HEPATITIS B VIRUS-DERIVED POLYPEPTIDE AND ANTI-VIRAL USE THEREOF
20210054029 ยท 2021-02-25
Inventors
Cpc classification
C12N2730/10122
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
A61K31/708
HUMAN NECESSITIES
C12N2730/10133
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Y207/07007
CHEMISTRY; METALLURGY
International classification
A61K31/708
HUMAN NECESSITIES
A61K38/16
HUMAN NECESSITIES
Abstract
A hepatitis B virus-derived polypeptide exhibits anti-viral effects not only on HIV-1 and HBV but also on all viruses by increasing the expression of type I interferon. The hepatitis B virus-derived polypeptide has a synergistic effect when co-administered with a conventional anti-viral agent. The hepatitis B virus-derived polypeptide is effectively usable in the treatment of virus-related diseases such as AIDS or liver diseases.
Claims
1. A polypeptide comprising of any one amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
2. The polypeptide of claim 1, wherein the polypeptide consists of the amino acid sequence of SEQ ID NO: 2.
3. The polypeptide of claim 1, wherein the polypeptide is an end-capped modified polypeptide.
4. The polypeptide of claim 1, wherein the polypeptide has anti-viral activity.
5. The polypeptide of claim 3, wherein the end-capped modified polypeptide comprises an N terminus end-capping, a C terminus end-capping, or both.
6. The polypeptide of claim 5, wherein the N terminus end-capping comprises an Acetyl and wherein the C terminus end-capping comprises an Amide.
7. An anti-viral pharmaceutical composition comprising the polypeptide of claim 1.
8. The pharmaceutical composition of claim 7, wherein the virus is at least one selected from the group consisting of adenovirus, smallpox virus, polio virus, measles virus, severe fever with thrombocytopenia syndrome virus, influenza virus, hepatitis C virus, human immunodeficiency virus-1 (HIV-1), and hepatitis B virus (HBV).
9. The pharmaceutical composition of claim 7, wherein the polypeptide has anti-viral activity, and the virus is at least one selected from the group consisting of HIV-1 and HBV.
10. The pharmaceutical composition of claim 7, further comprising an anti-viral agent.
11. The pharmaceutical composition of claim 10, wherein the anti-viral agent is at least one selected from the group consisting of acyclovir, famciclovir, valacyclovir, ganciclovir, amprenavir, abacavir, ansamycin, cidofovir, darunavir, delavirdine, efavirenz, etravirine, famciclovir, hypericin, indinavir, lamivudine, lobucavir, nelfinavir, nevirapine, novaferon, ritonavir, saquinavir, stavudine, tipranavir, virazole, ribavirin, zalcitabine, zidovudine, maraviroc, raltegravir, elvitegravir, didanosine, tenofovir, emtricitabine, lopinavir, atazanavir, enfuvirtide, clevudine, entecavir, and adefovir.
12. The pharmaceutical composition of claim 7, wherein the polypeptide suppresses viral replication.
13. The pharmaceutical composition of claim 7, wherein the polypeptide inhibits acetylation of HIV-1 integrase to inhibit activity of the HIV-1 integrase.
14. The pharmaceutical composition of claim 7, wherein the polypeptide increases mitochondrial reactive oxygen species in cells.
15. The pharmaceutical composition of claim 7, wherein the polypeptide increases type I interferon (IFN-I) expression.
16. The pharmaceutical composition of claim 7, wherein the polypeptide inhibits HBV HBcAg or nucleocapsid synthesis.
17. A method of preventing or treating viral infection diseases and symptoms related thereto, the method comprising administering the pharmaceutical composition of claim 7 to an individual in need thereof.
18. The method of claim 17, wherein the viral infection diseases are selected from an acquired immune deficiency syndrome (AIDS) caused by viral infection and a liver disease caused by viral infection.
19. The method of claim 18, wherein the AIDS is caused by HIV1 infection.
20. The method of claim 18, wherein the liver disease is at least one selected from the group consisting of hepatitis, cirrhosis, and liver cancer.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
DETAILED DESCRIPTION
[0082] Current available therapeutic agents for chronic hepatitis include interferons, which are immunomodulators, lamivudine, which is a nucleoside analogue, etc. Among them, interferon-, the efficacy of which has been recognized in the last decade, has the disadvantages of being expensive, having side effects, and being less effective in Asian patients who have problems with infection immediately after birth. Other therapeutic agents, nucleoside analogues, have the advantage of being orally administered. However, since nucleoside analogues act on DNA polymerase and inhibit viral replication, there are problems in that they do not act directly on non-replicative viruses, making it difficult to completely remove HBV from the body, and resistance develops, etc.
[0083] In view of this technical background, there is a need to develop new therapeutic agents that are able to alleviate AIDS or liver diseases through anti-HIV-1 and anti-HBV effects.
[0084] Hereinafter, the present disclosure will be described in more detail with reference to exemplary embodiments. However, these exemplary embodiments are only for illustrating the present disclosure, and the scope of the present disclosure is not limited to these exemplary embodiments.
EXAMPLE
Example 1. Examination of Anti-HIV-1 Efficacy
[0085] Reference Example Statistical Analysis
[0086] Statistical comparisons between control and experimental groups were analyzed using one-way ANOVA. The p value of statistical significance was set as follows: p<0.05 (*), 0.01 (**), or 0.001 (***). All experiments were independently repeated three times.
Experimental Example 1. Identification of HBV Polymerase-Derived Peptide Having Anti-HIV-1 Effects
[0087] In this Experimental Example, it was examined whether an HBV polymerase-derived peptide has anti-HIV-1 effects. In detail, since deletion of 15, 18, and 21 nucleotides at the preS1 start in hepatitis B virus of chronic patients with genotype C2 infection may contribute disease progression by regulating viral replication, three kinds of candidate peptides were selected from polymerase regions corresponding to deletion of 15, 18, and 21 nucleotides in this Experimental Example. These peptides were called Poly5 (GRLVF, SEQ ID NO: 1), Poly6 (GRLVFQ, SEQ ID NO: 2), or Poly7 (GRLVFQT, SEQ ID NO: 3) (
[0088] After washing cells with PBS, infected cells were treated with dimethyl sulfoxide (DMSO), azidothymidine (AZT; 3-azido-3-deoxythymidine), and Poly5 to Poly7. In this regard, DMSO and AZT were purchased from Sigma-Aldrich. After 2 days of incubation, GFP images were obtained using a fluorescence microscope. The relative GFP intensity was determined using an ImageJ software program (National Institutes of Health) in pixels per area. The supernatant and cells were collected and subjected to RNA extraction, and then RT-qPCR was performed to determine viral titers. To measure virus in the supernatant, p24 ELISA was used. Cell viability against the treated reagents was assessed by an MTT assay.
[0089] To examine the role of HSP90 (cell signaling) in the antiviral effects of Poly5 to Poly7, MT-4 cells were infected with HIV-1 for 1 hr, and then treated with an HSP90 antibody (1 g/ml) or 17-AAG (Calbiochem, 1 M) for 1 hr to block HSP90 activity. Cells were treated with DMSO, AZT, or Poly6 and incubated for 48 hr. HIV-LTR-dependent synthesis of GFP was confirmed by Western blotting using a GFP antibody (Santa Cruz Biotechnology).
[0090] HIV-1-infected MT-4 cells were treated with DMSO (0.5%), AZT (5 nM), or each 10 M of three kinds of candidates, and 2 days later, GFP imaging and p24 ELISA were performed to examine HIV-1 titers. As a result, it was confirmed that virus production was reduced by Poly5 and Poly7, and in particular, considerably reduced by Poly6 (
Experimental Example 2. Cytotoxicity Assay
[0091] In this Experimental Example, prior to examination of the effect of Poly6, cytotoxic effects of Poly6 was analyzed to exclude the possibility that Poly6 affects HIV-1 replication due to its nonspecific cytotoxicity. In detail, MT-4 cells were prepared at a density of 110.sup.4 cells, and incubated with varying concentrations of Poly6 for 5 days. Cytotoxicity was determined using an MTT assay kit (Promega). To analyze the anti-cytotoxic effect of Poly6 from cell death caused by cytotoxicity due to HIV-infection, MT-4 cells (110.sup.4 cells) were infected with HIV-1 (110.sup.4 CCID.sub.50), incubated for five days, and then subjected to cell viability assays. In addition, to determine HIV-1 titers in the supernatant, p24 ELISA was performed. As a result, Poly6 did not exert significant cytotoxic activity against MT-4 cells up to 25 M for 5 days (
Experimental Example 3. Examination of HIV-1 Replication-Inhibitory Effect in Human Peripheral Blood Mononuclear Cells (PBMCs)
[0092] In this Experimental Example, the anti-HIV-1 effect of Poly6 was examined in Ex-vivo. In detail, PBMCs were infected with HIV-1. Human PBMCs were separated using Biocoll (BIOCHROME), and PBMCs were incubated in an RPMI1640 medium supplemented with 10% FBS and 1 g/ml phytohemaggulutinin (PHA; Sigma-Aldrich), and IL-2 (100 U/ml; PEPROTECH) for 3 days. PHA-stimulated PBMC cells were infected with HIV-1 at a multiplicity of infection (MOI) of 0.1, and treated with reagents, followed by incubation for 5 days. To determine the viral titers in PBMCs, viral RNAs were isolated from cells, and analyzed by RT-qPCR as described. GFP expression was observed using a fluorescence microscope, and Western blot analysis was performed using a GFP antibody.
[0093] At this time, to determine HIV-1 viral titers, p24 ELISA (ABL, Rockville, Md.) was conducted according to the manufacturer's protocol. HIV-1 RNAs from cell culture supernatants and cells were purified using a QIAamp UltraSens Virus kit (QIAGEN), and quantitated by RT-qPCR using primers specific to Gag region of HIV-1. Glyceraldehyde phosphate dehydrogenase (GAPDH) was used as a reference gene for normalization. Primers such as GagF, GCAGCCATGCAAATGTTAAAAGAG (forward, SEQ ID NO: 4) and GagR, TCCCCTTGGTTCTCTCATCTGG (reverse, SEQ ID NO: 5) and GAPDH-F, AATCCCATCACCATCTTCCA (forward, SEQ ID NO: 6), and GAPDH-R, TGGACTCCACGACGTACTCA (reverse, SEQ ID NO: 7) were used in RTqPCR. An HIV-1 Genesig Standard kit (Primer design) was used to calibrate the viral titers.
[0094] PBMC cells were infected with HIV-1, and then incubated in the presence of DMSO (0.5%), AZT (5 nM), Raltegravir (10 nM), or Poly6 (10 M) for 5 days. It was confirmed that, as compared with DMSO, GFP and p24 protein expression in PBMC cells was significantly reduced by Poly6 in the similar level to those in AZT or Raltegravir (
Experimental Example 4. Examination of HIV-1 Integration-Inhibitory Effect
[0095] In this Experimental Example, to analyze integration of HIV-1 DNA into the host genome, 2-long terminal repeat (2-LTR) and Alu PCR were performed. In detail, 2-LTR PCR was used to detect circular viral DNA that was left unintegrated in the cell cytoplasm, and Alu PCR was performed to amplify the integrated viral DNA. Reagents were treated for 48 hr, and then viral DNA was extracted from HIV-1-infected MT-4 cells using a QIAamp MinElute Virus Spin Kit (QIAGEN). As primers and probes for 2-LTR PCR analysis, 2-LTR F (MH535), AACTAGGGAACCCACTGCTTAAG (forward, SEQ ID NO: 8), 2-LTR R (MH536), TTCACAGATCAAGGATATCTTGTC (reverse, SEQ ID NO: 9) and FAM-ACACTACTTGAAGCACTCAA-TAMRA (SEQ ID NO: 10) as a 2-LTR probe were used, and Alu-1F, TCCCAGCTACTCGGGAGGCTGAGG (forward, SEQ ID NO: 11) and Alu-1R, CCCTAGTTAGCCAGAGAGCTCCCA (reverse, SEQ ID NO: 12) and secondary Alu PCR forward primer, Alu-2F, ACAGCCTCCTAGCATTTCGT (forward, SEQ ID NO: 13), Alu-2R, AGCGGAAAGTCCCTTGTAGA (reverse, SEQ ID NO: 14) and FAM-AGCATGGGATGGAGGACCCG-TAMRA (SEQ ID NO: 15) as an Alu PCR probe were used.
[0096] In this Experimental Example, to reveal a mechanism of integration inhibition by Poly6, Western blot and immunoprecipitation assay were performed using integrase and a p300 antibody (Santa Cruz Biotechnology). For immunoprecipitation assay, MT-4 cells were infected with HIV-1 for 1 hr, and then treated with DMSO (0.5%), AZT (5 nM), Raltegravir (10 nM), or Poly6 (10 M) for 48 hr. Cells were lysed by treatment with RIPA (Abcam) buffer, and then the whole lysate was washed in advance with 10 l of Protein A/G PLUS-Agarose (sc2003, Santa Cruz) and the supernatant was collected. The supernatant was incubated with 20 g of the antibody for 1 hr at 4 C., and then 10 l of Protein A/G PLUS-Agarose was added thereto, followed by incubation overnight at 4 C. while rotating at 360. After the final wash, immunoprecipitates were collected and the resulting precipitates were loaded for Western blot analysis.
[0097] Meanwhile, when MT-4 cells are infected with HIV-1, HIV-1 replication proceeds through several stages. Newly developed anti-HIV-1 reagents have several mechanisms of action, because there are several stages in the HIV-1 life cycle, such as viral attachment, integration, transcription, or viral synthesis. Accordingly, to further delineate the underlying mechanism of HIV-1 inhibition by Poly6, a time-of-addition (TOA) study was performed using Poly6 and several anti-HIV-1 drugs capable of suppressing different stages of the HIV-1 life cycle in MT-4 cells, such as AZT (reverse transcriptase inhibition), raltegravir (integrase inhibition), ritonavir, T20 (inhibition of virus emergence), etc. At this time, T-20, raltegravir and ritonavir were obtained through the NIH/AIDS Research and Reference Reagent Program (NIH). TOA assay showed that the inhibition of HIV-1 replication by each reagent was well represented to a time point corresponding to the replication step targeted by the drugs, and Poly6 started to lose drug efficacy at the time point between 6 hr and 8 hr (
Experimental Example 5. Detailed Examination of Mechanism of HIV-1 Inhibition by Poly6
[0098] This Experimental Example was performed to demonstrate TOA data regarding HIV-1 integrase inhibition by Poly6. In detail, integrase circle formation was detected in HIV-1-infected MT-4 cells using Alu PCR and 2-LTR PCR. It is known that when HIV-1 cDNA enters the nuclei of cells, but integration does not occur, HIV-1 cDNA itself replicates to form 2-LTR circle. Unlike Raltegravir which is an integrase inhibitor, the level of 2-LTR circle was increased by Poly6, and the number of integrated cDNA was remarkably reduced in HIV-1-infected MT-4 cells (
[0099] Taken together, these results indicate that HIV-1 activity inhibition of Poly6 occurs by inhibiting acetylation of integrase by p300.
Example 2. Examination of Anti-HBV Efficacy
Experimental Example 1. Identification of HBV Polymerase-Derived Peptides Having Anti-HBV Effects and Analysis of Cell Viability
[0100] In this Experimental Example, HBV polymerase-derived peptides having anti-HBV effects were identified, and cell viability upon treatment thereof was analyzed. To evaluate anti-viral effects of the above-described three candidate peptides, Poly5 (GRLVF, SEQ ID NO: 1), Poly6 (GRLVFQ, SEQ ID NO: 2), or Poly7 (GRLVFQT, SEQ ID NO: 3,
TABLE-US-00001 TABLE1 TaqManProbe SEQ Sequences(5-FAMto ID Name TAMRA-3) Position NO. cccProbe CCTAATCATCTC 1834-1853 16 ATGTTCAT 3.5-pgProbe CCTTGGACTCAT 2457-2472 17 AAGG GAPDHprobe CCTGGCCAAGGTCAT 18 CCATGACAACTT
[0101] As a result, s antigen and e antigen were reduced in all of the groups treated with Poly5, Poly6 or Poly7 for 48 hr, and the most prominent antigen-reducing effect was observed in the Poly6-treated group, as comparing various concentrations. When treated for 24 hr, significant envelope antigen-reducing effect was observed only in the Poly6-treated group, as compared with ETV (
[0102] In this Experimental Example, prior to examination of anti-viral effect of Poly6, cell viability by Poly6 was observed to examine the possibility that Poly6 affects HBV replication due to its non-specific cytotoxicity.
[0103] In detail, HepG2, HepG2.2.15, and HepG2-hNTCP-C4 cells (expressing NTCP receptors on the cell membrane) were plated in a 96 microplate (110.sup.4 cells/well), and incubated for 5 days with increasing concentrations of ETV (30 nM) and Poly6. For an MTS assay, a cell-titer 96 aqueous one solution was directly added to each well, and the plate was incubated for 3 hr. The plate was read at 490 nm, and each analysis was repeated in triplicate. At this time, for HBV infection analysis, HepG2.2.15 cell supernatant containing 2% DMSO was collected every three days for 15 days, and virions were precipitated with 6% PEG8000 on ice for 1 hr, and concentrated using a ultra-centrifuge at 4 C. and 100,000 g for 3 hr The pellets were re-suspended in 1PBS containing 10% FBS, and then stored at 80 C. until use. Cells were seeded in a 6-well plate, and infected at 810.sup.4 GEq/cell in the presence of 4% PEG8000 overnight. Next day, the cells were washed with PBS three times, and treated with PBS (0.5%), ETV (30 nM), or Poly6 (10 M) for 5 days until analysis.
[0104] As a result, Poly6 did not exert significant cytotoxic activity against HepG2, HepG2.2.15, and HepG2-hNTCP-C4 cells up to 10 M as time passed, and did not affect cell viability (
Experimental Example 2. Examination of Anti-Viral Efficacy of Poly6 in In-Vitro System
[0105] Chronic HBV infection is known to cause severe liver diseases such as cirrhosis and hepatocellular carcinoma, unlike acute infection. Therefore, it is important to develop anti-HBV drugs that overcome chronic infections. However, since the HBV genome is integrated into the host chromosome, the complete removal of the virus from human liver and serum remains a difficult problem. Therefore, in this Experimental Example, to evaluate the anti-viral effect of Poly6, HepG2.2.15 permanent cell line that continuously expresses HBV was treated with Poly6. Further, HepG2 cells were seeded in a 6-well plate, and then transiently transfected with pHBV-1.2-WT. HepG2 cells having pHBV-1.2-WT or HepG2-2.15 cells were treated with PBS (0.5%), ETV (30 nM), or Poly6 (10 M) for 24 hr or 48 hr, and then supernatants and pellets were used to perform various analyses. To measure secreted HBsAg and HBeAg in culture supernatants, HBsAg (BIOKIT) and HBeAg (AccuDiag) ELISA were performed according to experimental methods provided. For detection of 8-hydroxy-2-deoxyguanosine (8-OHdG) activity, an 8-OHdG assay kit (OxiSelect Oxidative DNA Damage ELISA kit, Cell Biolabs) and ELISA were performed according to the manufacturer's protocol.
[0106] As a result, after treatment with PBS, ETV, and Poly6 for 2 days, a statistically significant reduction in extracellular HBsAg and HBeAg levels was observed in the Poly6-treated group, and viral replication levels were more remarkably reduced by Poly6. Viral replication was also reduced by ETV, but there was no statistical significance between ETV and PBS (
[0107] To measure extracellular virion secretion, Southern blot analysis was performed. In detail, before ultra-centrifugation at 4 C. and 24,000 rpm for 3 hr, cell debris was removed, and virions were precipitated from the supernatant using 8% PEG6000 (Sigma) on ice for 1 hr. Pellets were harvested with PBS, and HBV DNA was collected using a QIAamp DNA mini kit (QIAGEN) according to the manufacturers instructions. Viral DNA was measured using quantitative real-time PCR (Q-PCR). PCR amplification was performed using a QPCR primer set targeting a small surface gene, which is designed to amplify an a101-bp product (Table 2). Q-PCR was performed using a commercial SensiFAST SYBR Lo-ROX kit (BIOLINE) and an HBV Genesig standard kit (Primer design) to calibrate a viral load. In addition, to detect extracellular HBV DNA, supernatants were collected and HBV particles were precipitated using 6% PEG8000 (Sigma) as described above. Virus pellets were collected from PBS and DNA was extracted with a lysis buffer (0.25% SDS, 250 mM Tris-HCl, pH 7.4 and 250 mM EDTA). Purified HBV DNA was separated on a 1% agarose gel, transferred to a nylon membrane (Hybond N+; Amersham) by Southern blotting, and hybridized with a 32P-labeled wild-type, full length HBV DNA probe. Analysis was performed using a random primer DNA labeling kit (TaKaRa). Autoradiography was performed and analyzed using a BAS 2500 image analyzer (Fuji Photo Film).
TABLE-US-00002 TABLE2 Primer SEQ ID Name Sequences(5to3) Position NO. Real-SF TTGACAAGAATCCTCACAATACC 218-240 19 Real-SR GGAGGTTGGGGACTGCGAAT 309-328 20 m18S-F CGCGGTTCTATTTTGGTTT 21 m18S-R TTCGCTCTGGTCCGTCTTG 22 hIFN--F TTGTGCTTCTCCACTACAGC 23 hIFN--R CTGTAAGTCTGTTAATGAAG 24 hIFN--F GACTCCATCTTGGCTGTGA 25 hIFN--R TGATTTCTGCTCTGACAACCT 26 hISG15-F AGCTCCATGTCGGTGTCAG 27 hISG15-R GAAGGTCAGCCAGAACAGGT 28 hRIG-I-F GGACGTGGCAAAACAAATCAG 29 hRIG-I-R GCAATGTCAATGCCTTCA 30 hTNF--F GGAGAAGGGTGACCGACTCA 31 hTNF--R CTGCCCAGACTCGGCAA 32 mIFN--F CACAGCCCTCTCCATCAACT 33 mIFN--R TCCCACGTCAATCTTTCCTC 34 m18S-F CGCGGTTCTATTTTGGTTT 35 m18S-R TTCGCTCTGGTCCGTCTTG 36
[0108] As a result, in the Southern blot analysis, extracellular virion secretion was clearly decreased in Poly6 and ETV, as compared with PBS conditions (
Experimental Example 3. Specific Examination of Mechanism of HBV Inhibition of Poly6
[0109] In this Experimental Example, the antiviral mechanism of Poly6 in cells was examined through analysis of nucleocapsid expression, measurement of mitochondrial reactive oxygen species, and experiment of IFN-1.
[0110] In detail, as a result of performing Western blot analysis with an anti-HBc antibody (Dako, Agilent Tech), it was confirmed that HBcAg and capsid were significantly reduced in the Poly6-treated group, as compared with the PBS or ETV-treated group. Even when this was quantified using the Image J program, statistical significance was confirmed (
[0111] It has been revealed that when a reagent is absorbed into a cell and oxidative stress is induced, various reactions including proliferation, cell death, or antiviral effects may be caused by expressing cell factors such as IFN-I. Accordingly, to reveal the mechanism of antiviral effect by oxidative stress-mediated action of Poly6, pHBV-1.2-wild type transfected HepG2 cells or HepG2.2.15 cells were seeded on a 6-well culture plate at a density of 410.sup.5 cells/well for 24 hours, and treated with PBS, ETV, or Poly6. After culturing the cells for an appropriate time, the cells were incubated with 5 M of MitoSox (Molecular probes) at 37 C. for 30 min. For flow cytometry, cell pellets were re-suspended in FACS buffer (1% FBS and 1 mM EDTA in PBS) and fixed with 4% paraformaldehyde. To prevent mitochondrial dysfunction, 10 M of MitoTempo (SigmaAldrich) was pretreated for 12 hr, and 0.5 M of rotenone (SigmaAldrich) reagent was used as a positive control for ROS induction through mitochondrial stress.
[0112] As a result, production of reactive oxygen species (mtROS) by mitochondrial stress in HepG2 cells was significantly increased from 2 hr to 24 hr in the rotenone or Poly6-treated group, as compared with PBS (
[0113] IFN-I is induced by host cells to regulate viral infection (Stetson & Medzhitov, 2006). Therefore, to examine the effect of Poly6 on IFN-I production in HepG2-2.15 cells and mouse liver, mRNA levels of IFN-, RIG-I, and ISG15 were examined.
[0114] As a result, it was observed that mRNA levels of IFN-, RIG-I, and ISG15 were significantly increased in the Poly6-treated group, as compared with the PBS group, and no statistical significance was observed in the entecavir-treated group (
[0115] On the other hand, the interaction between interferons and receptors was blocked through a neutralizing type I interferon receptor, and to investigate a change in the anti-HBV effect by Poly6, receptor activation was blocked by treating with a neutralizing antibody at 2 hr before PBS, ETV, or Poly6 treatment, followed by incubation. After incubation for 48 hr after treatment with each material, the anti-HBV effect was evaluated by ELISA and qPCR. As a result, it was confirmed that the HBeAg level reduced by Poly6 in GAPDH antibody treatment significantly increased again by blocking the IFN receptor, and it was confirmed that the HBV DNA level was also recovered to the level of the PBS-treated group (
[0116] In conclusion, the above results demonstrated that Poly6 stimulates IFN- through IFN-I pathway by increasing mitochondrial reactive oxygen species in cells, thereby inhibiting HBV replication while inhibiting HBcAg and protein envelope.
Experimental Example 4. Examination of Anti-Viral Efficacy of Poly6 in In-Vivo System
[0117] To examine the effect of Poly6 in a mouse model (in vivo), this experimental example was performed. First, to establish a transformed mouse model, transgenic mice expressing mutant HBV W4P were generated in Macrogen, and mice were randomly raised and maintained under the germ-free conditions in Macrogen. The experimental animals were stored in a specific pathogen free laboratory animal center. Briefly, PMSG (7.5 IU) and hCG were intraperitoneally injected into C57BL/6N female mice every 48 hr (5 IU) for 5 weeks to 8 weeks for superovulation. After injection, these female mice were crossed with C57BL/6N male mice. Next day, female mice with vaginal plugs were sacrificed, and fertilized embryos were harvested. The HBV W4P full genome was co-microinjected into one-cell embryo in accordance with standard microinjection procedures for transgenic mouse production (Macrogen). After directly injecting HBV DNA (4 ng/l) for microinjection into sperm nuclei using a microinjector, the microinjected embryos were incubated at 37 C. for 1 hr to 2 hr. 14 to 16-injected one-cell stage embryos were surgically implanted into the oviduct of pseudopregnant recipient mice (ICR). After F0 was born, genotyping was performed using tail cut samples for the presence of transgenes, and genomic DNA PCR screening through a phenol extraction method was confirmed by PCR analysis.
[0118] Then, Poly6 (50 g/kg) and 3TC (Lamivudine, Sigma-Aldrich, 500 g/kg) were intravenously administered to a transgenic mouse model expressing HBV virions containing a mutant W4P in the preS1 region (Genotype A, pHY92-W4P) twice a week. HBV DNA and HBsAg levels were measured in mouse sera through orbital sinus blood collection at 4 weeks and 8 weeks.
[0119] As a result, the HBsAg levels in the sera of mice injected with Poly6 and 3TC were similar to those of mice injected with PBS at 4 weeks, but the HBsAg levels were significantly decreased at 8 weeks in Poly6, as compared with 3TC (
[0120] Taken together, these results indicate that Poly6 affects in vivo transgenic mouse model system in which HBsAg and HBV virion levels are decreased.
Experimental Example 5. Synergistic Effect on IFN-1 Increase by Combination Treatment of Poly6 and Entecavir, and Anti-HBV Effect Thereby
[0121] Through the combination treatment of entecavir, which is currently used as an HBV anti-viral agent having a mechanism whereby activity of HBV polymerase in the nucleus is inhibited and converted to a phosphorylated form, and Poly6, which was confirmed to increase IFN-I, its anti-HBV effect and synergistic effect of IFN-I increase were examined. HepG2-2.15 cells were incubated at a density of 510.sup.5 cells/well on a 6-well culture plate for 24 hr, and treated with PBS, ETV, or Poly6 alone or in combination of two substances. After incubating the cells for 48 hr, supernatants were collected, and subjected to ELISA, qPCR, and LDH assay.
[0122] As a result, when ETV or Poly6 alone was treated, the extracellular HBV DNA levels were statistically significantly reduced, as compared with PBS, but the combination treatment of two substances showed more significant reduction effects, and a significant difference was also observed, as compared with single treatment groups (
[0123] On the other hand, LDH levels were measured to examine non-specific cytotoxicity levels by single or combination treatment of the substances. No significant difference was observed, as compared with the control group, indicating no cytotoxicity (
[0124] Meanwhile, to examine a synergistic effect of the combination treatment of two substances with respect to the increase level of IFN-I, mRNAs of single treatment groups and combination treatment groups were extracted, and IFN-, IFN-, and TNF- expression levels were observed. As a result, it was confirmed that the mRNA level associated with IFN-1 was significantly increased in the combination treatment groups, as compared with the single treatment groups (
[0125] The above results demonstrated that the combination treatment of entecavir and Poly6 shows the synergistic effect on IFN-I increase and the anti-viral effect against HBV, and therefore, a synergistic effect on inhibition of liver diseases is expected, when administered in combination.