METHOD FOR PRIMER EXTENSION REACTION WITH IMPROVED SPECIFICITY
20210071243 · 2021-03-11
Assignee
Inventors
Cpc classification
C12Q2531/101
CHEMISTRY; METALLURGY
C12Q2525/125
CHEMISTRY; METALLURGY
C12Q2525/186
CHEMISTRY; METALLURGY
C12Q2525/161
CHEMISTRY; METALLURGY
C12Q2545/107
CHEMISTRY; METALLURGY
C12Q2531/101
CHEMISTRY; METALLURGY
C12Q1/6848
CHEMISTRY; METALLURGY
C12Q2525/121
CHEMISTRY; METALLURGY
C12Q2545/107
CHEMISTRY; METALLURGY
C12Q2525/161
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a method for the extension of an oligonucleotide primer with improved specificity using a specific oligonucleotide primer and a controller nucleotide, wherein the controller oligonucleotide enables sequence-specific strand opening of a double strand of extension product and template. The invention further relates to a respective kit for carrying out the method according to the invention.
Claims
1. A method for the synthesis of a nucleic acid sequence complementary to a target sequence, wherein a) a sample comprising a nucleic acid polymer which comprises the target sequence M, wherein the target sequence in 5-3 orientation comprises the sequence segments MS and MP, and MP is located immediately in the 3 direction of MS, wherein the sample is brought into contact with the following components: b) an oligonucleotide primer P, which in 5-3 orientation comprises the sequence segments PC and PM, and PM is located immediately in the 3 direction of PC, wherein PM comprises the sequence complementary to the sequence segment MP and PC cannot bind to M or a sequence immediately following MP in the 3 direction; c) a controller oligonucleotide C, which in 5-3 orientation comprises the sequence segments CS, CP and CC, wherein CP is located immediately in 3 direction of CS and immediately in 5 direction of CC, and wherein CS is identical to at least the 3 segment of MS, immediately in 5 direction of MP, and CP and CC comprise the sequence complementary to the sequence segment PM and PC, and wherein CS comprises modified nucleotide building blocks so that CS cannot serve as a template for the activity of the template-dependent nucleic acid polymerase; d) a template-dependent nucleic acid polymerase, particularly a DNA polymerase, as well as substrates of the template-dependent nucleic acid polymerase, and suitable cofactors, wherein a primer extension product P is obtained, which in addition to the sequence regions PC and PM comprises a synthesized region PS which is essentially complementary to the target sequence MS, and wherein either the reaction conditions are chosen, and/or the length and melting temperature of PC and/or MS are chosen so that P can form a double strand with M and P can form a double strand with C.
2. The method according to claim 1, wherein the sequence segment CS at its 3 end immediately in 5 direction of the sequence segment CP contains a sequence segment CS of 5 to 15 nucleotide positions in length, which consists of nucleic acid analogues, particularly of 2O-alkyl ribonucleotides.
3. The method according to claim 1, wherein M comprises a sequence segment MB immediately in 5 direction of MS, and further wherein a block oligonucleotide B, which can hybridize to MB, is brought into contact with the sample, and wherein a. B comprises nucleoside analogues which are selected such that a hybrid of B with MB does not allow the template-dependent nucleic acid polymerase to react on MB, or b. the template-dependent nucleic acid polymerase is selected such that a hybrid of B with MB does not allow the template-dependent nucleic acid polymerase to react on MB, even if B consists of natural nucleosides or deoxynucleotides.
4. The method according to claim 3, wherein B is contacted with the sample before the template-dependent nucleic acid polymerase is brought into contact with the sample.
5. The method according to claim 1, wherein CS is identical to MS and CP is identical to MP.
6. The method according to claim 1, wherein the formation of the double strand of P and C is preferred over the formation of the double strand of P and M.
7. (canceled)
8. The method according to claim 1, wherein the sample is not brought into contact with an oligonucleotide primer which can bind to a sequence segment located in PS and from which a synthesis of a counter strand to PS can take place via a template-dependent nucleic acid polymerase, and does not result in the exponential amplification of M.
9. (canceled)
10. (canceled)
11. The method according to claim 1, characterized in that PC has a length in the range of 5 nucleotides to 85 nucleotides, particularly that PC has between 50% and 300% of the length of the sequence segment PM.
12. (canceled)
13. The method according to claim 1, characterized in that the sample comprises a variant VM of the target sequence M which is 92%, particularly 95%, 92%, 94%, 96% or even 96% identical to M, wherein a segment VMS of the variant is highly identical to the segment MS and a segment VMP is highly identical to the segment MP, and VM is different from the sequence M in at least one position VMM, particularly comprising one or more substitution(s), insertion(s) and/or deletion(s).
14. (canceled)
15. The method according to claim 13, wherein VMM is located in the sequence segment comprised in VMS.
16. (canceled)
17. (canceled)
18. (canceled)
19. The method according to claim 13, further characterized in that a second controller oligonucleotide VC is brought into contact with the sample, wherein the second controller oligonucleotide VC in 5-3 orientation comprises the sequence segments VCS, VCP and VCC, wherein VCP is located immediately in 3 direction of VCS and immediately in 5 direction of VCC, and wherein VCS is identical at least to the 3 segment of VMS, and VCP and VCC comprise the sequence complementary to the sequence segment PM and PC and wherein VCS comprises modified nucleotide building blocks so that VCS cannot serve as a template for the activity of the template-dependent nucleic acid polymerase.
20. The method according to claim 13, wherein VMM is at least partially comprised in the sequence segment comprising VMP.
21. (canceled)
22. The method according to claim 13, further characterized in that a second oligonucleotide primer VP is brought into contact with the sample, wherein the second oligonucleotide primer VP in 5-3 orientation comprises the sequence segments VPC and VPM, and VPM is located immediately in 3 of VPC, wherein VPM comprises the sequence complementary to the sequence segment VMP of the target sequence VM and VPC cannot bind to VM or a sequence immediately following VMP in 3.
23. The method according to claim 13, characterized in that VMM is at the 5 end of VMP, in other words the 3 end of VPM hybridizes to VMM.
24. The method according to claim 13, characterized in that a competitor oligonucleotide KP which hybridizes with VMP is further brought into contact with the sample.
25. (canceled)
26. A kit for performing a method according to claim 1, comprising: an oligonucleotide primer P which in 5-3 orientation comprises the sequence segments PC and PM, and PM is located immediately in 3 of PC, wherein PM can bind to a genomic sequence M of a eukaryotic organism or of a pathogenic bacterium, particularly of a mammal, particularly to a human target sequence comprising a primer binding site MP, and PC cannot bind to a sequence directly in the 3 direction of MP; a controller oligonucleotide C which in 5-3 orientation comprises the sequence segments CS, CP and CC, wherein CP is located immediately in 3 of CS and immediately in 5 of CC, and wherein CS is identical to a sequence MS located immediately in 5 direction of MP and CP is identical to MP and CC has the sequence complementary to the sequence segment PC, and wherein CS comprises modified nucleotide building blocks such that CS cannot serve as a template for the activity of a template-dependent nucleic acid polymerase.
27. The kit according to claim 26, further comprising a block oligonucleotide B which can hybridize to a sequence segment of target sequence MB located immediately in 5 direction of MS, wherein B comprises nucleoside analogues selected such that a hybrid of B with MB does not allow a template-dependent nucleic acid polymerase to react on MB.
28. The kit according to claim 26, further comprising a second oligonucleotide primer VP which in 5-3 orientation comprises the sequence segments VPC and VPM, and VPM is located immediately in 3 of VPC, wherein VPM can bind to a genomic sequence VM comprising a primer binding site VMP, wherein VM is identical to M to 85%, particularly to 95%, 92%, 94%, 96% or even to 92%, but is different from M in at least one position, and VPC cannot bind to a sequence located directly in 3 direction of VMP; and/or a second controller oligonucleotide VC, which in 5-3 orientation comprises the sequence segments VCS, VCP and VCC, wherein VCP is located immediately in 3 direction of VCS and immediately in 5 direction of VCC, and wherein VCS is identical to a genomic sequence VMS, immediately in 5 direction of VMP, which is part of a variant VM which is 85%, particularly 95%, 92%, 94%, 96% or even 98% identical to M but different from M in at least one position, and VCP is identical to VMP and VCC comprises the complementary sequence to the sequence segment VPC, and wherein VCS comprises modified nucleotide building blocks such that VCS cannot serve as a template for the activity of a template-dependent nucleic acid polymerase, and/or a competitor oligonucleotide KP, which hybridizes with VMP
29. The kit according to claim 26, further comprising a template-dependent nucleic acid polymerase, particularly a DNA polymerase, as well as optionally substrates of the template-dependent nucleic acid polymerase and suitable cofactors.
30. The kit according to claim 26, wherein said kit does not comprise an oligonucleotide primer which can bind to a sequence segment located on the opposite strand of M and from which a synthesis of a sequence essentially identical to the 5 end of MP on M can be performed by the template-dependent nucleic acid polymerase.
Description
DESCRIPTION OF FIGURES
[0841]
[0842]
[0843] The synthesis of a P1-Ext primer extension product is shown schematically in
[0844] The sequence-specific control of the primer extension is particularly mediated by the binding of a controller oligonucleotide. The controller binding to the primer extension product during the controlling phase is schematically shown in
[0845]
[0846] As a probe, for example, an oligonucleotide complementary to the 3 segment of the formed primer extension product can be used with a quencher (e.g. BHQ1) and a reporter (e.g. FAM). A molecular beacon with self-quenching properties can be used as reporter. The signal is only generated when a complementary binding occurs. This allows to distinguish for example complete P1-Ext from incomplete P1-Ext.
[0847] The synthesis phase and the controlling phase can take place simultaneously, as illustrated by the reaction setup shown in
[0848]
[0849]
[0850] In said embodiment, a target sequence which can comprise several sequence variants in a polymorphic locus (N2), further comprises at least a first target sequence segment (N1) which is characteristic and uniform for all target sequence variants of a target sequence (target sequence group comprising here M 1.1 and M 1.2). Furthermore, a target sequence comprises at least one second target sequence segment (N3), which is characteristic and uniform for all target sequence variants of a target sequence (target sequence group comprising here M 1.1 and M 1.2). Such uniform target sequence segments are preferably located on both sides of a polymorphic locus and thus flank a polymorphic locus (with sequence variants) of a target sequence from both sides. Preferably, the first uniform target sequence segment (N1) differs in its sequence composition from the sequence composition of the second uniform target sequence segment (N3) in at least one nucleotide position.
[0851]
[0852]
[0853] The figure summarizes schematically what effect the presence of the fully complementary strand (template strand) has on the possible mismatch duplex: Due to the fully complementary nature of the primer extension product synthesized by a polymerase, both primer extension products formed during the synthesis comprise fully complementary sequences respectively. Binding of such fully complementary sequences to each other takes place more effectively than in sequences comprising a mismatch. Thus, strand separation only occurs over a shorter distance and is less effective than with fully complementary strands.
[0854]
[0855] In said examplary embodiment, the sequence segment of the controller oligonucleotide corresponding to the N2 partly comprises the third region and partly the second region. The 3 segment of the first primer is also designed sequence-specific and characteristic for a specific and characteristic sequence variant of the target nucleic acid. Thus, both the controller oligonucleotide and the first oligonucleotide primer are part of the allele discrimination. Thus, for each specific sequence variant of the polymorphic locus, both a specific controller oligonucleotide and a specific first oligonucleotide primer can be constructed.
[0856]
[0857] Array 1 (P1): A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region). Said components of the amplification system can thus be designed specifically and characteristically for the respective sequence variations of the target sequence.
[0858] Array 2 (P2): A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region). These components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variations of the target sequence. Array P2 differs from P1 mainly in that N2 is located predominantly in the 3-terminal sequence segment of the first primer. This can lead to a better specificity of the amplification.
[0859] Array 3 (P3): A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region), wherein the corresponding sequence segment of the controller oligonucleotide is located in the 5-terminal sequence segment of the synthesized portion of the first primer extension product. The controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variation of the target sequence. In said array, a target sequence specific first primer is used, which is not sequence variant specific. Due to the possible proximity of the second blocking moiety, the binding of a controller oligonucleotide to the first primer extension product can be influenced by nucleotide modifications of the second blocking moiety.
[0860] Array 4 (P4-P6): A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region). The controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variations of the target sequence. In said array, a target sequence-specific first primer is used, but said primers are not sequence variant-specific. Said sequence segment of the controller oligonucleotide is located in the 5 direction from the second blocking unit and may comprise several DNA nucleotide monomers, e.g. from 5 to 30.
[0861]
[0862]
[0863] Overall, the array of individual amplification components can be designed in such way that several variants/combinations are possible:
[0864] Array 1 (P1): A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region). Said components of the amplification system can thus be designed specifically and characteristically for the respective sequence variant of the target sequence.
[0865] Array 2 (P2): A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region). Said components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variants of the target sequence. Array P2 differs from P1 mainly in that N2 can be located predominantly in the 3-terminal sequence segment of the first primer or even comprises the 3-terminal nucleotide. This can result in a further increase in the specificity of the amplification.
[0866] Array 3 (P3): A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region), wherein the corresponding sequence segment of the controller oligonucleotide is located in the 5-segment of the synthesized portion of the first primer extension product. The controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In said array a target sequence specific first primer is used, which is not sequence variant specific. Due to the possible proximity of the second blocking unit, the binding of a controller oligonucleotide to the first primer extension product can be influenced by nucleotide modifications of the second blocking unit.
[0867] Array 4 (P4-P6): A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region). The controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In said array a target sequence specific first primer is used, which is not sequence variant specific. Said sequence segment of the controller oligonucleotide is located in 5 direction from the second blocking unit. Said segment of the controller oligonucleotide may comprise several DNA nucleotide monomers, e.g. from 5 to 30, wherein the N2 corresponding sequence segment can be flanked by at least 3 to 15 DNA nucleotide building blocks on both sides.
[0868]
[0869]
[0870] In the course of primer extension, P1.1-Ext is formed. No competitor primer is used. Binding to another sequence variant (M 1.2) takes place less efficiently due to mismatch with position (N) within the primer binding site of M 1.2. Thus, primer extension is started less efficiently under stringent reaction conditions.
[0871]
[0872]
[0873]
[0874]
[0875] To further increase the specificity, a competitor-oligonucleotide-primer (P 5.1) is added to the reaction, which is capable of predominantly complementary binding to the sequence variants of the target sequence and whose copy creation with subsequent separation from the template strand must be suppressed. Due to complementary binding with such primer binding sites, a competitor primer can bind preferentially and be extended by the polymerase. The resulting product (here P5.1-Ext) blocks the single-stranded primer binding sites for an interaction of the first primer.
[0876] In certain embodiments, the 3-end of a competitor-oligonucleotide-primer binds within the second blocking site of the controller oligonucleotide, so that no extension of this primer can take place at the controller oligonucleotide. The competitor-oligonucleotide-primer does not comprise a sequence segment that can interact with the first region of the controller oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
[0877]
[0878] To increase specificity, a competitor-oligonucleotide-primer (P5.2) is added to the reaction, which is capable of predominantly complementary binding to the sequence variants of the target sequence and whose primer extension and subsequent separation from the template strand must be suppressed. Due to complementary binding with such primer binding sites, a competitor-oligonucleotide-primer can bind preferably to certain sequence variants (here designated N) and be extended by the polymerase. The resulting product (P5.2-Ext) blocks the single-stranded primer binding sites for interaction with the first primer.
[0879] In certain embodiments, the 3-end of a competitor-oligonucleotide-primer binds within the second blocking site of the controller oligonucleotide, so that no extension of this primer can take place at the controller oligonucleotide. The competitor-oligonucleotide-primer does not comprise a sequence segment with which it can interact with the first region of the controller oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
[0880]
[0881] To increase specificity, a competitor-oligonucleotide-primer (P5.3) is added to the reaction, which is capable of predominantly complementary binding (N) to sequence variants of the target sequence, and whose copy creation and subsequent strand separation must be suppressed. Due to complementary binding with such primer binding sites, a competitor-oligonucleotide-primer can bind preferably to certain sequence variants (here designated N) and be extended by the polymerase. The resulting product blocks the single-stranded primer binding sites for interaction with the first primer.
[0882] In certain embodiments, the competitor-oligonucleotide-primer (P5.3) is longer than the first oligonucleotide primer so that its 3-end can bind within the fourth blocking unit of the controller oligonucleotide (the fourth blocking unit is composed analogously to the second blocking unit and blocks a primer extension at the controller oligonucleotide), so that no extension of this primer can take place at the controller oligonucleotide. The competitor-oligonucleotide-primer does not comprise a sequence segment that can interact with the first region of the controller oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
[0883]
[0884]
[0885]
[0886]
[0887]
[0888]
[0889]
[0890]
[0891]
[0892]
[0893] a) a sample comprising a nucleic acid polymer which comprises the target sequence M, wherein the target sequence in 5-3 orientation comprises the sequence segments MS and MP, and MP is located immediately in the 3 of MS, is brought into contact with the following components:
[0894] b) an oligonucleotide primer P, which in 5-3 orientation comprises the sequence segments PC and PM, and PM is located immediately in the 3 direction of PC, wherein PM comprises the sequence complementary [hybridizing] to the sequence segment MP [can bind essentially sequence-specifically] and PC cannot bind to M [or a sequence in 3 immediately following MP];
[0895] c) a controller oligonucleotide C, which in 5-3 orientation comprises the sequence segments CS, CP and CC, wherein CP is located immediately in 3 direction of CS and immediately in 5 direction of CC, and wherein CS is identical to at least the 3 segment of MS (immediately in 5 direction of MP), and CP and CC comprise the [hybridizing] sequence complementary to the sequence segment PM and PC, and wherein CS comprises modified nucleotide building blocks so that CS cannot serve as a template for the activity of the template-dependent nucleic acid polymerase;
[0896] d) a template-dependent nucleic acid polymerase, particularly a DNA polymerase, as well as substrates of the DNA polymerase (particularly ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors,
[0897] wherein a primer extension product P is obtained, which in addition to the sequence regions PC and PM comprises a synthesized region PS, which is essentially complementary to the target sequence MS,
[0898] and wherein
[0899] either the reaction conditions are chosen, and/or
[0900] the lengths and the melting temperature of PC and, if necessary, MS are chosen
[0901] so that P can form a double strand with M and P can form a double strand with C and the formation of the double strand of P and C is preferred over the formation of the double strand of P with M.
[0902] The method according to certain embodiments, wherein the sequence segment CS contains at its 3 end immediately in the 5 direction of the sequence segment CP a sequence segment CS' of 5 to 15 nucleotide positions in length, which consists of nucleic acid analogues, particularly of 20-alkyl ribonucleotides. The method according to any of the preceding embodiments, wherein M comprises a sequence segment MB immediately in 5 of MS, and wherein further a block oligonucleotide B, which can hybridize to MB, is brought into contact with the sample, and wherein
[0903] a. B comprises nucleoside analogues which are selected such that a hybrid of B with MB does not allow the template-dependent nucleic acid polymerase to react on MB, or
[0904] b. the template-dependent nucleic acid polymerase is selected such that a hybrid of B with MB [even if B consists of natural nucleosides or deoxynucleotides] does not allow the template-dependent nucleic acid polymerase to react on MB.
[0905] The terms used in said embodiment illustrate certain variants of the structures described in the application.
[0906] A nucleic acid polymer (an embodiment of the template) comprises the target sequence M, which in 5-3 orientation comprises the sequence segments MS and MP and MP and is located immediately in 3 of MS. In an embodiment, the target sequence comprises a polymorphic locus (N2).
[0907] An oligonucleotide primer P (corresponding to a first oligonucleotide primer) comprises in 5-3 orientation the sequence segments PC (corresponding to a second region of the first primer oligonucleotide) and PM (corresponding to a first region of the first oligonucleotide primer).
[0908] A controller oligonucleotide C comprises in 5-3 orientation the sequence segments CS (corresponding to a third region of the controller oligonucleotide), CP (corresponding to a second region of the controller oligonucleotide) and CC (corresponding to a first region of the controller oligonucleotide).
[0909] A primer extension product P (corresponding to a first primer extension product) is obtained by template-dependent extension of the first oligonucleotide primer. In addition to the sequence regions PC and PM, the primer extension product comprises a synthesized region PS, which is essentially complementary to the target sequence MS.
[0910] A variant VM of the target sequence M is different from the sequence M in at least one position VMM. Said position particularly comprises one or more substitution(s), insertion(s) and/or deletion(s). Said position VMM in said embodiment is a sequence variant of the polymorphic locus (N2) of the target sequence. In an embodiment VMM is located at the 5-end of VMP. In other words, the 3-end of VPM hybridizes with VMM.
[0911] A second controller oligonucleotide VC comprises in 5-3 orientation the sequence segments VCS (corresponding to a third region of the controller oligonucleotide), VCP (corresponding to a second region of the controller oligonucleotide) and VCC (corresponding to a first region of the controller oligonucleotide).
[0912] A second oligonucleotide primer VP (corresponding to a variant of a first oligonucleotide primer) comprises in 5-3 orientation the sequence segments VPC (corresponding to a second region of the first oligonucleotide primer) and VPM (corresponding to a first region of the first oligonucleotide primer) and VPM is located immediately in 3 of VPC, wherein VPM comprises the [the hybridizing] sequence complementary to the sequence segment VMP of the target sequence VM [can bind essentially sequence-specifically] and VPC cannot bind to VM [or any sequence in 3 immediately following VMP]. In an embodiment VMM (polymorphic locus N2) of the target sequence is located at the 5 end of VMP and the 3 end of VPM (of the first oligonucleotide primers) can hybridize specifically to VMM.
[0913] A competitor oligonucleotide KP can hybridize with the target sequence. In an embodiment, KP can hybridize to VMP of the target sequence.
[0914] A block oligonucleotide B can hybridize in an embodiment to a sequence segment immediately in the 5 direction of MS of the target sequence MB, wherein B comprises nucleoside analogues selected as such that a hybrid (complex) of B with MB does not allow a template-dependent nucleic acid polymerase to react on MB.
[0915]
[0916]
EXAMPLES
[0917] Material and Methods:
[0918] Reagents were purchased from the following commercial suppliers:
[0919] unmodified and modified oligonucleotides (Eurofins MWG, Eurogentec, Biomers, Trilink Technologies, IBA Solutions for Life Sciences); polymerases NEB (New England Biolabs); dNTP's: Jena Bioscience; intercalating EvaGreen dye: Jena Bioscience; buffer substances and other chemicals: Sigma-Aldrich; plastic goods: Sarstedt
[0920] Solution 1 (amplification reaction Solution 1):
[0921] Potassium glutamate, 50 mmol/l, pH 8.0; magnesium acetate, 10 mmol/l; dNTP (dATP, dCTP, dTTP, dGTP), 200 mol/l each; polymerase (Bst 2.0 WarmStart, 120. 000 U/ml NEB), 12 units/10 l; Triton X-100, 0.1% (v/v); EDTA, 0.1 mmol/l; TPAC (Tetrapropylammonium chloride), 50 mmol/l, pH 8.0; EvaGreen dye (dye was used in dilution 1:50 according to the respective manufacturer's instructions).
[0922] Solution 2 (amplification reaction Solution 2):
[0923] 1 Isothermal buffer (New England Biolabs); in single concentration the buffer contains: 20 mM Tris-HCl; 10 mM (NH4)2SO4 ; 50 mM KCl; 2 mM MgSO4; 0.1% Tween 20;pH 8.8@25 C.); dNTP (dATP, dCTP, dUTP, dGTP), each 200 mol/l;
[0924] EvaGreen dye (dye was used in dilution 1:50 according to respective manufacturer's instructions)
[0925] All concentrations are indications of the final concentrations in the reaction. Deviations from the standard reaction are indicated respectively.
[0926] The melting temperature (Tm) of components involved was determined at concentrations of 1 mol/l of respective components in solution 1 or 2. Deviating parameters are indicated respectively.
[0927] General Information on Reactions
[0928] Primer extension reactions and amplification were performed at two reaction temperatures of 55 C. and/or 65 C. as standard. Deviations are indicated.
[0929] The reaction start took place by heating the reaction solutions to reaction temperature, since Bst 2.0 polymerase warm start at lower temperatures is largely inhibited in its function by a temperature-sensitive oligonucleotide (an aptamer according to the manufacturer's specifications). The polymerase becomes increasingly active at temperatures above 45 C. At a temperature of 65 C. no differences between Polymerase Bst 2.0 and Bst 2.0 warm start could be detected. To prevent the extensive formation of by-products (e.g. primer-dimers) during the preparation phase of a reaction, Polymerase Bst 2.0 Warmstart was used. Deviations from this are specifically indicated.
[0930] The reaction stop took place by heating the reaction solution to over 80 C., e.g. 10 min at 95 C. At this temperature the Polymerase Bst 2.0 is irreversibly denatured and the result of the synthesis reaction cannot be changed afterwards.
[0931] Reactions were performed in a thermostat with a fluorescence measuring device. For this purpose, a commercial real-time PCR device, StepOne Plus (Applied Biosystems, Thermofischer) was used. The standard reaction volume was 10 Deviations from this volume are indicated.
[0932] Both endpoint determination and kinetic observations were performed. For endpoint determinations the signal was detected e.g. from dyes bound to nucleic acids, e.g. from TMR (Tetramethyl-Rhodamine, also called TAMRA) or from FAM (Fluorescein). The wavelengths for excitation and measurement of the fluorescence signals of FAM and TMR are stored as factory settings in the StepOne Plus Real-Time PCR device. Also an intercalating dye (EvaGreen) was used for endpoint measurements (e.g. measurement of a melting curve). EvaGreen is an intercalating dye and is an analogue of the frequently used dye Sybrgreen, but with slightly lower inhibition of polymerases. The wavelengths for excitation and measurement of the fluorescence signals of SybrGreen and EvaGreen are identical and are stored as factory settings in the StepOne Plus Real-Time PCR device. The fluorescence can be detected continuously, i.e. online or real-time by means of built-in detectors. Since the polymerase synthesizes a double strand during its synthesis, said technique could be used for kinetic measurements (Real-Time Monitoring) of the reaction. Due to a certain cross-talk between color channels in the StepOne Plus device, increased basal signal intensity was sometimes observed in measurements using TMR-labeled primers in concentrations above 1 mol/l (e.g. 10 mol/l). It was observed that the TMR signal in the SybrGreen channel leads to elevated basal values. These elevated baseline values were taken into account in calculations.
[0933] Kinetic observations of reaction courses were routinely recorded using fluorescence signals from fluorescein (FAM-TAMRA Fret pair) or intercalating dyes (EvaGreen). Time-dependence of the signal was recorded (real-time signal acquisition with StepOne plus PCR device). An increase of the signal during a reaction compared to a control reaction was interpreted according to the structure of the batch. For example, an increase in the signal when using Evagreen dye was interpreted as an indication of an increase in the quantity of double-stranded nucleic acid chains during the reaction, and thus as the result of a synthesis taking place by the DNA polymerase.
[0934] For some reactions, a melting curve determination was generally performed after the reaction. Such measurements allow conclusions to be drawn about the presence of double strands, which can, for example, absorb intercalating dyes and thus significantly amplify the signal intensity of dyes. With increasing temperature, the portion of double strands decreases and the signal intensity decreases as well. The signal depends on the length of nucleic acid chains and on the sequence composition. This technique is sufficiently known to a skilled person.
[0935] When using melting curve analysis in connection with reactions containing significant portions of modified nucleic acid chains (e.g., controller oligonucleotides or primers), it was found that the signal from the EvaGreen dye, for example, can behave differently between the B-form of DNA and the A-form of modified nucleic acid chains. For example, a higher signal intensity was observed for the B form of double-stranded nucleic acid chains (usually assumed for classical DNA segments) than for double-stranded nucleic acid chains with the same sequence of nucleobases that can adopt a conformation similar to A form (e.g. by several 2-O-Me modifications of nucleotides). This observation was taken into account when using intercalating dyes.
[0936] If necessary, the reaction was analyzed by capillary electrophoresis and the length of formed fragments was compared to a standard. In preparation for capillary electrophoresis, the reaction mixture was diluted in a buffer (Tris-HCl, 20 mmol/l, pH 8.0, and EDTA, 20 mmol/l, pH 8.0) so that the concentration of labeled nucleic acids was approximately 20 nmol/l. The capillary electrophoresis was carried out by GATC-Biotech (Constance, Germany) as a contract service. According to the supplier, capillary electrophoresis was performed on an ABI 3730 Cappilary Sequencer under standard conditions for Sanger sequencing using POP7 gel matrix, at approx. 50 C. and at constant voltage (approx. 10 kV). The conditions used led to the denaturation of double strands, so that in capillary electrophoresis the single-stranded form was separated from nucleic acid chains. Electrophoresis is a standard technique in genetic analysis. Today, automated capillary electrophoresis is routinely used in Sanger sequencing. The fluorescence signal is continuously recorded during capillary electrophoresis (usually using virtual filters), resulting in an electrophorogram in which the signal intensity correlates with the duration of the electrophoresis. For shorter fragments, e.g. unused primers, an earlier signal peak is observed; for longer fragments, there is a time shift of the signals proportional to the length of the extended region. The length of extended fragments can be measured by using controls with known lengths. This technique is known to a skilled person and is also used as standard for fragment length polymorphism.
[0937] Unless otherwise defined with respect to a particular sequence, both upper and lower case letters agct and AGCT denote the deoxyribonucleotide building blocks of DNA, or the respective ribonucleotides or base analogues. In some exemplary embodiments, uracil nucleobases are used in modified sequence segments, therefore 2-OMe modifications were used as sugars (ribose with 2-O-methyl modification). Other 2-O-alkyl modifications are also possible. In batches with dUTP particularly the first amplification reaction) amplification fragments are generated, which comprise dUMP (as protection against contamination). In general, however, uracil bases can be used with 2-deoxyribose as well as with ribose; the skilled person takes from the revelation as a whole the teaching related to the respective sequence segments of the sequences used here to determine at which points classical DNA backbones, RNA or base analogues can be usefully applied.
Example 1
[0938] A primer extension reaction for preparing a primer extension product using sequence variants of a target sequence and subsequent use of the synthesized primer extension product in an amplification reaction.
[0939] In said example, the influence of sequence differences in two templates on the interaction with the controller after a synthesis phase was investigated. Two templates were provided, which comprised a sequence difference at one nucleotide position. When extending the first oligonucleotide primer, a complementary strand was formed which contained a sequence complementary to the respective template and thus also comprised this sequence difference in the sequence. Both templates comprised a uniform primer binding site, so that a uniform primer could be used. Discrimination between individual sequence variants of the target sequence thus took place using a specific controller oligonucleotide.
[0940] The primer extension products generated during the synthesis phase can be specifically separated from template strands by controllers. The primer extension products comprise a 3-segment, which is not bound by a controller oligonucleotide. This 3-segment of the first primer extension product can be bound complementarily by another oligonucleotide, e.g. a primer. First primer extension products generated in this way can be amplified in a subsequent amplification reaction using another, second primer. The amplification reaction thus serves to illustrate the effect of a controlling phase (strand separation by a controller) after a synthesis phase.
[0941] Following templates were used:
[0942] A template with sequence composition which results in a first primer extension product with a perfect match with the controller oligonucleotide:
[0943] M2SF5-M001-200
TABLE-US-00001 (SEQIDNO:001) 5GCTCATACTACAATGTCACTTACTGTAAGAGCAGATCC CTGGACAGGCAAGGAATACAGGTAAAAAA3
[0944] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[0945] The binding sequence for the first oligonucleotide primer is underlined.
[0946] Template with sequence composition resulting in a first primer extension product that forms a mismatch with the controller oligonucleotide at a single base position (in bold):
[0947] M2SF5-WT01-200
TABLE-US-00002 (SEQIDNO:002) 5GCTCATACTACAATGTCACTTACTGTAAGAGCAGATCC CTGGACAGGCGAGGAATACAGGTAAAAAA3
[0948] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[0949] The binding sequence for the first oligonucleotide primer is underlined.
[0950] Following primers were used:
[0951] The first oligonucleotide primer: P1F5-200-AE2053
TABLE-US-00003 (SEQIDNO:003) 5AACTCAGACAAGATGTGATTTTTTTACCTGTAT[CUCU GAUGCUUC]1TACCTGTATTCC3
[0952] The segment used as primer in the reaction is underlined.
[0953] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[0954] This oligonucleotide comprised the following modifications:
[0955] 1=C3-linker
[0956] The segment of the primer in square brackets [CUCU GAUGCUUC] comprised 2-O-Me modifications and served as a second primer region for binding of the first region of the controller oligonucleotide:
[0957] A=(2-O-Methyl-Adenosine), G=(2-O-Methyl-Guanosine); C=(2-O-Methyl-Cytosine);
[0958] U=(2-O-Methyl-Uridine)
[0959] This oligonucleotide primer comprises the first region (positions 1-12 from the 3-end), the second region (C3 linker, as well as positions 13-24 from the 3-end), as well as a segment with an additional sequence variant P1 (positions 25-57 from the 3-end). The first region and the second region are necessary for performing a specific amplification and can be summarized as basic structure of the first primer or minimal structure of the first primer. The additional sequence variant P1 is an example of additional segments which can be integrated at the first oligonucleotide primer. Positions 1-12 serve as templates for the synthesis of the second primer extension product. C3 modification and the second region prevent continuation of the synthesis at positions 25-57 during synthesis of the second primer extension product.
[0960] Following controller oligonucleotide was used: AD-F5-1001-503
TABLE-US-00004 (SEQIDNO:004) 5[UAAUCUGUAAGAGCAGAUCCCUGGACAGGCAAGGAAUAC]AGGTAGAAGCATC AGAGX3
[0961] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[0962] The 5 segment of the oligonucleotide in square brackets [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] comprised 2-O-Me-nukleotide modifications:
[0963] Modifications: A=(2-O-Methyl-Adenosine), G=(2-O-Methyl-Guanosine); C=(2-O-Methyl-Cytosine); U=(2-O-Methyl-Uridine)
[0964] X=3-phosphate group to block a possible extension by polymerase.
[0965] The nucleotides and nucleotide modifications are linked together with phosphodiester bonds. The 3-end of the controller oligonucleotide is blocked with a phosphate group to prevent a possible extension by the polymerase.
[0966] The primer extension reaction was directly continued as amplification reaction (homogeneous assay).
[0967] For this purpose, another primer (primer 2) was added to the reaction mixture before the primer extension reaction started. This second primer can bind complementarily to the 3 segment of the primer extension product synthesized in the primer extension reaction. Furthermore, this second primer can support an amplification reaction starting from the first primer extension product, which was synthesized during the synthesis phase and which is subsequently detached from its template by the controller during the controlling phase.
[0968] Primer 2: P2G3-5270-7063
TABLE-US-00005 (SEQIDNO:005) 5CTACAGAACTCAGACAAGATGTGAACTACAATGTT6 GCTCATACTACAATGTCACTTACTGTAAGAGCAGA3
[0969] Said oligonucleotide comprises the following modifications:
[0970] 6=HEG-linker
[0971] The segment used as primer in the reaction is underlined. Said segment is capable of binding complementarily to the 3 segment of the first primer extension product and initiating a second primer extension reaction using the first primer extension product as template.
[0972] Said oligonucleotide primer comprises a copyable region and a non-copyable region. The copyable region comprises (positions 1-13 from the 3 end, which can bind complementarily to sequence of the FVL gene within hgDNA and positions 14-35, which do not bind complementarily to sequence of the FVL gene but can bind to the first segment of the primer extension product during amplification). The copyable regions can be summarized as basic structure of the second primer or minimal structure of the second primer.
[0973] The non-copyable region (positions 36-70 from the 3 end, which do not bind to the sequence of FVL gene complementarily) is separated from the copyable region by HEG modification, which prevents the continuation of the synthesis at positions 36-70 during a synthesis of the first segment of the primer extension product. The non-copyable region is an example of an additional sequence variant P2, which can be integrated at the second oligonucleotide primer.
[0974] The first primer extension reaction and the second primer extension reaction result in a double strand comprising the first and second primer extension product. Further use of both primers and the controller oligonucleotide (and repeated temperatures of 55 C. and 65 C.) resulted in an exponential amplification comprising both primer extension steps as well as strand separation using controller oligonucleotides. During the amplification phase, the first oligonucleotide primer continued to serve as the amplification primer.
[0975] Four batches were prepared:
[0976] Batch 1 contains the template M2SF5-M001-200 (perfect match situation) in a concentration of 300 fmol/l (corresponds to approx. 2e6 copies/ batch).
[0977] Batch 2 contains the template M2SF5-M001-200 (perfect match situation) in a concentration of 300 amol/l (corresponds to approx. 210{circumflex over ()}3 copies/ batch).
[0978] Batch 3 does not contain a template and is therefore a control.
[0979] Batch 4 contains the template M2SF5-WT01-200 (single mismatch situation) in a concentration of 300 pmol/l (approx. 210{circumflex over ()}9 copies per batch).
[0980] Primer 1 was tested with 5 mol/l, the controller oligonucleotide with 2 mol/l and primer 2 with 1 mol/l is inserted. The further reaction conditions were: Amplification solution 2.
[0981] To replicate the presence of genomic DNA in the assay, 100 ng freshly denatured fish DNA (salmon DNA) was added per reaction.
[0982] A primer extension reaction (synthesis phase and controlling phase).
[0983] The thermal reaction conditions were 2 min at 55 C. (synthesis phase) and then 5 min at 65 C. (controlling phase).
[0984] The synthesis phase of the primer extension reaction of the first primer took place primarily at 55 C. At this temperature, the controller was present in complex with the first primer and was therefore in a non-active state. The controlling phase took place at 65 C. At this temperature, the controller dissociated at least partially from the first oligonucleotide primer and was thus able to interact with the primer extension products formed. The melting temperature of the first region of the first primer with its primer binding site on the template was about 45 C. in amplification solution 2. Thus, the synthesis phase was performed at a reaction temperature of about Tm+10 C., based on Tm of template/first primer complex. Due to a higher concentration of the first primer (5 mol), a sufficient quantity of the first primer was present in the synthesis phase to bind to the template and start the reaction. When the temperature was increased to 65 C., the yield of the synthesis phase decreased significantly. At said temperature the controller was partially released from its binding with the primer (Tm of the complex comprising the first primer and controller in amplification solution 1 was 63 C.). Therefore, the controlling phase was performed at approx. Tm+2 C. related to Tm of controller/first primer-complex.
[0985] Amplification reaction (Repetition of primer extension reactions)
[0986] The thermal reaction conditions were cyclically alternating temperature changes, wherein a 2 min time interval at 55 C. was followed respectively by a 5 min time interval at 65 C. The amplification was monitored over 100 cycles. Detection took place at 65 C. for EvaGreen fluorescence signal.
[0987] The successful synthesis of primer extension products (here referred to as amplification) was determined by an increase in EvaGreen fluorescence signal over time. Temperature changes and real-time monitoring were performed with Thermofisher's StepPne Plus Real-Time PCR device.
[0988]
TABLE-US-00006 Arrow 1: 300 fmol/l perfect match template (approx. 2 10{circumflex over ()}6 copies/batch) Arrow 2: 300 amol/l perfect match template (approx. 2 10{circumflex over ()}3 copies/batch) Arrow 3: no template Arrow 4: 300 pmol/l mismatch template (approx. 2 10{circumflex over ()}9 copies per batch).
[0989] The increase of the fluorescence signal can be seen in both perfect match and mismatch variant of the template, wherein the signal of the mismatch variant (4) appears later despite a 1000-fold excess. In single mismatch, a delay of about 15 cycles is observed. The time delay (=number of cycles) is an immediate measure of the discrimination due to the action of the controller. When using a perfect match template, a complementary strand of a primer extension product is synthesized. Said extension product is complementary to both the perfect match template and the controller oligonucleotide used. In contrast, using a mismatch sequence, the synthesis of the first segment of the primer extension product results in the generation of a complementary strand of the extension product, which comprises complete complementarity to the mismatch template, but thereby deviates from complementarity with the third region of the oligonucleotide controller. Said deviation takes place in the 5-strand segment of the extension product, which should react with the controller oligonucleotide in order to allow the strand displacement process to proceed. As shown in said example, the mismatch interferes with strand separation by the controller oligonucleotide.
[0990] Said result illustrates the importance of the base composition in the controller oligonucleotide: deviations from the complementarity between the controller oligonucleotide and the primer extension product can cause the amplification to slow down or even stop.
[0991] In said example it was shown that although sequence ends of the perfect match template and mismatch template were completely matching and thus the potential for binding of both oligonucleotide primers was the same, both reactions proceeded completely different: in case of complete complementarity between the controller oligonucleotide and the 5 segment of the extension product of the first oligonucleotide primer, the amplification proceeded according to plan. An interruption of the strand separation during the controlling phase by a non-complementary sequence variant (in this case by a mismatch) led to a reduction of the strand separation, which was reflected in the suppression of the amplification kinetics.
[0992] Thus, a primer extension product produced in a primer extension reaction can be used as a starting nucleic acid in an amplification method.
Example 2
[0993] Influence of a Mismatch Between a First Primer and a Controller on the Strand Separation (Controlling Phase).
[0994] Similar to the first example, an amplification reaction was used to illustrate an effect of a controlling phase (strand separation by a controller) after a synthesis phase.
[0995] The synthesis phase takes place under reaction conditions that allow a primer extension reaction on a template. However, different controllers were used for the respective strand separation (controller phase): Perfect match and mismatch controller oligonucleotide to the primer used during the synthesis phase. To demonstrate the effect of such a single mismatch between a first primer and a controller, repeated primer extension reactions (synthesis phases) and controlling phases were performed under cyclic temperature conditions. This resulted in an amplification of a first primer extension product.
[0996] The amplification was used as a detection method for the controlling phase: only if the strand separation is successful and the second oligonucleotide primer can bind to the 3-segment of the first primer extension product, an amplification takes place. Due to the high sensitivity of said method (due to exponential character) and a quantification possibility (time dependence of signal detection depending on concentration), amplification was used as a detection method for successful or unsuccessful strand separation during a controlling phase. Real-time monitoring of the synthesis of resulting amplification products took place in this example with the intercalating dye Eva Green.
[0997] The following template was used: [0998] Template with sequence composition resulting in a first primer extension product with a perfect match matching with the controller oligonucleotide:
[0999] M2SF5-M001-200
TABLE-US-00007 (SEQIDNO:001) 5GCTCATACTACAATGTCACTTACTGTAAGAGCAGATCC CTGGACAGGCAAGGAATACAGGTAAAAAA3
[1000] The binding sequence for the first oligonucleotide primer is underlined.
[1001] The second oligonucleotide primer binds to the reverse complement of the double underlined sequence.
[1002] Following primers were used:
[1003] The first oligonucleotide primer (SEQ ID NO:2), served as primer extension primer and as amplification primer.
[1004] P1 F5-200-AE2053
TABLE-US-00008 (SEQIDNO:003) 5AACTCAGACAAGATGTGATTTTTTTACCTGTAT[CUCU GAUGCUUC]1TACCTGTATTCC3
[1005] The segment used as primer in the reaction is underlined.
[1006] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[1007] Said oligonucleotide comprises following modifications:
[1008] 1=C3-linker was used to terminate the synthesis of the second primer extension product.
[1009] Segment of the primer [CUCU GAUGCUUC] comprised 2-O-Me modifications and served as a second primer primer region to bind the first region of a controller oligonucleotide:
[1010] A=(2-O-Methyl-Adenosine), G=(2-O-Methyl-Guanosine); C=(2-O-Methyl-Cytosine);
[1011] U=(2-O-Methyl-Uridine) [1012] The second oligonucleotide primer served as a second primer for amplification: P2G3-5270-7063
TABLE-US-00009 (SEQIDNO:005) 5CTACAGAACTCAGACAAGATGTGAACTACAATGTT6 GCTCATACTACAATGTCACTTACTGTAAGAGCAGA3
[1013] Modifications:
[1014] 6=HEG-linker
[1015] Both the first primer and the second primer are capable of supporting amplification with a perfect match oligonucleotide primer.
[1016] Following perfect match controller oligonucleotide was used:
[1017] AD-F5-1001-503
TABLE-US-00010 (SEQIDNO:004) 5[UAAUCUGUAAGAGCAGAUCCCUGGACAGGCAA GGAAUAC]AGGTAGAAGCATCAGAGX3
[1018] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[1019] The 5 segment of the oligonucleotide set in square brackets [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] comprised 2-O-Me-nucleotide-modifications:
[1020] Modifications: A=(2-O-Methyl-Adenosine), G=(2-O-Methyl-Guanosine); C=(2-O-Methyl-Cytosine);
[1021] U=(2-O-Methyl-Uridine)
[1022] X=3-phosphate group to block a possible extension by the polymerase.
[1023] Following mismatch controller oligonucleotide was used:MD2AD-F5-011-5
TABLE-US-00011 (SEQIDNO:007) 5-GCTCTAATCTGTAAGAGCAGATCCCTG[GACAGGCAA GAAUACAGG]TA GAAGCATCAGAGX3
[1024] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[1025] The middle segment of the oligonucleotide set in square brackets [GAC AGGC AA AGAAUACAGG] comprised 2-O-Me- nucleotide-modifications: A=(2-O-Methyl-Adenosine), G=(2-O-Methyl-Guanosine); C=(2-O-Methyl-Cytosine); U=(2-O-Methyl-Uridine)
[1026] X=3-phosphate group to block a possible extension by the polymerase.
[1027] The nucleotides and nucleotide modifications are linked to one another with phosphodiester bonds. The 3-end is blocked with a phosphate group to prevent a possible extension by the polymerase.
[1028] In the mismatch controller oligonucleotide, an A nucleotide (mismatch variant) was inserted at position 24 (from the 3 end) instead of a G nucleotide (perfect match variant). The nucleotide is highlighted in bold. This position forms a mismatch with the 3-terminal nucleotide of the inserted first primer.
[1029] The template was used in concentrations of 1-3 pmol/l. No template was used in the control reaction (=negative control). Primer 1 was used at 5 mol/l, the respective controller oligonucleotide at 2 mol/l and primer 2 at 1 mol/l.
[1030] The other reaction conditions were: [1031] Amplification solution 2 [1032] To replicate the presence of genomic DNA in the assay, 100 ng freshly denatured fish DNA (salmon DNA) was added per reaction.
[1033] The synthesis phase of the primer-extension reaction of the first primer took place primarily at 55 C. At said temperature the controller was present in complex with the first primer and was therefore in a non-active state. The controlling phase took place at 65 C. At said temperature, the controller dissociated at least partially from the first oligonucleotide primer and was thus able to interact with formed primer extension products. The melting temperature of the first region of the first primer with its primer binding site on the template was about 45 C. in amplification solution 2. Thus, the synthesis phase was performed at a reaction temperature of about Tm+10 C., based on Tm of template/first primer complex. Due to a higher concentration of the first primer (5 mol), a sufficient amount of the first primer was present in the synthesis phase to bind to the template and start the reaction. When the temperature was increased to 65 C., the yield of the synthesis phase decreased significantly. At this temperature the controller was partially released from its binding with the primer (Tm of the complex comprising first primer and controller in amplification solution 1 was 63 C.). Therefore, the controlling phase was performed at approx. Tm+2 C. related to Tm of controller/first primer-complex.
[1034] In the amplification, the thermal reaction conditions were cyclically alternating temperature changes, wherein a 1 min time interval at 55 C. was followed respectively by a 5 min time interval at 65 C. The amplification was typically monitored over 120 cycles, i.e. 120(1 min 55 C.+5 min 65 C.)=1206 min=12 h. Successful amplification was determined by an increase in EvaGreen fluorescence signal over time.
[1035] Analysis of the Primer Extension Reaction (And Amplification Reaction)
[1036] The following techniques were used to analyze the amplification reaction and to evaluate the resulting amplification products: [1037] Fluorescence signal of an intercalating dye (EvaGreen) [1038] Melt curve analysis of the resulting amplification products
[1039]
[1040]
[1041]
[1042] In summary: a nucleotide mismatch in the controller oligonucleotide positioned in the second region of the controller oligonucleotide to the corresponding first region of the primer can prevent amplification.
[1043] Based on said example, it can be seen that sequence variant-specific amplification systems can be assembled comprising a sequence variant-specific primer and a respective complementary sequence variant-specific controller oligonucleotide.
Example 3
[1044] Primer Extension Reaction Using a Template and Block Oligonucleotides with LNA Modifications to Limit a Primer Extension Reaction.
[1045] Said example shows the use of human genomic DNA (hgDNA) as a source of a target sequence, wherein the primer extension reaction is performed using a first oligonucleotide primer and a controller oligonucleotide. To limit the synthesis progress, block oligonucleotides were used, which were bound complementarily to the template strand in 3 direction from the primer before starting a primer extension reaction by hybridization. The synthesis was performed for 15 min at 55 C. During this synthesis phase, the first region of the primer binds to the primer binding site in the template and is extended by the polymerase, resulting in a primer extension product. The controller was added before the primer extension reaction started and was present in a double-stranded complex with the primer during said synthesis phase in a non-active form in the batch.
[1046] After completion of the synthesis phase, the reaction temperature was increased to 65 C. for 5 minutes, so that the complex comprised the controller and the primer at said temperature and the controller could interact with the primer extension product formed during the synthesis phase and separate it from the template strand.
[1047] A sequence segment of the factor V Leiden gene (Homo sapiens coagulation factor V (F5), mRNA, here called FVL gene) was chosen as the target sequence.
[1048] Target Sequence:
TABLE-US-00012 (SEQIDNO:008) 5TGACGTGGACATCATGAGAGACATCGCCTCTGGGCTAATA GGACTACTTCTAATCTGTAAGAGCAGATCCCTGGACAGGC AAGGAATACAGGTATTTTGTCCTTGAAGTAACCTTTCAGA3
[1049] The binding sequence for the first oligonucleotide primer is underlined (primer binding site). The binding site for the block oligonucleotide is double underlined.
[1050] The Block Oligonucleotide:
TABLE-US-00013 P1-EXB-1000-101 (SEQIDNO:009) 5{CCAGAGGCGATG}TATCTCATGATGTCCACAACA CTGTAGTATGGTCTTGTTAAGCAAAAA 3X
[1051] The sequence segment in curly brackets {CCA GAGGCGATG} comprises LNA modifications.
[1052] The first primer as well as controller oligonucleotide were designed and synthesized for FVL mutation variant of the gene.
[1053] The First Oligonucleotide Primer:
TABLE-US-00014 P1F5-200-AE2053 (SEQIDNO:003) 5AACTCAGACAAGATGTGATTTTTTTACCTGTAT[CUCU GAUGCUUC]1TACCTGTATTCC3
[1054] The segment used as primer in the reaction is underlined.
[1055] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[1056] Said oligonucleotide comprises the following modifications:
[1057] 1=C3-linker was used to terminate the synthesis of the second primer extension product.
[1058] The segment of the primer [CUCU GAUGCUUC] comprised 2-O-Me modifications and served as a second primer region to bind the first region of a controller oligonucleotide: Said sequence cannot bind complementarily to the template in the region next to the primer binding site and is therefore available for interaction with the controller oligonucleotide.
[1059] Modifications: A=(2-O-Methyl-Adenosine), G=(2-O-Methyl-Guanosine); C=(2-O-Methyl-Cytosine); U=(2-O-Methyl-Uridine)
[1060] The first primer comprises in its first region a sequence which can bind specifically to the sequence of the Factor V Leiden gene within the genomic DNA, so that a synthesis can be initiated by a polymerase. The second region of the first primer comprises a sequence that does not specifically hybridize to the sequence of the FVL gene. Furthermore, the first primer comprises a further sequence segment which links to the 5 end of the second region. Said segment does not participate in the specific primer extension of the Factor 5 Leiden segment. The function of said segment is mainly seen in the delay of side reactions.
[1061] The following controller oligonucleotide was used:
TABLE-US-00015 AD-F5-1001-503 (SEQIDNO:004) 5[UAAUCUGUAAGAGCAGAUCCCUGGACAGGCAAGGAAUAC] AGGTAGAAGCATC AGAGX3
[1062] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[1063] The 5 segment of the oligonucleotide set in square brackets [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] comprised 2-O-Me-nucleotide-modifications:
[1064] Modifications: A=(2-O-Methyl-Adenosine), G=(2-O-Methyl-Guanosine); C=(2-O-Methyl-Cytosine); U=(2-O-Methyl-Uridine)
[1065] X=3-phosphate group to block a possible extension by the polymerase.
[1066] The nucleotides and nucleotide modifications are linked together with phosphodiester bonds. The 3-end of the controller oligonucleotide is blocked with a phosphate group to prevent a possible extension by the polymerase. This controller can bind complementarily with its segment (positions underlined above) to the first expected primer extension product:
TABLE-US-00016 (SEQIDNO:010) [UAAUCUGUAAGAGCAGAUCCCUGGACAGGCAAGGAAUAC]AGGTA
[1067] The controller oligonucleotide has been constructed in such way that a perfect match to the sequence of the Factor V Leiden mutation of the FVL gene results. The controller oligonucleotide comprises a first, second and third region.
[1068] All reactions were performed in amplification solution 2.
[1069] The dNTPs used comprised: dATP, dGTP, dCTP, dUTP (instead of dTTP).
[1070] The polymerase used was Bst 2.0 Warm-Start Polymerase from NEB.
[1071] The primer extension reaction was prepared as follows:
[1072] About 50,000 haploid genomic equivalents (HGE), 150 ng hgDNA in 40 l, FVL-WHO standard, double-stranded, were brought into contact with a block oligonucleotide (0.3 mol/l) in reaction solution 2 and first denatured by heating (5 min at 95 C.) and then cooled to room temperature.
[1073] Then the first primer (2 mol/l) together with the controller oligonucleotide (1 mol/L) was added to the reaction and then Bst-2.0 warm start polymerase (about 1 unit) as well as dNTPs (about 250 mol/l) were added and the reaction volume was brought to 50 l. The resulting reaction mixture was incubated under stringent primer extension conditions (amplification solution 2, temperature of about 55 C.) for about 15 min. During said phase an extension of the first primer took place, wherein the genomic DNA served as template. The result is a primer extension product. Since during this phase the controller oligonucleotide is complexed with the first primer (and is therefore in an inactive state), the primer extension product formed was located in the double-stranded complex with the template. In order to remove said product from the template sequence specifically, the reaction mixture was heated to 65 C. and incubated for about 5 min. During said phase, the primer extension product was at least partially displaced from the binding with the template by the controller. The 3 segment of the primer extension product dissociated spontaneously under selected reaction conditions. Such a primer extension product can be used, for example, in a subsequent amplification reaction in analogy to example 1.
[1074] Such an array of block oligonucleotides on a template and thus a limitation of the length of a primer extension product can be used, for example, to provide a nucleic acid fragment to be used as the starting nucleic acid in a specific exponential amplification reaction. It is true that such a start nucleic acid as a primer extension reaction can also take place without a block oligonucleotide (
[1075] In contrast, the use of a block oligonucleotide primer allows an almost arbitrary specific limitation of the length of a primer extension product, regardless of the length of a template strand (
[1076] As a result, a specific primer extension product is generated and separated sequence-specifically from the template with the participation of a controller, without the need for an unspecific denaturing step (
[1077] The block oligonucleotide preferably does not serve as a primer itself. This can take place, for example, by blocking its 3-OH group. The block oligonucleotide primer thus comprises at least one sequence segment that is complementary to the template strand on which the primer extension reaction also takes place. Preferably, said segment (blocking segment) is sufficiently long or comprises modifications, if necessary, to form a stable double strand under reaction conditions of a primer extension reaction with the template strand. Furthermore, such a block oligonucleotide can also comprise sequence segments that are not complementary to the template strand. Such sequence segments can, for example, flank the segment that is to bind to the template and block the primer extension reaction on both sides. For example, the block oligonucleotide can be located in a sequence segment of a target nucleic acid or placed at one of its ends. The block oligonucleotide is thus positioned in such way that it is located in the 3 direction from the expected primer extension product on the template and prevents the polymerase from further copying the template strand.
[1078] The aim of a primer extension reaction can be to produce a starting nucleic acid chain for a subsequent amplification reaction. Such a start nucleic acid chain is used at the beginning of an amplification reaction. Its function can be seen as the initial template that allows the correct positioning of primers, the synthesis segments between the two primers, as well as the initiation of binding and extension processes. In certain embodiments, a start nucleic acid chain comprises a target sequence.
[1079] By binding primers to their respective primer binding sites (PBS 1 and PBS 2) and initiating respective primer extension reactions, generation of first primer extension products takes place. These are synthesized as specific copies of the nucleic acid chain present at the beginning of the reaction.
[1080] In certain embodiments, the nucleic acid chain to be inserted into the reaction mixture before the start of the amplification reaction (start nucleic acid chain) can be identical to the nucleic acid chain to be amplified. The amplification reaction only increases the quantity of such a nucleic acid chain.
[1081] In certain embodiments, the nucleic acid to be amplified and the start nucleic acid chain differ in that the start nucleic acid chain determines the array of individual sequence elements of the nucleic acid chain to be amplified, but the sequence composition of the start nucleic acid chain can deviate from the sequence of the nucleic acid chain to be amplified. For example, during primer binding and extension during amplification, new sequence contents (related to the start nucleic acid chain) can be integrated into the nucleic acid chain to be amplified. Furthermore, sequence elements of a nucleic acid chain to be amplified may differ from such sequence elements of a start nucleic acid chain in their sequence composition (e.g. primer binding sites or primer sequences). The start nucleic acid only serves as an initial template for the specific synthesis of the nucleic acid chain to be amplified. Said initial template can remain in the reaction mixture until the end of the amplification. However, due to the exponential character of amplification, the quantity of the nucleic acid chain to be amplified at the end of an amplification reaction outweighs the quantity of a starting nucleic acid chain added to the reaction.
[1082] In certain embodiments, the start nucleic acid chain comprises a target sequence or its subsegments, which comprise at least one expected sequence variant of a polymorphic locus of the target sequence.
[1083] A start nucleic acid further comprises at least one predominantly single-stranded sequence segment, to which at least one of the primers of the amplification system with its 3 segment can bind predominantly complementarily, so that the polymerase used can extend such a primer, when hybridized to the start nucleic acid chain, template-specifically by incorporation of dNTPs.
[1084] A start nucleic acid, which can comprise several sequence variants in a polymorphic locus of a target sequence, preferably further comprises at least one first target sequence segment, which is characteristic and uniform for all target sequence variants. In certain embodiments, a start nucleic acid comprises at least two target sequence segments (a first target sequence segment and a second target sequence segment), which are located on both sides of a polymorphic locus of a target sequence and thus flank the sequence variants of a target sequence from both sides.
[1085] The length of a polymorphic locus of a start nucleic acid nucleus can comprise ranges from one nucleotide up to 200 nucleotides, particularly from one nucleotide up to 50 nucleotides, particularly from one nucleotide up to 20 nucleotides. The lengths of uniform sequence segments (first and second uniform sequence segment of a starting nucleic acid) can comprise the following ranges for at least one of the two uniform sequence segments: from 4 to 200 nucleotides, particularly from 6 to 100 nucleotides, particularly from 8 to 50 nucleotides.
[1086] In certain embodiments, the starting nucleic acid chain can comprise at least one sequence segment which is not amplified. Such a start nucleic acid chain is therefore not identical with the sequence to be amplified. Such segments that are not to be amplified can, for example, represent a sequence segment of a start nucleic acid chain as a sequence of sequence preparation steps or as a sequence of preceding sequence manipulation steps.
[1087] In a preferred embodiment, the start nucleic acid chain to be inserted into the reaction mixture before the start of the reaction includes at least one target sequence.
[1088] In certain embodiments, such a start nucleic acid chain includes at least one target sequence and further sequences which are not target sequences. During amplification, sequence segments comprising the target sequence are exponentially amplified and other sequence segments are either not amplified at all or only partially exponentially.
[1089] Structure of a Start Nucleic Acid Chain
[1090] An example of such a start nucleic acid chain is a nucleic acid chain which includes a target sequence or its equivalents (e.g. a sequence complementary to the target sequence) and which comprises a sequence fragment A and comprises a sequence fragment B.
[1091] The sequence fragment A of the start nucleic acid chain comprises a sequence which comprises a significant homology with the sequence of one of the two primers used in the amplification or which is essentially identical to the copyable portion of the 3 segment of said one primer. Synthesis of a complementary strand to said segment generates a complementary sequence that represents a respective primer binding site.
[1092] Sequence fragment B of the start nucleic acid chain comprises a sequence suitable for complementary binding of a respective further primer or its 3 segment to form an extendible primer-assembly template complex, wherein sequence fragment A and sequence fragment B are predominantly/preferably non-complementary relative to each other.
[1093] In a preferred embodiment, a start nucleic acid chain comprising a target sequence which comprises the following properties is added to the reaction mixture of an amplification method: [1094] Sequence segment 5 (called segment 5, S5 in
[1098] In a further embodiment, a starting nucleic acid chain comprising a sequence complementary to the target sequence (equivalent of a target sequence) is added to the reaction mixture of an amplification method, which comprises the following properties: [1099] Sequence segment 5 (called segment 5, S5 in
[1103] Functionality of the Start Nucleic Acid Chain
[1104] At the beginning of the amplification reaction, the starting nucleic acid chain serves as a template for the initial formation of respective primer extension products. It thus represents the start template for the nucleic acid chain to be amplified. The start nucleic acid chain does not necessarily have to be identical with the nucleic acid chain to be amplified. By binding and extending both primers during the amplification reaction, the two primers essentially determine which sequences are generated at both terminal segments of the nucleic acid chain to be amplified during the amplification process.
[1105] In a preferred embodiment of the method, non-denaturing reaction conditions are maintained for a double strand during the exponential amplification process. Therefore, it is advantageous if the start nucleic acid chain comprises a limitation in its 5 sequence segment extendable by a polymerase, which leads to a stop in the enzymatic extension of a respective primer. This limits the length of primer extension fragments generated under reaction conditions. This can have an advantageous effect on the strand displacement by the controller oligonucleotide and lead to a dissociation of the respective strand, so that primer binding sites are transformed into a single-stranded state and thus become accessible for rebinding of primers.
Example 4
Influence of a Controller Oligonucleotide on the Primer Extension Reaction in a Parallel Synthesis Phase and Controlling Phase:
[1106] The reactions were performed in amplification solution 2.
[1107] The following templates were used (DNA templates):
TABLE-US-00017 P1Ex-400-4001 (SEQIDNO:011) CTTACAGTAAGTGACATTGTAGTATGAGCGATCCCTGGACAGGC AAGGAATACAGGTAA3 P1EX-400-4002 (SEQIDNO:012) CTTACAGTAAGTGACATTGTAGTATGAGCGATCCCTGGACAGGC AAGAATACAGGTAA P1EX-400-4003 (SEQIDNO:013) CTTACAGTAAGTGACATTGTAGTATGAGCGATCCCTGGACAGGC AAAATACAGGTAA P1EX-400-4004 (SEQIDNO:014) CTTACAGTAAGTGACATTGTAGTATGAGCGATCCCTGGACAGGC AAGGAATAAAGGTAA P1EX-400-4005 (SEQIDNO:015) CTTACAGTAAGTGACATTGTAGTATGAGCGATCCCTGGACAGGC AAAGAATACAGGTAA
[1108] DNA-Templates with Iso-dC
[1109] P1EX-400-4201 (is identical to SEQ ID NO 11; however, in the sequence shown below it comprises an iso-dC instead of the bold G at position 47:)
TABLE-US-00018 (SEQIDNO:011) CTTACAGTAAGTGACATTGTAGTATGAGCGATCCCTGGACAGGC AAGGAATACAGGTAA3 (SEQIDNO:016) CTTACAGTAAGTGACATTGTAGTATGAGCGATCCCTGGAC AGGCAA1GAATACAGGTAA
[1110] P1EX-400-4202 (is identical to SEQ ID NO 11, but i comprises an Iso-dC instead of the G at position 43:)
TABLE-US-00019 (SEOIDNO:017) CTTACAGTAAGTGACATTGTAGTATGAGCGATCCCTGGACAG1C AAGGAATACAGOTAA
[1111] 1=5-Me-Iso-dC (nucleotide can only form a complementary nucleobase with Iso-dG. It does not form a typical Watson-Crick base pairing with any of the dNTP's used, so that overcoming this position can only take place by mismatch formation)
[1112] The templates were varied in their sequence composition in such way that resulting primer extension products can interact differently with the controller oligonucleotide. Depending on the sequence composition of the template, either a perfect match or a mismatch in the primer extension product/controller complex could be generated.
[1113] To test for a polymerase error, templates were used that include an iso-dC at specific positions. Since said nucleotide does not comprise a natural correlate, a polymerase must generate a mismatch and only when said mismatch is overcome can the displacement of the probe (see below) take place. Thus, templates with iso-dC represent an example of the primer extension reactions that occur under mismatch formation (e.g., due to a polymase error). Templates with Iso-dC are only intended to illustrate the changes in the behavior of the primer extension reactions and the influence of the controller on the behavior of the polymerases/synthesis of complementary strands.
[1114] The following primers were used:
TABLE-US-00020 SEQP1F5300-35X (SEQIDNO:018) 5ACGAAGCTCGCAAGAACTCAGAGTGTGCTCGACAC TACCTGTATTCC3
[1115] The first region of the primer is underlined. With said segment the primer can bind to perfect match templates.
[1116] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[1117] Said primer does not comprise a segment that can interact with the first region of the controller oligonucleotide. Thus, when said primer is extended, a controller oligonucleotide cannot separate the formed primer extension product from the template strand.
TABLE-US-00021 P1F5-001-1003 (SEQIDNO:019) 5TMR-[CUGAUGCUUC]1TACCTGTATTCC3
[1118] 1=C3-linker
[1119] The first region of the primer is underlined. With said segment the primer can bind to perfect match templates.
[1120] The segment [CU GAUGCUUC] set in square brackets comprises 2-O-Me modifications and represents the second region of the primer.
[1121] Modifications: A=(2-O-Methyl-Adenosine), G=(2-O-Methyl-Guanosine); C=(2-O-Methyl-Cytosine); U=(2-O-Methyl-Uridine)
[1122] TMR=Tetramethyl-Rhodamine at the 5-end
[1123] Following controller oligonucleotide was used:
TABLE-US-00022 AD-F5-1001-503 (SEQIDNO:020) 5[UAAUCUGUAAGAGCAGAUCCCUGGACAGGCAAGGAAUAC] AGGTAGAAGCATCAGAGX3
[1124] A=2-deoxy-Adenosin; C=2-deoxy-Cytosin; G=2-deoxy-Guanosin; T=2-deoxy-Thymidin (Thymidin)
[1125] The 5-segment of the oligonucleotide [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] comprised 2-O-Me nucleotide modifications:
[1126] Modifications: A=(2-O-Methyl-Adenosine), G=(2-O-Methyl-Guanosine); C=(2-O-Methyl-Cytosine); U=(2-O-Methyl-Uridine)
[1127] X=3-phosphate group to block a possible extension by the polymerase.
[1128] In said example, the controller oligonucleotide can form a perfect match with certain primer extension products. It can form a mismatch with other primer extension products.
[1129] To monitor the progress of the primer extension reaction, a fluorescence probe was used, which can bind to the 5 segment of the used templates. When said probe is displaced from the binding with said 5-segment of the respective template, the signal of the probe is reduced (intramolecular quenching between dT-BHQ1 and FAM reporter)
TABLE-US-00023 Fluorescenceprobe: P2D-LUX-1000-101 (SEQIDNO:021) FAM-5TAGTATGAGCTTTT1GCTCATAC2ACAATGTCACTTA CTGTAAGAGCAGA
[1130] 1=HEG
[1131] 2=dT-BHQ1
[1132] The probe was used in 0.2 mol/L concentration. The templates were used at a concentration of 0.5 mol/l, the primers were used at 1 mol/l concentration and controllers (if used as indicated) were used at 2 mol/l. Bst-2.0 Warm-Start (NEB) was used in a concentration of 4 units/10 l.
[1133] The reactions were performed in a StepOne Plus device at a temperature of 55 C. Signal detection took place via FAM channel. The reaction was monitored continuously (sampling interval=10 sec). The signal intensity was controlled by batches without polymerase (but with all other components) or alternatively with polymerase but without template.
[1134] The Tm of PBS (perfect match) of the template with the first region of the primer was about 45 C. The Tm of controller oligonucleotide/primer (P1F5-001-1003) was about 57 C. The reaction temperature of the primer extension reaction was 55 C. The reaction ran over 100 min.
[1135] The results of individual reactions are summarized in
[1136] The kinetics of individual reactions were evaluated based on the change of the fluorescence signal.
[1137] The evaluation of representative data sets is shown below:
TABLE-US-00024 Reaction Tempate Primer Controller Polymerase 1 P1Ex-400-4001 P1F5-001-1003 No Yes 2 P1Ex-400-4001 P1F5-001-1003 AD-F5- Yes 1001-503 3 P1Ex-400-4001 P1F5-001-1003 No No
[1138] Reaction 1 (
[1139] Reaction 2 (
[1140] Reaction 3 (
TABLE-US-00025 Reaktion Matrize Primer Controller Polymerase 4 P1Ex-400-4001 SEQP1F5 300-35X No Yes 5 P1Ex-400-4001 SEQP1F5 300-35X AD-F5- Yes 1001-503 6 P1Ex-400-4001 SEQP1F5 300-35X No No
[1141] Reactions 4-6 (
[1142] Introduction of a mismatch in primer binding site of the template
TABLE-US-00026 Reaktion Matrize Primer Controller Polymerase 7 P1EX-400-4002 P1F5-001-1003 No Yes 8 P1EX-400-4002 P1F5-001-1003 AD-F5- Yes 1001-503 9 P1EX-400-4002 P1F5-001-1003 No No
[1143] Reactions 7 and 8 show that the absence of a complementary nucleotide in the template (3-terminal mismatch) leads to a complete prevention of the primer extension reaction (
TABLE-US-00027 Reaktion Matrize Primer Controller Polymerase 10 P1EX-400-4202 P1F5-001-1003 No Yes 11 P1EX-400-4202 P1F5-001-1003 AD-F5- Yes 1001-503 12 P1EX-400-4202 P1F5-001-1003 No No
[1144] Reaction 10 (
[1145] Reaction 11 (
[1146] Reaction 12: served as reference signal for the probe in the absence of a polymerase.
TABLE-US-00028 Reaktion Matrize Primer Controller Polymerase 13 P1EX-400-4202 SEQP1F5 No Yes 300-35X 14 P1EX-400-4202 SEQP1F5 AD-F5- Yes 300-35X 1001-503 15 P1EX-400-4202 SEQP1F5 No No 300-35X
[1147] Reaction 13 (
[1148] Reaction 14: However, the presence of a controller oligonucleotide seems to have no effect on the behavior of the primer extension system in such a primer design: the primer used does not have a second region, unlike the primer used in reaction 11.
[1149] Overall, this example demonstrated the ability of a primer extension system to modify/prevent the polymerase from overcoming a mismatch in the presence of a controller oligonucleotide and a first primer.
Example 5
[1150] Use of a Synthesized Nucleic Acid Chain as the Start Nucleic Acid Chain in an Amplification Method.
[1151] The nucleic acid chain obtained by a primer extension reaction can be detached from the template strand and used in another method.
[1152] The execution of this amplification method has already been described in the PCT application PCT/EP2017/071011 and the European application 16185624.0. For details on the execution of the amplification, the skilled person is referred to this application.
[1153] For example, in a method for amplifying nucleic acid chains with a controller oligonucleotide (see examples 1 and 2). Such an amplification method comprises several steps as shown in
[1154] Thus, the nucleic acid chain provided by a primer extension can be used as a start nucleic acid chain in an amplification with allele discrimination as a template, for example.
[1155]
[1156] Start nucleic acid (start DNA) comprising a target sequence.
[1157] Primer 1 (P1.1), Primer 2 (P2.1), an activator oligonucleotide (C1.1).
[1158] Components for primer extension reaction: polymerase (Pol) and dNTPs
[1159]
[1160] The primer extension product P1.1-Ext starting from P1.1 and the primer extension product 2.1-Ext. These products (P1.1-Ext, P2.1-Ext) can form different complex forms among themselves and with activator oligonucleotide (depending on the concentration ratio and reaction conditions). In detail, said forms can comprise complexes of P1.1-Ext/C1.1 and/or P1.1-Ext and/or P1.1-Ext/C1.1/ P2.1-Ext.
[1161] The P1-Ext comprises a 3-segment, which is not bound complementarily by the activator oligonucleotide. Said segment serves as a binding partner for the oligonucleotide probe.
[1162]
[1163] In total, the arrangement of individual amplification components can be designed in such a way that several variants/combinations are possible:
[1164] Array 1 (P1): polymorphic locus (N2) of the target sequence overlays the first primer (first region) and activator oligonucleotide primer (second region). Said components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variants of the target sequence. In said array, a target sequence specific second primer is used, which is not sequence variant specific.
[1165] Array 2 (P2): polymorphic locus (N2) of the target sequence overlays the first primer (first region) and activator oligonucleotide (second region). Said components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variations of the said target sequence. In said array, a target sequence-specific second primer is used, which is not sequence variant-specific. Array P2 differs from P1 mainly in that N2 is located predominantly in the 3-terminal sequence segment of the first primer. This can lead to a better specificity of the amplification.
[1166] Array 3 (P3): polymorphic locus (N2) of the target sequence overlays only the activator oligonucleotide (third region), wherein the corresponding sequence segment of the activator oligonucleotide is located in the 5 segment of the synthesized portion of the first primer extension product. The activator oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variation of the target sequence. In said array, a target sequence-specific first and second primer is used, which are not sequence variants specific. Due to the possible proximity of the second blocking unit, the binding of the activator oligonucleotide primer to the first primer extension product can be influenced by nucleotide modifications of the second blocking unit.
[1167] Array 4 (P4): polymorphic locus (N2) of the target sequence overlays only the activator oligonucleotide (third region). The activator oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variations of the target sequence. In said array, a target sequence-specific first and second primer is used, which are not sequence variant-specific. Said sequence segment of the activator oligonucleotide is located in 5 direction from the second blocking unit and may comprise several DNA nucleotide monomers, e.g. from 5 to 30.
[1168] Array 5 (P5): polymorphic locus (N2) of the target sequence overlays the second primer and the activator oligonucleotide (third region). Said components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variations of the target sequence. In said array a target sequence-specific first primer is used, which is not sequence variant specific.
[1169] Array 6 (P6): polymorphic locus (N2) of the target sequence overlays the second primer and the activator oligonucleotide (third region, near the 5-end). These components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variations of the said target sequence. In said array a target sequence-specific first primer is used, which is not sequence variant specific.
[1170] The design differences of individual elements also result in differences for the primer extension products synthesized during amplification.
[1171]
[1172] Overall, the arrangement of individual amplification components can be designed in such a way that several variants/combinations are possible:
[1173] Array 1 (P1): polymorphic locus (N2) of the target sequence overlays the first primer (first region) and the activator oligonucleotide (second region). Said components of the amplification system can thus be designed specifically and characteristically for the respective sequence variants of the said target sequence. In said array a target sequence-specific second primer is used, which is not sequence variant specific.
[1174] Array 2 (P2): polymorphic locus (N2) of the target sequence overlays the first primer (first region) and the activator oligonucleotide (second region). Said components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variants of the said target sequence. In said array, a target sequence-specific second primer is used, which is not sequence variant specific. Array P2 differs from P1 mainly in that N2 can be located predominantly in the 3-terminal sequence segment of the first primer or even comprises the 3-terminal nucleotide. This may result in a further increase in the specificity of the amplification.
[1175] Array 3 (P3): polymorphic locus (N2) of the target sequence overlays only the activator oligonucleotide (third region), wherein the corresponding sequence segment of the activator oligonucleotide is located in the 5-segment of the synthesized portion of the first region primer extension product. The activator oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In said array, a target sequence-specific first and second primer is used, which are not sequence variant specific. Due to the possible proximity of the second blocking unit, the binding of the activator oligonucleotide to the first primer extension product can be influenced by nucleotide modifications of the second blocking unit.
[1176] Array 4 (P4): polymorphic locus (N2) of the target sequence overlays only the activator oligonucleotide (third region). The activator oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In said array, a target sequence-specific first and second primer is used, which are not sequence variant specific. Said sequence segment of the activator oligonucleotide is located in 5 direction from the second blocking unit. Said segment of the activator oligonucleotide may comprise several DNA nucleotide monomers, e.g. from 5 to 30, wherein the N2 corresponding sequence segment may be flanked by at least 3 to 15 DNA nucleotide building blocks on both sides.
[1177] Array 5 (P5): polymorphic locus (N2) of the target sequence overlays the second primer and the activator oligonucleotide (third region). Said components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the said target sequence. The array can be designed so that the 3-terminal nucleotide of the second primer corresponds to the N2 locus. In said array, a target sequence-specific first primer is used, which is not sequence variant specific.
[1178] Array 6 (P6): polymorphic locus (N2) of the target sequence overlays the second primer and the activator oligonucleotide (third region, near the 5-end). Said components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the said target sequence. In said arrangement a target sequence-specific first primer is used, which is not sequence variant specific.
[1179] The design differences of individual elements also result in differences for the primer extension products synthesized during amplification.
[1180]
[1181]
[1182]
[1183]
[1184]
[1185]
[1186]
[1187] To increase the specificity, a competitor primer (P 5.1) is added to the reaction, which is capable of binding predominantly complementary to the sequence variants of the target sequence, the amplification of which must be suppressed. Due to complementary binding with such primer binding sites, a competitor primer can bind preferably and be extended by the polymerase. The resulting product blocks the single-stranded primer binding sites for an interaction of the first amplification primer. In certain embodiments, the 3-end of a competitor primer binds within the second blocking site of the activator oligonucleotide so that no extension of said primer can take place at the activator oligonucleotide. The competitor primer does not comprise a second region and thus cannot interact with the first region of the activator oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template with the participation of an activator oligonucleotide.
[1188]
[1189] To increase the specificity, a competitor primer (P 5.2) is added to the reaction, which is able to bind predominantly complementarily to the sequence variants of the target sequence whose amplification must be suppressed. Due to complementary binding with such primer binding sites, a competitor primer can bind preferentially to certain sequence variants (here designated N) and be extended by the polymerase. The resulting product blocks the single-stranded primer binding sites for an interaction of the first amplification primer.
[1190] In certain embodiments, the 3-end of a competitor primer binds within the second blocking site of the activator oligonucleotide, so that no extension of this primer can take place at the activator oligonucleotide. The competitor primer does not comprise a second region and thus cannot interact with the first region of the activator oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
[1191]
[1192] To increase specificity, a competitor primer (P 5.3 or P5.4) is added to the reaction, which is capable of predominantly complementary binding (N) to sequence variants of the target sequence, the amplification of which must be suppressed. Due to complementary binding with such primer binding sites, a competitor primer can bind preferentially to certain sequence variants (here designated N) and be extended by the polymerase. The resulting product blocks the single-stranded primer binding sites for an interaction of the first amplification primer.
[1193] In certain embodiments, the competitor-oligonucleotide-primer (P 5.3) is longer than the first region of the first oligonucleotide primer, so that its 3-end binds within the fourth blocking unit of the activator oligonucleotide (fourth blocking unit is composed analogously to the second blocking unit and blocks a primer extension at the activator oligonucleotide), so that no extension of said primer can take place at the activator oligonucleotide. The competitor primer can completely (P 5.3) or partially (P 5.4) cover the segment of the template that can bind P1.1 predominantly complementary. The competitor primer does not comprise a second region and thus cannot interact with the first segment of the activator oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template with the participation of an activator oligonucleotide.
[1194] Such an amplification can be performed alone or in combination, for example with a subsequent PCR.
[1195]
[1196] The starting nucleic acid 1.1 comprises (in 5-3 direction) the following segments: M1.Y, M1.5, M1.4, M1.3, M1.2, M1.1, M1.X
[1197] The first oligonucleotide primer comprises (in 5-3 direction) the following segments: the first region (P1.1.1) and the second region (P1.1.2).
[1198] The controller oligonucleotide (C1.1) comprises (in 5-3 direction) the following segments: the third region (C1.1.3), the second region (C1.1.2) and the first region (C.1.1.1).
[1199] The controller oligonucleotide (C1.2) comprises (in 5-3 direction) the following segments: the third region (C1.2.3), the second region (C1.2.2) and the first region (C.1.2.1).
[1200] The second primer P2.1 comprises (in 5-3 direction) the following segments: P2.1.1.
[1201] The second primer P2.2 comprises (in 5-3 direction) the following segments: P2.2.1.
[1202] The second primer P2.3 comprises (in 5-3 direction) the following segments: P2.3.1.
[1203] The first primer extension product (P1.1-Ext) comprises (in 5-3 direction) the following segments: P1.1E6, P1.1 E5, P1.1E4, P1.1E3, P1.1E2, P1.1E1.
[1204] The second primer extension product (P2.1-Ext) comprises (in 5-3 direction) the following segments: P2.1E5, P2.1E4, P2.1E3, P2.1E2, P2.1 E1.
[1205] The primer extension products P1.1-Ext and P2.1-Ext preferably obtained during the first amplification can form a complementary double strand and together represent the second amplification fragment 1.1, which can serve as starting nucleic acid 2.1 for the second amplification.
[1206] Wherein P1.1.1 can bind predominantly complementary to M1.1 and can be extended by the polymerase and P2.1.1 can bind complementary to P1.1 E1 and can be extended. P1.1-Ext and P2.1-Ext represent the nucleic acid to be amplified, which serves as start nucleic acid 2.1 for the second amplification. P2.1, P2.2 and P2.3 represent variants of second primers and lead to identical amplification fragments.
[1207]
[1208] The third oligonucleotide primer comprises (in 5-3 direction) the following segments: P3.1.2, P3.1.1, wherein P3.1.2 is not complementary to the start nucleic acid 1.1 or P2.1-Ext. P3.1.1 is essentially complementary to P2.1 E1 of P2.1-Ext.
[1209] The fourth oligonucleotide primer comprises (in 5-3 direction) the following segments: P4.1.2, P4.1.1, wherein P4.1.2 is not complementary to the complementary strand of the start nucleic acid 1.1 or to P1.1-Ext. P4.1.1 is essentially complementary to P1.1 E1 of P1.1-Ext.
[1210] The primer extension products P3.1-Ext and P4.1-Ext, preferably obtained during the second amplification, can form a complementary double strand and together represent the second amplification fragment 2.1.
[1211] P3.1-Ext comprises (in 5-3 direction) the following segments: P3.1 E7, P3.1 E6, P3.1 E5, P3.1 E4, P3.1 E3, P3.1 E2, P3.1 E1. Segments P3.1.E5 to P3.1 E3 are identical in sequence to P1.1 E4 to P1.1E2.
[1212] P4.1-Ext comprises (in 5-3 direction) the following segments: P4.1 E7, P4.1 E6, P43.1 E5, P4.1 E4, P4.1 E3, P43.1 E2, P4.1 E1. The segments P4.1.E5 to P4.1 E3 are identical in sequence to P2.1 E4 to P2.1 E2.
[1213]
[1214] The coupling of both amplifications using start nucleic acid chain synthesized by the method of the invention can be summarized as follows:
[1215] The method comprises the following steps:
[1216] A) Providing a nucleic acid fragment comprising a first target sequence (a start nucleic acid chain)
[1217] B) Providing an initial amplification system, comprising: [1218] A first oligonucleotide primer [1219] A second oligonucleotide primer [1220] A controller oligonucleotide [1221] A first polymerase [1222] Substrates for the first polymerase (dNTPs) and suitable buffer solution
[1223] C) Providing a second amplification system, comprising: [1224] A third oligonucleotide primer [1225] A fourth oligonucleotide primer [1226] A second polymerase comprising a thermostable polymerase [1227] Substrates for the second polymerase (dNTPs) and suitable buffer solution [1228] A detection system
[1229] D) Carrying out a first amplification using the start nucleic acid chain as initial template strand and the first amplification system, obtaining a first amplification fragment 1. 1 comprising the first target sequence, and comprising a first primer extension product and a second primer extension product which can form a complementary double strand, wherein the first primer extension product results from template-dependent extension of a first primer by a polymerase using the start nucleic acid chain and/or the second primer extension product as template and the second primer extension product results from template-dependent extension of a second primer by a polymerase using the first primer extension product as template, wherein the first and second primer extension products can mutually serve as templates for the respective primer extension, and
[1230] wherein both complementary strands of the first amplification product 1.1 can be at least partially converted into single-stranded form with the participation of a controller oligonucleotide, so that renewed primer binding to respectively complementary sequences of the synthesized primer extension products is possible, and
[1231] the reaction conditions used for the first amplification comprise at least one temperature step which permits hybridization and template-dependent primer extension of both primers of the first amplification system and comprise at least one temperature step in which the first primer extension product is separated from the second primer extension product with the participation of the controller oligonucleotide, wherein the reaction conditions used do not permit spontaneous separation of the first primer extension product from the second primer extension product in the absence of the controller oligonucleotide. Wherein the first amplification is carried out until the desired quantity of the first amplification product 1.1 is synthesized.
[1232] E) Performing a second amplification using at least one of the two strands of the first amplification fragment 1.1 as initial template strand and using the second amplification system to obtain a second amplification fragment 2.1 comprising a third primer extension product and a fourth primer extension product which can form a complementary double strand, wherein both strands of the amplification fragment 2. 1 can both serve as templates in a primer extension, wherein the reaction conditions used in the second amplification allow hybridization of the two primers of the second amplification system at least in one temperature step and template-dependent primer extension of the primer of the second amplification system respectively bound to complementary regions and allow separation of a double strand at least in one further temperature step, comprising a third primer extension product and a fourth primer extension product, wherein the third and fourth primer extension products are converted to single-stranded form such that another primer binding and extension can occur. Wherein the second amplification is carried out until the desired amount of the second amplification product 2.1 is synthesized.
[1233] In detail, the properties of components of the respective amplification system, the nucleic acid fragment comprising a first target sequence as well as the reaction conditions used determine the course of the two amplification reactions.
[1234] Generally, the first amplification takes place with the participation of the controller oligonucleotide. The separation of the two synthesized primer extension products takes place at least partially depending on the sequence composition of the first primer extension product and its complementarity to the composition of the controller oligonucleotide.
[1235] During the second amplification, a second amplification fragment 2.1 is amplified essentially without participation of the controller oligonucleotide.
[1236] In the course of both amplification reactions, both desired amplification products (Amplification Fragment 1.1 and Amplification Fragment 2.1) and their intermediate stages (intermediates) can be formed (
[1237] In the following, some molecular procedures and the resulting products and the potential intermediates are explained schematically and exemplarily.
[1238] According to a first aspect of the invention, a method for amplification is provided. The method comprises the following steps:
[1239] 1) a first amplification with the steps [1240] 1.A) Hybridizing a first oligonucleotide primer to the 3 segment of a template strand of a first nucleic acid to be amplified comprising a first target sequence, wherein the first oligonucleotide primer comprises the following regions: [1241] a first region which can bind sequence-specifically to the 3 segment of a template strand of the first nucleic acid to be amplified and is complementary to at least part of the target sequence; [1242] a second region contiguous to the 5 end of the first region or connected by a linker, wherein the second region can be bound by a controller oligonucleotide and remains essentially uncopied by a polymerase used for the first amplification under the selected reaction conditions; [1243] 1.B) Extension of the first oligonucleotide primer when hybridized to complementary segments of a first nucleic acid to be amplified by the first template-dependent polymerase to give a first primer extension product which comprises, in addition to the first oligonucleotide primer, a region synthesized by the polymerase, which is essentially complementary to the template strand of the first nucleic acid to be amplified, which comprises a first target sequence, wherein the first primer extension product and the template strand of the first nucleic acid to be amplified are essentially present as a double strand under reaction conditions used in the first amplification; [1244] 1.C) Binding of a controller oligonucleotide to the first primer extension product, wherein the controller oligonucleotide comprises the following regions: [1245] a first region that can bind to the second region of the first primer and/or the first primer extension product [1246] a second region which is essentially complementary or fully complementary to the first region of the first oligonucleotide primer and/or the first primer extension product, and [1247] a third region which is essentially complementary or fully complementary to at least part of the polymerase synthesized region of the first primer extension product; [1248] wherein the controller oligonucleotide does not serve as a template for primer extension of the first oligonucleotide primer, and [1249] the controller oligonucleotide comprises a sequence segment which is complementary or essentially complementary to a strand of the first nucleic acid to be amplified, and [1250] the controller oligonucleotide binds to the first region of the first segment of the primer extension product, and [1251] and the controller oligonucleotide binds to the second region of the first primer extension product, as well as at least partially to the synthesized region of the first primer extension product, thereby displacing complementary portions of the template strand of the first nucleic acid to be amplified; wherein the polymerase synthesized region of the first primer extension product comprising the segment of the first primer extension product complementary to the second oligonucleotide primer becomes single-stranded under reaction conditions [1252] 1.D) Hybridizing a second oligonucleotide primer to the single-stranded complementary segment of the first primer extension product, wherein the second oligonucleotide primer comprises a region which can hybridize sequence specifically to the synthesized region of the first primer extension product and comprises at least a portion of a target sequence [1253] 1.E) Extension of the second oligonucleotide primer by the first polymerase using the first primer extension product as template to obtain a second primer extension product which, in addition to the second oligonucleotide primer, comprises a region synthesized by the polymerase which comprises at least a portion of the first target sequence, wherein the first primer extension product and the second primer extension product form a first double-strand amplification product under reaction conditions of the first amplification; and; [1254] 1.F) Repeat the steps of the first amplification if necessary
[1255] 2) a second amplification with the steps (
[1272] wherein a detection system is added to the reaction mixture.
[1273] The extent of yields of individual products and intermediates depends on several factors. For example, higher concentrations of individual primers generally favor product/intermediate yields. Furthermore, the formation of products/intermediates can be influenced by the reaction temperature as well as by the binding/affinity of individual reactants to each other (affinity of the binding of individual primers to their complementary primer binding sites within template strands): generally, for example, longer oligonucleotides bind better than shorter oligonucleotides at higher temperatures, and the CG content can play a role as well in complementary sequence segments: CG-rich sequences also bind more strongly than AT-rich sequences at higher temperatures. Furthermore, modifications such as MGB or 2-amino-dA or LNA can increase the binding strength of primers to their respective complementary segments, which also results in preferential binding of primers at higher temperatures.
[1274] From this it can be deduced that by designing sequence segments of individual primer sequences it is possible to influence the yield of certain products/intermediates and thus to influence their enrichment during amplification.
[1275] Method for amplifying a nucleic acid (