deletion 219 Ta_AOP2-like MutantCoding TCCTCATGTTTTGGACAAAGTTTA aop2-5SED-CDS Region (nt300-323ofSEQIDNO: 1).fwdarw.TCCTCATGTTTT(T)GGACAAA GTTTA(nt300-324ofSEQID NO:219) 220 Ta_AOP2-like MutantProtein Frameshiftcausedby1bp aop2-5SED-PRT insertion 221 Ta_gtr1-1-CDS MutantCoding CCGCAGCTCTTGCTTGCAGG(nt I87113,gtr1-1 Region 1561-1580ofSEQIDNO: 13).fwdarw.CCGCAGCTCTTGTT<T>GCAG G(nt1561-1580ofSEQID NO:221) 222 Ta_gtr1-1-PRT MutantProtein Aminoacidchange 223 Ta_gtr1-2-CDS MutantCoding TGAAATGCATTGTGAGAGT(nt 3A5K,gtr1-2 Region 1145-1163ofSEQIDNO: 13).fwdarw.TGAAATGCATGTGTGAGAGT (nt1145-1164ofSEQID NO:223) 224 Ta_gtr1-2-PRT MutantProtein Frameshiftcausedby1bp insertion 225 Ta_gtr2-1-CDS MutantCoding AAAGAAAGTGATGATGATCA(nt AX17D Region 1762-1781ofSEQIDNO: 16).fwdarw.AAAGAAAGT<A>ATGATGATC A(nt1762-1781ofSEQID NO:225) 226 Ta_gtr2-1-PRT MutantProtein Aminoacidchange 227 Ta-gtr2-2-CDS MutantCoding AGTGCATTGTGAGAGTGCT(nt 3A5C,3A5K,gtr2-2,A427A Region 1037-1055ofSEQIDNO: 16).fwdarw.AGTGCAT(A)TGTGAGAGTGC T(nt1037-1056ofSEQID NO:227) 228 Ta_gtr2-2-PRT MutantProtein Frameshiftcausedby1bp A427A insertion 229 Ta_gtr2-3-CDS MutantCoding AGTGCATTGTGAGAGTGCT(nt 3A5K,gtr2-3 Region 1037-1055ofSEQIDNO: 16).fwdarw.AGTGCAT(G)TGTGAGAGTGC T(nt1037-1056ofSEQID NO:227) 230 Ta_gtr2-3-PRT MutantProtein Frameshiftcausedby1bp 3A5K insertion 231 MYB28-2180A- MutantCoding Mutanthag1allele(-GT 2180A CDS region deletion) 232 MYB28-2180A- MutantProtein Mutanthag1protein(-GT 2180A PRT deletion) 233 MYB28-2172A- MutantCoding Mutanthag1allele(-TG 2172A CDS region deletion) 234 MYB28-2172A- MutantProtein Mutanthag1protein(-TG 2172A PRT deletion) 235 Ta_gtr1-3-CDS MutantCoding TGAAATGCATTGTGAGAGT(nt 3A5C,gtr1-3 Region 1145-1163ofSEQIDNO: 13).fwdarw.TGAAATGCAT-GTGAGAGT (nt1145-1164ofSEQID NO:235) 236 Ta_gtr1-3-PRT MutantProtein Frameshiftcausedby1bp 3A5C deletion

    [0031] In certain embodiments, pennycress plant seeds, seed lots, seed meal, and compositions having reduced sinigrin content as described herein can be obtained from the E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207 pennycress mutant lines provided herein, from progeny derived from those mutant lines, from hybrids derived from those mutant lines, or from germplasm from the mutants that provide seed or seed meal comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight. In certain embodiments, germplasm from the mutants that provides seed or seed meal comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight can be obtained by outcrossing the E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207 pennycress mutant lines to other pennycress lines with wild-type sinigrin levels, selfing progeny of the cross, and selecting for progeny of the self that provide seed or seed meal having less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight. In certain embodiments, germplasm from the mutants that provides seed meal comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram can be introgressed into the genetic background of a second pennycress line with wild-type sinigrin levels by using the second pennycress line as a recurrent parent in a series of backcrosses followed by selfs, where progeny of the selfs that seed or seed meal comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight are selected and carried forward into additional crosses to the recurrent parent. In certain embodiments, the pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, and/or I87207 germplasm that provides seed meal comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight can be combined in a pennycress plant to provide pennycress plant seeds, seed lots, seed meal, and compositions having reduced sinigrin content as described herein. In certain embodiments, the pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, and/or I87207 germplasm can provide pennycress plant seeds, seed lots, seed meal, and compositions comprising 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 mol sinigrin/gm dw (gram dry weight). Germplasm combinations comprising any of: (i) E3 196 and E5 444P1 germplasm; (ii) E3 196 and I87113 or E5 444P1 germplasm; (iii) E3 196 and I87207 or E5 444P1 germplasm; (iv) I87113 and I87207 or E5 444P germplasm; (iv) E3 196, I87113, E5 444P1, and I87207 germplasm; (v) E5 356P5 and E5 543 germplasm; or (vi) any combination of E3 196, E5 444P1, E5 356P5, I87113, E5 543, and/or I87207 germplasm that provide seed or seed meal comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight are provided herein. Also provided herein is the combination of any of the germplasms of the E3 196, E5 444P1, E5 356P5, I87113, E5 543, and/or I87207 pennycress mutant lines that provides for reduced sinigrin content or any of the aforementioned germplasm combinations of (i), (ii), (iii), (iv), or (v) with germplasm comprising loss-of function mutations in a GSL biosynthetic coding sequence or gene (e.g., SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 92, 93, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, or allelic variant thereof), at least one loss-of-function mutation in a GSL transport coding sequence or gene (SEQ ID NO: 13, 14, 16, 18, or allelic variant thereof), in a GSL hydrolysis coding sequence or gene (SEQ ID NO: 28, 29, or allelic variant thereof), and/or in an expression regulator (e.g., transcription factor; SEQ ID NO: 19, 20, 22, 23, 25, 26, 159, 160, allelic variant thereof) coding sequence or gene.

    [0032] A representative wild-type (WT) pennycress MYB28 (HAG1) coding sequence is as shown in sequence listing (SEQ ID NO: 19). The terms MYB28 and HAG1 are used interchangeably herein. In certain embodiments, a WT pennycress MYB28 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO: 19), and is referred to as an allelic variant sequence. In certain embodiments, a MYB28 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 19. A representative wild-type pennycress MYB28 polypeptide is shown in sequence listing (SEQ ID NO: 21). In certain embodiments, a WT pennycress MYB28 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO: 21), and is referred to as an allelic variant sequence. In certain embodiments, a WT pennycress MYB28 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO: 21), referred to herein as an allelic variant sequence, provided the polypeptide maintains its wild-type function. For example, a MYB28 polypeptide can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99) percent sequence identity to SEQ ID NO: 21. A MYB28 polypeptide of an allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO: 21.

    [0033] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include at least one loss-of-function modification in a MYB28 gene (e.g., in a MYB28 coding sequence, in a MYB28 regulatory sequence including the promoter, 5 UTR, intron, 3 UTR, or in any combination thereof) or a transgene or genome rearrangement that suppresses expression of the MYB28 gene. As used herein, a loss-of-function mutation in a MYB28 gene can be any modification that is effective to suppress MYB28 polypeptide expression or MYB28 polypeptide function. In certain embodiments, suppressed MYB28 polypeptide expression and/or MYB28 polypeptide function can comprise elimination or a reduction in such expression or function in comparison to a wild-type plant (i.e., can be complete or partial). Examples of genetic modifications that can provide for a loss-of-function mutation include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, or any combination thereof. In certain embodiments, any of the aforementioned loss-of-function (LOF) modifications in the MYB28 gene can be combined with a loss-of-function modification in a MYB29 gene or allelic variant thereof, and/or a loss-of-function modification in a MYB76 gene or allelic variant thereof to obtain pennycress plant seeds, seed lots, seed meal, and compositions having reduced sinigrin content described herein. Plants, germplasm, seed, seed lots, seed meal, and compositions comprising: (i) MYB28 and MYB29 LOF modifications; (ii) MYB28 and MYB76 LOF modifications; (iii) MYB29 and MYB76 LOF modifications; and (iii) MYB28, MYB29 and MYB76 LOF modifications are also provided herein.

    [0034] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a deletion (e.g., a single base-pair deletion) relative to the WT pennycress MYB28 coding sequence. In certain embodiments, a modified MYB28 coding sequence can include a single base-pair deletion of the guanine (G) at nucleotide residue 20 in a WT pennycress MYB28 coding sequence (e.g., SEQ ID NO: 19 or an allelic variant thereof). For example, a single base-pair deletion of the guanine (G) at nucleotide residue at nucleotide residue 20 in a WT pennycress MYB28 coding sequence thereby producing a premature stop codon. A representative modified pennycress MYB28 coding sequence having a loss-of-function single base pair deletion is presented in SEQ ID NO: 80.

    [0035] A modified or mutated pennycress MYB28 coding sequence having a loss-of-function single base pair deletion mutation (e.g., SEQ ID NO: 80) can encode a modified MYB28 polypeptide (e.g., a modified MYB28 polypeptide having suppressed MYB28 polypeptide expression and/or reduced MYB28 polypeptide function). For example, a modified pennycress MYB28 coding sequence having a single base-pair deletion (e.g., SEQ ID NO:80) can encode a modified MYB28 polypeptide. In certain embodiments, a modified MYB28 polypeptide can include a truncation resulting from the introduction of a stop codon at codon position 20 within the MYB28 open reading frame (e.g., SEQ ID NO:19). A representative truncated pennycress MYB28 polypeptide is presented in SEQ ID NO:81. The aforementioned loss-of-function modifications in a MYB28 encoding gene or a transgene or genome rearrangement that suppresses expression of the MYB28 gene thus include loss-of-function modifications in a gene encoding an MYB28 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a MYB28 allelic variant gene.

    [0036] A representative WT pennycress CYP83A1 coding region is presented in SEQ ID NO:92. Two protospacer locations and adjacent protospacer-adjacent motif (PAM) sites that can be targeted by, for example, CRISPR-SpCAS9, correspond to nucleotides 190-209 (protospacer) and 210-212 (PAM site).

    [0037] In certain embodiments, a WT pennycress CYP83A1 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:92), and is referred to as an allelic variant sequence. In certain embodiments, a CYP83A1 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:92. A representative WT pennycress CYP83A1 polypeptide is presented in SEQ ID NO:94.

    [0038] In certain embodiments, a WT pennycress CYP83A1 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:94), and is referred to as an allelic variant sequence, provided the polypeptide maintains its wild-type function. For example, a CYP83A1 polypeptide can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:94. A CYP83A1 polypeptide can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:94.

    [0039] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a CYP83A1 gene (e.g., in a CYP83A1 coding sequence) or a transgene or genome rearrangement that suppresses expression of the CYP83A1 gene. As used herein, a loss-of-function mutation in a CYP83A1 gene can be any modification that is effective to suppress CYP83A1 polypeptide expression or CYP83A1 polypeptide function. In certain embodiments, suppressed CYP83A1 polypeptide expression and/or CYP83A1 polypeptide function can comprise elimination or a reduction in such expression (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. The aforementioned loss-of-function modifications in a CYP83A1 encoding gene or a transgene or genome rearrangement that suppresses expression of the CYP83A1 gene thus include loss-of-function modifications in a gene encoding an CYP83A1 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of an CYP83A1 allelic variant gene.

    [0040] In certain embodiments, a WT pennycress AOP2 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:1 or 2), and is referred to as an allelic variant sequence. In certain embodiments, a AOP2 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:1 or 2. In certain embodiments, a WT pennycress AOP2 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:3), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. For example, a AOP2 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:3. An AOP2 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:3.

    [0041] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a AOP2 encoding gene or a transgene or genome rearrangement that suppresses expression of the AOP2 gene. As used herein, a loss-of-function mutation in a AOP2 gene can be any modification that is effective to reduce AOP2 polypeptide expression or AOP2 polypeptide function. In certain embodiments, suppressed AOP2 polypeptide expression and/or AOP2 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. The aforementioned loss-of-function modifications in an AOP2 encoding gene or a transgene or genome rearrangement that suppresses expression of the AOP2 gene thus include loss-of-function modifications in a gene encoding an AOP2 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of an AOP2 allelic variant gene.

    [0042] In certain embodiments, a WT pennycress BCAT4 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:4), and is referred to as an allelic variant sequence. In certain embodiments, a BCAT4 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:4. In certain embodiments, a WT pennycress BCAT4 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:6), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. For example, a BCAT4 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:6. A BCAT4 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:76.

    [0043] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a BCAT4 encoding gene or a transgene or genome rearrangement that suppresses expression of the BCAT4 gene. As used herein, a loss-of-function mutation in a BCAT4 gene can be any modification that is effective to reduce BCAT4 polypeptide expression or BCAT4 polypeptide function. In certain embodiments, suppressed BCAT4 polypeptide expression and/or BCAT4 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. The aforementioned loss-of-function modifications in a BCAT4 encoding gene or a transgene or genome rearrangement that suppresses expression of the BCAT4 gene thus include loss-of-function modifications in a gene encoding a BCAT4 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a BCAT4 allelic variant gene.

    [0044] In certain embodiments, a WT pennycress BCAT6 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:7), and is referred to as an allelic variant sequence. In certain embodiments, a BCAT6 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:7. In certain embodiments, a WT pennycress BCAT6 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:9), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. For example, a BCAT6 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:9. A BCAT6 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:9.

    [0045] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a BCAT6 encoding gene or a transgene or genome rearrangement that suppresses expression of the BCAT6 gene. As used herein, a loss-of-function mutation in a BCAT6 gene can be any modification that is effective to reduce BCAT6 polypeptide expression or BCAT6 polypeptide function. In certain embodiments, suppressed BCAT6 polypeptide expression and/or BCAT6 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof. The aforementioned loss-of-function modifications in a BCAT6 encoding gene or a transgene or genome rearrangement that suppresses expression of the BCAT6 gene thus include loss-of-function modifications in a gene encoding a BCAT6 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a BCAT6 allelic variant gene.

    [0046] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a CYP79F1 encoding gene or a transgene or genome rearrangement that suppresses expression of the CYP79F1 gene. As used herein, a loss-of-function mutation in a CYP79F1 gene can be any modification that is effective to reduce CYP79F1 polypeptide expression or CYP79F1 polypeptide function. In certain embodiments, suppressed CYP79F1 polypeptide expression and/or CYP79F1 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

    [0047] In certain embodiments, a WT pennycress CYP79F1 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:10), and is referred to as an allelic variant sequence. In certain embodiments, a CYP79F1 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:10. In certain embodiments, a WT pennycress CYP79F1 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:46), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. In certain embodiments, a CYP79F1 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:12. A CYP79F1 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:12. Loss-of-function modifications in a CYP79F1 encoding gene or a transgene or genome rearrangement that suppresses expression of the CYP79F1 gene thus include loss-of-function modifications in a gene encoding a CYP79F1 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a CYP79F1 allelic variant gene.

    [0048] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a GTR1 encoding gene or a transgene or genome rearrangement that suppresses expression of the GTR1 gene. As used herein, a loss-of-function mutation in a GTR1 gene can be any modification that is effective to reduce GTR1 polypeptide expression or GTR1 polypeptide function. In certain embodiments, suppressed GTR1 polypeptide expression and/or GTR1 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

    [0049] In certain embodiments, a WT pennycress GTR1 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:13), and is referred to as an allelic variant sequence. In certain embodiments, a GTR1 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:13. In certain embodiments, a WT pennycress GTR1 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:15), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. In certain embodiments, a GTR1 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:15. A GTR1 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:15. The aforementioned loss-of-function modifications in a GTR1 encoding gene or a transgene or genome rearrangement that suppresses expression of the GTR1 gene thus include loss-of-function modifications in a gene encoding a GTR1 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a GTR1 allelic variant gene.

    [0050] In certain embodiments, pennycress seed lots, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content can include a complete or partial loss-of-function modification in a GTR2 encoding gene or a transgene or genome rearrangement that suppresses expression of the GTR2 gene. As used herein, a loss-of-function mutation in a GTR2 gene can be any modification that is effective to reduce GTR2 polypeptide expression or GTR2 polypeptide function. In certain embodiments, suppressed GTR2 polypeptide expression and/or GTR2 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

    [0051] In certain embodiments, a WT pennycress GTR2 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:16), and is referred to as an allelic variant sequence. In certain embodiments, a GTR2 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:16. In certain embodiments, a WT pennycress GTR2 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:17), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. In certain embodiments, a GTR2 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:17. A GTR2 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:17. The aforementioned loss-of-function modifications in a GTR2 encoding gene or a transgene or genome rearrangement that suppresses expression of the GTR2 gene thus include loss-of-function modifications in a gene encoding a GTR2 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a GTR2 allelic variant gene.

    [0052] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content can include a complete or partial loss-of-function modification in a TFP encoding gene or a transgene or genome rearrangement that suppresses expression of the TFP gene. As used herein, a loss-of-function mutation in a TFP gene can be any modification that is effective to reduce TFP polypeptide expression or TFP polypeptide function. In certain embodiments, suppressed TFP polypeptide expression and/or TFP polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

    [0053] In certain embodiments, a WT pennycress TFP coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:28), and is referred to as an allelic variant sequence. In certain embodiments, a TFP coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:28. In certain embodiments, a WT pennycress TFP polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:30), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. In certain embodiments, a TFP polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:30. A TFP polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:30. The aforementioned loss-of-function modifications in a TFP encoding gene or a transgene or genome rearrangement that suppresses expression of the TFP gene thus include loss-of-function modifications in a gene encoding a TFP allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a TFP allelic variant gene.

    [0054] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a BHLH05 encoding gene or a transgene or genome rearrangement that suppresses expression of the BHLH05 gene. As used herein, a loss-of-function mutation in a BHLH05 gene can be any modification that is effective to reduce BHLH05 polypeptide expression or BHLH05 polypeptide function. In certain embodiments, suppressed BHLH05 polypeptide expression and/or BHLH05 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

    [0055] In certain embodiments, a WT pennycress BHLH05 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:159 or 160), and is referred to as an allelic variant sequence. In certain embodiments, a BHLH05 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO:159 or 160. In certain embodiments, a WT pennycress BHLH05 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:161), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. For example, a BHLH05 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 161. An BHLH05 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:161. The aforementioned loss-of-function modifications in a BHLH05 encoding gene or a transgene or genome rearrangement that suppresses expression of the BHLH05 gene thus include loss-of-function modifications in a gene encoding a BHLH05 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a BHLH05 allelic variant gene.

    [0056] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a IMD1 encoding gene or a transgene or genome rearrangement that suppresses expression of the IMD1 gene. As used herein, a loss-of-function mutation in a IMD1 gene can be any modification that is effective to reduce IMD1 polypeptide expression or IMD1 polypeptide function. In certain embodiments, suppressed IMD1 polypeptide expression and/or IMD1 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

    [0057] In certain embodiments, a WT pennycress IMD1 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO: 162 or 163), and is referred to as an allelic variant sequence. In certain embodiments, a IMD1 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 162 or 163. In certain embodiments, a WT pennycress IMD1 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:164), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. For example, a IMD1 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 164. An IMD1 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:164. The aforementioned loss-of-function modifications in a IMD1 encoding gene or a transgene or genome rearrangement that suppresses expression of the IMD1 gene thus include loss-of-function modifications in a gene encoding a IMD1 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a IMD1 allelic variant gene.

    [0058] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a CYP79B3 encoding gene or a transgene or genome rearrangement that suppresses expression of the CYP79B3 gene. As used herein, a loss-of-function mutation in a CYP79B3 gene can be any modification that is effective to reduce CYP79B3 polypeptide expression or CYP79B3 polypeptide function. In certain embodiments, suppressed CYP79B3 polypeptide expression and/or CYP79B3 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

    [0059] In certain embodiments, a WT pennycress CYP79B3 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO: 165 or 166), and is referred to as an allelic variant sequence. In certain embodiments, a CYP79B3 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 165 or 166. In certain embodiments, a WT pennycress CYP79B3 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:167), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. For example, a CYP79B3 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 167. A CYP79B3 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:167. The aforementioned loss-of-function modifications in a CYP79B3 encoding gene or a transgene or genome rearrangement that suppresses expression of the CYP79B3 gene thus include loss-of-function modifications in a gene encoding a CYP79B3 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a CYP79B3 allelic variant gene.

    [0060] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a MAM1 encoding gene or a transgene or genome rearrangement that suppresses expression of the MAM1 gene. As used herein, a loss-of-function mutation in a MAM1 gene can be any modification that is effective to reduce MAM1 polypeptide expression or MAM1 polypeptide function. In certain embodiments, suppressed MAM1 polypeptide expression and/or MAM1 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

    [0061] In certain embodiments, a WT pennycress MAM1 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO:168 or 169), and is referred to as an allelic variant sequence. In certain embodiments, a MAM1 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 168 or 169. In certain embodiments, a WT pennycress MAM1 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:170), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. For example, a MAM1 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 170. A MAM1 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:170. The aforementioned loss-of-function modifications in a MAM1 encoding gene or a transgene or genome rearrangement that suppresses expression of the MAM1 gene thus include loss-of-function modifications in a gene encoding a MAM1 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a MAM1 allelic variant gene.

    [0062] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a FMO-GS-Ox1 encoding gene or a transgene or genome rearrangement that suppresses expression of the FMO-GS-Ox1 gene. As used herein, a loss-of-function mutation in a FMO-GS-Ox1 gene can be any modification that is effective to reduce FMO-GS-Ox1 polypeptide expression or FMO-GS-Ox1 polypeptide function. In certain embodiments, suppressed FMO-GS-Ox1 polypeptide expression and/or FMO-GS-Ox1 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

    [0063] In certain embodiments, a WT pennycress FMO-GS-Ox1 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO: 171 or 172), and is referred to as an allelic variant sequence. In certain embodiments, a FMO-GS-Ox1 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 171 or 172. In certain embodiments, a WT pennycress FMO-GS-Ox1 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:173), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. For example, a FMO-GS-Ox1 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 173. An FMO-GS-Ox1 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:173. The aforementioned loss-of-function modifications in a FMO-GS-Ox1 encoding gene or a transgene or genome rearrangement that suppresses expression of the FMO-GS-Ox1 gene thus include loss-of-function modifications in a gene encoding a FMO-GS-Ox1 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a FMO-GS-Ox1 allelic variant gene.

    [0064] In certain embodiments, pennycress seed lots, plants, seeds, as well as the seed meals and compositions obtained therefrom, all having reduced sinigrin content, can include a loss-of-function modification in a UGT74B1 encoding gene or a transgene or genome rearrangement that suppresses expression of the UGT74B1 gene. As used herein, a loss-of-function mutation in a UGT74B1 gene can be any modification that is effective to reduce UGT74B1 polypeptide expression or UGT74B1 polypeptide function. In certain embodiments, suppressed UGT74B1 polypeptide expression and/or UGT74B1 polypeptide function can comprise elimination or a reduction in such expression or function (i.e., can be complete or partial). Examples of genetic modifications include, without limitation, deletions, insertions, substitutions, translocations, inversions, duplications, and any combination thereof.

    [0065] In certain embodiments, a WT pennycress UGT74B1 coding sequence can have a sequence that deviates from the coding sequence set forth above (e.g., SEQ ID NO: 174 or 175), and is referred to as an allelic variant sequence. In certain embodiments, a UGT74B1 coding sequence allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 174 or 175. In certain embodiments, a WT pennycress UGT74B1 polypeptide can have a sequence that deviates from the polypeptide sequence set forth above (SEQ ID NO:176), and is referred to as an allelic variant sequence provided the polypeptide maintains its wild-type function. For example, a UGT74B1 polypeptide allelic variant can have at least 80, at least 85, at least 90, at least 95, at least 98, or at least 99 percent sequence identity to SEQ ID NO: 176. An UGT74B1 polypeptide allelic variant can have one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) amino acid modifications (e.g., substitutions) relative to SEQ ID NO:176. The aforementioned loss-of-function modifications in a UGT74B1 encoding gene or a transgene or genome rearrangement that suppresses expression of the UGT74B1 gene thus include loss-of-function modifications in a gene encoding a UGT74B1 allelic variant gene, or a transgene or genome rearrangement that suppresses expression of a UGT74B1 allelic variant gene.

    [0066] In certain embodiments, the pennycress seeds, seed lots, seed meals (defatted and non-defatted), compositions comprising those seed meals, and pennycress plants provided herein can comprise loss-of-function mutation(s), transgene(s), and/or genomic rearrangement(s) that suppress expression and/or activity of at least two of any of the aforementioned endogenous pennycress genes or allelic variants thereof (e.g., MYB28, MYB29, MYB76, CYP83A1, AOP2, BCAT4, BCAT6, CYP79F1, GTR1, GTR2, TFP, BHLH05 IMD1, CYP79B3, MAM1, FMO-GS-Ox1, and/or UGT74B1) or encoded polypeptides). In one embodiment, the loss-of-function mutation(s), genomic rearrangement(s), and/or transgene(s) can suppress expression of both a GTR1 gene (e.g., of SEQ ID NO:15 or an allelic variant thereof) and a GTR2 gene (e.g., of SEQ ID NO:17 or an allelic variant thereof). In one embodiment, the loss-of-function mutation(s), genomic rearrangement(s), and/or transgene(s) can suppress expression and/or activity of both a MYB28 gene (e.g., of SEQ ID NO:21 or an allelic variant thereof) and a MYB29 gene (e.g., of SEQ ID NO:24 or an allelic variant thereof). In one embodiment, the loss-of-function mutation(s), transgene(s), and/or genomic rearrangement(s) can suppress expression and/or activity of both a GTR1 gene (e.g., of SEQ ID NO:15 or an allelic variant thereof) and a MYB29 gene (e.g., of SEQ ID NO:24 or an allelic variant thereof). In certain embodiments, suppression of gene expression and/or activity provided by the loss-of-function mutation(s), transgene(s), and/or genomic rearrangement(s) is partial. In certain embodiments, such partial suppression in the any of the aforementioned embodiments can comprise a reduction of at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of activity and/or transcript levels of the endogenous pennycress gene (e.g., MYB28, MYB29, MYB76, CYP83A1, AOP2, BCAT4, BCAT6, CYP79F1, GTR1, GTR2, TFP, BHLH05 IMD1, CYP79B3, MAM1, FMO-GS-Ox1, and/or UGT74B1) in the plant or a part of the plant (e.g., seed) comprising the loss-of-function mutation(s), transgene(s), and/or genomic rearrangement(s) in comparison to the activity and/or transcript levels in a wild-type control plant lacking the loss-of-function mutation(s), transgene(s), and/or genomic rearrangement(s).

    [0067] In certain embodiments, a genome editing system such as a CRISPR-Cas9 system can be used to introduce one or more loss-of-function mutations into genes such as the glucosinolate biosynthesis, transporters and related regulatory genes (i.e., transcription factors) provided herewith in Table 1 and the sequence listing to obtain pennycress plants, seeds, seed lots, and compositions with reduced seed sinigrin content. For example, a CRISPR-Cas9 vector can include at least one guide sequence specific to a pennycress GTR2 sequence (see, e.g., SEQ ID NO:16) and/or at least one guide sequence specific to a pennycress GTR2 sequence (see, e.g., SEQ ID NO:17). A Cas9 enzyme will bind to and cleave within the gene when the target site is followed by a PAM sequence. For example, the canonical SpCAS9 PAM site is the sequence 5-NGG-3, where N is any nucleotide followed by two guanine (G) nucleotides. The Cas9 component of a CRISPR-Cas9 system designed to introduce one or more loss-of-function modifications described herein can be any appropriate Cas9. In certain embodiments, the Cas9 of a CRISPR-Cas9 system described herein can be a Streptococcus pyogenes Cas9 (SpCas9). One example of a SpCas9 is described in Fauser et al., 2014.

    [0068] The LOF mutations in any of the genes of coding sequences of Table 1 can be introduced by a variety of methods. Methods for introduction of the LOF mutations include, but are not limited to, traditional mutagenesis (e.g., Ethyl Methane Sulfonate (EMS), fast neutrons (FN), or gamma rays), TILLING, meganucleases, zinc finger nucleases, transcription activator-like effector nucleases, clustered regularly interspaced short palindromic repeat (CRISPR)-associated nuclease (e.g., Cas9, Cpf1, Cms1, S. aureus Cas9 variants, eSpCas9), targetrons, and the like. Various tools that can be used to introduce mutations into genes have been disclosed in Guha et al., 2017. Methods for modifying genomes by use of Cpf1 or Csm1 nucleases are disclosed in US Patent Application Publication 20180148735, which is incorporated herein by reference in its entirety, can be adapted for introduction of the LOF mutations disclosed herein. Methods for modifying genomes by use of CRISPR-CAS systems are disclosed in US Patent Application Publication 20180179547, which is incorporated herein by reference in its entirety, can be adapted for introduction of the LOF mutations disclosed herein. The genome editing reagents described herein can be introduced into a pennycress plant by any appropriate method. In certain embodiments, nucleic acids encoding the genome editing reagents can be introduced into a plant cell using Agrobacterium- or Ensifer mediated transformation, particle bombardment, liposome delivery, nanoparticle delivery, electroporation, polyethylene glycol (PEG) transformation, or any other method suitable for introducing a nucleic acid into a plant cell. In certain embodiments, the Site-Specific Nuclease (SSN) or other expressed gene editing reagents can be delivered as RNAs or as proteins to a plant cell and the RT, if one is used, can be delivered as DNA.

    [0069] Also provided herein are defatted pennycress seed meal with reduced sinigrin content in comparison to defatted pennycress seed meal obtained from wild-type pennycress seed lots. Defatted-pennycress seed meal is a product obtained from high-pressure crushing of seed, or from a pre-press solvent extraction process, which removes oil from the whole seed. Solvents used in such extractions include, but are not limited to, hexane or mixed hexanes. The meal is the material that remains after most of the oil has been removed. The typical range of sinigrin in meal made from wild-type pennycress seed is greater than 190 micromoles sinigrin per gram meal by dry weight (mol/gm dw). To be useful as a high protein animal feed, and competitive with other protein feedstuffs, the level of sinigrin level in meal should be less than 30 micromoles sinigrin per gram by dry weight of the meal. In certain embodiments, defatted pennycress seed meal having a sinigrin content of less than 30, 28, 25, or 15 mol sinigrin/gm dw are provided. In certain embodiments, defatted pennycress seed meal having a sinigrin content of about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 mol sinigrin/gm dw is provided herein. Compositions comprising such defatted pennycress seed meal are also provided herein. Such seed meal or compositions can comprise polynucleotides encoding any of the aforementioned LOF mutations. Such seed meal or compositions can also comprise any marker that is characteristic of the pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207 germplasm. In certain embodiments, such biomarkers include a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 444P1 E5 356P5, I87113, E5 543, or I87207. Mutations in the pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207 can be identified by sequencing the genomic DNA or pertinent genes (e.g., genes of Table 1) and comparing those sequences to the corresponding sequences of the parent pennycress lines from which they were obtained.

    [0070] Non-defatted pennycress seed meal having less sinigrin than non-defatted control pennycress seed meal obtained from wild-type pennycress seed is provided herein. In certain embodiments, the sinigrin content of non-defatted pennycress seed meal and compositions comprising the same that are provided herein is reduced from about 1.25-, 1.5-, 2-, or 3-fold to about 4-, 5-, 6-, 7-, 10-, 20-, 40-, 50-, 60-, 70-, 80-, 100-, 120-, 140-, -160-, 180-, or 200-fold in comparison to control non-defatted pennycress seed meal and compositions comprising the same obtained from control wild-type pennycress seeds. In certain embodiments, the non-defatted pennycress seed meal is obtained from pennycress seeds that have been crushed, ground, macerated, expelled, extruded, or any combination thereof. Typically, the level of sinigrin in wild-type pennycress seed and non-defatted seed meal obtained therefrom varies from about 70 to about 150 mol sinigrin/gm dw. To be useful as a high protein animal feed, and competitive with other protein feedstuffs, the sinigrin level in non-defatted meal should be less than 30 mol sinigrin/gm dw of the meal. In certain embodiments, non-defatted pennycress seed meal having a sinigrin content of less than 30, 28, 25, 16, or 15 mol sinigrin/gm dw are provided herein. In certain embodiments, non-defatted pennycress seed meal having a sinigrin content of about less than 15, 14, or 12 mol sinigrin/gm dw is provided herein. In certain embodiments, non-defatted pennycress seed meal having a sinigrin content of 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 mol sinigrin/gm dw are provided herein. Compositions comprising such non-defatted pennycress seed meal are also provided herein. Such seed meal or compositions can comprise polynucleotides encoding any of the aforementioned LOF mutations.

    [0071] The disclosure will be further described in the following examples, which do not limit the scope of the disclosure described in the claims.

    EXAMPLES

    Example 1: Generation of Transgenic Pennycress Lines Harboring the CRISPR-Cas9 or CRISPR-Cpf1 or CRISPR-Cms1 Constructs

    Materials and Methods

    [0072] Construction of the Thlaspi arvense (Pennycress) AOP2, BCAT4, BCAT6, CYP79F1, CYP83A1, GTR1, GTR2, MYB28 (HAG1), HAG3 (MYB29), MYB76 and TFP Gene-Specific CRISPR Genome-Editing Vectors.

    [0073] The constructs and cloning procedures for generation of the Thlaspi arvense (pennycress) AOP2, BCAT4, BCAT6, CYP79F1, CYP83A1, GTR1, GTR2, MYB28 (HAG1), HAG3 (MYB29), MYB76 and TFP-specific CRISPR-SpCas9 and CRISPR-SaCas9 constructs were adapted in part from the following two publications that describe general procedures for use of SaCas9 in plants: Steinert J, et. al. (2015) and Fauser F, et. al. (2014).

    [0074] The plant selectable markers (formerly NPT) in the original pDe-SpCas9 and pDe-SaCas9 binary vectors were swapped for hygromycin resistance (Hygromycin phosphotransferase, or HPT) or fluorescent protein marker (FP) gene.

    [0075] Vector Transformation into Agrobacterium

    [0076] The pDe-SpCas9_Hyg, pDe-SaCas9_Hyg, pARV145, containing the Streptococcus pyogenes Cas9 (SpCas9) and the Staphylococcus aureus Cas9 (SaCas9) cassettes, or related vectors represented in FIGS. 1-7, with the corresponding sequence-specific protospacers were transformed into Agrobacterium tumefaciens strain GV3101 using the freeze/thaw method (Holsters et al, 1978).

    [0077] The transformation product was plated on 1% agar Luria Broth (LB) plates with gentamycin (50 g/ml) rifampicin (50 g/ml) and spectinomycin (75 gimp. Single colonies were selected after two days of growth at 28 C.

    [0078] Plant TransformationPennycress Floral Dip

    [0079] Day One:

    [0080] 5 mL of LB+5 uL with appropriate antibiotics (Rifampin (50), Spectinomycin (75), and/or Gentamycin (50)) were inoculated with Agrobacterium. The cultures were allowed to grow, with shaking, overnight at 28 C.

    [0081] Day Two (Early Morning):

    [0082] 25 mL of Luria Broth+25 uL appropriate antibiotics (Rifampin (50), Spectinomycin (75), and/or Gentamycin (50)) were inoculated with the initial culture from day one. The cultures were allowed to grow, with shaking, overnight at 28 C.

    [0083] Day Two (Late Afternoon):

    [0084] 250 mL of Luria Broth+250 uL appropriate antibiotic (Rifampin (50), Spectinomycin (75), and/or Gentamycin (50)) were inoculated with 25 mL culture. The cultures were allowed to grow, with shaking, overnight at 28 C.

    [0085] Day Three:

    [0086] When the culture had grown to an OD.sub.600 of 1 (or looks thick and silky), the culture was decanted into large centrifuge tubes (all evenly weighted with analytical balance), and spun at 3,500 RPM at room temperature for 10 minutes to pellet cells. The supernatant was decanted off. The pelleted cells were resuspended in a solution of 5% sucrose and 0.02% Silwet L-77. The suspension was poured into clean beakers and placed in a vacuum chamber.

    [0087] Newly flowering inflorescences of pennycress were fully submerged into the beakers, and subjected to a vacuum pressure of 30 inches mercury (14.7 psi) for 5 to 10 minutes.

    [0088] After racemes of pennycress plants (W0011 variety; these plants were 5 generations removed from seeds) were dipped, they were covered loosely with Saran wrap to maintain humidity and kept in the dark overnight before being uncovered and placed back in the environmental growth chamber.

    [0089] Screening Transgenic Plants and Growth Condition

    [0090] Pennycress seeds were surface sterilized by first rinsing in 70% ethanol then incubating 10 minutes in a 30% bleach, 0.05% SDS solution before being rinsed two times with sterile water and plated on selective plates (0.8% agar/one half-strength Murashige and Skoog salts with hygromycin B selection (40 U/ml) or glufosinate (18 g/ml). Plates were wrapped in parafilm and kept in an environmental growth chamber at 21 C., 16:8 day/night for 8 days until antibiotic or herbicide selection was apparent.

    [0091] Surviving hygromycin or glufosinate-resistant T.sub.1-generation seedlings were transplanted into autoclaved Redi-Earth soil mix and grown in an environmental growth chamber set to 16-hour days/8-hour nights at 21 C. and 50% humidity. T.sub.2-generation seeds were planted, and 1.5 mg of leaf tissue from each T.sub.2-generation plant was harvested with a 3-mm hole punch, then processed using the Thermo Scientific Phire Plant Direct PCR Kit (Catalog #F130WH) as per manufacturer's instructions. PCR (20 l volume) was performed.

    Example 2: Generation and Characterization of EMS-Mutagenized Low Sinigrin Mutant Lines E3 196, E5 444P1, I87113 and I87207

    [0092] Mutants carrying domestication enabling low glucosinolate trait were isolated from two mutant populations independently created using chemical mutagenesis (ethyl methanesulfonate, EMS) protocol essentially as described in the Materials and Methods section below.

    [0093] In other embodiments, pennycress plants exhibiting domestication enabling traits such as reduced seed glucosinolate content and loss-of-function mutations in domestication genes can be identified in mutant populations created using fast neutrons (FN), gamma rays (y rays) or other methods of introducing genetic diversity into genomic DNA.

    Materials and Methods

    [0094] Solutions:

    TABLE-US-00002 A) 0.2M sodium phosphate monobasic 6.9 g/250 mL (NaH.sub.2PO.sub.4*H.sub.2O) B) 0.2M sodium phosphate dibasic 7.1 g/250 mL (NaH.sub.2PO.sub.4 anhydrous)

    [0095] For 50 mL of 0.1 M sodium phosphate buffer at pH 7:

    TABLE-US-00003 9.75 mL A 15.25 mL B 25.0 mL dH.sub.2O

    [0096] 0.2% EMS in buffer: [0097] 20 mL 0.1M Sodium Phosphate Buffer, pH 7 [0098] 40 L EMS liquid (Sigma #M0880-5G)

    [0099] 0.1 M sodium thiosulfate at pH 7.3: [0100] 12.4 g sodium thiosulfate in 500 mL

    [0101] Primary Seed Surface Sterilization

    [0102] In the Set #1 experiments, wild-type pennycress (Thlaspi arvense) seeds (W0011 ecotype) were surface sterilized for 10 minutes in a 30% bleach, 0.05% SDS solution before being rinsed 3 with sterile water. Sterilized seeds were immediately subjected to EMS treatment.

    [0103] Ethyl Methane Sulfonate (EMS) Treatment of Pennycress Seeds

    [0104] In the Set #1 experiments, sterilized pennycress seeds (41 g) were agitated in distilled water overnight. Four 250 mL Erlenmeyer flasks with 10 g seed each, and 1 g in a separate small flask as a control, were agitated. The water was decanted.

    [0105] 25 mLs of 0.2% EMS in 0.1M sodium phosphate buffer (pH 7) was added. The control received only phosphate buffer with no EMS. The flasks were shaken in fume hood for 18 hours. The EMS solution was decanted off into an EMS waste bottle.

    [0106] To rinse the seeds, 25 ml of dH.sub.2O was added to each flask, and the flasks were shaken for 20 minutes. The rinse water was decanted into the EMS waste bottle.

    [0107] To deactivate the EMS, seeds were washed for 20 minutes in 0.1M sodium thiosulfate (pH 7.3). The sodium thiosulfate solution was decanted into the EMS waste bottle.

    [0108] The seeds were rinsed 4 times with dH2O for 15 minutes.

    [0109] The seeds were suspended in 0.1% agarose, and germinated directly in autoclaved Redi-Earth soil mix at a density of approximately 10 seeds per 4-inch pot.

    [0110] In the Set #2 experiments, 42 grams of seeds derived from pennycress accession MN106 were collected as described elsewhere (Dorn et al., 2013), and were treated with 180 ml 0.2% ethyl methanesulfonate (EMS) in a chemical flow hood. The solution and seeds were kept mixed on a rotating platform for 14 hours at room temperature. The seeds were thereafter extensively rinsed with distilled water to remove all traces of the EMS. The seeds were then dried for 24 hours on filter paper in a chemical flow hood. These seeds were considered to be the progenitors of the M1-generation of plants.

    [0111] Plant Growth Conditions

    [0112] In the Set #1 experiments, EMS-treated pennycress seeds were germinated and grown in an environmental growth chamber at 21 C., 16:8 6400K fluorescent light/dark, 50% humidity. Approximately 14 days after planting, plants were thinned and transplanted to a density of 4 plants per 4-inch pot. These M1-generation plants showed telltale chlorotic leaf sectors that are indicative of a successful mutagenesis.

    [0113] After dry-down, these M1-generation W0011 plants were catalogued and harvested. The M2- and M3-generation seeds were surface sterilized, planted and grown according to the protocols previously described.

    [0114] In the Set #2 experiments, the MN106 mutagenized seeds were sowed into two small field plots. These plots were allowed to grow over the winter. The following spring abundant albino sectors were noted on the flowering plants as an indication of a successful mutagenesis.

    [0115] Identification and Characterization of Low Seed Sinigrin Mutant Lines

    [0116] In the Set #1 experiments, seeds (M3-generation) from putative M2-generation mutants were planted and grown in potting soil-containing 4-inch pots in a growth chamber, harvested and the sinigrin content in the seed was assessed upon its desiccation to a moisture level of 7-9%. EMS mutagenesis typically introduces single-nucleotide transition mutations (e.g., G to A, or C to T) into plant genomes.

    [0117] In the Set #2 experiments, seeds were collected from mature M1-generation MN106 plants. M2-generation seeds from batches of 10 M1-generation plants were pooled together. In all, 500 pools representing 5000 mutagenized M1-generation plants were collected. In August, each pool was sowed in a field into an individual row. Robust growth was noted in October. During the following June, M3-generation seeds were collected from approximately 8,000 mature M2-generation individual plants and stored in individual packets.

    [0118] In both Sets #1 and #2 experiments, NIR spectral analysis was used to make preliminary identification of lines with reduced glucosinolate in M3-generation seeds from each packet. These seeds were scanned using a Metrohm NIRS XDS Multi Vial Analyzer or a Perten DA7250 NIR Spectroscopy Analyzer to assess the amount of sinigrin as described elsewhere (Sidhu et. al., 2014; Golebiowski et. al, 2005; Riu et. al., 2006; Xin et. al., 2014). These analyses captured information related to the approximate levels of total glucosinolate and were used to identify low sinigrin candidates. Seeds showing a significant predicted reduction were used in a wet lab analysis to confirm or determine the sinigrin amount with better accuracy.

    [0119] Near infrared (NIR) spectroscopic analysis was used to determine the sinigrin content of selected seed lines E3 196, E5 444P1, I87113 and I87207 and to compare the obtained values to the range of sinigrin in corresponding wild type seeds. These mutant lines showed sinigrin content significantly below population average and along with some other representative lines and controls were further analyzed using a method adapted from (Kliebenstein et. al., 2001). Results presented in Table 2 indicate that sinigrin levels in the seeds of these mutant lines are significantly lower and are outside of the corresponding ranges found in control parental seeds.

    TABLE-US-00004 TABLE 2 Sinigrin content in seeds from selected pennycress lines with low glucosinolates content was measured using high throughput ion-exchange chromatography-based method. A minimum of three biological replicates each consisting of 20 mg (~20 seeds) per replicate was used. Each biological replicate was split into two technical replicates that were loaded on the mini-column and treated independently after seed extraction process. Last column represents standard error of the mean for glucosinolates (primarily sinigrin) content in each line. Sinigrin, Mean Std Error, Biological Technical moles/g Mean Line ID Origin Reps Reps seed moles/g 1 E3 196 MN106-derived 6 2 15 1.6 2 E5 444P1 MN106-derived 6 2 23 3.5 3 I87207 W0011-derived 3 2 25 4.1 4 I87113 W0011-derived 6 2 30 4.5 5 I87102 W0011-derived 3 2 94 8.0 6 I87383 W0011-derived 3 2 96 10.7 7 E5 051 P1 MN106-derived 3 2 99 8.9 8 I87256 W0011 wild type 3 2 110 9.2 9 E5 101 P1 MN106-derived 3 2 102 10.1 10 E5 484P6 MN106-derived 3 2 106 10.4 11 1120/1062 1-13 ARV breeding 3 2 101 12.1 12 1082/1008 3-12-1 ARV breeding 3 2 106 12.2 13 1053/1023 2-5-1 ARV breeding 3 2 112 5.9 14 Y1067 ARV low fiber 3 2 129 9.4 15 Y1126 ARV low fiber 3 2 128 10.2 16 Beecher (WT parent) USDA 120 2 103 2.5 17 W0011 (WT parent) WIU/ISU 6 2 102 6.4 18 MN106 (WT parent) UMN 6 2 116 8.5

    Example 3. Identification of Underlying Gene Mutations in EMS-Generated Low Seed Sinigrin Mutant Lines

    [0120] Genomic DNA was extracted from each mutant, and each sample was subjected to whole-genome sequencing (adapted from Zhang, X., et al., 2018) and extensive bioinformatic analysis to identify induced mutations resulting in amino acid substitutions. For every gene target described in Table 1, a sequence from the mutant line was compared to a WT sequence from the parental line. If the EMS-induced change resulted in a non-silent mutation (amino acid change or a stop codon), the mutation was considered to be a candidate for the low sinigrin phenotype. Once the mutation was identified, a co-segregation analysis in the F2 single seeds or F3 families derived from each of these mutants was performed. This whole-genome sequencing (WGS) revealed that E3 196 (Nutty) line contains a mutation in a predicted pennycress ALKNYL HYDROXALKYL PRODUCING (AOP) polypeptide involved in the last step of sinigrin biosynthesis, while the I87113 line carries a homozygous mutation in the GTR1 gene which encodes a glucosinolate transporter.

    [0121] Mutation in the AOP2-Like Gene Co-Segregates with Low Glucosinolate Phenotype in Seeds and Vegetative Tissues of Mutant E3 196 (Nutty) Pennycress Line.

    [0122] In order to demonstrate that the mutation in the AOP2 gene discovered in the E3 196 (Nutty) mutant is responsible for the low sinigrin phenotype, a segregating F2 population from the cross of homozygous Nutty mutant with WT MN106 parental line was performed. The results are presented in Table 3.

    TABLE-US-00005 TABLE 3 Glucosinolates content in seeds and vegetative tissues from the segregating population created using mutant pennycress line E3 196 (Nutty). Each line was genotyped for the presence of G97R mutation found in AOP2 gene variant in E3 196 (Nutty) using standard sequencing. Moisture and sinigrin content in seeds were measured using NIRS, whereas total glucosinolates content in fresh tissue was determined using a wet-lab method described in Chopra et al. (2019). NIR Sinigrin, Glucosinolates sample Genotype, Moisture, moles/g moles/g # G97R % seed tissue 1 15 wt 7.3 115.4 26.1 2 23 wt 7.6 98.3 23.9 3 29 wt 7.1 101.1 20.7 4 34 wt 7.1 108.1 9.7 5 35 wt 7.3 111.3 24.6 6 37 wt 7.4 115.1 13.8 7 38 wt 7.3 106.0 7.8 8 8 homo 7.5 4.9 0.7 9 12 homo 7.5 9.2 0.5 10 17 homo 7.0 6.9 1.4 11 24 homo 7.7 13.7 0.4 12 28 homo 7.4 7.4 0.3 13 41 homo 6.9 2.1 2.1 14 1 het 6.9 107.7 19.0 15 6 het 7.1 106.3 21.5 16 7 het 7.1 102.0 23.9 17 10 het 7.7 110.0 25.6 18 13 het 7.3 95.4 28.6 19 14 het 7.5 100.4 17.2 20 19 het 7.4 89.8 17.7 21 22 het 7.4 108.1 24.4 22 26 het 7.4 103.5 23.3 23 27 het 7.6 99.6 23.7 24 32 het 7.0 114.3 n/a 25 33 het 7.2 103.6 23.6 Average WT 107.9 18.1 Average HET 103.4 22.6 Average HOMO 7.4 0.9

    [0123] The results presented in Table 3 strongly indicate that the G97R mutation present in the AOP2 gene variant in mutant line E3 196 (Nutty) mutant line results in 20-fold reduction of total glucosinolates content in dry seeds and vegetative tissues of the mutant plant.

    [0124] Mutation in the Homolog of GTR1 Gene Results in Low Glucosinolate Phenotype in Seeds and Vegetative Tissues of Mutant I87113 Pennycress Line.

    [0125] Using a WGS approach, the I87113 line was found to carry a homozygous mutation believed to confer a L491F amino acid change in GTR1, a glucosinolate transporter and a member of a major facilitator superfamily. In 98 Embryophyta sequences this position is in a conserved transmembrane helical region and is populated exclusively with small hydrophobic AAs, suggesting that the L491F-causing mutation results in at least a partial loss of function. Indeed, in a separate set of NIRS and wet-lab experiments, the progeny of the I87113 mutant has consistently demonstrated a significant reduction in glucosinolates levels in dry seeds (30% of the WT level).

    TABLE-US-00006 TABLE 4 Sinigrin content in seeds of gtr1-1 mutant I87113 as determined using a wet-lab method described in Chopra et. al. (2019). Sinigrin, Mean Std Error, Generation/ moles/g Mean Line ID Type seed moles/g I87113 M3 25 4 I87113 M3 30 4 I87113 M4 33 2 W0011 Control 98 4 Beecher Control 101.4 7

    Example 4: Discovery and Characterization of Other Mutant Lines with Low Sinigrin Content in Seeds

    [0126] In the process of whole genome sequencing (WGS) of multiple EMS-mutagenized lines segregating for useful traits (flowering, pod-shattering, oil, protein and fiber content, etc.) mutations in other genes described as potential targets for suppression in Table 1 were identified. In these cases, mutations were present almost exclusively in a heterozygous form, consistent with the fact that they were not selected based on a low glucosinolate phenotype which typically requires a homozygous LOF mutation. Instead, they were identified using this opportunistic approach because the original seed stock was very heavily mutagenized (with an estimated 1,000-2,000 mutations per haploid genome), which makes the presence of more than one potentially useful mutation in the same line relatively likely. Because these lines were selected exclusively based on presence of non-silent mutations, most are expected to be in non-conserved regions and have little or no impact on corresponding gene functions. Nevertheless, these lines were subjected to NIRS and wet-lab assays in order to determine the effects of the identified mutations on glucosinolate content in seeds. The results are summarized in Table 5.

    TABLE-US-00007 TABLE 5 Sinigrin content in seeds of the segregating populations created using mutant pennycress lines identified via WGS. The genotypes of each mother line were determined using standard sequencing. Moisture and sinigrin content in seeds were measured using NIRS whereas, total glucosinolates content in dry seeds was determined using a wet-lab procedure described in (Chopra et.al., 2019). Wet-Lab Geno- NIRS Gluco- type Mois- Sinigrin, sinolate of the Gene ture moles/g moles/g mother Line Name Affected % seed seed line 1 A7 11 FMO_GS- 7.6 103.3 113.5 HET OX1 2 A766- CYP83A1 7.3 101.0 123.5 HOM CYP83A1 Mut 3 A7 66- CYP83A1 8.1 85.3 119.2 WT CYP83A1 WT 4 A7 95 IMD1 4.9 115.5 115.1 HOM 5 D3 22 IMD1 8.3 96.6 120.0 HET 6 D3 N13P3- bHLH05 17.1 81.1 66.0 HOM F2 (Mut)-16 (MYC3) 7 D3 N13P3- bHLH05 12.3 80.2 91.4 HOM F2 (Mut)-22 (MYC3) 8 D3 N13P3- bHLH05 13.7 119.1 125.1 WT F2 (Wt)-11 (MYC3) 9 D3 N13P3- bHLH05 16.8 122.8 118.8 WT F2 (Wt)-12 (MYC3) 10 E5 133P2-1 bHLH05 7.5 63.6 86.0 unknown (MYC3) 11 E5 133P2-2 bHLH05 8.1 90.3 107.9 unknown (MYC3) 12 E5 133P2-3 bHLH05 7.9 57.9 94.9 unknown (MYC3) 13 E5 356P5 FMO_GS- 7.5 92.5 96.7 HET OX1 14 E5 519- CYP79B3 7.9 91.8 110.2 HOM CYP79B3 Mut 309 15 E5 519- CYP79B3 8.1 80.9 108.4 HOM CYP79B3 Mut 311 16 E5 543 MAM1 6.3 57.9 89.7 HET 17 MN106 #33 Wt 8.2 91.2 106.6 WT 18 A7 137 Wt 7.7 99.8 104.0 WT 19 E5 301P1 Wt 8.3 94.5 99.0 WT

    [0127] This analysis suggested that some of the mutations (such as in FMO-GS-Ox1 and MAM1 genes) may have at least a partial impact on corresponding protein function. To test this hypothesis, the seeds from the progeny of the original heterozygous lines (segregating in a typical 1:2:1 Mendelian ratio) were subjected to a single-seed wet-lab assay and PCR-based genotyping. The results summarized in Table 6 suggest that mutations in FMO-GS-Ox1 and MAM1 may result in reduction of glucosinolates in dry seeds of homozygous mutant lines (40-60% of WT level).

    TABLE-US-00008 TABLE 6 Glucosinolates content in seeds of the segregating populations created using mutant pennycress lines. Total glucosinolates content (moles/g) in single seeds was determined using a wet-lab method described in Chopra et al. (2019). Gene WT Mutant 1 CYP83A1 138 (12.22) 113 (19.72) 2 FMO-GS-Ox1 106 (10.4) 64 (3.98) 3 MAM1 127 (8.82) 51 (4.67)

    Example 5. Identification and Characterization of CRISPR-Induced Mutations in Target Genes Related to Glucosinolate Pathway and Seed Accumulation

    [0128] Gene editing using Cas9, Cpf1 and Cms1 nucleases typically introduces a double-stranded break into a targeted genome area in close proximity to the nuclease's PAM site. During non-homologous end-joining process (NHEJ) double-stranded breaks are repaired, at times resulting in the introduction of INDELS-type mutations at the repair location in targeted genomes. To identify plants with small INDELS in targeted genes of interest, standard Sanger sequencing and/or T7 endonuclease assays (Guschin et. al., 2010) were employed. Standard PCR protocols followed by Sanger sequencing were used to identify and characterize larger (several hundred base pairs) deletions. Sequence analyses revealed that multiple guide RNAs/CRISPR nuclease combinations were effective in generating loss-of-function (LOF) mutations in gene targets described in Table 1. Plants carrying LOF mutations were grown to the next generation and the phenotypes in seeds or vegetative tissues were confirmed using analytical methods.

    [0129] Multiple mutations in the MYB28 (HAG1) gene were identified, including frameshift mutations likely conferring complete loss of gene function, but no reduction in sinigrin was observed in any of the corresponding homozygous mutant lines (Table 7). On the other hand, mutations in another MYB family member, MYB29 (HAGS), did result in sinigrin reduction, on average, by 35-50% (Tables 7-9). However, in vegetative tissues of myb28/myb29 (hag1/hag3) mutations stack, a dramatic reductions in glucosinolate content relative to WT controls were observed, suggesting a redundancy in the MYB28 and MYB29 gene functions.

    TABLE-US-00009 TABLE 7 Sinigrin levels as determined using a wet-lab method described in Chopra et al. (2019), in homozygous lines generated using CRISPR-induced mutagenesis in selected gene targets described in Table 1. Gluco- sinolates Gene Sinigrin, moles/ % Line Name ratio moles/ g fresh Con- Gene Name(s) Genotype n g seed tissue trol 1 WT Control WT-Beecher 105 46.1 n/a (Beecher) 2 WT Control WT-W0011 94.3 40.1 5.7 n/a (W0011) 3 MYB28 (HAG1) hag1-1 T2 98.1 98% (homozygous-G deletion) 4 MYB28 (HAG1) hag1-2 T3 100.7 101% (homozygous +A insertion) 5 MYB28 (HAG1) 2180A (hag1 T1 26.0 3.1 65% MYB29 (HAG3) het 2 bp; hag3- Stack 2 homo 6 bp) 6 MYB28 (HAG1)/ 2172A (hag1 T1 1.1 0.3 3% MYB29 (HAG3) biallelic 2 bp, stack +A; hag3-1 homo 13 bp) 7 GTR1/GTR2 3A5K (gtr1-2 T2 20.6 21% stack homo +G, gtr2- 3 chimeric +G, +A, WT) 8 GTR1/GTR2 3A5C (gtr1-3 T2 48.9 49% stack het T, gtr2-2 homo +A)

    TABLE-US-00010 TABLE 8 Sinigrin levels in single T2-generation seeds obtained from selected biallelic/homozygous MYB29 (HAG3)-edited lines (wet-lab method, normalized to moles/g seed). WT Line Line Line Seed # Control A263A A264A A269A 1 117.9 70.8 121.5 77.4 2 106.7 58.8 103.5 84.1 3 119.6 46.5 94.5 60.6 4 124.6 42.1 70.5 56.3 5 130.3 64.5 84.7 56.2 6 123.9 51.3 86.1 54.6 7 111.7 56.4 94.1 62.1 8 126.5 45.4 89.6 41.9 9 127.5 52.1 114.0 57.1 10 125.1 45.9 83.5 51.5 11 124.5 44.0 71.3 63.3 12 116.1 49.8 68.7 57.2 13 126.1 75.7 113.4 85.7 14 128.1 53.0 73.2 61.5 15 115.9 46.7 84.9 87.3 16 114.4 46.2 74.6 69.2 17 103.2 55.3 101.6 86.8 18 114.5 54.3 99.6 81.5 19 101.4 47.6 116.8 56.2 20 150.0 98.4 62.6 41.5 21 127.1 48.1 71.1 63.7 22 135.0 58.6 101.3 60.8 23 133.7 70.3 78.3 48.1 24 126.9 51.5 83.3 65.7 AVE, moles/g 122.1 55.5 89.3 63.8 STDEV 10.8 12.8 16.8 13.6 % Control 100% 45% 73% 52%

    TABLE-US-00011 TABLE 9 Sinigrin levels in vegetative tissues from selected 4-weeks old T2-generation plants grown from biallelically modified MYB29 (HAG3) CRISPR-mutated line A269A (wet-lab method, normalized to moles/g fresh tissue punch). WT A269A, line # BioRep # Control 13 16 21 22 11 14 19 24 1 19.8 4.0 7.5 3.0 3.4 3.9 8.3 7.9 8.2 2 19.9 4.1 5.6 3.1 5.7 2.7 6.9 5.6 8.4 3 16.4 3.4 5.0 3.6 5.8 2.8 7.0 6.4 7.8 AVERAGE 18.7 3.8 6.0 3.2 5.0 3.1 7.4 6.6 8.1 STDEV 2.0 0.4 1.3 0.3 1.4 0.7 0.8 1.2 0.3 % Control 100% 20% 32% 17% 27% 17% 40% 35% 43%

    TABLE-US-00012 TABLE 10 Sinigrin levels in vegetative tissues from selected T1-generation seedlings grown from biallelically modified AOP2 lines (wet-lab method, normalized to moles/4.3 mg fresh tissue punch). Tissue samples were harvested from cauline leaves when plants were setting pods (wet-lab method, normalized to moles/g fresh tissue punch). T1 plants are generally chimeric for the edits, resulting in overestimated sinigrin numbers and increased variability. 2032 WT BioRep # control A370A A379A A381A A380A 1 7.9 0.2 1.4 0.3 0.3 2 4.6 2.1 0.6 0.1 0.3 3 4.1 0.4 0.1 6.9 0.4 4 4.0 0.4 2.9 7.2 0.6 5 4.2 3.5 0.5 0.1 0.4 6 1.6 4.1 0.9 0.1 0.4 AVERAGE 4.4 1.7 1.1 2.3 0.1 STDEV 2.0 1.9 1.0 3.6 0.4 % Control 100% 38% 24% 53% 1%

    REFERENCES

    [0130] Tripathi, M. K., & Mishra, A. S. (2007). Glucosinolates in animal nutrition: A review. Animal Feed Science and Technology, 132 (1-2), 1-27. [0131] EFSA Panel on Contaminants in the Food Chain. (2008). Glucosinolates as undesirable substances in animal feedscientific opinion of the panel on contaminants in the food chain. EFSA Journal, 590, 1-76. [0132] Fauser F., Schiml S., & Puchta H. (2014). Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J 79: 348-359. [0133] Guha T. K., Wai A, & Hausner G. (2017). Programmable Genome Editing Tools and their Regulation for Efficient Genome Engineering, Computational and Structural Biotechnology Journal, 15, 146-160. [0134] Guschin D Y, Waite A J, Katibah G E, Miller J C, Holmes M C, & Rebar E J. (2010) A rapid and general assay for monitoring endogenous gene modification. In: Engineered zinc finger proteins: 247-256. Humana Press, Totowa, N.J. [0135] Holsters, M., De Waele, D., Depicker, A., Messens, E., Van Montagu, M., & Schell, J. (1978). Transfection and transformation of Agrobacterium tumefaciens. Molecular and General Genetics 163(2), 181-187. [0136] Steinert J., Schiml S., Fauser F., & Puchta H. (2015). Highly efficient heritable plant genome engineering using Cas9 orthologues from Streptococcus thermophilus and Staphylococcus aureus. The Plant Journal 84:1295-305. [0137] Kliebenstein, D. J., Lambrix, V. M., Reichelt, M., Gershenzon, J., & Mitchell-Olds, T. (2001). Gene duplication in the diversification of secondary metabolism: tandem 2-oxoglutarate-dependent dioxygenases control glucosinolate biosynthesis in Arabidopsis. The Plant Cell, 13(3), 681-693. [0138] Chopra, R., Folstad, N., Lyons, J., Ulmasov, T., Gallaher, C., Sullivan, L., McGovern, A., Mitacek, R., Frels, K., Altendorf, K. Killam, A. Ismail, B., Anderson, J. A., Wyse, D. L. & Marks, M. D. (2019). The adaptable use of Brassica NIRS calibration equations to identify pennycress variants to facilitate the rapid domestication of a new winter oilseed crop. Industrial Crops and Products, 128, 55-61. [0139] Sidhu, H. K., Haagenson, D. M., Rahman, M., & Wiesenborn, D. P. (2014). Diode Array Near Infrared Spectrometer Calibrations for Composition Analysis of Single Plant Canola (Brassica napus) Seed. Applied Engineering in Agriculture, 30(1), 69-76. [0140] Golebiowski, T., Leong, A. S., & Panozzo, J. F. (2005). Near infrared reflectance spectroscopy of oil in intact canola seed (Brassica napus L.). II. Association between principal components and oil content. Journal of Near Infrared Spectroscopy, 13(5), 255-264. [0141] Riu, Y. K., Huang, K. L., Wang, W. M., Guo, J., Jin, Y. H., & Luo, Y. B. (2006). Detection of erucic acid and glucosinolate in intact rapeseed by near-infrared diffuse reflectance spectroscopy. Guang pu xue yu guang pu fen xi=Guang pu, 26(12), 2190-2192. [0142] Xin, H., Khan, N. A., Falk, K. C., & Yu, P. (2014). Mid-infrared spectral characteristics of lipid molecular structures in Brassica carinata seeds: relationship to oil content, fatty acid and glucosinolate profiles, polyphenols, and condensed tannins. Journal of Agricultural and Food Chemistry, 62(32), 7977-7988. [0143] Dorn, K. M., Fankhauser, J. D., Wyse, D. L., & Marks, M. D. (2013). De novo assembly of the pennycress (Thlaspi arvense) transcriptome provides tools for the development of a winter cover crop and biodiesel feedstock. The Plant Journal, 75(6), 1028-1038. [0144] Zhang, X., Li, R., Chen, L., Niu, S., Chen, L., Gao, J., Wen, J., Yi, B., Ma, C., Tu, J. and Fu, T., (2018). Fine-mapping and candidate gene analysis of the Brassica juncea white-flowered mutant Bjpc2 using the whole-genome resequencing. Molecular Genetics and Genomics, 293(2), pp. 359-370.

    Other Embodiments

    [0145] It is to be understood that while certain embodiments have been described in conjunction with the detailed description thereof and examples, the foregoing description is intended to illustrate and not limit the scope of the disclosure. Other aspects, advantages, and modifications are within the scope of the following embodiments and claims.

    [0146] Embodiment 1. A composition comprising non-defatted pennycress seed meal that comprises less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    [0147] Embodiment 2. The composition of embodiment 1, wherein said seed meal comprises about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    [0148] Embodiment 3. The composition of any one of embodiments 1 or 2, wherein said composition has an oil content of about 30% or 35% to about 40% or 50% by dry weight.

    [0149] Embodiment 4. The composition of any one of embodiments 1 to 3, wherein said composition further comprises a preservative, a dust preventing agent, a bulking agent, a flowing agent, or any combination thereof.

    [0150] Embodiment 5. The composition of any one of embodiments 1 to 4, wherein said pennycress seed meal is obtained from pennycress seeds that have been crushed, ground, macerated, expelled, extruded, or any combination thereof.

    [0151] Embodiment 6. The composition of any one of embodiments 1 to 5, wherein said composition comprises: (i) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof (ii) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207; or (iii) crushed, ground, and/or macerated seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    [0152] Embodiment 7. A non-defatted pennycress seed meal that comprises less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    [0153] Embodiment 8. The seed meal of embodiment 7, wherein said seed meal comprises about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    [0154] Embodiment 9. The seed meal of embodiment 7 or 8, wherein said composition has an oil content of 30% or 35% to 40% or 50% by dry weight.

    [0155] Embodiment 10. The seed meal of any one of embodiments 7 to 9, wherein said seed meal comprises: (i) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof; (ii) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 356P5, I87113, or E5 543; or (ii) crushed, ground, and/or macerated seed of pennycress mutant lines E3 196, E5 356P5, I87113, E5 543, or germplasm therefrom.

    [0156] Embodiment 11. A pennycress seed comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    [0157] Embodiment 12. The pennycress seed of embodiment 11, wherein the seed comprises about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    [0158] Embodiment 13. The pennycress seed of embodiment 11 or 12, wherein the seed comprises: (i) at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof; (ii) at least one transgene or genome rearrangement that suppresses expression of at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof; or (iii) seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, E5 543, I87207, or germplasm therefrom.

    [0159] Embodiment 14. The pennycress seed of any one of embodiments 11 to 13, wherein the seed comprises at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof.

    [0160] Embodiment 15. The pennycress seed of any one of embodiments 11 to 14, wherein the seed comprises at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a sinigrin biosynthetic enzyme and/or at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a sinigrin transporter.

    [0161] Embodiment 16. The pennycress seed of embodiment 15, wherein: (i) the sinigrin biosynthetic enzyme comprises a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 21, 24, 27, 94 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof or (ii) the pennycress seed comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 21 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 24 or an allelic variant thereof.

    [0162] Embodiment 17. The pennycress seed of embodiment 15 or 16, wherein: (i) the sinigrin transporter comprises a polypeptide selected from the group consisting of SEQ ID NO: 15, 17 and allelic variants thereof; (ii) the pennycress seed comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 15 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 17 or an allelic variant thereof; or (iii) the pennycress seed comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 15 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 24 or an allelic variant thereof.

    [0163] Embodiment 18. A seed lot comprising a population of pennycress seeds comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    [0164] Embodiment 19. The seed lot of embodiment 18, wherein the pennycress seeds comprise 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    [0165] Embodiment 20. The seed lot of embodiment 18 or 19, wherein the seed comprises: (i) at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof or (ii) at least one transgene or genome rearrangement that suppresses expression of at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof; or (ii) seed of pennycress mutant lines E3 196, E5 356P5, I87113, E5 543, or germplasm therefrom.

    [0166] Embodiment 21. The seed lot of any one of embodiments 18 to 20, wherein the seed comprises at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof.

    [0167] Embodiment 22. The seed lot of any one of embodiments 18 to 20, wherein the seed comprises at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a sinigrin biosynthetic enzyme and/or at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a sinigrin transporter.

    [0168] Embodiment 23. The seed lot of embodiment 22, wherein: (i) the sinigrin biosynthetic enzyme comprises a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 21, 24, 27, 94, 164, 167, 170, 173, 176, and allelic variants thereof; or (ii) the pennycress seed lot comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 21 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 24 or an allelic variant thereof.

    [0169] Embodiment 24. The seed lot of embodiment 22 or 23, wherein: (i) the sinigrin transporter comprises a polypeptide selected from the group consisting of SEQ ID NO: 15, 17 and allelic variants thereof; (ii) the pennycress seed lot comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 15 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 17 or an allelic variant thereof; or (iii) the pennycress seed lot comprises a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of SEQ ID NO: 15 or an allelic variant thereof and a loss-of-function mutation in an endogenous pennycress gene encoding the polypeptide of a SEQ ID NO: 24 or an allelic variant thereof.

    [0170] Embodiment 25. The seed lot of any one of embodiments 18 to 24, wherein said population of pennycress seeds comprise seeds having at least one loss-of-function mutation in an endogenous pennycress gene that encodes SEQ ID NO:2 or an allelic variant thereof.

    [0171] Embodiment 26. The seed lot of any one of embodiments 18 to 25, wherein the loss-of-function mutation in the gene encoding SEQ ID NO:2 or the allelic variant thereof comprises an insertion, deletion, or substitution of one or more nucleotides.

    [0172] Embodiment 27. The seed lot of embodiment 26, wherein the loss-of-function mutation in the gene encoding SEQ ID NO:2 or the allelic variant thereof comprises a mutation that introduces a pre-mature stop codon or frameshift mutation at codon positions 1-108 of SEQ ID NO:1 or an allelic variant thereof.

    [0173] Embodiment 28. The seed lot of embodiment 26, wherein the loss-of-function mutation is in a polynucleotide encoding MYB28, MYB29, MYB76, or any combination thereof.

    [0174] Embodiment 29. The seed lot of any one of embodiments 18 to 28, wherein the population comprises at least 10 seeds comprising less than 25 micromoles sinigrin per gram by dry weight or 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    [0175] Embodiment 30. The seed lot of any one of embodiments 18 to 29, wherein at least 95% of the pennycress seeds in the seed lot are seeds comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight or 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    [0176] Embodiment 31. The seed lot of any one of embodiments 18 to 30, wherein less than 5% of the seeds in said seed lot have greater than 25 or 30 micromoles sinigrin per gram by dry weight.

    [0177] Embodiment 32. The seed lot of any one of embodiments 18 to 31, wherein said seeds further comprise an agriculturally acceptable excipient or adjuvant.

    [0178] Embodiment 33. The seed lot of any one of embodiments 18 to 32, wherein said seeds further comprise a fungicide, a safener, or any combination thereof.

    [0179] Embodiment 34. A method of making non-defatted pennycress seed meal comprising less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight or 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight, comprising the step of grinding, macerating, extruding, and/or crushing the seed lot of any one of embodiments 18 to 32 thereby obtaining the non-defatted seed meal.

    [0180] Embodiment 35. A method of making defatted pennycress seed meal comprising less than 30 micromoles sinigrin per gram by dry weight or about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 micromoles sinigrin per gram by dry weight, comprising the steps of solvent extracting the seed lot of any one of embodiments 18 to 32, and separating the extracted seed meal from the solvent, thereby obtaining the defatted seed meal.

    [0181] Embodiment 36. Pennycress seed meal comprising less than 30, 28, or micromoles sinigrin per gram by dry weight or about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 micromoles sinigrin per gram by dry weight, wherein the seed meal is defatted.

    [0182] Embodiment 37. The seed meal of embodiment 36, wherein said seed meal has an oil content of about 0% or 0.5% to about 12% or 15% by dry weight.

    [0183] Embodiment 38. The pennycress seed meal of embodiments 36 or 37, wherein said meal comprises: (i) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof; (ii) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207; or (iii) crushed, ground, and/or macerated seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    [0184] Embodiment 39. The pennycress seed meal of any one of embodiments 36 to 38, wherein said meal comprises ground and/or macerated seed of a population of pennycress seeds comprising seeds having at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof.

    [0185] Embodiment 40. The pennycress seed meal of any one of embodiments 36 to 39, wherein said meal comprises ground and/or macerated seed of a population of pennycress seeds comprising seeds having at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof.

    [0186] Embodiment 41. The pennycress seed meal of any one of embodiments 36 to 40, wherein said meal comprises ground and/or macerated seed of a population of pennycress seeds comprising seeds having at least one transgene or genome rearrangement that suppresses expression of at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof.

    [0187] Embodiment 42. A composition comprising defatted pennycress seed meal that comprises less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    [0188] Embodiment 43. The composition of embodiment 42, wherein said seed meal comprises about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 micromoles sinigrin per gram by dry weight.

    [0189] Embodiment 44. The composition of embodiments 42 or 43, wherein said composition has an oil content of about of about 0% or 0.5% to about 12% or 15% by dry weight.

    [0190] Embodiment 45. The composition of any one of embodiments 42 to 44, wherein said composition further comprises a preservative, a dust preventing agent, a bulking agent, a flowing agent, or any combination thereof.

    [0191] Embodiment 46. The composition of any one of embodiments 42 to 45, wherein said composition comprises: (i) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof (ii) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207; or (iii) crushed, ground, and/or macerated seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    [0192] Embodiment 47. Pennycress seed cake comprising 30 micromoles sinigrin per gram by dry weight or about 1, 2.5, 5, or 10 to about 15, 16, 18, 20, 25, 28, or 30 micromoles sinigrin per gram by dry weight.

    [0193] Embodiment 48. The seed cake of embodiment 47, wherein said seed cake has an oil content of about 0% or 0.5% to about 12% or 15% by dry weight.

    [0194] Embodiment 49. The pennycress seed cake of embodiment 47, wherein the cake comprises crushed or expelled seed of the seed lot of any one of embodiments 18 to 33.

    [0195] Embodiment 50. The pennycress seed cake of any one of embodiments 47 to 49, wherein the cake comprises: (i) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in at least one endogenous pennycress coding sequence or gene comprising a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 18, 19, 20, 22, 23, 25, 26, 28, 29, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof; (ii) a detectable amount of a polynucleotide comprising at least one loss-of-function mutation in pennycress mutant E3 196, E5 444P1, E5 356P5, I87113, E5 543, or I87207; or (iii) seed cake obtained from seed of pennycress mutant lines E3 196, E5 444P1, E5 356P5, I87113, I87207, E5 543, or germplasm therefrom.

    [0196] Embodiment 51. A method of making a pennycress seed lot comprising the steps of:

    (a) introducing at least one loss-of-function mutation in at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 92, 93, 159, 160, 162, 163, 165, 166, 168, 169, 171, 172, 174, 175, and allelic variants thereof;
    (b) selecting germplasm that is homozygous for said loss-of-function mutation; and,
    (c) harvesting seed from the homozygous germplasm, thereby obtaining a seed lot, wherein said seed lot comprises a population of pennycress seed having less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    [0197] Embodiment 52. The method of embodiment 51, wherein the harvested seed of the seed lot comprise 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    [0198] Embodiment 53. The method of embodiment 51 or 52, wherein said harvested seed of the seed lot comprises the seed lot of any one of embodiments 18 to 33.

    [0199] Embodiment 54. A method of making a pennycress seed lot comprising the steps of:

    (a) introducing at least one transgene or genome rearrangement that suppresses expression of at least one endogenous pennycress gene encoding a polypeptide selected from the group consisting of SEQ ID NO: 3, 6, 9, 12, 15, 17, 21, 24, 27, 30, 94, 161, 164, 167, 170, 173, 176, and allelic variants thereof into a pennycress plant genome;
    (b) selecting a transgenic plant line that comprises said transgene or genome rearrangement; and,
    (c) harvesting seed from the transgenic plant line, thereby obtaining a seed lot, wherein said seed lot comprises a population of pennycress seed having less than 30, 28, 25, 16, or 15 micromoles sinigrin per gram by dry weight.

    [0200] Embodiment 55. The method of embodiment 54, wherein the harvested seed of the seed lot comprise 1, 2.5, 5, or 10 to 15, 16, 18, 20, or 25 micromoles sinigrin per gram by dry weight.

    [0201] Embodiment 56. The method of embodiment 54 or 55, wherein said harvested seed comprise a seed lot of any one of embodiments 18 to 33.