METHOD FOR PRODUCING HUMAN A1 ASTROCYTES, HUMAN A1 ASTROCYTES, AND METHOD FOR EVALUATING TEST SUBSTANCE

Abstract

The present invention provides a method for producing human A1 astrocytes, which includes inducing human A1 astrocytes from human astrocytes other than human A1 astrocytes; human A1 astrocytes obtained by the method for producing human A1 astrocytes; and a method for evaluating a test substance, which uses the human A1 astrocytes described above. According to the present invention, there is provided the method for producing human A1 astrocytes, which includes a step a of culturing human astrocytes other than human A1 astrocytes in the presence of TNF and IFN.

Claims

1. A method for producing human A1 astrocytes, comprising: a step a of culturing human astrocytes other than human A1 astrocytes in a presence of TNF and IFN.

2. The method for producing human A1 astrocytes according to claim 1, wherein the step a is performed in a further presence of at least one cytokine and/or complement selected from the group consisting of IL-1, IL-1, and C1q.

3. The method for producing human A1 astrocytes according to claim 1, wherein the step a is performed in a presence of any one of the followings; (1) TNF, IFN, IL-1, IL-1 (2) TNF, IFN, IL-1, C1q (3) TNF, IFN, IL-1, C1q (4) TNF, IFN, IL-1, IL-1, C1q, and, (5) TNF, IFN.

4. The method for producing human A1 astrocytes according to claim 1, wherein the step a includes: a step a1 of differentiating human pluripotent stem cells or cells capable of differentiating into human astrocytes into human astrocytes other than human A1 astrocytes; and, a step a2 of culturing the human astrocytes other than human A1 astrocytes, which are obtained in the step a1, in a presence of TNF and IFN.

5. The method for producing human A1 astrocytes according to claim 1, wherein the human astrocytes other than human A1 astrocytes, which are cultured in the step a, are human A2 astrocytes.

6. The method for producing human A1 astrocytes according to claim 1, wherein the step a is culturing in a serum-free medium.

7. The method for producing human A1 astrocytes according to claim 1, wherein in the step a, a concentration of TNF in a medium is 0.01 ng/mL to 30 ng/mL.

8. The method for producing human A1 astrocytes according to claim 1, wherein in the step a, a concentration of IFN in a medium is 0.1 ng/mL to 20 ng/mL.

9. The method for producing human A1 astrocytes according to claim 1, wherein in the step a, a ratio of a concentration of TNF in a medium to a concentration of IFN in the medium is 100:1 to 1:100.

10. An isolated human A1 astrocyte obtained by the method for producing human A1 astrocytes according to claim 1.

11. A method for evaluating a test substance, comprising bringing a test substance into contact with the human A1 astrocytes according to claim 10.

12. The method for evaluating a test substance according to claim 11, further comprising evaluating a neuropathic change of the human A1 astrocytes after the bringing of the test substance into contact with a human A1 astrocyte obtained by a method for producing human A1 astrocytes, comprising: a step a of culturing human astrocytes other than human A1 astrocytes in a presence of TNF and IFN.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0031] FIG. 1 shows the appearance of human astrocytes after being cultured in the presence of a specific combination of compounds.

[0032] FIG. 2 shows the appearance of human astrocytes (induced from astrocyte progenitor cells) after being cultured in the presence of a specific combination of compounds.

[0033] FIG. 3 shows the results of quantifying the expression of GBP2 and CXCL10 after culturing human astrocytes in the presence of a specific combination of compounds.

[0034] FIG. 4 shows the results of quantifying the expression of C3 after culturing human astrocytes in the presence of a specific combination of compounds.

[0035] FIG. 5 shows the result of quantifying the expression of C3 after culturing human astrocytes (induced from astrocyte progenitor cells) in the presence of a specific combination of compounds.

[0036] FIG. 6 shows the result of quantifying the expression of C3 after culturing human astrocytes (primary culture) in the presence of a specific combination of compounds.

[0037] FIG. 7 shows the appearance of nerve cells (also referred to as neurons) which have been cultured together with untreated human astrocytes or with human astrocytes cultured in the presence of a specific combination of compounds.

[0038] FIG. 8 shows the evaluation results of the cell death of nerve cells (also referred to as neurons) which have been cultured together with untreated human astrocytes or with human astrocytes cultured in the presence of a specific combination of compounds.

[0039] FIG. 9 shows the appearance of nerve cells and the length of neurites in a case where the nerve cells were cultured together with untreated human astrocytes (induced from astrocyte progenitor cells) or in a case where nerve cells were cultured together with human astrocytes (induced from astrocyte progenitor cells) in the presence of a specific combination of compounds.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0040] Hereinafter, the embodiments of the present invention will be described in detail. [0041] TNF refers to Tumor Necrosis Factor . [0042] IFN refers to Interferon . [0043] IL-1 refers to Interleukin-1. [0044] IL-10 refers to Interleukin-1. [0045] C1q refers to complement C1q. [0046] MPTP refers to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine. [0047] EMP1 refers to Epithelial membrane protein 1. [0048] CD109 refers to Cluster of Differentiation 109. [0049] GBP2 refers to guanylate binding protein 2. [0050] C3 refers to complement molecule C3. [0051] CXCL10 refers to CXC motif chemokine 10. [0052] GAPDH refers to glyceraldehyde 3-phosphate dehydrogenase. [0053] HBEGF refers to heparin binding-epidermal growth factor-like growth factor. [0054] WST refers to Water soluble Tetrazolium salts.

[0055] The present invention relates to a method for producing human A1 astrocytes, which includes a step a of culturing human astrocytes other than human A1 astrocytes in the presence of TNF and IFN.

[0056] Step a is a step of culturing human astrocytes other than human A1 astrocytes in the presence of TNF and IFN, or in the presence of at least one cytokine and/or complement selected from the group consisting of IL-1, IL-1, and C1q, in addition to TNF and IFN.

[0057] The step a is preferably a step of culturing human astrocytes other than human A1 astrocytes in the presence of any one of the followings. [0058] (1) TNF, IFN, IL-1, IL-1 [0059] (2) TNF, IFN, IL-1, C1q [0060] (3) TNF, IFN, IL-1, C1q [0061] (4) TNF, IFN, IL-1, IL-1, C1q, and [0062] (5) TNF, IFN.

[0063] The step a is particularly preferably a step of culturing human astrocytes other than human A1 astrocytes in the presence of any one of the followings. [0064] (4) TNF, IFN, IL-1, IL-1, C1q, and [0065] (5) TNF, IFN.

[0066] The step a is preferably a step of culturing human astrocytes other than human A1 astrocytes in the absence of MPTP.

[0067] <Human Astrocytes>

[0068] Human astrocytes are astrocytes of human.

[0069] Examples of the method for obtaining the human astrocytes other than human A1 astrocytes used in the present invention include separating from the cerebral cortex, spinal cord, or the like, which is surgically obtained from a patient, inducing from cells capable of differentiating into human astrocytes, and inducing from human pluripotent stem cells. Any of these human astrocytes can be used as the human astrocytes other than human A1 astrocytes in the method according to the embodiment of the present invention.

[0070] As the human astrocytes other than human A1 astrocytes used in the present invention, human astrocytes induced from human pluripotent stem cells and human astrocytes induced from cells capable of differentiating into human astrocytes can be preferably used.

[0071] The human astrocytes other than human A1 astrocytes can be used in the method according to the embodiment of the present invention in an isolated state or in a state of being mixed with other cells. Further, it can also be considered that the induction from pluripotent stem cells to human astrocytes and the induction from human astrocytes to human A1 astrocytes are performed consecutively. In this case, the step a includes a step a1 of differentiating human pluripotent stem cells or cells capable of differentiating into human astrocytes into human astrocytes other than human A1 astrocytes; and a step a2 of culturing the human astrocytes other than human A1 astrocytes, which are obtained in the step a1, in a presence of TNF and IFN.

[0072] As the human pluripotent stem cells, human induced pluripotent stem (iPS) cells, human embryonic stem (ES) cells, and human mesenchymal stem cells can be mentioned, which are not particularly limited.

[0073] As the cells capable of differentiating into human astrocytes, neural stem cells, glial neural progenitor cells, glial progenitor cells, astrocyte progenitor cells, and fibroblasts can be mentioned, which are not particularly limited.

[0074] <Activated Human Astrocytes>

[0075] Activated human astrocytes are human astrocytes activated by the influence of neurological diseases or the like. As the activated human astrocytes, human A1 astrocytes that are characterized by neuropathic properties and neuroprotective human A2 astrocytes are known. The activated human astrocytes are also included in the human astrocytes according to the embodiment of the present invention.

[0076] <Human A1 Astrocytes>

[0077] The Human A1 astrocytes is a type of activated human astrocytes.

[0078] The human A1 astrocytes produced by the method according to the embodiment of the present invention can be detected, confirmed, and separated by utilizing, for example, morphological changes of cells, characteristic properties of human A1 astrocytes, and specific markers.

[0079] The human A1 astrocytes have the characteristic appearance of hypertrophy. Accordingly, the human A1 astrocytes can be detected by observation with a microscope.

[0080] As the specific markers for human A1 astrocytes, GBP2, CXCL10, and C3 are mentioned but are not limited thereto.

[0081] A immunological method (detection with an antibody) can be used to detect the specific markers, but the detection may be carried out by quantifying the amount of mRNA of the protein molecule in a case where the specific markers are proteins.

[0082] Human A1 astrocytes exhibit neuronal cytotoxicity. Accordingly, the human A1 astrocytes can be detected by co-culturing with nerve cells and utilizing the cytotoxicity on the nerve cells.

[0083] <Human A2 Astrocytes>

[0084] The human A2 astrocytes is a type of activated human astrocytes.

[0085] A2 astrocytes are up-regulated in various neurotrophic factors and act protectively on nerve cells. As the specific markers of the A2 astrocytes, EMP1 and CD109 are mentioned but not limited thereto.

[0086] The human A2 astrocytes have a star-shaped appearance.

[0087] In the present invention, the human A2 astrocytes can be used as the human astrocytes other than human A1 astrocytes, which are cultured in the step a.

[0088] <TNF>

[0089] TNF is a kind of cytokine and is a substance widely involved in biophylaxis and activation of the immune mechanism during inflammation. The means for achieving the culture conditions in in the presence of TNF is not particularly limited, and examples thereof include adding TNF to a medium, co-culturing with cells that produce TNF, and adding the culture supernatant of cells that produce TNF.

[0090] The concentration of TNF may be appropriately determined and is not particularly limited, but for example, TNF can be used in the range of 0.01 ng/mL to 30 ng/mL and preferably in the range of 0.5 ng/mL to 10 ng/mL.

[0091] <IFN>

[0092] IFN is a cytokine that controls the induction of cell-mediated immunity. The means for achieving the culture conditions in the presence of IFN is not particularly limited, and examples thereof include adding IFN to a medium, co-culturing with cells that produce IFN, and adding the culture supernatant of cells that produce IFN.

[0093] The concentration of IFN may be appropriately determined and is not particularly limited, but for example, IFN can be used in the range of 0.1 ng/mL to 20 ng/mL and preferably int the range of 0.5 ng/mL to 10 ng/mL.

[0094] The ratio of the concentration of TNF to the concentration of IFN in the medium is not particularly limited, but is preferably 100:1 to 1:100, more preferably 10:1 to 1:10, and still more preferably 5:1 to 1:5, and particularly preferably 3:1 to 1:1.

[0095] <IL-1>

[0096] IL-1 is a kind of interleukin that is a cytokine secreted by leukocytes. The means for achieving the culture conditions in the presence of IL-1 is not particularly limited, and examples thereof include, adding IL-1 to a medium, co-culturing with cells that produce IL-1, and adding the culture supernatant of cells that produce IL-1.

[0097] The concentration of IL-1 may be appropriately determined and is not particularly limited, but for example, IL-1 can be used in the range of 1 pg/mL to 5 ng/mL and preferably in the range of 0.05 ng/mL to 3 ng/mL.

[0098] <IL-1>

[0099] IL-1 is a kind of interleukin that is a cytokine secreted by leukocytes. The means for achieving the culture conditions in the presence of IL-1 is not particularly limited, and examples thereof include, adding IL-10 to a medium, co-culturing with cells that produce IL-1, and adding the culture supernatant of cells that produce IL-1.

[0100] The concentration of IL-10 may be appropriately determined and is not particularly limited, but for example, IL-1 can be used in the range of 1 pg/mL to 10 ng/mL and preferably in the range of 0.5 ng/mL to 5 ng/mL.

[0101] <C1q>

[0102] C1q is one of complements. C1q is a factor that is the origin of the classical pathway, which is one of the complement activation pathways. The means for achieving the culture conditions in the presence of C1q is not particularly limited, and examples thereof include adding C1q to a medium, co-culturing with cells that produce C1q, and adding the culture supernatant of cells that produce C1q.

[0103] The concentration of C1q may be appropriately determined and is not particularly limited, but for example, C1q can be used in the range of 10 ng/mL to 10 g/mL and preferably in the range of 50 ng/mL to 300 ng/mL.

[0104] <Culture of Human Astrocytes>

[0105] The culture of human astrocytes in the present invention may be carried out in the presence of the above-described various cytokines and/or complement by selecting a medium, temperature, and other conditions depending on the origin and state of the human astrocytes to be used. The medium may contain components in addition to the above-described various cytokines and/or complement as long as the components do not interfere with the culture of human astrocytes in the present invention. A medium can be selected from the known media and commercially available media. For example, suitable components (serum, protein, amino acid, sugar, vitamin, fatty acid, antibiotics, and the like) are added to a general medium such as minimum essential medium (MEM), Dulbecco's modified Eagle medium (DMEM), DMEM/F12, or a medium obtained by modifying these media, for using in cell culture. A medium not containing serum (serum-free medium) is preferably used as the medium.

[0106] As the culture conditions, general cell culture conditions may be selected. For example, conditions of 37 C. and 5% CO.sub.2.are mentioned. During the culture, it is preferable to change the medium at appropriate intervals (preferably once a day to 7 days and more preferably once every 2 days to 3 days). In a case where the method according to the embodiment of the present invention is carried out using human astrocytes as a material, human A1 astrocytes appear in one day to one week under the conditions of 37 C. and 5% CO.sub.2.

[0107] For culturing somatic cells, cell culture vessels such as plates, dishes, cell culture inserts, cell culture flasks, and cell culture bags can be used. As the cell culture bag, a cell culture bag having gas permeability is suitable. Larger culture tanks may be used in a case where a large number of cells are required. The culturing can be performed in either an open system or a closed system.

[0108] In the method according to the embodiment of the present invention, human A1 astrocytes can be produced by culturing human astrocytes in the medium containing the above-described various cytokines and/or complement.

[0109] <Human A1 Astrocytes and Method for Evaluating Test Substance Using Human A1 Astrocytes>

[0110] The present invention provides an isolated human A1 astrocyte obtained by the method for producing human A1 astrocytes according to the embodiment of the present invention.

[0111] The human A1 astrocytes produced by the method according to the embodiment of the present invention can also be used for screening drug candidate compounds that act on human A1 astrocytes and for evaluating the safety of drug candidate compounds.

[0112] The present invention provides a method for evaluating a test substance, which includes bringing a test substance into contact with the human A1 astrocytes according to the embodiment of the present invention. For example, the test substance may be evaluated by evaluating change in neuronal cytotoxicity of the human A1 astrocytes after bringing the test substance into contact with the human A1 astrocytes. The change in neuronal cytotoxicity of human A1 astrocytes can be evaluated, for example, by co-culturing human A1 astrocytes with nerve cells according to the method described in Examples described later and utilizing the cytotoxicity on the nerve cells.

[0113] The present invention will be more specifically described with reference to Examples, but the present invention is not limited to the scope of Examples.

EXAMPLES

Test Example 1: Induction from Human Astrocytes to Human A1 Astrocytes

[0114] (1) Human Astrocytes

[0115] (1-1) Astrocytes Derived from Human iPS Cells

[0116] As human astrocytes, iCell (registered trademark) Astrocytes (CDI, ASC-100-020-001-PT), which are astrocytes derived from human iPS cells, were purchased from FUJIFILM Cellular Dynamics, Inc. and used. From the appearance, it was confirmed that iCell (registered trademark) Astrocytes were human astrocytes other than human A1 astrocytes.

[0117] (1-2) Astrocytes Induced from Astrocyte Progenitor Cells

[0118] In addition, as human astrocytes, commercially available human astrocyte progenitor cells (AX0083, manufactured by Axol Bioscience Ltd.) were also induced under the conditions described in the method attached to the kit and used. From the appearance, it was confirmed that the induced human astrocytes were human astrocytes other than human A1 astrocytes.

[0119] (1-3) Human-Derived Primary Cultured Astrocytes

[0120] Further, commercially available primary cultured human astrocytes (CC-2565, manufactured by Lonza) were also used.

[0121] (2) Induction to Human A1 Astrocytes

[0122] Induction to human A1 astrocytes was performed by an induction method 1 in Examples 1 to 4 and Comparative Examples 1 to 4, and by an induction method 2 in Example 5. An induction method 3 was used in Examples 6 and 7.

[0123] Induction Method 1

[0124] Matrigel (registered trademark) basement membrane matrix (356234, manufactured by Corning Inc.) diluted 120 folds with DMEM (11960-044, manufactured by Thermo Fisher Scientific, Inc.) was added to a 6-well plate at 1.5 mL/well and allowed to be left at 4 C. After 24 hours, the medium was replaced with the following serum-free medium for use.

[0125] Composition of Serum-Free Medium

[0126] Neurobasal (registered trademark) medium (50%, 21103049, manufactured by Thermo Fisher Scientific, Inc.)

[0127] DMEM (50%)

[0128] Penicillin/Streptomycin (100) (1, 15140-122, manufactured by Thermo Fisher Scientific, Inc.)

[0129] Sodium pyruvate (1 mM, 11360-070, manufactured by Thermo Fisher Scientific, Inc.)

[0130] L-glutamine (292 g/mL, 25030-081, manufactured by Thermo Fisher Scientific, Inc.)

[0131] N2 Supplement with Transferrin (Apo) (1, 141-09041, manufactured by Wako)

[0132] N-acetyl system (5 m/mL, A8199, manufactured by Sigma-Aldrich Co. LLC)

[0133] HBEGF (5 ng/mL, 100-47, manufactured by PeproTech Inc.)

[0134] iCell (registered trademark) astrocytes were suspended in a serum-free medium, seeded on a 6-well plate at a density of 3010.sup.4 cells/well and cultured under the conditions of 37 C. and 5% CO.sub.2 for 24 hours.

[0135] The medium was replaced with a serum-free medium to which two to five of the compounds (TNF, 8902SC, manufactured by Cell Signaling Technology Inc.), IFN (285-IF, manufactured by R&D Systems Inc.), IL-1 (SRP3310, manufactured by Sigma-Aldrich Co. LLC), IL-1 (201-LB, manufactured by R&D Systems Inc.), and C1q (MBS143105, manufactured by MyBioSource Inc.)) described in Table 1 were added, and the astrocytes were cultured under the conditions of 37 C. and 5% CO.sub.2 for one day.

[0136] Induction Method 2

[0137] Matrigel (registered trademark) basement membrane matrix (356234, manufactured by Corning Inc.) diluted 120 folds with DMEM (11960-044, manufactured by Thermo Fisher Scientific, Inc.) was added to a 96-well plate at 65 L/well and allowed to be left at 4 C. After 24 hours, the medium was replaced with the same serum-free medium as the serum-free medium used in the Induction method 1 and used.

[0138] iCell (registered trademark) astrocytes were suspended in a serum-free medium, seeded on a 96-well plate at a density of 310.sup.4 cells/well, and cultured under the conditions of 37 C. and 5% CO.sub.2 for 24 hours.

[0139] The medium was replaced with a serum-free medium to which two of the compounds described in Table 1 were added, and the astrocytes were cultured under the conditions of 37 C. and 5% CO.sub.2 for one day.

[0140] Induction Method 3

[0141] Matrigel (registered trademark) basement membrane matrix (356234, manufactured by Corning Inc.) diluted 120 folds with DMEM (11960-044, manufactured by Thermo Fisher Scientific, Inc.) was added to a 96-well plate at 65 L/well, allowed to be left at 4 C., and used after 24 hours.

[0142] In Example 6 and in Example 7 respectively, astrocytes induced from commercially available human astrocyte progenitor cells and primary cultured human astrocytes were seeded on a 96-well plate at a density of 310.sup.4 cells/well and cultured under the conditions of 37 C. and 5% CO.sub.2 for 24 hours.

[0143] The medium was replaced with a medium to which two of the compounds described in Table 1 were added, and the astrocytes were cultured under the conditions of 37 C. and 5% CO.sub.2 for one day.

[0144] Immunostaining

[0145] In Example 6, staining of GFAP, which is a marker for astrocytes, was performed by immunostaining. 80% ethanol (100 L/well) was added to astrocytes induced from human astrocyte progenitor cells induced by the induction method 3, and the astrocytes were fixed at 30 C. for 24 hours. After washing 3 times with PBS, the astrocytes were blocked by adding a PBS solution (1% BSA) containing 1% BSA, and treated with a primary antibody (MAB3402, manufactured by Merck Millipore) diluted 3,000 folds with 1% BSA at 4 C. for 24 hours. After washing 3 times with PBS, the astrocytes were treated with a secondary antibody (A11005, manufactured by ThermoFisher Scientific Inc.) diluted 1,000 folds with 1% BSA at room temperature for 1 hour. After washing 3 times with PBS, images were acquired by photographing with IncuCyte S3 (4647, manufactured by Essen BioScience).

TABLE-US-00001 TABLE 1 (The unit for the numerical values in Table is ng/mL) TNF IFN IL-1 IL-1 C1q Example 1 7.5 5 0.75 2.5 100 Example 2 7.5 5 0.75 2.5 Example 3 7.5 5 0.75 100 Example 4 7.5 5 2.5 100 Example 5 7.5 5 Example 6 7.5 5 Example 7 7.5 5 Comparative Example 1 7.5 0.75 2.5 100 Comparative Example 2 5 0.75 2.5 100 Comparative Example 3 5 2.5 Comparative Example 4 7.5 0.75 100

[0146] (3) Evaluation of Cell Morphology

[0147] The morphology of the cells after culture was observed with a microscope or a photographed image. The results are shown in FIG. 1 and FIG. 2. In addition, the results of evaluating the morphology from FIGS. 1 and 2 are shown in Table below. The morphology was determined by selecting 10 cells/field from typical cells and comparing the long axis with the short axis. Cells with a ratio of long axis/short axis of 10 or less were defined as hypertrophic, cells with a ratio of long axis/short axis of more than 10 and having fibrous shape was defined as fibrous, and cells with a ratio of long axis/short axis of more than 10 and having a plurality of protrusions were defined as star-shaped. The numerical values of the evaluation results of the ratio of long axis/short axis are shown in FIGS. 1 and 2. The magnified view in the frame of FIG. 2 shows a typical star-shaped (left side of the figure) and hypertrophic (right side of the figure) cell.

TABLE-US-00002 TABLE 2 Cell morphology Example 1 All hypertrophic Example 2 All hypertrophic Example 3 All hypertrophic Example 4 All hypertrophic Example 5 All hypertrophic Example 6 All hypertrophic Comparative Example 1 Fibrous, star-shaped Comparative Example 2 Fibrous, star-shaped Comparative Example 3 Fibrous, star-shaped Comparative Example 4 Fibrous, star-shaped

[0148] From FIG. 1, FIG. 2, and Table 2, it can be seen that in Examples 1 to 6, substantially all the cells exhibited the hypertrophic morphology characteristic of human A1 astrocytes. On the other hand, in Comparative Examples 1 to 4, it can be seen that there are no or very few cells that exhibit a hypertrophic morphology.

[0149] (4) Evaluation of mRNA Expression Level

[0150] The amount of genes expressed by the cells after culturing was measured by quantitative polymerase chain reaction (PCR). The quantitative PCR was carried out by a quantitative PCR method 1 in Examples 1 to 4 and Comparative Examples 1 to 4, and by a quantitative PCR method 2 in Examples 5 to 7.

[0151] Quantitative PCR Method 1

[0152] Total RNA was extracted from cells one day after induction. RNeasy (registered trademark) mini kit (74104, manufactured by QIAGEN) was used for the extraction of total RNA according to the attached manual. PrimeScript (registered trademark) RT reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A, manufactured by Takara Bio Inc.) was used for reverse transcription of total RNA according to the attached manual. For quantitative PCR, TB Green Premix Ex Taq II (Tli RNase H Plus) (RR820B, manufactured by Takara Bio Inc.) was used according to the attached protocol. Mx3005P (manufactured by Stratagene) was used and, as the cycle program, one cycle of 95 C. for 30 seconds and 45 cycles of 95 C. for 5 seconds and 60 C. for 30 seconds were performed. The sequences of the primers are shown below.

TABLE-US-00003 GBP2 Forwardprimer: (SEQIDNO:1) tttcaccctggaactggaag Reverseprimer: (SEQIDNO:2) gacgaagcacttcctcttgg CXCL10 Forwardprimer: (SEQIDNO:3) ccacgtgttgagatcattgc Reverseprimer: (SEQIDNO:4) cctctgtgtggtccatcctt GAPDH Forwardprimer: (SEQIDNO:5) gtcagtggtggacctgacct Reverseprimer: (SEQIDNO:6) tgctgtagccaaattcgttg

[0153] Quantitative PCR Method 2

[0154] mRNA was quantified from cells one day after induction using FastLane cell Multiplex NR Kit (216513, manufactured by QIAGEN) according to the attached manual. The primers and the fluorescent probes were synthesized by the Dual Labeled Probe design set (manufactured by Takara Bio Inc.). CFX384 Touch real-time PCR analysis system (manufactured by Bio-Rad Laboratories Inc.) was used and, as the cycle program, one cycle of 50 C. for 20 minutes, one cycle of 95 C. for 15 minutes, and 45 cycles of 94 C. for 45 seconds and 60 C. for 75 seconds were performed. The sequences of the primer and the fluorescent probe are shown below.

TABLE-US-00004 C3probe: (SEQIDNO:7) 5-(FAM)CACAGCGGCACAGTTCATCACGGCA(BHQ1)-3 Forwardprimer: (SEQIDNO:8) GCCTATTACAACCTGGAGGAAAG Reverseprimer: (SEQIDNO:9) GTGACCTTGTCATCCGACTTTTG CXCL10probe: (SEQIDNO:10) 5-(Cyanine5)TCTGACTCTAAGTGGCATTCAAGGAGTACCT (BHQ1)-3 Forwardprimer: (SEQIDNO:11) GCCATTCTGATTTGCTGCCTTA Reverseprimer: (SEQIDNO:12) ACAGGTTGATTACTAATGCTGATGC GAPDHprobe: (SEQIDNO:13) 5-(HEX)CATCAGCAATGCCTCCTGCACCACCAA(BHQ1)-3 Forwardprimer: (SEQIDNO:14) GAACCATGAGAAGTATGACAACAGC Reverseprimer: (SEQIDNO:15) TGGGTGGCAGTGATGGCA

[0155] The expression level of mRNA was quantified by the AACt method (comparative Ct method) using GAPDH as the internal standard. The results are shown in FIG. 3, FIG. 4, FIG. 5, and FIG. 6.

[0156] From FIG. 3, it can be seen that in Examples 1 to 4, both GBP2 and CXCL10 are sufficiently expressed. On the other hand, in Comparative Examples 1 to 4, almost no GBP2 and CXCL10 are expressed, or even in a case of being expressed, the amount thereof is small compared to Examples. From FIG. 4, it can be seen that the expression of C3 is increased by stimulation in Examples 1 and 5. From FIG. 5 and FIG. 6, it can be seen that the expression of C3 is increased by stimulation in Examples 6 and 7.

Test Example 2: Co-Culture of Human A1 Astrocytes and Nerve Cells

[0157] (1) Seeding of Human Astrocytes on Cell Culture Insert

[0158] As human astrocytes, iCell (registered trademark) astrocytes were used as in Test Example 1.

[0159] Matrigel (registered trademark) diluted 120 folds with DMEM was added to cell culture insert (353104, manufactured by Corning Inc.) at 100 L/well and allowed to be left at 4 C. After 24 hours, the medium was replaced with the same serum-free medium as the serum-free medium used in the Induction method 1. iCell (registered trademark) astrocytes were suspended in a serum-free medium, seeded on a cell culture insert at a density of 510.sup.4 cells/well, and cultured under the conditions of 37 C. and 5% CO.sub.2.

[0160] After 24 hours, the medium was replaced with a serum-free medium or a serum-free medium to which IL-1 (0.75 ng/mL), TNF (7.5 ng/mL), C1q (100 ng/mL), IL-1 (2.5 ng/mL), and IFN (5 ng/mL) were added.

[0161] (2) Seeding of Nerve Cells on Culture Plate

[0162] Poly-L-Lysine solution (P4707, manufactured by Sigma-Aldrich Co. LLC) diluted 10 folds with phosphate buffered solution (PBS) was added to a 24-well plate at 500 L/well and allowed to be left at room temperature. After 24 hours, iMatrix-511 (892012, manufactured by Nippi. Inc.) diluted 166 folds with PBS was added to a 24-well plate at 500 L/well, incubated at 37 C. for 1 hour, and then replaced with a serum-free medium.

[0163] According to the method disclosed in WO2014/148646A1, Neurogenin2 was forcibly expressed to differentiate iPS cells into nerve cells. The obtained nerve cells were suspended in a serum-free medium, seeded on a 24-well plate at a density of 1010.sup.4 cells/well, and cultured under the conditions of 37 C. and 5% CO.sub.2.

[0164] (3) Co-Culture with Nerve Cells

[0165] The culture medium in the cell culture insert on which human astrocytes were seeded and the culture medium in the culture plate on which nerve cells were seeded were replaced with a serum-free medium or a serum-free medium containing the five compounds, and the combined co-culture was started. As a control, a single culture of nerve cells was also started at the same time. After culturing under the conditions of 37 C. and 5% CO.sub.2 for 5 days, the appearance of nerve cells was observed. The results are shown in FIG. 7.

[0166] It can be seen that human astrocytes replaced with serum-free medium act protectively on nerve cells and co-cultured nerve cells have a larger number of viable cells and firm neurites as compared with nerve cells cultured singly. On the other hand, it can be seen that human astrocytes replaced with the serum-free medium containing the five compounds exhibited neurotoxicity, and the co-cultured nerve cells have many dead cells, as compared with the nerve cells co-cultured with the astrocytes replaced with the serum-free medium, and have a reduced number of viable cells and neurites.

[0167] (4) Quantitative Evaluation of Nerve Cell Death

[0168] After co-culturing for 5 days, viable cells were quantitatively evaluated by the WST test and the counting of the viable cells. The WST test was evaluated using Cell Counting Kit-8 (CK04, manufactured by Dojindo Molecular Technologies. Inc.). After removing the cell culture insert, 50 L of Cell Counting Kit solution was added to the culture plate, and color reaction was performed for 1 to 4 hours under the conditions of 37 C. and 5% CO.sub.2. Then, 100 L of the reaction solution was measured for absorbance at 450 nm and 650 nm using a microplate reader, and quantification was performed based on the value obtained by subtracting the value at 650 nm from the value at 450 nm. The number of viable cells was evaluated using Cellstain (registered trademark) CytoRed solution (C410, manufactured by Dojindo Molecular Technologies. Inc.) and IncuCyte (registered trademark) S3 (4647, manufactured by Essen BioScience) using the sample after performing the WST test. 0.5 L of 1 mmol/L CytoRed solution was added to the culture plate, color reaction was performed for 30 minutes to 2 hours under the conditions of 37 C. and 5% CO.sub.2, whereby viable cells were stained. Then, the number of viable cells was counted using IncuCyte (registered trademark) S3.

[0169] The results are shown in FIG. 8.

[0170] As a result of the WST test and quantification of the number of viable cells, it has been confirmed that the nerve cells co-cultured with the human astrocytes in the replaced serum-free medium have a larger number of viable cells as compared with nerve cells cultured singly. On the other hand, it has been confirmed that the nerve cells co-cultured with the human astrocytes in the replaced serum-free medium containing the five compounds have a reduced number of viable cells as compared with the nerve cells co-cultured with the astrocytes in the replaced serum-free medium.

Test Example 3: Neuropathic Properties of Various Human Astrocytes

[0171] (1) Seeding of Astrocytes Induced from Human Astrocyte Progenitor Cells

[0172] Matrigel (registered trademark) basement membrane matrix (356234, manufactured by Corning Inc.) diluted 120 folds with DMEM (11960-044, manufactured by Thermo Fisher Scientific, Inc.) was added to a 96-well plate at 65 L/well and allowed to be left at 4 C. After 24 hours, astrocytes induced from commercially available human astrocyte progenitor cells were seeded at a density of 510.sup.4 cells/well.

[0173] The astrocytes were treated with (A) unstimulation, (B) stimulation with TNF (7.5 ng/mL) and IFN (5 ng/mL), or (C) stimulation with TNF (7.5 ng/mL), IL-1 (0.75 ng/mL), and C1q (100 ng/mL), and nerve cells were seeded 48 hours later.

[0174] (2) Seeding of Nerve Cells on Culture Plate

[0175] According to the method disclosed in WO2014/148646A1, Neurogenin2 was forcibly expressed to differentiate iPS cells into nerve cells. The obtained nerve cells were seeded on the astrocytes induced to A1 type at a density of 310.sup.4 cells/well and cultured for 3 days under the conditions of 37 C. and 5% CO.sub.2

[0176] (3) Immunostaining

[0177] 80% ethanol (100 L/well) was added to the cells cultured for 3 days and fixed at 30 C. for 24 hours. After washing 3 times with PBS, blocking was performed by adding 1% BSA, and a primary antibody (MRB-435P, manufactured by Covance Inc.) diluted 2,000 folds with 1% BSA was treated at 4 C. for 24 hours. After washing 3 times with PBS, a secondary antibody (ThermoFisher Scientific, A11008) diluted 1,000 folds with 1% BSA was treated at room temperature for 1 hour. After washing 3 times with PBS, images were acquired by photographing with IncuCyte S3 (4647, manufactured by Essen BioScience). The results are shown in FIG. 9.

[0178] In a case where nerve cells respectively co-cultured with human astrocytes cells treated with (A) unstimulation, human astrocytes treated with (B) stimulation, and human astrocytes treated with (C) stimulation are compared, it has been confirmed that the nerve cells co-cultured with the astrocytes treated with (B) stimulation has a reduced number of neurites. [Sequence list] International application 18F01625W1JP19022545_2. app based on International Patent Cooperation Treaty