Temperature-sensitive attenuated FMDV strains, construction method and application thereof

Abstract

A temperature-sensitive attenuated FMDV strain, construction method and applications thereof. The construction method of the temperature-sensitive attenuated FMDV strain is as follows. Mutating a cytosine on K region loop of IRES domain 4 of an FMDV genome to a guanine or an adenine to obtain the temperature-sensitive attenuated FMDV strain, or replacing a K region of IRES domain 4 of an FMDV genome with a K region of IRES domain 4 of a bovine rhinovirus genome to obtain the temperature-sensitive attenuated FMDV strain.

Claims

1. A construction method of a temperature-sensitive attenuated FMDV strain, comprising: constructing a FMDV full-length cDNA infectious cloning plasmid, performing a site-directed mutagenesis to an IRES region of the FMDV full-length cDNA infectious cloning plasmid, obtaining a FMDV genomic RNA by in vitro transcription, and transfecting the FMDV genomic RNA into cells and culturing the cells containing the FMDV genomic RNA at temperatures to rescue the temperature-sensitive attenuated FMDV strain; wherein a cytosine at 351-site on K region loop of IRES domain 4 of the FMDV genomic RNA obtained by the in vitro transcription is mutated to a guanine or an adenine during the site-directed mutagenesis, a base sequence of the K region loop after mutation is .sup.351GUUUAA.sup.356 or .sup.351AUUUAA.sup.356.

2. A temperature-sensitive attenuated FMDV strain obtained by the construction method according to claim 1, wherein a microbial deposit number of a full-length cDNA infectious cloning plasmid for rescuing the temperature-sensitive attenuated FMDV strain is: CGMCC NO.13148.

3. A mutant IRES contained in the temperature-sensitive attenuated FMDV strain according to claim 2, wherein the mutant IRES has the nucleotide sequence of SEQ ID No: 1.

4. A construction method of a temperature-sensitive attenuated FMDV strain, comprising: constructing a FMDV full-length cDNA infectious cloning plasmid, obtaining a FMDV genomic RNA by in vitro transcription, and transfecting the FMDV genomic RNA into cells to rescue the temperature-sensitive attenuated FMDV strain; wherein an IRES domain 4 of the FMDV genomic RNA obtained by the in vitro transcription is replaced with an IRES domain 4 of a bovine rhinovirus genomic RNA.

5. A temperature-sensitive attenuated FMDV strain obtained by the construction method according to claim 4, wherein a microbial deposit number of a full-length cDNA infectious cloning plasmid used for rescuing the temperature-sensitive attenuated FMDV strain is: CGMCC NO.13149.

6. A chimeric IRES sequence obtained by replacing an IRES domain 4 of a foot-and-mouth disease virus genomic RNA with an IRES domain 4 of a bovine rhinovirus genomic RNA, wherein the chimeric IRES sequence has the nucleotide sequence of SEQ ID No: 2.

7. A construction method of a temperature-sensitive attenuated FMDV strain, comprising: constructing a FMDV full-length cDNA infectious cloning plasmid, obtaining a FMDV genomic RNA by in vitro transcription, and transfecting the FMDV genomic RNA into cells to rescue the temperature-sensitive attenuated FMDV strain; wherein a K region of an IRES domain 4 of the FMDV genomic RNA obtained by the in vitro transcription is replaced with a K region of IRES domain 4 of a bovine rhinovirus genomic RNA.

8. A temperature-sensitive attenuated FMDV strain obtained by the construction method according to claim 7, wherein a microbial deposit number of a full-length cDNA infectious cloning plasmid used for rescuing the temperature-sensitive attenuated FMDV strain is: CGMCC NO.13150.

9. A chimeric IRES sequence obtained by replacing a subdomain K of FMDV IRES domain 4 with a subdomain K of IRES domain 4 of a bovine rhinovirus, wherein the chimeric IRES sequence has the nucleotide sequence of SEQ ID No: 3.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a graph showing test results of the virulence of IRES domain 4 chimeric virus FMDV(R4) in suckling mice.

(2) FIG. 2 is a graph showing one-step growth curves of IRES chimeric virus FMDV(R4) and its parental virus at different temperatures.

(3) FIG. 3 is a graph showing one-step growth curve of IRES domain 4 subdomain chimeric FMDV mutant.

(4) FIG. 4 is a graph showing one-step growth curves of IRES chimeric FMDV mutants rK(Stem) and rK(Loop).

(5) FIG. 5 is a graph showing one-step growth curves of IRES site-directed mutagenesis FMDV mutants rC351G and rC351A.

(6) FIG. 6 is a graph showing the genetic stability (A) and temperature sensitivity (B) of the IRES chimeric and site-directed FMDV mutants in BHK-21 cells.

(7) FIG. 7 is a graph showing the virulence of temperature-sensitive FMDV mutant in suckling mice.

(8) FIG. 8 is a graph showing the temperature sensitivities (A and B) in cells and virulence (C and D) in suckling mice of the type-A and type-Asia1 FMDV IRES C351G mutants thereof.

(9) FIG. 9 is a graph showing the analysis of the IRES C351G mutant-mediated translation initiation efficiency: the IRES-mediated translation efficiency (A) is detected by using a replicon system; the expression amount of VP2 protein and virus titers are detected in the BHK-21 cells (B) and IBRS-2 cells (C) infected with the virus.

(10) FIG. 10 is a graph showing test results of the virulence of the several temperature-sensitive attenuated strains and wild-type parental viruses FMDV(WT) in the inoculated pigs.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(11) The present invention will be further described below with reference to the specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, it should be understood that the embodiments are merely illustrative rather than intended to limit the scope of the present invention. It should be understood by thoseof ordinary skill in the art that the details and forms of the present invention may be modified or substituted without departing from the spirit and scope of the present invention, however, such modifications or substitutions fall within the scope of the present invention.

(12) 1. Materials and Methods

(13) 1.1 Cells, Vectors and Viruses

(14) BHK-21 cells and IBRS-2 cells were cultured at 37 C. under the condition of containing 5% CO.sub.2, and the culture medium was DMEM containing 10% foetal bovine serum (FBS). pOK-12 vector was a generous gift from the Messing (1991); type-O FMDV O/YS/CHA/05 strain (GenBank accession number: HM008917) and the infectious cDNA clone pYS of the virus can be obtained by the method disclosed in the literature (Chinese Patent Publication No.: CN101838658A (ZL201010160669.9)); an infectious cDNA clone of the type-Asia 1 FMDV Asia1/YS/CHA/05 strain (GenBank accession number: GU931682) can be obtained by the method disclosed in the literature (Chinese Patent Publication No. CN101724636A (ZL200810171258.2)); type-A FMDV A/VN/03/2009 strain (GenBank accession number: GQ406249) was kept by the inventor's laboratory.

(15) 1.2 Primers

(16) According to the bovine rhinovirus IRES gene sequence (GenBank accession number: EU236594) and the genomic sequence of the FMDV O/YS/CHA/05 strain, the primers (Tab. 1) used to amplify different domains in IRES of two viruses and site-directed mutagenesis primers (Tab. 2) were designed and were synthesized in Shanghai Yingjun Biotechnology Co., Ltd.

(17) TABLE-US-00001 TABLE1 PrimersforconstructingIRES chimericvirusandsequencesthereof Primer Sequence(5.fwdarw.3) Sequence(5.fwdarw.3) 4N-1:U SEQIDNO:4 CGCAGATCTTAATACGACTCACTATAGG TTGAAAGGGGGCGTTAGGGTCTC 4N-1:L SEQIDNO:5 CTCGGGGTACCTGAAGGGCATCCTTAGG CTGTCACCAGTGGTTGAGTACCAGTATC 4N-2:U SEQIDNO:6 TGGTGACAGCCTAAGGATGCCCTTCAGG TACCCCGAGGTAACACGCGAC 4N-2:L SEQIDNO:7 GGCCTCCGGTCACCTATTCAGCTTAGAC GTTTTTTAAACCAGGCGCTTTT 4N-3:U SEQIDNO:8 CGGAGGCCGGCACCTTTCCTTCGAACAA CTGTCTTTAACC 4N-3:L SEQIDNO:9 GAGGATATCGCTAGCTTTGAAAACCAGT CGTTG 4J-1:U SEQIDNO:10 CGCAGATCTTAATACGACTCACTATAGG TTGAAAGGGGGCGTTAGGGTCTC 4J-1:L SEQIDNO:11 TTGTTACCCCGGGGTACCTGGAGGGCAT CCTTAGCCTGTCACCAGT 4J-2:U SEQIDNO:12 CGCAGATCTTAATACGACTCACTATAGG TTGAAAGGGGGCGTTAGGGTCTC 4J-2:L SEQIDNO:13 TCCTCAGATCCCGGGTGTCACTTGTTAC CCCGGGGTACCT 4J-3:U SEQIDNO:14 CACCCGGGATCTGAGGAGGGGACTGGGG CTTCTTTAAAAGCG 4J-3:L SEQIDNO:15 GAGGATATCGCTAGCTTTGAAAACCAGT CGTTG 4K-1:U SEQIDNO:16 CGCAGATCTTAATACGACTCACTATAGG TTGAAAGGGGGCGTTAGGGTCTC 4K-1:L SEQIDNO:17 GCTTTTTAAACTACGTAAAGTAGTCCCC TTCTCAGATCCCGAGTGT 4K-2:U SEQIDNO:18 CTTTACGTAGTTTAAAAAGCTTCTACGC CTGAATAGGTGACC 4K-2:L SEQIDNO:19 GAGGATATCGCTAGCTTTGAAAACCAGT CGTTG

(18) TABLE-US-00002 TABLE2 Primersandsequences forsite-directedmutagenesis Primer Sequence(5.fwdarw.3) Sequence(5.fwdarw.3) Loop-U SEQIDNO:20 CTCGGGATCTGAGAAGGGGA CTGGGGCTTTTTACAAGCGC CTGGTTTAAAAAGCTTC Loop-L SEQIDNO:21 GAAGCTTTTTAAACCAGGCG CTTGTAAAAAGCCCCAGTCC CCTTCTCAGATCCCGAG Stem-U SEQIDNO:22 CACTCGGGATCTGAGAAGGG GACTACCTTTAAGTAGTTTA AAAAGCTTCTACGCCTG Stem-L SEQIDNO:23 CAGGCGTAGAAGCTTTTTAA ACTACTTAAAGGTAGTCCCC TTCTCAGATCCCGAGTG C351G-U SEQIDNO:24 CTCGGGATCTGAGAAGGGGA CTGGGGCTTGTTTAAAAGCG CCTGGTTTAAAAAGCTTC C351G-L SEQIDNO:25 GAAGCTTTTTAAACCAGGCG CTTTTAAACAAGCCCCAGTC CCCTTCTCAGATCCCGAG C351A-U SEQIDNO:26 CTCGGGATCTGAGAAGGGGA CTGGGGCTTATTTAAAAGCG CCTGGTTTAAAAAGCTTC C351A-L SEQIDNO:27 GAAGCTTTTTAAACCAGGCG CTTTTAAATAAGCCCCAGTC CCCTTCTCAGATCCCGAG C351T-U SEQIDNO:28 CTCGGGATCTGAGAAGGGGA CTGGGGCTTTTTTAAAAGCG CCTGGTTTAAAAAGCTTC C351T-L SEQIDNO:29 GAAGCTTTTTAAACCAGGCG CTTTTAAAAAAGCCCCAGTC CCCTTCTCAGATCCCGAG InsertC351-U SEQIDNO:30 CGGGATCTGAGAAGGGGACT ACCTTTACGTAGTTTAAAAA GCTTCTACGCCTGAATAG InsertC351-L SEQIDNO:31 CAGGCGTAGAAGCTTTTTAA ACTACGTAAAGGTAGTCCCC TTCTCAGATCCCGAGTGT deltaC351-U SEQIDNO:32 CTCGGGATCTGAGAAGGGGA CTGGGGCTTTTTAAAAGCGC CTGGTTTAAAAAGCTTC deltaC351-L SEQIDNO:33 GAAGCTTTTTAAACCAGGCG CTTTTAAAAAGCCCCAGTCC CCTTCTCAGATCCCGAG TypeA-G351-U SEQIDNO:34 CTCGGGATCTGAGAAGGGGA CTGGGGCTTGTATAAAAGCG CCCAGTTTAAAAAGCTTC TypeA-G351-L SEQIDNO:35 GAAGCTTTTTAAACTGGGCG CTTTTATACAAGCCCCAGTC CCCTTCTCAGATCCCGAG Asia1-G351-U SEQIDNO:36 CTCGGGATCTGAGAAGGGGA CCGGGACTTGTTTAAAAGTG CCCGGTTTAAAAAGCTTC Asia1-G351-L SEQIDNO:37 GAAGCTTTTTAAACCGGGCA CTTTTAAACAAGTCCCGGTC CCCTTCTCAGATCCCGAG
1.3 Construction of IRES-Chimeric FMDV Infectious Clone Plasmids

(19) An IRES-chimeric FMDV full-length infectious cDNA clone, in which the subdomain N of FMDV IRES domain 4 was replaced with that of the BRBV, was constructed using fusion PCR method. The specific method is as follows: first, using plasmid pYS as a template, 4N-1:U and 4N-1:L as primers to amplify fragment A; using synthetic BRBV IRES gene as a template, 4N-2:U and 4N-2: L as primers to amplify fragment B; and using pYS plasmid as a template, 4N-3:U, 4N-3:L as primers to amplify fragment C. Using the purified PCR amplified fragments A, B, and C as templates, and 4N-1:U and 4N-3:L as primers to perform fusion PCR to amplify the FMDV 5 gene fragment containing partial BRBV IRES substitution, the fragment size is approximately 1.9 Kb. The fragment was recovered from the agarose gel, double digested with Bgl II and Nhe I, and cloned into pYS vector, the correct clone identified by sequencing was named p(dN). Similarly, the full-length FMDV infectious cDNA cloning plasmids containing the BRBV IRES domain4 subdomains J and K were constructed respectively using the primers in Tab. 1, and named p(dJ) and p(dK).

(20) 1.4 Construction of A-Type FMDV Full-Length cDNA Infectious Clone

(21) According to the results of whole genome sequencing of foot-and-mouth disease virus A/QSA/CHA/09 strain, the full length of the genome was synthesized by the method of artificially synthesizing genes, and the T7 promoter sequence and Spe I restriction site (5act agt TAA TAC GAC TCA CTA TAGGG 3; SEQ ID NO: 40) were introduced at the 5 end of the whole genome cDNA, an EcoR V restriction site (gat atc) was introduced at the 3 end of the whole genome cDNA, which is used for linearization of whole genome cDNA. After restriction digested with restriction endonucleases Spe I and EcoR V, the whole genome was cloned into the low copy vector pOK12, the constructed infectious cDNA clone was named pQSA.

(22) 1.5 Site-Directed Mutagenesis

(23) According to the instructions of Quik Change Site-Directed Mutagenesis Kit, through the PCR technique, the mutation sites were introduced into the infectious cDNA clones using the primers in Tab.2, respectively. PCR amplification procedure: 94 C. for 4 min; 94 C. for 30 s, 68 C. for 9 min, for 18 cycles; 72 C. for 10 min. After the amplification is completed, purifying the PCR products. Degrading the methylated template of the PCR products by Dpn I (at 37 C. for 1 h), transferring the treated PCR products into DH5a competent cells, selecting the bacterial clones, and the correct recombinant plasmids identified by sequencing were named pK(loop), pK(stem), pC351G, pC351A, pC351T, pC351, pIn-351C, pA-rC351G, pAsia1-rC351G.

(24) 1.6 Rescue of the Virus

(25) After restriction digested and linearized by restriction endonuclease EcoR V, the recombinant plasmids p(dN), p(dJ) and p(dK), pK(loop), pK(stem), pC351G, pC351A, pC351T, pC351, pIn-351C, pA-rC351G, pAsia1-rC351G were subjected to the in vitro transcription according to the instruction of RiboMAX Large Scale RNA Production Systems-T7 kit. The reaction mixture is: 6 L 25 mmol/L rNTP, 4 L 5 buffer, 2 L T7 RNA polymerase, 8 L (2 g) EcoRV linearized recombinant plasmid, a total volume of 20 L. After thoroughly mixed, the reactants were incubated at 37 C. for 2.5 h, digested with RNase-Free DNase for 15 min, removing the DNA template, and the transcript products were purified by phenol chloroform extracting method. When BHK-21 cells in 6-well plates grew to 60%-90% monolayer, washing the cells twice with PBS and adding 1.5 mL of DMEM containing 2% FBS. Transfecting the RNA obtained by in vitro transcription into BHK-21 cells to rescue the virus according to the transfection kit instructions of Effectene Transfection Reagent (Qiagen). Culturing the transfected cells at 37 C. under the condition of 5% CO.sub.2, observing cytopathicity effect (CPE), the virus was harvested in about 3 days, after repeatedly freezing and thawing for 3 times, the virus was inoculated into fresh BHK-21 cells until the virus produced a stable CPE. The correct mutant strains of the recombinant virus identified by full-length genome sequencing were used for subsequent experiments. The rescued viruses were named rdN, rdJ, rdK, rK(loop), rK(stem), rC351G, rC351A, rIn-351C, A-rC351G, and Asia1-rC351G, respectively.

(26) 1.7 One-Step Growth Curve

(27) Wild-type FMDV, recombinant IRES chimeric virus and IRES site-directed mutant virus were inoculated into BHK-21 and IBRS-2 cells at a MOI of 0.05, and adsorbed for 1 h at 33 C., 37 C., 41 C., respectively, then washed with PBS to remove the unadsorbed virus, and DMEM containing 2% FBS was added to maintain the culture, the virus was harvested 4 h, 8 h, 12 h, 16 h, 20 h, 24 h, 28 h, 32 h, 40 h after inoculation, the TCID.sub.50 titers of the virus harvested at different time points were measured, and the average value of virus TCID.sub.50 titers was calculated after repeating the measurement three times at each time point. The one-step growth curve of virus replication at different temperatures was plotted with the time of virus infecting cells as the abscissa and the logarithmic value of TCID.sub.50 titers at different time points as the ordinate.

(28) 1.8 Virus Passage and Genetic Stability Test

(29) The wild-type FMDV, IRES-chimeric virus rK (loop), the point mutation viruses rC351A and rC351G were inoculated into BHK-21 cells to react for 1 h, washing with PBS twice, and adding DMEM containing 2% FBS to maintain the culture. Harvesting the viruses until the appearance of CPE. Passing down to continuous passage for 20 passages after repeatedly freezing and thawing for 3 times. Extracting the RNA of viruses every 5 passages for RT-PCR amplification and sequencing.

(30) 1.9 FMDV Luciferase Replicons and Luciferase Assay

(31) The 96-well plates of the BHK-21 cells and IBRS-2 cells transfected with the replicon RNA of IRES-chimeric viruses were maintained at 33 C., 37 C. or 41 C. Collecting and lysing the cells after 12 h, and measuring the Rluc activity on a GloMax luminometer according to the instructions of Renilla luciferase assay kit of Renilla-Glo Luciferase Assay System, the reaction system is that per 10 L of cell lysate buffer was added with 50 L of reaction solution, parameters are: 2s of read-ahead delay, and 10s of detection time.

(32) 1.10 Western Blot

(33) BHK-21 cells or IBRS-2 cells inoculated with 100 TCID.sub.50 wild-type FMDV and its recombinant virus were cultured for 12 h and then harvested, after lyse treatment, the protein samples were separated by SDS-PAGE, and then transferred to a nitrocellulose membrane. After blocking with 5% skim milk, the membrane was incubated with the primary antibodies MAb 4B2 (diluted at a ratio of 1:1000) at 37 C. for 1 h. After washing with PBST, HRP-labeled rabbit anti-mouse IgG (diluted at a ratio of 1:5000) was added as the secondary antibody, and reacted at 37 C. for 1 h, the DAB solution was added for color development after washing. In addition, the internal reference selected -Actin antibody (diluted at a ratio of 1:1000) as the primary antibody, and HRP-labeled goat anti-mouse IgG (diluted at a ratio of 1:10000) was used as the secondary antibody.

(34) 1.11 Virulence Test in Suckling Mice

(35) The virus was serially gradient diluted in 10-fold with sterilized PBS, and 3-day-old BALB/c suckling mice were selected and randomly divided into groups with 5 mice in each group. Each strain was inoculated successively with virus diluted in 3-gradient, each suckling mouse was injected cervicodorsally with 200 L of virus solution, and the negative control group were injected with the equal amount of PBS. After continuous observation for 7 days, the survival curve of the suckling mice was plotted with the death time of the suckling mice as the abscissa and with the survival rate of the suckling mice as the ordinate.

(36) 1.12 Virulence Test, Safety Test, Vaccination and Challenge Test in Pig

(37) Virulence Test

(38) Twenty of 20-30 kg FMDV serum antibody-negative healthy pigs were randomly divided into 4 groups with 5 in each group. Three pigs in one group were injected intramuscularly at cervical part with wild-type viral strain FMDV (WT) at a dose of 10.sup.5 TCID.sub.50/pig, in the other three groups, three pigs in each group were injected intramuscularly at cervical part with IRES mutant strains rC351G, FMDV (R4) or rdK at a dose of 10.sup.6 TCID.sub.50/pig, 1 day post-inoculation (dpi), two pigs were placed in each group as cohabiting animals. Within 7 days after inoculation, measuring the body temperature of each pig, observing the clinical symptoms, and collecting the nasal swabs, oral swabs and blood.

(39) Safety Test

(40) Nine of 30-40 kg FMDV serum antibody-negative healthy feeder pigs were randomly divided into 3 groups with 3 pigs in each group. The pigs in the first group were injected at posterior auricular muscle with rC351G attenuated strain at a dose of 10.sup.6 TCID.sub.50/pig. Five days after the inoculation, slaughtering the first group of pigs, mixing and homogenizing the tonsil tissue, plasma, and oral and nasal secretion, and injecting 2 mL of the mixture into the second group of pigs. Similarly, slaughtering the second group of pigs after inoculated for 5 days, mixing and homogenizing the same tissues and samples, and injecting 2 mL of the mixture into the third group of pigs. Measuring the body temperature of each group of pigs, observing the clinical symptoms, and collecting the nasal swabs, oral swabs and blood daily after inoculation. And the third group of pigs had blood sampling performed 3 d, 7 d, 14 d, and 21 d after inoculation.

(41) Vaccination and Challenge Test

(42) In order to evaluate the immune-protective effect of the attenuated strain rC351G, 3 pigs were inoculated with this mutant, 2 pigs inoculated with PBS were used as the challenge controls. At 21 days post-vaccination, the O-type FMDV strain O/Mya-98/CHA/2010 which is currently prevalent in China was used to challenge the pigs to evaluate the immune-protective effect, the specific method is as follows:

(43) Five of 20-30 kg FMDV serum antibody-negative healthy feeder pigs, 3 pigs were injected intramuscularly at cervical part with rC351G attenuated strain at a dose of 10.sup.6 TCID.sub.50/pig, 2 pigs were injected intramuscularly at cervical part with 1 mL PBS as the controls. The immunized group and the control group were challenged at 21 days post-vaccination, each pig was injected intramuscularly at cervical part with O/Mya-98/CHA/2010 virus at a dose of 1000 ID.sub.50/pig. Within 7 days after challenge, measuring the body temperature of each pig, observing the clinical symptoms, and collecting the nasal swabs, oral swabs and blood every day.

(44) 1.121 Clinical Symptoms Observation

(45) Carefully observing and recording the clinical incidence of pigs daily, and performing the clinical scores according to the method described by Pacheco and Mason et al. (Pacheco and Mason et al., J. Vet. Sci., 2010): Clinical scores were based on the number of the sites containing vesicular lesions (three scores for each hoof, nose, tongue or lips), with a maximum score of 20 points.

(46) 1.122 Detection of the Viremia and Viral Shedding

(47) The total RNA of the fresh nasal, oral swabs and blood samples were extracted using TRIZOL method, and were reversely transcribed using Oligo (dT.sub.15) primer to obtain the cDNA used as a template, and the fluorescent quantitative PCR detection was performed using the FMDV specific primers (3DF: 5 GGA TGC CGT CTG GTT GTT 3 (SEQ ID NO: 38); 3DR: 5 CGT AGG AGA TCA TGG TGT AAG AGT 3 (SEQ ID NO: 39)). The specific operation of the fluorescent quantitative PCR is performed according to the kit instructions of Platinum SYBR Green qPCR Super Mix-UDG with ROX (Invitrogen), and the content of genomic RNA of virus in the samples are calculated by a standard curve. The background value of FMDV RNA amplified by using the blood, oral and nasal swab samples of preclinical healthy pigs through PCR amplification was 2.6 (x+SD=2.26+0.34) log 10, and if the viral RNA copy number/ml (viral RNA CN/ml) is higher than this value, it is judged as FMDV-RNA-positive.

(48) 1.123 FMDV Specific Antibody Detection

(49) The whole blood of pig was collected every day, the serum fraction separated was used to detect FMDV antibodies, and operate according to the instructions of the 0-type FMDV antibody liquid-phase blocking ELISA kit produced by the Foot and Mouth Disease Reference Laboratory of Lanzhou Veterinary Research Institution. Setting two wells for each serum dilution plate at a ratio of 1:2 and 1:4 as the negative controls, four wells of 1:16, 1:32, 1:64, 1:128 as the positive controls, and the virus antigen was set 4 wells as the controls. The serum to be tested is successively diluted from 1:8 to 1:1024 by double dilution method. Each step of the reaction was carried out according to the instructions. After the reaction was terminated, the OD.sub.450 nm values were measured by a microplate reader.

(50) 1.124 Antibody Detection of FMDV Non-Structural Protein 3ABC

(51) The whole blood of pig was collected every day, the serum fraction separated was used to detect the antibodies of FMDV non-structural protein 3ABC according to the instructions of the 3ABC-I-ELISA of the Foot-and-Mouth Disease Reference Laboratory of Lanzhou Veterinary Research Institution. Diluting serum in 96-well ELISA plates, and setting two wells for the negative and positive controls, respectively. Diluting 6 L of serum into 120 L of serum diluent with a dilution of 1:21, one repetition is set per diluted serum, and diluting 46 serum per plate, adding dropwise the diluted serum to the ELISA coated plate. After reacting for a certain period of time, various enzyme labeling reagents and substrates were sequentially added, and finally the absorbance values (OD450.sub.nm value) at a wavelength of 450 nm were measured by a microplate reader. Antibody titer=(OD.sub.450 nm sample OD.sub.450 nm negative)/(OD.sub.450 nm positive OD.sub.450 nm negative), if this value >0.2, it is judged as positive.

(52) 1.125 Micro-Neutralization Assay

(53) First, the TCID.sub.50 of FMDV O/YS/CHA/05 virus was determined using BHK-21 cells, and then the micro-neutralization test was carried out by using the method of fixing virus diluted serum. Inactivating the serum at 56 C. for 30 min, and performing doubling dilution using PBS. Mixing 100 TCID.sub.50 of virus with different dilutions of serum in equal volume, and incubating for 1 h at 37 C.; the above serum-virus mixtures (100 L/well) were inoculated into BHK-21 cells respectively, 8-well repeats per titer, culturing at 37 C. in a 5% CO.sub.2 incubator, observing the CPE daily, and making the final determination after 72 hours. In addition, setting the virus, positive serum and normal cell controls. The virus neutralization titer was calculated according to the CPE by using the Reed-Muench method (Reed and Muench., 1938). The virus neutralization titer was the serum dilution concentration that can protect 50% of BHK-21 cells from CPE.

(54) 1.126 Indirect ELISA

(55) The FMDV serum antibody-negative pigs were screened using the indirect ELISA methods to detect three serotypes (Type-O, Type-A, and Type-Asia1) of FMDV antibody. The specific steps are as follows: using the inactivated and purified FMDV whole virus as an antigen, coating the 96-well ELISA plate, and adding 5% skim milk for sealing overnight at 4 C.; washing 3 times with PBST, and then adding the serum to be tested, 100 L per well, incubating at 37 C. for 1 h, washing 3 times with PBST, and adding 100 L of HRP-labeled goat anti-porcine IgG (1:5000) per well as a secondary antibody (Sigma), incubating at 37 C. for 1 h; washing 3 times with PBST, adding 50 L/well of TMB substrate color-developing solution, performing light-proof reaction at 37 C. for 15 min; adding 50 L/well of 2M H.sub.2SO.sub.4 to stop the reaction, and finally determining the OD.sub.450 nm value by microplate reader.

(56) 2. Results

(57) 2.1 IRES Chimeric Virus FMDV(R4) is an Attenuated Mutant

(58) The present invention uses the Type-O FMDV reverse genetic operating system to replace the domain 4 of FMDV IRES with the corresponding domain of BRBV IRES, and successfully constructs and rescues the IRES chimeric mutant FMDV(R4). The suckling mouse is a well-recognized animal model for evaluating the virulence of FMDV, thus 3-day-old suckling mice are used as models, and the virulence of the IRES chimeric virus FMDV(R4) and its wild-type virus FMDV(WT) have been determined and compared, the test results are shown in FIG. 1. For FMDV(WT), 1 TCID.sub.50 of virus inoculation dose caused the death of all suckling mice, 0.1TCID.sub.50 of virus inoculation dose caused partial (50%) of suckling mice to die, while 0.01 TCID.sub.50 of virus inoculation dose did not cause the death of suckling mice; for IRES chimeric virus FMDV(R4) strain, 100 TCID.sub.50 of virus inoculation dose caused the death of all suckling mice, 10 TCID.sub.50 of virus inoculation dose caused partial (80%) of suckling mice to die, while 1 TCID.sub.50 of virus inoculation dose did not cause the death of suckling mice. The above results showed that the virulence of IRES domain 4 chimeric virus FMDV(R4) to suckling mice significantly decreased, and the virulence thereof decreased by about 100 times compared with that of the parental virus FMDV(WT), demonstrating that domain 4 of IRES is the determinant factor of the virulence of FMDV.

(59) 2.2 FMDV(R4) is a Temperature-Sensitive Mutant

(60) To investigate the mechanism of FMDV virulence attenuation caused by replacement of IRES domain 4, we firstly analyzed the secondary structure stability of the domain 4-chimeric IRES compared to wild-type FMDV IRES using M-fold software (version 3.2). As calculated by M-fold, the G value of FMDV(R4) IRES was higher (185.40 kcal/mol) than that of FMDV(WT) (196.60 kcal/mol), indicating that the structure of FMDV(R4) IRES was less stable. In addition, BRBV replication is normally confined to the cooler upper respiratory tract epithelium, and is naturally temperature-sensitive when grew at elevated temperatures. Getting together we have reason to assume that the FMDV(R4), in which the IRES domain 4 was replaced by that of BRBV, is a temperature-sensitive and thus attenuated mutant.

(61) In order to investigate whether the replication of FMDV(R4) is temperature-sensitive, one-step growth curves of FMDV(R4) at different temperatures in hamster-derived BHK-21 and porcine-derived IBRS-2 cells were plotted. The results are shown in FIG. 2. In BHK-21 cells, the replication ability of FMDV(R4) was slightly higher than that of FMDV(WT) at 33 C.; and the replication ability of FMDV(R4) was slightly lower than that of FMDV(WT) at 37 C.; whereas, the replication ability of chimeric virus FMDV(R4) significantly decreased, which decreased by about 100 times compared with that of the parental virus FMDV(WT) at 41 C. In IBRS-2 cells, the chimeric virus FMDV(R4) has similar proliferation properties to the parental FMDV(WT) at 33 C.; and the replication ability of chimeric virus FMDV(R4) significantly decreased, which decreased by about 100 times compared with that of parental virus FMDV(WT) at 37 C.; at 41 C., the replication ability of chimeric virus FMDV(R4) was almost lost, but its parental virus FMDV(WT) can still achieve a high replication titer (10.sup.6.25 TCID.sub.50/ml). The above results confirmed that the IRES chimeric attenuated strain FMDV(R4) is a temperature-sensitive mutant, and this temperature sensitivity is very significant in the porcine-derived IBRS-2 cells.

(62) 2.3 the K Region of IRES Domain 4 Determines the Temperature-Sensitive Attenuated Phenotype of FMDV(R4)

(63) In order to further analyze the molecular determinants of the temperature-sensitive attenuated phenotype of the IRES chimeric virus FMDV(R4), the present invention uses the type-O FMDV reverse genetic system to replace the J, K, and N subdomains in domain 4 of FMDV IRES with the corresponding subdomains of BRBV IRES. Three IRES J, K and N subdomains chimeric FMDV mutant were successfully constructed and rescued, respectively named rdJ, rdK and rdN. The replication dynamics of the three chimeric viruses at different temperatures were determined and analyzed, and the one-step growth curves were plotted. The test results are shown in FIG. 3. Whether in BHK-21 cells or IBRS-2 cells, or at different temperatures of 33 C., 37 C. and 41 C., the chimeric viruses rdJ, rdN and the parental virus FMDV(WT) had similar proliferation properties. However, in BHK-21 cells, the chimeric virus rdK had the similar replication ability to the parental virus FMDV(WT) at 33 C. and 37 C., but the replication ability significantly decreased at 41 C., which decreased by about 100 times compared with that of the parental virus FMDV(WT); in IBRS-2 cells, the replication ability of chimeric virus rdK significantly decreased even at 37 C., which decreased by about 100 times compared with that of the parental virus, and the replication ability of rdK was almost lost at 41 C. The replication properties of the chimeric virus rdK (rather than rdJ and rdN) were consistent with the replication properties of the chimeric virus FMDV(R4), indicating that the K region of IRES domain 4 determined the temperature-sensitive properties of the chimeric virus FMDV(R4). At the same time, the virulence test results in the suckling mice showed that the virulence of rdK decreased by about 10.sup.6 times compared with the virulence of FMDV(WT) (FIG. 7). To sum up, the above results indicated that the K region of IRES domain 4 determines the temperature-sensitive attenuated phenotype of the IRES chimeric virus FMDV(R4).

(64) 2.4 the Loop Structure of the K Region of the IRES Domain 4 Determines the Temperature-Sensitive Attenuated Phenotype of FMDV(R4)

(65) The K regions of the IRES domain 4 of FMDV and BRBV are respectively composed of a stem-loop structure. In order to determine the region in the stem-loop structure of the K region associated with the temperature-sensitive attenuated phenotype of FMDV, the present invention uses the reverse genetic system to replace the stem or loop of the K region of the FMDV IRES with the counterpart region of the BRBV IRES. The two chimeric viruses rescued were named rK(Stem) and rK(Loop), respectively. The replication dynamics of the two chimeric viruses in different cells were determined at different temperatures, and the one-step growth curves are shown in FIG. 4. Whether in BHK-21 cells or IBRS-2 cells, or at different temperatures of 33 C., 37 C. and 41 C., the chimeric virus rK(Stem) has similar proliferation properties to the parental virus FMDV(WT); however, the replication abilities of chimeric virus rK(Loop) in the two kinds of cells gradually decreased with the increase of temperature, and its replication properties were extremely similar to those of rdK. The above results indicated that the loop structure of the K region of IRES domain 4 determined the temperature sensitivity of the chimeric virus FMDV(R4). The virulence of rK(Loop) was determined, and it was found that the virus was unstable in suckling mice, a T351C reverse mutation occurred at the 351-site of IRES, which is consistent with the reverse mutation occurred at the 351-site of IRES after the virus was subjected to multiple passages in vitro cells (FIG. 6A); this reverse mutation results in the loop structure of the K region of the rK(Loop) being close to the loop structure of the K region of the parental virulent strain, and thus the virulence of the mutant rK(Loop) to the suckling mouse restored to the level of the parental virus (FIG. 7).

(66) 2.5 Nucleotide C at 351-Site on the Loop of K Region of IRES Domain 4 Determines the Temperature-Sensitive Attenuated Phenotype of FMDV

(67) Alignment analysis revealed that the loop sequence (.sup.351CUUUAA.sup.356) in IRES subdomain K of FMDV is different to that of BRBV (UUUAC), including one more nucleotide at 351 position in the IRES of FMDV, and one nucleotide difference at 356 position (A for FMDV or C for BRBV) between the IRESes of two viruses. To test which nucleotide in the loop of subdomain K determined the temperature-sensitive attenuated phenotypes of FMDV, single point mutation was performed in the infectious cDNA clones of FMDV. Firstly, we generated a mutant rA356C with a single-nucleotide substitution at 356 position of IRES. The replication dynamics (FIG. 5) of the mutant virus at different temperatures showed that the replication abilities of rA356C in the two kinds of cells, BHK-21 and IBRS-2, were similar to those of the parental virus FMDV(WT) at 33 C., 37 C. and 41 C., which indicated that the nucleotide A356 of FMDV IRES was irrelevant to the temperature-sensitive phenotype of FMDV.

(68) In order to determine whether the nucleotide C351 of IRES determines the temperature-sensitive phenotype of FMDV, the present invention makes the following four mutations for the nucleotide C at the 351 position:

(69) (1) a deletion of nucleotide C351; (2) nucleotide C351 mutated to nucleotide A; (3) nucleotide C351 mutated to nucleotide G; (4) nucleotide C351 mutated to nucleotide U.

(70) The final test results showed that the mutation schemes (1) and (4) failed to rescue the virus due to the destruction of the loop structure of the IRES (FIG. 5A), while the mutation schemes (2) and (3) can rescue the virus due to the of invariance of the IRES loop structure (FIG. 5A), and the rescued mutants are named rC351A and rC351G, respectively. The replication dynamics of these two IRES point mutant viruses at different temperatures were measured, and the results are shown in FIG. 5. In BHK-21 cells, the rC351G, rC351A and the parental virus FMDV(WT) had similar proliferation properties at 33 C. and 37 C., when the temperature rose to 41 C., the replication abilities of rC351G and rC351A decreased by 100 times compared with that of parental virus. In porcine-derived IBRS-2 cells, the replication abilities of rC351G and rC351A decreased gradually with the increase of temperature compared with that of the parental virus, and the replication levels of rC351G and rC351A decreased significantly by 10,000 times compared with that of the parental virus at 41 C. The above results showed that the replication properties of the two IRES 351-site nucleotide C point mutant viruses were similar to that of the IRES chimeric virus rK(Loop), indicating that this site is the molecular determinant of the temperature-sensitive phenotype of IRES chimeric FMDV. At the same time, it was also found that the virulence of FMDV temperature-sensitive mutants mutated at IRESC351-site significantly decreased to suckling mice. Compared with wild-type virus, the virulence of rC351G decreased by about 10,000 times and the virulence of rC351A decreased by about 1,000 times. To sum up, the above results finally indicate that the nucleotide C at 351 position on the loop of the K region of IRES domain 4 determines the temperature-sensitive attenuated phenotype of FMDV.

(71) 2.6 Genetic Stability of Temperature-Sensitive Attenuated Strains for Continuous Passage In Vitro

(72) In order to determine the genetic stability of FMDV temperature-sensitive attenuated strains, in the present invention, the IRES chimeric or site-directed mutagenesis viruses FMDV(R4), rdK, rK(Loop), rC351G, rC351A and the parental virus FMDV(WT) were continuously passaged for 20 times in BHK-21 cells, and the IRES sequences of 20.sup.th passage viruses were determined. For 20 passages in BHK-21 cells, the IRES sequences of FMDV(R4), rdK, rC351G and rC351A did not have any mutation; moreover, the mutant viruses still retained their original temperature-sensitive properties in cells (FIG. 6B) and the attenuated phenotypes in suckling mice (FIG. 7). However, although rK(Loop) did not have any occurrences of any mutations until the 15.sup.th passage, and in the 20th passage, some viruses had T351C mutations at the IRES 351 position. The viruses of rK(Loop) were continue passaging for 5 times, and the T351C mutant viruses became the dominant clones (FIG. 6A); meanwhile, the 25.sup.th passage viruses of rK(Loop) lost the temperature-sensitive properties (FIG. 6B), and their virulence to suckling mice reversed to a level similar to that of wild-type virus (FIG. 7). The above results showed that the IRES chimeric or site-directed mutagenesis mutants of FMDV, FMDV(R4), rdK, rC351G and rC351A, had high genetic stability; whereas the IRES K-region loop chimeric FMDV, rK(Loop), is unstable. When it was passed to the 20.sup.th passage, the reverse mutation occurred in some of the virus, and when it was passed to the 25.sup.th passage, the reverse mutation occurred in the whole virus group.

(73) 2.7 IRES C351 is the Determining Site for Temperature-Sensitive Attenuated Phenotype Shared by FMDV Strains

(74) Although both rC351G and rC351A have high genetic stability, the attenuating effect of rC351G is more obvious than that of rC351A. Therefore, rC351G and C351G mutant IRES are selected as the research objects in the subsequent studies. The above research results were all produced using the type-O FMDV strains. In order to verify that the C351G mutation of IRES also determines the temperature-sensitive attenuated phenotype of other serotypes of FMDV strains, the present invention further uses the full-length cDNA infectious clone of the type-A and type-Asia1 FMDV to construct and rescue viral mutants with the nucleotide substitution of C351G in the IRES, which are named A-rC351G and Asia1-rC351G, respectively. The temperature sensitivities of the above IRES mutants have been determined, and the results are shown in FIGS. 8A and 8B: the replication abilities of both A-rC351G and Asia1-rC351G in BHK-21 and IBRS-2 cells decreased with the increase of temperature, which indicated that the C351G mutation in the IRES also enabled other serotypes of FMDV strains to obtain the temperature-sensitive phenotype. In addition, the virulence test results of A-rC351G and Asia1-rC351G to suckling mice showed that the C351G mutation in the IRES could also reduce the virulence of the type-A and type-Asia1 FMDV to suckling mice by at least 10,000 times (FIGS. 8C and 8D), indicating that the temperature-sensitive attenuated phenotypes of the three serotypes of FMDV strains prevalent in China, type-O, type-A and type-Asia1, were determined by IRES C351. Since the C351 site of IRES and the functional stem-loop structure surrounding the site are conserved in all seven serotypes of FMDV strains, it is inferred that the IRES C351 is a molecular determinant of the temperature-sensitive attenuated phenotype in all serotypes of FMDV strains.

(75) 2.8 the Ability of the IRES C351G Mutant-Mediated Translation Initiation is Regulated by Temperature

(76) To explore the molecular mechanism causing the temperature-sensitive attenuated phenotypes of rC351G, we investigated a critical early step in viral replication, the initiation of IRES-directed translation of viral protein in a cap-independent manner. In order to achieve this, we constructed two luciferase replicons rC351G-luc and FMDV(WT)-luc, which contain the respective IRES elements in the same context as in their parent viruses, rC351G and FMDV(WT). The capacity of these luciferase replicons for IRES-mediated translation was assessed by transfecting BHK-21 and IBRS-2 cells with in vitro-transcribed replicon RNA at 33 C., 37 C. and 41 C., respectively. To differentiate the luciferase signal from translation of input viral RNA from the translation of newly replicated RNA, one portion of the transfected cells received 2 mM GnHCl, a potent inhibitor of FMDV RNA replication that has no toxic effects on cellular processes or viral translation. The results are shown in FIG. 9A, in BHK-21 cells, although the translation efficiencies of the IRES with C351G mutation were similar to those of wild-type IRES at 33 C. and 37 C., the translation efficiency thereof decreased significantly at 41 C.; in IBRS-2 cells, the translation initiation efficiency mediated by IRES with a C351G mutation decreased with the increase of temperature, the decrease was most obvious at 41 C., and the translation ability of the C351G-mutated IRES at this temperature was almost lost. This change in the translation initiation efficiency of the C351G-mutated IRES is consistent with the growth dynamics of the viral mutant rC351G in the BHK-21 and IBRS-2 cells at different temperatures, both of which exhibit temperature-sensitive property, and this temperature-sensitive property is behaving more obvious in the porcine-derived IBRS-2 cells. The above results indicate that the translation initiation efficiency of rC351G IRES is significantly inhibited by increased temperature, thereby affecting the replication ability and virulence of virus in a temperature-sensitive manner.

(77) In order to further confirm the temperature-sensitive effect of the translational initiation mediated by the C351G-mutated IRES, the expression dynamics of VP2 structural protein of the IRES mutant rC351G and its parental virus FMDV(WT) were analyzed. The results are shown in FIGS. 9B and 9C, the expression amount of VP2 protein of rC351G in the BHK-21 and IBRS-2 cells decreased with the increase of temperature, especially in the porcine-derived cells IBRS-2, the expression of VP2 protein of the virus was almost lost at 41 C. This temperature-sensitive effect of the translation level of VP2 protein mediated by the C351G mutation is consistent with the changes of the replication titer of infectious virions of the rC351G in the porcine-derived IBRS-2 cells at different temperatures, indicating that the translation initiation ability of the IRES C351G mutant is regulated by temperature.

(78) 2.9 Virulence Test of Mutant rC351G to the Suckling Mice and Pigs

(79) The test results of the virulence to suckling mice showed that the virulence of rC351G was reduced by about 10,000 times compared with the virulence of FMDV(WT) (FIG. 7).

(80) The test results of the virulence of rC351G strain returning to the pigs are shown in FIG. 10. Three pigs (15 #, 46 #, 18 #) were inoculated with 10.sup.5 TCID.sub.50 dose of wild-type virus FMDV(WT), and their body temperatures all reached 41 C. after inoculation for 48 hours, and the typical symptoms of FMD appeared, specifically manifested by decreased appetite, depression, lesions in both hoofs, mouth and nose; the inoculated pigs developed viremia only 1 day after vaccination. The amounts of the viral RNA in blood, oral and nasal swabs were significantly higher than the level of healthy pigs of 2.6 log.sub.10 viral RNA CN/ml, and the viremia reached a peak of 8.7 log.sub.10 RNA copies/ml at 4 dpi. The infection and incidence of the two cohabitation pigs (10 #, 35 #) were lagging behind those of the WT inoculated pigs, and their body temperatures reached 41 C. at 4 dpi (3 days after cohabitation), and lesions appeared in all four hoofs. Viral RNA in blood, oral and nasal swabs of cohabitation pigs were positive at 3 dpi, and reaching a peak of 7.1 log.sub.10 viral RNA CN/ml at 5 dpi. However, the attenuated mutant rC351G (10.sup.6 TCID.sub.50 per pig), equivalent to 10 times of the inoculated dose of the above wild-type virus, were inoculated into 3 pigs (36 #, 49 #, 59 #), and 2 pigs (57 #, 28 #) were used as cohabitation controls, and no clinical symptoms or increased body temperature occurred within 7 dpi; viral RNA in blood, oral and nasal swabs of the inoculated pigs and co-habiting pigs were all negative. Although rC351G inoculated pigs did not develop viremia, all the inoculated pigs produced the antibodies against FMDV non-structural protein 3ABC 21 days after inoculation, whereas, 3ABC antibodies of all the cohabiting pigs were test as negative for 21 days after inoculation, indicating that the attenuated strain rC351G showed partial replication at a low level in the vaccinated pigs, but did not develop viremia, did not shed virus or occur horizontal transmission. The above test results showed that the virulence of rC351G virus to suckling mice significantly decreased, and the virulence to the natural host pigs was lost.

(81) 2.10 Test Results of the Stability and Safety Evaluation of Attenuated Strain rC351G

(82) 1) In Vitro Cell Passage

(83) In order to test the genetic stability of the attenuated strain rC351G, continuous passage was performed in BHK-21 cells for 20 passages, and the whole genome sequence of the 20th passage virus was determined. The results showed that the rC351G strain had high genetic stability, and subjected to continuous passage for 20 passages in vitro, its IRES C351G did not undergo reversion mutation, and its attenuated phenotype did not change.

(84) 2) Co-Habiting Animals are not Infected

(85) The results of cohabitation test are shown in FIG. 1. Healthy pigs (57 #, 28 #) do not show any clinical symptoms after cohabitating with rC351G vaccinated pigs (36 #, 49 #, 59 #). Detections of viral RNA in blood samples, oral and nasal swabs collected within 7 days were negative, and the antibody against FMDV non-structural protein 3ABC in the serum was also negative on the 21st day, indicating that no infection with FMDV rC351G occurred in cohabiting pigs. The above cohabitation test results showed that the pigs did not produce viremia and did not shed virus after inoculated with the attenuated mutant strain rC351G, the attenuated mutant strain rC351G has lost the virulence to susceptible animals, unable to horizontally transmit. Therefore, rC351G has excellent safety.

(86) 3) The Virulence does not Return to Virulent after Continuous Passage in Natural Host Animals

(87) To further evaluate the safety of the attenuated strain rC351G, the strain was performed continuous passage in piglets. The results showed that the attenuated strain rC351G was subjected to continuous passage for 3 passages in the body of pigs, inoculating 3 pigs per passage. All the pigs were normal in body temperature during the 5-day observation period and had no clinical symptoms. Serum antibodies of the third-passage vaccinated pigs, collected on the 3rd, 7th, 14th, and 21st day after inoculation, were tested. The results showed that anti-FMDV structural protein antibody was negative (LPBE value was less than 1:8), and the anti-FMDV non-structural protein 3ABC antibody was also negative (OD value <0.2), and viral RNA in blood, oral and nasal swabs were also negative on the 3rd, 7th, 14th, and 21st day after inoculation. The above test results showed that the attenuated strain rC351G did not return to virulent after being subjected to continuous passage in pigs, on the basis of the previous evidence that the co-habitation did not spread the virus, this further proved that the artificial inoculation and passage of the attenuated strain rC351G had good safety in vivo.

(88) 2.11 Test Results of the Immune Protective Effect of Attenuated Strain rC351G Immunized Pigs

(89) The test results of the immune protective effect of rC351G immunized pigs are shown in Tab. 3.

(90) TABLE-US-00003 TABLE 3 Protection of the rC351G inoculated-pigs against challenged with FMDV O/Mya- 98/CHA/2010 strains Clinical Scoring Viral RNA Copy Viral RNA Copy Neutralizing Antibody Challenging Pig (Onset Virus Number in Blood Number in Nasal Titer Inoculum Dose (ID50) Number Date) Isolation (Onset Date) swabs (Onset Date) 0dpc 7dpc rC351G 10.sup.3 60 0 negative negative negative 128(180) 512(720) 66 0 negative negative negative 128(180) 512(720) 68 0 negative negative negative 64(90) 256(360) PBS 10.sup.3 65 18(2) positive 8.7log10(3) 8.5log10(3, 4) <8(<8) 128(180) 73 16(3) positive 6.2log10(3) 7.8log10(3, 4) <8(<8) 64(90)

(91) According to the test results, 2 days after the challenge, the body temperatures of two control pigs (65 #, 73 #) were increased to 41 C., the appetite decreased and the spirit was depressed, and 3 days after the challenge, the lesions appeared in the four hooves of the two pigs; 48 h after the challenge, the control pigs developed viremia, and the detections of FMDV RNA in blood, oral and nasal swabs were positive, the viremia reached a peak of 8.7 log.sub.10 viral RNA CN/ml 3 days after the challenge, at this time, the virus can be isolated from blood and from oral and nasal swabs. However, the 3 pigs (60 #, 66 #, 68 #) inoculated with the attenuated strain rC351G did not have any clinical symptoms or phenomenon of increasing body temperature within 7 days after the challenge, and the tests of the FMDV RNA, in the blood, oral and nasal swabs of the immunized pigs, were also negative, and the virus isolation was also negative; the results of FMDV antibody test after the challenge showed that the neutralizing antibody titer of FMDV 0 increased slightly from 1:128 to 1:512 and the titer of LPBE antibody increased from 1:180 to 1:720 at 7 dpc in the rC351G immunized group. In the PBS control group, the level of FMDV neutralizing antibody increased rapidly from less than 1:8 to 1:128, and the level of LPBE antibody also rapidly increased from 1:8 to 1:180. The results of the challenge test showed that the attenuated strain rC351G-immunized pigs could provide complete anti-infective protection against the challenge of currently popular type-O FMDV different genotype strains.

(92) 2.12 the Virulence of FMDV(R4) and rdK in Pigs

(93) Three pigs were inoculated with the attenuated mutants FMDV(R4) or rdK (10.sup.6 TCID.sub.50 per pig), and after 24 hours, two native pigs were placed in each group for co-habitation. The results are shown in FIG. 10, none of the pigs showed any clinical symptoms or increasing body temperature throughout the experimental period; No viral RNA was detectable in the blood, oral and nasal swabs of the inoculated pigs and directly contacted pigs. 21 days after inoculation, the FMDV antibody test results showed that the FMDV neutralizing antibodies of all vaccinated pigs and cohabiting pigs were negative (<1:8). These results showed that the mutant FMDV(R4) and rdK had lost the infectivity to the natural host, and no viremia, no virus shedding, no horizontally transmitting, and no antibody developing. Therefore, as a virus-seed of inactivated vaccine, the attenuated mutants FMDV(R4) and rdK have better safety.