COMPOSITIONS AND METHODS FOR AMPLIFICATION AND DETECTION OF HEPATITIS B VIRUS RNA, INCLUDING HBV RNA TRANSCRIBED FROM cccDNA

20210062259 ยท 2021-03-04

    Inventors

    Cpc classification

    International classification

    Abstract

    Methods for the rapid detection of the presence or absence of Hepatitis B Virus (HBV) in a biological or non-biological sample are described. The methods can include performing an amplifying step, a hybridizing step, and a detecting step. Furthermore, primers, competitive blocking oligonucleotides, and probes targeting HBV (in particular HBV RNA, in particular, HBV RNA transcribed from cccDNA, such as pgRNA) and kits are provided that are designed for the detection of HBV (in particular HBV RNA, in particular, HBV RNA transcribed from cccDNA, such as pgRNA).

    Claims

    1. A method for detecting one or more target nucleic acids of Hepatitis B Virus (HBV) RNA in a sample, the method comprising: (a) providing a sample; (b) performing an amplification step comprising contacting the sample with one or more competitive blocking oligonucleotides and one or more set of primers, wherein the one or more set of primers comprises one or more forward primer and one or more reverse transcription (RT) primer that also functions as a reverse primer, to produce an amplification product, if the one or more target nucleic acids of HBV RNA is present in the sample; (c) performing a hybridization step, comprising contacting the amplification product, if the one or more target nucleic acids of HBV RNA is present in the sample, with one or more probes; and (d) performing a detection step, comprising detecting the presence or absence of the amplification product, wherein the presence of the amplification product is indicative of the presence of the one or more target nucleic acids of HBV RNA in the sample, and wherein the absence of the amplification product is indicative of the absence of the one or more target nucleic acids of HBV RNA in the sample.

    2. The method of claim 1, wherein the one or more competitive blocking oligonucleotides hybridizes to any homologous HBV DNA that may be present in the sample, thereby preventing the binding of the one or more set of primers to any homologous HBV DNA that may be present in the sample.

    3. The method of claim 1, wherein the one or more target nucleic acids of HBV RNA is derived from covalently-closed circular double-stranded DNA (cccDNA).

    4. The method of claim 3, wherein the cccDNA is HBV pre-genomic RNA (pgRNA).

    5. The method of claim 1, wherein the one or more target nucleic acids of HBV RNA comprises a poly-A tail.

    6. The method of claim 5, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises a poly-T section to bind to the poly-A tail of the one or more target nucleic acids of HBV RNA.

    7. The method of claim 1, wherein the sample is a biological sample.

    8. The method of claim 7, wherein the biological sample is plasma.

    9. The method of claim 7, wherein the biological sample is blood.

    10. The method of any one of claims 1-9, wherein: (i) the one or more forward primer comprises a nucleic acid sequence of SEQ ID NO:387, or a complement thereof; (ii) the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:34, 35, 43, 94, 96, 112, 116, 117, 119, 121, 123, 124, 141, 142, 151, 152, 153, 154, 155, 157, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, and 190, or a complement thereof; (iii) the one or more probes comprises a nucleic acid sequence of SEQ ID NO:388, or a complement thereof; and (iv) the one or more competitive blocking oligonucleotides comprises a nucleic acid sequence of a group selected from SEQ ID NOs:1, 2, 3, 4, 5, 9, 10, 11, 14, and 15, or a complement thereof.

    11. The method of claim 10, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises two nucleic sequences, wherein the two nucleic acid sequences comprise the nucleic acid sequences of SEQ ID NOs:151 and 152, or complements thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    12. The method of claim 10, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequences of SEQ ID NO:96, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    13. The method of claim 10, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequences of SEQ ID NO:43, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:2, or a complement thereof.

    14. The method of claim 10, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:96, 112, 116, and 117, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:2, or a complement thereof.

    15. The method of claim 10, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:94, 96, 116, 117, 119, 121, 123, 124, 151, 153, 155, and 157, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    16. The method of claim 10, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:142, 161, 162, 163, 164, 165, 166, 167, 168, 169, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, and 190, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    17. The method of claim 10, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:141, 153, 157, 161, 163, 169, 171, 173, 175, 177, 179, 181, 183, 185, 188, and 190, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    18. The method of claim 10, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:35, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:1, 2, 3, 4, and 5, or a complement thereof.

    19. The method of claim 10, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:34, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:2, 9, 10, 11, and 14, or a complement thereof.

    20. The method of claim 10, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:151, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:2, 10, 11, and 15, or a complement thereof.

    21. A method for detecting one or more target nucleic acids of Hepatitis B Virus (HBV) RNA in a sample, the method comprising: (a) providing a sample; (b) performing an amplification step comprising contacting the sample with one or more competitive blocking oligonucleotides and one or more set of primers, wherein the one or more set of primers comprises one or more forward primer and one or more one reverse transcription (RT) primer that also functions as a reverse primer, to produce an amplification product, if the one or more target nucleic acids of HBV RNA is present in the sample; (c) performing a hybridization step, comprising contacting the amplification product, if the one or more target nucleic acids of HBV RNA is present in the sample, with one or more probes; and (d) performing a detection step, comprising detecting the presence or absence of the amplification product, wherein the presence of the amplification product is indicative of the presence of the one or more target nucleic acids of HBV RNA in the sample, and wherein the absence of the amplification product is indicative of the absence of the one or more target nucleic acids of HBV RNA in the sample, and wherein: the one or more set of primers comprises one or more one forward primer and one or more one reverse transcription (RT) primer that also functions as a reverse primer, and wherein: (i) the one or more one forward primer comprises a nucleic acid sequence of SEQ ID NO:387, or a complement thereof; (ii) the one or more one reverse transcription (RT) primer that also functions as a reverse primer comprises a poly-T section, and comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs: 34, 35, 43, 94, 96, 112, 116, 117, 119, 121, 123, 124, 141, 142, 151, 152, 153, 154, 155, 157, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, and 190, or a complement thereof; (iii) the one or more probes comprises a nucleic acid sequence of SEQ ID NO:388, or a complement thereof; and (iv) the one or more competitive blocking oligonucleotides comprises a nucleic acid of a group selected from SEQ ID NOs:1, 2, 3, 4, 5, 9, 10, 11, 14, and 15, or a complement thereof.

    22. The method of claim 21, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises two nucleic sequences, wherein the two nucleic acid sequences comprise the nucleic acid sequences of SEQ ID NOs:151 and 152, or complements thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    23. The method of claim 21, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequences of SEQ ID NO:96, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    24. The method of claim 21, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequences of SEQ ID NO:43, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:2, or a complement thereof.

    25. The method of claim 21, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:96, 112, 116, and 117, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:2, or a complement thereof.

    26. The method of claim 21, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:94, 96, 116, 117, 119, 121, 123, 124, 151, 153, 155, and 157, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    27. The method of claim 21, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:142, 161, 162, 163, 164, 165, 166, 167, 168, 169, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, and 190, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    28. The method of claim 21, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:141, 153, 157, 161, 163, 169, 171, 173, 175, 177, 179, 181, 183, 185, 188, and 190, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    29. The method of claim 21, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:35, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:1, 2, 3, 4, and 5, or a complement thereof.

    30. The method of claim 21, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:34, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:2, 9, 10, 11, and 14, or a complement thereof.

    31. The method of claim 21, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:151, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:2, 10, 11, and 15, or a complement thereof.

    32. The method of claim 21, wherein the one or more competitive blocking oligonucleotides hybridizes to any homologous HBV DNA that may be present in the sample, thereby preventing the binding of the one or more set of primers to any homologous HBV DNA that may be present in the sample.

    33. The method of claim 21, wherein the one or more target nucleic acids of HBV RNA is derived from covalently-closed circular double-stranded DNA (cccDNA).

    34. The method of claim 33, wherein the cccDNA is HBV pre-genomic RNA (pgRNA).

    35. The method of claim 21, wherein the one or more target nucleic acids of HBV RNA comprises a poly-A tail.

    36. The method of claim 35, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises a poly-T section to bind to the poly-A tail of the one or more target nucleic acids of HBV RNA.

    37. The method of claim 21, wherein the sample is a biological sample.

    38. The method of claim 37, wherein the biological sample is plasma.

    39. The method of claim 37, wherein the biological sample is blood.

    40. A kit for detecting one or more target nucleic acids of Hepatitis B Virus (HBV) RNA that may be present in a sample, the kit comprising amplification reagents comprising: (a) a nucleic acid polymerase; (b) nucleotide monomers; (c) one or more set of primers, wherein the one or more set of primers comprises one or more forward primer and one or more reverse transcription (RT) primer that also functions as a reverse primer; and (d) one or more probes, and (e) one or more competitive blocking oligonucleotides.

    41. The kit of claim 40, wherein the one or more competitive blocking oligonucleotides hybridizes to any homologous HBV DNA that may be present in the sample, thereby preventing the binding of the one or more set of primers to any homologous HBV DNA that may be present in the sample.

    42. The kit of claim 40, wherein the one or more target nucleic acids of HBV RNA is derived from covalently-closed circular double-stranded DNA (cccDNA).

    43. The kit of claim 42, wherein the cccDNA is HBV pre-genomic RNA (pgRNA).

    44. The kit of claim 40, wherein the one or more target nucleic acids of HBV RNA comprises a poly-A tail.

    45. The kit of claim 44, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises a poly-T section to bind to the poly-A tail of the one or more target nucleic acids of HBV RNA.

    46. The kit of claim 40, wherein the sample is a biological sample.

    47. The kit of claim 46, wherein the biological sample is plasma.

    48. The kit of claim 46, wherein the biological sample is blood.

    49. The kit of any one of claims 40-48, wherein: (i) the one or more forward primer comprises a nucleic acid sequence of SEQ ID NO:387, or a complement thereof; (ii) the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs: 34, 35, 43, 94, 96, 112, 116, 117, 119, 121, 123, 124, 141, 142, 151, 152, 153, 154, 155, 157, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, and 190, or a complement thereof; (iii) the one or more probes comprises a nucleic acid sequence of SEQ ID NO:388, or a complement thereof; and (iv) the one or more competitive blocking oligonucleotides comprises a nucleic acid of a group selected from SEQ ID NOs:1, 2, 3, 4, 5, 9, 10, 11, 14, and 15, or a complement thereof.

    50. The kit of claim 49, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises two nucleic sequences, wherein the two nucleic acid sequences comprise the nucleic acid sequences of SEQ ID NOs:151 and 152, or complements thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    51. The kit of claim 49, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequences of SEQ ID NO:96, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    52. The kit of claim 49, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequences of SEQ ID NO:43, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:2, or a complement thereof.

    53. The kit of claim 49, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:96, 112, 116, and 117, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:2, or a complement thereof.

    54. The kit of claim 49, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:94, 96, 116, 117, 119, 121, 123, 124, 151, 153, 155, and 157, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    55. The kit of claim 49, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:142, 161, 162, 163, 164, 165, 166, 167, 168, 169, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, and 190, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    56. The kit of claim 49, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:141, 153, 157, 161, 163, 169, 171, 173, 175, 177, 179, 181, 183, 185, 188, and 190, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    57. The kit of claim 49, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:35, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:1, 2, 3, 4, and 5, or a complement thereof.

    58. The kit of claim 49, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:34, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:2, 9, 10, 11, and 14, or a complement thereof.

    59. The kit of claim 49, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:151, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:2, 10, 11, and 15, or a complement thereof.

    60. A kit for detecting Hepatitis B Virus (HBV) RNA in a sample, the method comprising: (a) a nucleic acid polymerase; (b) nucleotide monomers; (c) one or more set of primers, wherein the one or more set of primers comprises one or more forward primer and one or more reverse transcription (RT) primer that also functions as a reverse primer; (d) one or more probes; and (e) one or more competitive blocking oligonucleotides; and wherein: (i) the one or more forward primer comprises a nucleic acid sequence of SEQ ID NO:387, or a complement thereof; (ii) the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises a poly-T section, and wherein the one or more reverse transcription primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs: 34, 35, 43, 94, 96, 112, 116, 117, 119, 121, 123, 124, 141, 142, 151, 152, 153, 154, 155, 157, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, and 190, or a complement thereof; (iii) the one or more probes comprises a nucleic acid sequence of SEQ ID NO:388, or a complement thereof; and (iv) the one or more competitive blocking oligonucleotides comprises a nucleic acid of a group selected from SEQ ID NOs:1, 2, 3, 4, 5, 9, 10, 11, 14, and 15, or a complement thereof.

    61. The kit of claim 60, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises two nucleic sequences, wherein the two nucleic acid sequences comprise the nucleic acid sequences of SEQ ID NOs:151 and 152, or complements thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    62. The kit of claim 60, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequences of SEQ ID NO:96, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    63. The kit of claim 60, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequences of SEQ ID NO:43, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:2, or a complement thereof.

    64. The kit of claim 60, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from of SEQ ID NOs:96, 112, 116, and 117, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:2, or a complement thereof.

    65. The kit of claim 60, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:94, 96, 116, 117, 119, 121, 123, 124, 151, 153, 155, and 157, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    66. The kit of claim 60, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:142, 161, 162, 163, 164, 165, 166, 167, 168, 169, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, and 190, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    67. The kit of claim 60, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:141, 153, 157, 161, 163, 169, 171, 173, 175, 177, 179, 181, 183, 185, 188, and 190, or a complement thereof; and the one or more competitive blocking oligonucleotides comprise one sequence comprising the nucleic acid sequence of SEQ ID NO:11, or a complement thereof.

    68. The kit of claim 60, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:35, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:1, 2, 3, 4, and 5, or a complement thereof.

    69. The kit of claim 60, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:34, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:2, 9, 10, 11, and 14, or a complement thereof.

    70. The kit of claim 60, wherein the one or more reverse transcription (RT) primer that also functions as a reverse comprises the nucleic acid sequence of SEQ ID NO:151, or a complement thereof; and the one or more competitive blocking oligonucleotides comprises one or more nucleic acid sequences of a group selected from SEQ ID NOs:2, 10, 11, and 15, or a complement thereof.

    71. The kit of claim 60, wherein the one or more competitive blocking oligonucleotides hybridizes to any homologous HBV DNA that may be present in the sample, thereby preventing the binding of the one or more set of primers to any homologous HBV DNA that may be present in the sample.

    72. The kit of claim 60, wherein the one or more target nucleic acids of HBV RNA is derived from covalently-closed circular double-stranded DNA (cccDNA).

    73. The kit of claim 72, wherein the cccDNA is HBV pre-genomic RNA (pgRNA).

    74. The kit of claim 60, wherein the one or more target nucleic acids of HBV RNA comprises a poly-A tail.

    75. The kit of claim 74, wherein the one or more reverse transcription (RT) primer that also functions as a reverse primer comprises a poly-T section to bind to the poly-A tail of the one or more target nucleic acids of HBV RNA.

    76. The kit of claim 60, wherein the sample is a biological sample.

    77. The kit of claim 76, wherein the biological sample is plasma.

    78. The kit of claim 76, wherein the biological sample is blood.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0036] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

    [0037] FIG. 1 shows the HBV poly-A target assay design, depicting the RT oligonucleotide, which can also act as a reverse primer and which has a poly-T section to bind to the poly-A tail of the target mRNA, without a competitive blocking oligonucleotide.

    [0038] FIG. 2 shows the HBV poly-A target assay design, depicting the RT oligonucleotide, which can also act as a reverse primer and which has a poly-T section to bind to the poly-A tail of the target mRNA, along with a competitive blocking oligonucleotide.

    [0039] FIG. 3 shows real time PCR growth curves of an HBV RNA poly-A target assay, showing greater amplicon production with greater amount of starting copies of RNA template containing the HBV poly-A site sequence with poly-A tail, in the presence of an RT primer and a competitive blocking oligonucleotide.

    [0040] FIG. 4 shows real time PCR growth curves of an HBV RNA poly-A target assay with no RNA target but in the presence of 250,000 IU of HBV DNA (estimated equivalent to 1 million IU/mL in a sample before extraction and processing), showing amplicon production (off-target DNA amplification) in the presence of an RT primer without any blocker, and no amplicon production in the presence of an RT primer and a competitive blocking oligonucleotide.

    [0041] FIG. 5 shows CT values of an HBV RNA poly-A target assay, showing specificity against HBV DNA, under conditions of DNA only samples, mixed DNA+RNA samples, or mixed samples with competitive blocker.

    [0042] FIG. 6 shows a comparison of relative fluorescence intensity (RFI) of HBV RNA poly-A target assay, showing specificity against HBV DNA, under conditions of DNA only (with or without competitive blocker), and mixed DNA+RNA samples (with or without competitive blocker).

    [0043] FIG. 7 shows real time PCR growth curves of an HBV RNA poly-A target assay with: (top row) 100/copies mL RNA target in serum, showing amplicon production in the presence of an RT primer without any blocker, and no change in the presence of an RT primer and a competitive blocking oligonucleotide. (bottom row) no RNA target but in the presence of 100,000 IU/mL of HBV DNA in serum, showing low-signal amplicon production (off-target DNA amplification) in the presence of an RT primer without any blocker, and no amplicon production in the presence of an RT primer and a competitive blocking oligonucleotide.

    [0044] FIG. 8 shows real time PCR growth curves of an HBV RNA poly-A target assays with an RNA input level estimated to be equivalent of 100 copies/mL RNA template in a sample before extraction and processing, where the sample contains 125 ng/rxn human DNA background. Four different RT/reverse primers were tested, with different designs and modified bases, showing the performance improvements that can be seen with the adjustment of the oligo design and chemical modifications.

    [0045] FIG. 9 shows CT values of an HBV RNA poly-A target assay with a competitive blocking oligonucleotide, showing tolerance of high HBV DNA input under conditions of mixed DNA+RNA samples. Without DNA added, the assay shows linearity from 110.sup.9 to 10 copies/mL HBV RNA. With DNA added at the high level of 110.sup.9 IU/mL, the RNA assay is unaffected except at 100 and 10 copies/mL RNA.

    DETAILED DESCRIPTION OF THE INVENTION

    [0046] Diagnosis of HBV infection by nucleic acid amplification provides a method for rapidly, accurately, reliably, specifically, and sensitively detecting and/or quantitating the viral infection. A real-time PCR assay for detecting HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA) in the presence of homologous HBV DNA in a non-biological or biological samples is described herein. Primers (including RT primers), competitive blocking oligonucleotides, and probes for detecting and/or quantitating HBV are provided, as are articles of manufacture or kits containing such primers, competitive blocking oligonucleotides, and probes. The increased specificity and sensitivity of real-time PCR for detection of HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA) compared to other methods, as well as the improved features of real-time PCR including sample containment and real-time detection and quantitating of the amplified product, make feasible the implementation of this technology for routine diagnosis of HBV infections and therapeutic efficacy, in the clinical laboratory. Moreover, this real-time PCR assay for detection of HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA) may provide important information regarding patient status (e.g., functional cure, sterilizing cure, and/or partial cure). As an example, a patient may have DNA viral titer depleted by a nucleoside analog treatment but retain high circulating HBV RNA levels indicative of continued presence and transcriptional activity of cccDNA in the infected liver cells, so that removal of treatment would cause a rebound in HBV. An another example, a patient on treatment may have both DNA and RNA markers suppressed, an indication that cccDNA has been depleted in the liver, however still have HbsAg produced from cells with integrated copies of HBV, which however cannot produce pgRNA and replicating virus.

    [0047] Additionally, this technology may be employed for blood screening as well as for prognosis. This HBV RNA detection assay may also be multiplexed with other assays for the detection of other nucleic acids, e.g., other viruses, including, but not limited to, HIV, HCV and other hepatitis viruses, such as HAV, HEV, and/or HDV, in parallel.

    [0048] The present disclosure includes oligonucleotide primers (including RT primers), competitive blocking oligonucleotides, and fluorescent labeled hydrolysis probes that hybridize to the HBV nucleic acids, in particular HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA), in order to specifically identify HBV RNA using, e.g., TaqMan amplification and detection technology.

    [0049] The disclosed methods may include performing at least one cycling step that includes amplifying one or more portions of the nucleic acid molecule gene target from a sample using one or more pairs of primers. HBV primer(s) or HBV RT primer(s) as used herein refer to oligonucleotide primers that specifically anneal to nucleic acid sequences found in HBV or HBV RNA (such as HBV pgRNA), and initiate reverse transcription and/or DNA synthesis therefrom under appropriate conditions producing the respective amplification products. An example of a nucleic acid sequences found in HBV that is suitable for targeting include HBV pgRNA. Each of the discussed HBV primers (including RT primers) anneals to a target such that at least a portion of each amplification product contains nucleic acid sequence corresponding to the target. The one or more amplification products are produced provided that one or more nucleic acid is present in the sample, thus the presence of the one or more amplification products is indicative of the presence of HBV and/or HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA) in the sample. The amplification product should contain the nucleic acid sequences that are complementary to one or more detectable probes for HBV and/or HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA). HBV probe(s) as used herein refer to oligonucleotide probes that specifically anneal to nucleic acid sequences found in the HBV target nucleic acid (e.g., HBV RNA, or HBV pgRNA). Each cycling step includes an amplification step, a hybridization step, and a detection step, in which the sample is contacted with the one or more detectable HBV or HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA) probes for detection of the presence or absence of HBV and/or HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA) in the sample. The term blocking oligonucleotide (or competitive blocking oligonucleotide, or blocker) as used herein refer to non-extensible oligonucleotides that specifically anneal to complement DNA and inhibit reverse transcription and DNA polymerization. In the presence of a blocking oligonucleotide any HBV DNA that may be present in the sample will hybridize to the blocking oligonucleotide, thereby rendering the HBV DNA unable to bind to primers targeting the polyA junction of HBV RNA, which may include short sequences matching both HBV DNA and HBV RNA. Thus, the blocking oligonucleotide prevents primer binding to homologous HBV DNA that might be in the sample.

    [0050] As used herein, the term amplifying refers to the process of synthesizing nucleic acid molecules that are complementary to one or both strands of a template nucleic acid molecule (e.g., nucleic acid molecules from the HBV and/or HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA)). Amplifying a nucleic acid molecule typically includes denaturing the template nucleic acid, annealing primers to the template nucleic acid at a temperature that is below the melting temperatures of the primers, and enzymatically elongating from the primers to generate an amplification product. Amplification typically requires the presence of deoxyribonucleoside triphosphates, a DNA polymerase enzyme (e.g., Platinum Taq) and an appropriate buffer and/or co-factors for optimal activity of the polymerase enzyme (e.g., MgCl.sub.2 and/or KCl).

    [0051] The term primer as used herein is known to those skilled in the art and refers to oligomeric compounds, primarily to oligonucleotides but also to modified oligonucleotides that are able to prime DNA synthesis by a template-dependent DNA polymerase, i.e., the 3-end of the oligonucleotide provides a free 3-OH group where further nucleotides may be attached by a template-dependent DNA polymerase establishing 3 to 5 phosphodiester linkage whereby deoxynucleoside triphosphates are used and whereby pyrophosphate is released. In some embodiments, the primer is also a reverse transcription (RT) primer (RT primer). There are several types of RT primers known in the art, including oligo(dT)N primers, anchored oligo(dT)N primers, random hexamer primers, and sequence specific primers. In some embodiments, the RT primer will anneal to RNA (e.g., HBV RNA, in particular, HBV RNA transcribed from cccDNA, such as pgRNA), and extend to generate a DNA complement (i.e., reverse transcription of the target). In some embodiments, the RT primer targets poly-A-containing HBV RNA, and therefore the RT primer is a poly-T containing oligonucleotide.

    [0052] The term hybridizing refers to the annealing of one or more probes to an amplification product. Hybridization conditions typically include a temperature that is below the melting temperature of the probes but that avoids non-specific hybridization of the probes.

    [0053] The term 5 to 3 nuclease activity refers to an activity of a nucleic acid polymerase, typically associated with the nucleic acid strand synthesis, whereby nucleotides are removed from the 5 end of nucleic acid strand.

    [0054] The term thermostable polymerase refers to a polymerase enzyme that is heat stable, i.e., the enzyme catalyzes the formation of primer extension products complementary to a template and does not irreversibly denature when subjected to the elevated temperatures for the time necessary to effect denaturation of double-stranded template nucleic acids. Generally, the synthesis is initiated at the 3 end of each primer and proceeds in the 5 to 3 direction along the template strand. Thermostable polymerases have been isolated from Thermus flavus, T. ruber, T. thermophilus, T. aquaticus, T. lacteus, T. rubens, Bacillus stearothermophilus, and Methanothermus fervidus. Nonetheless, polymerases that are not thermostable also can be employed in PCR assays provided the enzyme is replenished, if necessary.

    [0055] The term complement thereof refers to nucleic acid that is both the same length as, and exactly complementary to, a given nucleic acid.

    [0056] The term extension or elongation when used with respect to nucleic acids refers to when additional nucleotides (or other analogous molecules) are incorporated into the nucleic acids. For example, a nucleic acid is optionally extended by a nucleotide incorporating biocatalyst, such as a polymerase that typically adds nucleotides at the 3 terminal end of a nucleic acid.

    [0057] The terms identical or percent identity in the context of two or more nucleic acid sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same, when compared and aligned for maximum correspondence, e.g., as measured using one of the sequence comparison algorithms available to persons of skill or by visual inspection. Exemplary algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST programs, which are described in, e.g., Altschul et al. (1990) Basic local alignment search tool J. Mol. Biol. 215:403-410, Gish et al. (1993) Identification of protein coding regions by database similarity search Nature Genet. 3:266-272, Madden et al. (1996) Applications of network BLAST server Meth. Enzymol. 266:131-141, Altschul et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs Nucleic Acids Res. 25:3389-3402, and Zhang et al. (1997) PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation Genome Res. 7:649-656, which are each incorporated herein by reference.

    [0058] A modified nucleotide in the context of an oligonucleotide refers to an alteration in which at least one nucleotide of the oligonucleotide sequence is replaced by a different nucleotide that provides a desired property to the oligonucleotide. Exemplary modified nucleotides that can be substituted in the oligonucleotides described herein include, e.g., a t-butyl benzyl, a C5-methyl-dC, a C5-ethyl-dC, a C5-methyl-dU, a C5-ethyl-dU, a 2,6-diaminopurine, a C5-propynyl-dC, a C5-propynyl-dU, a C7-propynyl-dA, a C7-propynyl-dG, a C5-propargylamino-dC, a C5-propargylamino-dU, a C7-propargylamino-dA, a C7-propargylamino-dG, a 7-deaza-2-deoxyxanthosine, a pyrazolopyrimidine analog, a pseudo-dU, a nitro pyrrole, a nitro indole, 2-0-methyl ribo-U, 2-0-methyl ribo-C, an N4-ethyl-dC, an N6-methyl-dA, a 5-propynyl dU, a 5-propynyl dC, and the like. Another example of a modified nucleotide includes locked nucleic acid (LNA). An LNA (also known as inaccessible RNA) is a modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2 oxygen and the 4 carbon. This bridge locks the ribose in the 3-endo (North) confirmation, which is often found in the A-form duplexes. The effect of LNA is that the locked ribose conformation enhances base stacking and backbone pre-organization, which significantly increases the hybridization properties (melting temperature) of oligonucleotides. Many other modified nucleotides that can be substituted in the oligonucleotides are referred to herein or are otherwise known in the art. In certain embodiments, modified nucleotide substitutions modify melting temperatures (T.sub.m) of the oligonucleotides relative to the melting temperatures of corresponding unmodified oligonucleotides. To further illustrate, certain modified nucleotide substitutions can reduce non-specific nucleic acid amplification (e.g., minimize primer dimer formation or the like), increase the yield of an intended target amplicon, and/or the like in some embodiments. Examples of these types of nucleic acid modifications are described in, e.g., U.S. Pat. No. 6,001,611, which is incorporated herein by reference. Other modified nucleotide substitutions may alter the stability of the oligonucleotide, or provide other desirable features. For instance, some modifications can make an oligonucleotide non-extensible, which is useful for probes and for the competitive blocking oligonucleotides. Non-extensible ends can be facilitated by, in addition to a phosphate, a C3 spacer, a dideoxy nucleotide, attaching the 3-end of a second oligonucleotide to the 3-end of an oligonucleotide, and the like.

    Detection of HBV Target Nucleic Acid

    [0059] The present disclosure provides methods to detect HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA) by amplifying, for example, a portion of the HBV nucleic acid sequence that is adjacent to a poly-A tail (e.g., HBV RNA transcribed from cccDNA, such as pgRNA). Specifically, primers, competitive blocking oligonucleotides, and probes used to amplify and detect HBV nucleic acid molecule targets are provided by the embodiments in the present disclosure.

    [0060] For detection of HBV RNA (in particular, HBV RNA transcribed from cccDNA, for example pgRNA), primers, competitive blocking oligonucleotides, and probes to amplify HBV target nucleic acid, such as HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA) are provided. HBV nucleic acids other than those exemplified herein can also be used to detect HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA) in a sample. For example, functional variants can be evaluated for specificity and/or sensitivity by those of skill in the art using routine methods. Representative functional variants can include, e.g., one or more deletions, insertions, and/or substitutions in the HBV nucleic acids disclosed herein.

    [0061] More specifically, embodiments of the oligonucleotides each include a nucleic acid with a sequence selected from SEQ ID NOs:1-392, a substantially identical variant thereof in which the variant has at least, e.g., 80%, 90%, or 95% sequence identity to one of SEQ ID NOs:1-392, or a complement SEQ ID NOs:1-192 and the variant. For instance, the number of Ts in the polyT stretch of the polyA binding primers can vary (8, 10, 12, 15, 17, 18 and so on), the presence and length of the HBV-binding or other anchor at the junction of the polyA tail can vary (being 5,7,8 bp long and so on), and the presence, type, number, and locations of modified bases in the primer can be varied.

    [0062] In one embodiment, the above described sets of HBV primers, competitive blocking oligonucleotides, and probes are used in order to provide for detection of HBV RNA (in particular, HBV RNA transcribed from cccDNA, such as pgRNA) in a biological sample suspected of containing HBV (sequence listing, where N is meant to refer to any nucleotide). The sets of primers, competitive blocking oligonucleotides, and probes may comprise or consist of the primers, competitive blocking oligonucleotides, and probes specific for HBV nucleic acid sequences (e.g., HBV RNA, such as HBV RNA transcribed from cccDNA, such as pgRNA), comprising or consisting of the nucleic acid sequences of SEQ ID NOs:1-392. In another embodiment, the primers, competitive blocking oligonucleotides, and probes for the HBV target (including HBV RNA, such as HBV RNA transcribed from cccDNA (e.g., HBV pgRNA) comprise or consist of a functionally active variant of any of the primers, competitive blocking oligonucleotides, and probes of SEQ ID NOs: 1-392.

    [0063] A functionally active variant of any of the primers (including RT primers), competitive blocking oligonucleotides, and/or probes of SEQ ID NOs: 1-392 may be identified by using the primers (including RT primers), competitive blocking oligonucleotides, and/or probes in the disclosed methods. A functionally active variant of a primer, competitive blocking oligonucleotide, and/or probe of any of the SEQ ID NOs: 1-392 pertains to a primer, competitive blocking oligonucleotide, and/or probe which provide a similar or higher specificity and sensitivity in the described method or kit as compared to the respective sequence of SEQ ID NOs: 1-392.

    [0064] The variant may, e.g., vary from the sequence of SEQ ID NOs: 1-392 by one or more nucleotide additions, deletions or substitutions such as one or more nucleotide additions, deletions or substitutions at the 5 end and/or the 3 end of the respective sequence of SEQ ID NOs: 1-392. As detailed above, a primer (including RT primer), competitive blocking oligonucleotide, and/or probe may be chemically modified, i.e., a primer, competitive blocking oligonucleotide, and/or probe may comprise a modified nucleotide or a non-nucleotide compound. A primer, competitive blocking oligonucleotide, and/or probe is then a modified oligonucleotide. Modified nucleotides (or nucleotide analogs), as described previously, differ from a natural nucleotide by some modification but still consist of a base or base-like compound, a pentofuranosyl sugar or a pentofuranosyl sugar-like compound, a phosphate portion or phosphate-like portion, or combinations thereof. For example, a label may be attached to the base portion of a nucleotide whereby a modified nucleotide is obtained. A natural base in a nucleotide may also be replaced by, e.g., a 7-desazapurine whereby a modified nucleotide is obtained as well. The terms modified nucleotide or nucleotide analog are used interchangeably in the present application. A modified nucleoside (or nucleoside analog) differs from a natural nucleoside by some modification in the manner as outlined above for a modified nucleotide (or a nucleotide analog).

    [0065] Oligonucleotides including modified oligonucleotides and oligonucleotide analogs that amplify a nucleic acid molecule encoding the HBV target, e.g., nucleic acids encoding alternative portions of HBV can be designed using, for example, a computer program such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.). Important features when designing oligonucleotides to be used as amplification primers include, but are not limited to, an appropriate size amplification product to facilitate detection (e.g., by electrophoresis), similar melting temperatures for the members of a pair of primers, and the length of each primer (i.e., the primers need to be long enough to anneal with sequence-specificity and to initiate synthesis but not so long that fidelity is reduced during oligonucleotide synthesis). Typically, oligonucleotide primers are 8 to 50 nucleotides in length (e.g., 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, or 50 nucleotides in length).

    [0066] In the assay, a competitive blocking oligonucleotide, competitive blocking nucleotides, competitive blocking nucleic acids, blocking oligonucleotide, blocking nucleotides, blocker, and/or blocking nucleic acids are employed, and are terms that refer to a competitive blocking oligonucleotides bind to a region in the homologous genomic HBV DNA that is identical to the region targeted by the primer (e.g., RT primer), but that has higher affinity for the DNA than the RT primer does, for instance by not containing the polyA sequence in the RT primer but instead extending into the corresponding genomic sequence. That is, the competitive blocking oligonucleotide competes with the primer for binding to the target region, but the designs can be made in a way (such as differences in length, T.sub.m, or position of sequences bound) to allow the RT primer to have greater affinity for the RNA while the competitive blocking oligonucleotide has greater affinity for the DNA. The binding of the competitive blocking oligonucleotide to the homologous genomic HBV DNA prevents binding of the primer (e.g., RT primer), and therefore reduces and/or prevents the unwanted amplification of the homologous genomic HBV DNA.

    [0067] The set of forward primers for detection of the presence or absence of HBV nucleic acids, such as HBV RNA (such as HBV derived from cccDNA, such as pgRNA), include the sequences of SEQ ID NOs:20, 23, 24, 210, 213, 214, 387, and 389. The set of reverse transcription primers, which can function as reverse primers (e.g., RT/reverse primers) for detection of the presence or absence of HBV nucleic acids, such as HBV RNA (such as HBV derived from cccDNA, such as pgRNA), include the sequences of SEQ ID NOs:16, 18, 19, 25-30, 33-190, 206, 208, 209, 215-220, and 223-380. The set of competitive blocking oligonucleotides for increasing specificity of the detection of the presence or absence of HBV nucleic acids, such as HBV RNA (such as HBV derived from cccDNA, such as pgRNA), include the sequences of SEQ ID NOs:1-15, 21, 22, 191-205, 211, and 212. The set of probes for detection of the presence or absence of HBV nucleic acids, such as HBV RNA (such as HBV derived from cccDNA, such as pgRNA), include the sequences of SEQ ID NOs:17, 31, 32, 207, 221, 222, 381-386, 388, and 390-392.

    [0068] In addition to a set of primers and competitive blocking oligonucleotides, the methods may use one or more probes in order to detect the presence or absence of HBV nucleic acid, such as HBV RNA (such as HBV derived from cccDNA, such as pgRNA). The term probe refers to synthetically or biologically produced nucleic acids (DNA or RNA), which by design or selection, contain specific nucleotide sequences that allow them to hybridize under defined predetermined stringencies specifically (i.e., preferentially) to target nucleic acids, in the present case to HBV nucleic acids (including HBV RNA, such as HBV RNA transcribed from cccDNA, such as pgRNA) (target) nucleic acid. A probe can be referred to as a detection probe meaning that it detects the target nucleic acid.

    [0069] In some embodiments, the described HBV nucleic acid probes (including probes for HBV RNA, such as HBV RNA transcribed from cccDNA, such as pgRNA) can be labeled with at least one fluorescent label. In one embodiment, the HBV nucleic acids probes (including probes for HBV RNA, such as HBV RNA transcribed from cccDNA, such as pgRNA) can be labeled with a donor fluorescent moiety, e.g., a fluorescent dye, and a corresponding acceptor moiety, e.g., a quencher. In one embodiment, the probe comprises or consists of a fluorescent moiety and the nucleic acid sequences comprise or consist of SEQ ID NOs:17, 31, 32, 207, 221, 222, 381-386, 388, and 390-392.

    [0070] Designing oligonucleotides to be used as probes can be performed in a manner similar to the design of primers. Embodiments may use a single probe or a pair of probes for detection of the amplification product. Depending on the embodiment, the probe(s) used may comprise at least one label and/or at least one quencher moiety. As with the primers, the probes usually have melting temperatures appropriate for the thermal cycling parameters of the amplification method, and the length of each probe must be sufficient for sequence-specific hybridization to occur but not so long that fidelity is reduced during synthesis. Oligonucleotide probes are generally 15 to 40 (e.g., 16, 18, 20, 21, 22, 23, 24, or 25) nucleotides in length.

    [0071] Constructs can include vectors each containing one or more of the sequences of the primers, competitive blocking oligonucleotides, and probes nucleic acid molecules for HBV (e.g., SEQ ID NOs:1-392). Constructs can be used, for example, as control template nucleic acid molecules. Vectors suitable for use are commercially available and/or produced by recombinant nucleic acid technology methods routine in the art. HBV nucleic acid molecules can be obtained, for example, by chemical synthesis, direct cloning from HBV, or by nucleic acid amplification.

    [0072] Constructs suitable for use in the methods typically include, in addition to the HBV nucleic acids molecules (e.g., a nucleic acid molecule that contains one or more sequences of SEQ ID NOs:1-392), sequences encoding a selectable marker (e.g., an antibiotic resistance gene) for selecting desired constructs and/or transformants, and an origin of replication. The choice of vector systems usually depends upon several factors, including, but not limited to, the choice of host cells, replication efficiency, selectability, inducibility, and the ease of recovery.

    [0073] Constructs containing HBV nucleic acids molecules can be propagated in a host cell. As used herein, the term host cell is meant to include prokaryotes and eukaryotes such as yeast, plant and animal cells. Prokaryotic hosts may include E. coli, Salmonella typhimurium, Serratia marcescens, and Bacillus subtilis. Eukaryotic hosts include yeasts such as S. cerevisiae, S. pombe, Pichia pastoris, mammalian cells such as COS cells or Chinese hamster ovary (CHO) cells, insect cells, and plant cells such as Arabidopsis thaliana and Nicotiana tabacum. A construct can be introduced into a host cell using any of the techniques commonly known to those of ordinary skill in the art. For example, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer are common methods for introducing nucleic acids into host cells. In addition, naked DNA can be delivered directly to cells (see, e.g., U.S. Pat. Nos. 5,580,859 and 5,589,466).

    [0074] Constructs (plasmid vectors) can be used to generate RNA molecules, through an in-vitro transcription or other process, producing RNA templates which may also contain the binding sites of primers and probes. RNA template molecules can also be created by synthesis. A type of RNA template that can be created as a control material is an armored RNA (an RNA molecule that is enclosed within a protein coat), involving the production of RNA and a coat protein (such as a viral capsid protein) by a construct (for instance in a bacterial host) and assembly of the coat protein enclosing the RNA molecule. DNA molecules can also be enclosed in a protein coat for use as a control material.

    Polymerase Chain Reaction (PCR)

    [0075] U.S. Pat. Nos. 4,683,202, 4,683,195, 4,800,159, and 4,965,188 disclose conventional PCR techniques. PCR typically employs two oligonucleotide primers that bind to a selected nucleic acid template (e.g., DNA or RNA). Primers useful in some embodiments include oligonucleotides capable of acting as points of initiation of nucleic acid synthesis within the described HBV nucleic acid sequences (e.g., SEQ ID NOs:15, 18-20, 23-30, 33-190, 206, 208-210, 213-220, and 223-380). In some embodiments, the primers are reverse transcription (RT) primers (RT primers). A primer can be purified from a restriction digest by conventional methods, or it can be produced synthetically. The primer is preferably single-stranded for maximum efficiency in amplification, but the primer can be double-stranded. Double-stranded primers are first denatured, i.e., treated to separate the strands. One method of denaturing double stranded nucleic acids is by heating.

    [0076] If the template nucleic acid is double-stranded, it is necessary to separate the two strands before it can be used as a template in PCR. Strand separation can be accomplished by any suitable denaturing method including physical, chemical or enzymatic means. One method of separating the nucleic acid strands involves heating the nucleic acid until it is predominately denatured (e.g., greater than 50%, 60%, 70%, 80%, 90% or 95% denatured). The heating conditions necessary for denaturing template nucleic acid will depend, e.g., on the buffer salt concentration and the length and nucleotide composition of the nucleic acids being denatured, but typically range from about 90 C. to about 105 C. for a time depending on features of the reaction such as temperature and the nucleic acid length. Denaturation is typically performed for about 30 seconds to 4 minutes (e.g., 1 minute to 2 minutes 30 seconds, or 1.5 minutes).

    [0077] If the double-stranded template nucleic acid is denatured by heat, the reaction mixture is allowed to cool to a temperature that promotes annealing of each primer to its target sequence. The temperature for annealing is usually from about 35 C. to about 65 C. (e.g., about 40 C. to about 60 C.; about 45 C. to about 50 C.). Annealing times can be from about 10 seconds to about 1 minute (e.g., about 20 seconds to about 50 seconds; about 30 seconds to about 40 seconds). If necessary, the reaction mixture is then adjusted to a temperature at which the activity of the polymerase is promoted or optimized, i.e., a temperature sufficient for extension to occur from the annealed primer to generate products complementary to the template nucleic acid. The temperature should be sufficient to synthesize an extension product from each primer that is annealed to a nucleic acid template, but should not be so high as to denature an extension product from its complementary template (e.g., the temperature for extension generally ranges from about 40 C. to about 80 C. (e.g., about 50 C. to about 70 C.; about 60 C.). Extension times can be from about 10 seconds to about 5 minutes (e.g., about 30 seconds to about 4 minutes; about 1 minute to about 3 minutes; about 1 minute 30 seconds to about 2 minutes).

    [0078] The genome of a retrovirus or RNA virus is comprised of a ribonucleic acid, i.e., RNA. HBV is a pararetrovirus, which is a non-retrovirus that still uses reverse transcription in its replication process, requiring RNA made by host enzyme for viral replication. In such case, the template nucleic acid, RNA, must first be transcribed into complementary DNA (cDNA) via the action of the enzyme reverse transcriptase. Reverse transcriptases use an RNA template and a short primer complementary to the 3 end of the RNA to direct synthesis of the first strand cDNA, which can then be used directly as a template for polymerase chain reaction. For general preparation of RNA, primers can also be random, or assay/target-specific, depending on the method.

    [0079] PCR assays can employ HBV nucleic acid such as RNA (such as HBV pgRNA) or DNA (cDNA). The template nucleic acid need not be purified; it may be a minor fraction of a complex mixture, such as HBV nucleic acid contained in human cells. HBV nucleic acid molecules may be extracted from a biological sample by routine techniques such as those described in Diagnostic Molecular Microbiology: Principles and Applications (Persing et al. (eds), 1993, American Society for Microbiology, Washington D.C.). Nucleic acids can be obtained from any number of sources, such as plasmids, or natural sources including bacteria, yeast, viruses, organelles, or higher organisms such as plants or animals.

    [0080] The oligonucleotide primers (e.g., the forward primers comprising SEQ ID NOs: 20, 23, 24, 210, 213, 214, 387, and 389; and the RT/reverse primers comprising SEQ ID NOs:16, 18, 19, 25-30, 33-190, 206, 208, 209, 215-220, and 223-380) are combined with PCR reagents under reaction conditions that induce primer extension. For example, chain extension reactions generally include 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 15 mM MgCl.sub.2, 0.001% (w/v) gelatin, 0.5-1.0 g denatured template DNA, 50 pmoles of each oligonucleotide primer, 2.5 U of Taq polymerase, and 10% DMSO). The reactions usually contain 150 to 320 M each of dATP, dCTP, dTTP, dGTP, or one or more analogs thereof.

    [0081] The newly-synthesized strands form a double-stranded molecule that can be used in the succeeding steps of the reaction. The steps of strand separation, annealing, and elongation can be repeated as often as needed to produce the desired quantity of amplification products corresponding to the target HBV nucleic acid molecules (including HBV RNA, such as HBV pgRNA). The limiting factors in the reaction are the amounts of primers, thermostable enzyme, and nucleoside triphosphates present in the reaction. The cycling steps (i.e., denaturation, annealing, and extension) are preferably repeated at least once. For use in detection, the number of cycling steps will depend, e.g., on the nature of the sample. If the sample is a complex mixture of nucleic acids, more cycling steps will be required to amplify the target sequence sufficient for detection. Generally, the cycling steps are repeated at least about 20 times, but may be repeated as many as 40, 60, or even 100 times.

    Fluorescence Resonance Energy Transfer (FRET)

    [0082] FRET technology (see, for example, U.S. Pat. Nos. 4,996,143, 5,565,322, 5,849,489, and 6,162,603) is based on a concept that when a donor fluorescent moiety and a corresponding acceptor fluorescent moiety are positioned within a certain distance of each other, energy transfer takes place between the two fluorescent moieties that can be visualized or otherwise detected and/or quantitated. The donor typically transfers the energy to the acceptor when the donor is excited by light radiation with a suitable wavelength. The acceptor typically re-emits the transferred energy in the form of light radiation with a different wavelength. In certain systems, non-fluorescent energy can be transferred between donor and acceptor moieties, by way of biomolecules that include substantially non-fluorescent donor moieties (see, for example, U.S. Pat. No. 7,741,467).

    [0083] In one example, an oligonucleotide probe can contain a donor fluorescent moiety (e.g., FAM) and a corresponding quencher (e.g., BlackHole Quenchers (BHQ) (such as BHQ2)), which may or not be fluorescent, and which dissipates the transferred energy in a form other than light. When the probe is intact, energy transfer typically occurs between the donor and acceptor moieties such that fluorescent emission from the donor fluorescent moiety is quenched the acceptor moiety. During an extension step of a polymerase chain reaction, a probe bound to an amplification product is cleaved by the 5 to 3 nuclease activity of, e.g., a Taq Polymerase such that the fluorescent emission of the donor fluorescent moiety is no longer quenched. Exemplary probes for this purpose are described in, e.g., U.S. Pat. Nos. 5,210,015, 5,994,056, and 6,171,785. Commonly used donor-acceptor pairs include the FAM-TAMRA pair. Commonly used quenchers are DABCYL and TAMRA. Commonly used dark quenchers include BlackHole Quenchers (BHQ) (such as BHQ2), (Biosearch Technologies, Inc., Novato, Cal.), Iowa Black, (Integrated DNA Tech., Inc., Coralville, Iowa), BlackBerry Quencher 650 (BBQ-650), (Berry & Assoc., Dexter, Mich.).

    [0084] In another example, two oligonucleotide probes, each containing a fluorescent moiety, can hybridize to an amplification product at particular positions determined by the complementarity of the oligonucleotide probes to the HBV RNA target nucleic acid sequence (including HBV RNA, such as HBV RNA transcribed from cccDNA, such as pgRNA). Upon hybridization of the oligonucleotide probes to the amplification product nucleic acid at the appropriate positions, a FRET signal is generated. Hybridization temperatures can range from about 35 C. to about 65 C. for about 10 seconds to about 1 minute.

    [0085] Fluorescent analysis can be carried out using, for example, a photon counting epifluorescent microscope system (containing the appropriate dichroic mirror and filters for monitoring fluorescent emission at the particular range), a photon counting photomultiplier system, or a fluorimeter. Excitation to initiate energy transfer, or to allow direct detection of a fluorophore, can be carried out with an argon ion laser, a high intensity mercury (Hg) arc lamp, a xenon lamp, a fiber optic light source, or other high intensity light source appropriately filtered for excitation in the desired range.

    [0086] As used herein with respect to donor and corresponding acceptor moieties corresponding refers to an acceptor fluorescent moiety or a dark quencher having an absorbance spectrum that overlaps the emission spectrum of the donor fluorescent moiety. The wavelength maximum of the emission spectrum of the acceptor fluorescent moiety should be at least 100 nm greater than the wavelength maximum of the excitation spectrum of the donor fluorescent moiety. Accordingly, efficient non-radiative energy transfer can be produced therebetween.

    [0087] Fluorescent donor and corresponding acceptor moieties are generally chosen for (a) high efficiency Foerster energy transfer; (b) a large final Stokes shift (>100 nm); (c) shift of the emission as far as possible into the red portion of the visible spectrum (>600 nm); and (d) shift of the emission to a higher wavelength than the Raman water fluorescent emission produced by excitation at the donor excitation wavelength. For example, a donor fluorescent moiety can be chosen that has its excitation maximum near a laser line (for example, helium-cadmium 442 nm or Argon 488 nm), a high extinction coefficient, a high quantum yield, and a good overlap of its fluorescent emission with the excitation spectrum of the corresponding acceptor fluorescent moiety. A corresponding acceptor fluorescent moiety can be chosen that has a high extinction coefficient, a high quantum yield, a good overlap of its excitation with the emission of the donor fluorescent moiety, and emission in the red part of the visible spectrum (>600 nm).

    [0088] Representative donor fluorescent moieties that can be used with various acceptor fluorescent moieties in FRET technology include fluorescein, Lucifer Yellow, B-phycoerythrin, 9-acridineisothiocyanate, Lucifer Yellow VS, 4-acetamido-4-isothio-cyanatostilbene-2,2-disulfonic acid, 7-diethylamino-3-(4-isothiocyanatophenyl)-4-methylcoumarin, succinimdyl 1-pyrenebutyrate, and 4-acetamido-4-isothiocyanatostilbene-2,2-disulfonic acid derivatives. Representative acceptor fluorescent moieties, depending upon the donor fluorescent moiety used, include LC Red 640, LC Red 705, Cy5, Cy5.5, Lissamine rhodamine B sulfonyl chloride, tetramethyl rhodamine isothiocyanate, rhodamine x isothiocyanate, erythrosine isothiocyanate, fluorescein, diethylenetriamine pentaacetate, or other chelates of Lanthanide ions (e.g., Europium, or Terbium). Donor and acceptor fluorescent moieties can be obtained, for example, from Molecular Probes (Junction City, Oreg.) or Sigma Chemical Co. (St. Louis, Mo.).

    [0089] The donor and acceptor fluorescent moieties can be attached to the appropriate probe oligonucleotide via a linker arm. The length of each linker arm is important, as the linker arms will affect the distance between the donor and acceptor fluorescent moieties. The length of a linker arm can be the distance in Angstroms () from the nucleotide base to the fluorescent moiety. In general, a linker arm is from about 10 to about 25 . The linker arm may be of the kind described in WO 84/03285. WO 84/03285 also discloses methods for attaching linker arms to a particular nucleotide base, and also for attaching fluorescent moieties to a linker arm.

    [0090] An acceptor fluorescent moiety, such as an LC Red 640, can be combined with an oligonucleotide that contains an amino linker (e.g., C6-amino phosphoramidites available from ABI (Foster City, Calif.) or Glen Research (Sterling, Va.)) to produce, for example, LC Red 640-labeled oligonucleotide. Frequently used linkers to couple a donor fluorescent moiety such as fluorescein to an oligonucleotide include thiourea linkers (FITC-derived, for example, fluorescein-CPG's from Glen Research or ChemGene (Ashland, Mass.)), amide-linkers (fluorescein-NHS-ester-derived, such as CX-fluorescein-CPG from BioGenex (San Ramon, Calif.)), or 3-amino-CPGs that require coupling of a fluorescein-NHS-ester after oligonucleotide synthesis.

    Detection of Hepatitis B Virus (HBV) Amplified Product (Amplicon)

    [0091] The present disclosure provides methods for detecting the presence or absence of HBV RNA (such as HBV RNA from transcribed cccDNA, such as HBV pgRNA) in a biological or non-biological sample. Methods provided avoid problems of sample contamination, false negatives, and false positives. The methods include performing at least one cycling step that includes amplifying a portion of HBV target nucleic acid molecules (such as HBV RNA transcribed from cccDNA, including HBV pgRNA) from a sample using one or more pairs of HBV primers, and a FRET detecting step. Multiple cycling steps are performed, preferably in a thermocycler. Methods can be performed using the HBV primers and probes to detect the presence of HBV target nucleic acid molecules (HBV RNA transcribed from cccDNA, including HBV pgRNA), and the detection of HBV target nucleic acid molecules (HBV RNA transcribed from cccDNA, including HBV pgRNA) indicates the presence of HBV target nucleic acid molecules (HBV RNA transcribed from cccDNA, including HBV pgRNA) in the sample.

    [0092] As described herein, amplification products can be detected using labeled hybridization probes that take advantage of FRET technology. One FRET format utilizes TaqMan technology to detect the presence or absence of an amplification product, and hence, the presence or absence of HBV virus (in particular, HBV nucleic acids, such as HBV RNA (e.g., HBV pgRNA)). TaqMan technology utilizes one single-stranded hybridization probe labeled with, e.g., one fluorescent dye (e.g., HEX) and one quencher (e.g., BHQ), which may or may not be fluorescent. When a first fluorescent moiety is excited with light of a suitable wavelength, the absorbed energy is transferred to a second fluorescent moiety or a dark quencher according to the principles of FRET. The second moiety is generally a quencher molecule. During the annealing step of the PCR reaction, the labeled hybridization probe binds to the target DNA (i.e., the amplification product) and is degraded by the 5 to 3 nuclease activity of, e.g., the Taq Polymerase during the subsequent elongation phase. As a result, the fluorescent moiety and the quencher moiety become spatially separated from one another. As a consequence, upon excitation of the first fluorescent moiety in the absence of the quencher, the fluorescence emission from the first fluorescent moiety can be detected. By way of example, an ABI PRISM 7700 Sequence Detection System (Applied Biosystems) uses TaqMan technology, and is suitable for performing the methods described herein for detecting the presence or absence of HBV target nucleic acid molecules (HBV RNA RNA transcribed from cccDNA including HBV pgRNA) in the sample.

    [0093] Molecular beacons in conjunction with FRET can also be used to detect the presence of an amplification product using the real-time PCR methods. Molecular beacon technology uses a hybridization probe labeled with a first fluorescent moiety and a second fluorescent moiety. The second fluorescent moiety is generally a quencher, and the fluorescent labels are typically located at each end of the probe. Molecular beacon technology uses a probe oligonucleotide having sequences that permit secondary structure formation (e.g., a hairpin). As a result of secondary structure formation within the probe, both fluorescent moieties are in spatial proximity when the probe is in solution. After hybridization to the target nucleic acids (i.e., amplification products), the secondary structure of the probe is disrupted and the fluorescent moieties become separated from one another such that after excitation with light of a suitable wavelength, the emission of the first fluorescent moiety can be detected.

    [0094] Another common format of FRET technology utilizes two hybridization probes. Each probe can be labeled with a different fluorescent moiety and are generally designed to hybridize in close proximity to each other in a target DNA molecule (e.g., an amplification product). A donor fluorescent moiety, for example, fluorescein, is excited at 470 nm by the light source of the LightCycler Instrument. During FRET, the fluorescein transfers its energy to an acceptor fluorescent moiety such as LightCycler-Red 640 (LC Red 640) or LightCycler-Red 705 (LC Red 705). The acceptor fluorescent moiety then emits light of a longer wavelength, which is detected by the optical detection system of the LightCycler instrument. Efficient FRET can only take place when the fluorescent moieties are in direct local proximity and when the emission spectrum of the donor fluorescent moiety overlaps with the absorption spectrum of the acceptor fluorescent moiety. The intensity of the emitted signal can be correlated with the number of original target RNA or DNA molecules (e.g., the number of HBV nucleic acids (e.g., number of HBV RNA transcripts, such as HBV pgRNA). If amplification of HBV target nucleic acid (including HBV RNA, such as HBV pgRNA) occurs and an amplification product is produced, the step of hybridizing results in a detectable signal based upon FRET between the members of the pair of probes.

    [0095] Generally, the presence of FRET indicates the presence of HBV RNA (such as HBV RNA molecules originating from cccDNA (HBV RNA transcribed from cccDNA, including HBV pgRNA) in the sample, and the absence of FRET indicates the absence of HBV RNA molecules (HBV RNA transcribed from cccDNA, including HBV pgRNA) in the sample. Inadequate specimen collection, transportation delays, inappropriate transportation conditions, or use of certain collection swabs (calcium alginate or aluminum shaft) are all conditions that can affect the success and/or accuracy of a test result, however.

    [0096] Representative biological samples that can be used in practicing the methods include, but are not limited to respiratory specimens, urine, fecal specimens, blood specimens, plasma, serum, dermal swabs, nasal swabs, wound swabs, blood cultures, dried blood spots, skin, and soft tissue infections. Other biological samples may include cell culture and plasma separation cards or dried blood spots. Collection and storage methods of biological samples are known to those of skill in the art. Biological samples can be processed (e.g., by nucleic acid extraction methods and/or kits known in the art) to release HBV RNA (HBV RNA transcribed from cccDNA, including HBV pgRNA) or in some cases, the biological sample can be contacted directly with the PCR reaction components and the appropriate oligonucleotides.

    [0097] Melting curve analysis is an additional step that can be included in a cycling profile. Melting curve analysis is based on the fact that DNA melts at a characteristic temperature called the melting temperature (Tm), which is defined as the temperature at which half of the DNA duplexes have separated into single strands. The melting temperature of a DNA depends primarily upon its nucleotide composition. Thus, DNA molecules rich in G and C nucleotides have a higher Tm than those having an abundance of A and T nucleotides. By detecting the temperature at which signal is lost, the melting temperature of probes can be determined. Similarly, by detecting the temperature at which signal is generated, the annealing temperature of probes can be determined. The melting temperature(s) of the HBV probes from the HBV amplification products can confirm the presence or absence of HBV in the sample.

    [0098] Within each thermocycler run, control samples can be cycled as well. Positive control samples can amplify target nucleic acid control template (other than described amplification products of target genes) using, for example, control primers and control probes. Positive control samples can also amplify, for example, a plasmid construct containing the target nucleic acid molecules. Such a plasmid control can be amplified internally (e.g., within the sample) or in a separate sample run side-by-side with the patients' samples using the same primers and probe as used for detection of the intended target. Such controls are indicators of the success or failure of the amplification, hybridization, and/or FRET reaction. Each thermocycler run can also include a negative control that, for example, lacks target template DNA. Negative control can measure contamination. This ensures that the system and reagents would not give rise to a false positive signal. Therefore, control reactions can readily determine, for example, the ability of primers to anneal with sequence-specificity and to initiate elongation, as well as the ability of probes to hybridize with sequence-specificity and for FRET to occur.

    [0099] In an embodiment, the methods include steps to avoid contamination. For example, an enzymatic method utilizing uracil-DNA glycosylase is described in U.S. Pat. Nos. 5,035,996, 5,683,896 and 5,945,313 to reduce or eliminate contamination between one thermocycler run and the next.

    [0100] Conventional PCR methods in conjunction with FRET technology can be used to practice the methods. In one embodiment, a LightCycler instrument is used. The following patent applications describe real-time PCR as used in the LightCycler technology: WO 97/46707, WO 97/46714, and WO 97/46712.

    [0101] The LightCycler can be operated using a PC workstation. Signals from the samples are obtained as the machine positions the capillaries sequentially over the optical unit. The software can display the fluorescence signals in real-time immediately after each measurement. Fluorescent acquisition time is 10-100 milliseconds (msec). After each cycling step, a quantitative display of fluorescence vs. cycle number can be continually updated for all samples. The data generated can be stored for further analysis.

    [0102] The LightCycler 480 II Real-Time PCR System can also be operated using a PC workstation. The instrument has a thermal block cycler and heating and cooling is achieved using Peltier elements. Fluorescent signals from the samples are obtained from the 96-well plate using a high-intensity Xenon lamp which emits light across a broad spectrum. Flexible combination of the built-in filters for specific excitation and emission allows the use of a variety of fluorescent dyes and detection formats. The software can display the fluorescence signals and calculate CT values, and the data generated can be stored for further analysis.

    [0103] As an alternative to FRET, an amplification product can be detected using a double-stranded DNA binding dye such as a fluorescent DNA binding dye (e.g., SYBR Green or SYBR Gold (Molecular Probes)). Upon interaction with the double-stranded nucleic acid, such fluorescent DNA binding dyes emit a fluorescence signal after excitation with light at a suitable wavelength. A double-stranded DNA binding dye such as a nucleic acid intercalating dye also can be used. When double-stranded DNA binding dyes are used, a melting curve analysis is usually performed for confirmation of the presence of the amplification product.

    [0104] One of skill in the art would appreciate that other nucleic acid- or signal-amplification methods may also be employed. Examples of such methods include, without limitation, branched DNA signal amplification, loop-mediated isothermal amplification (LAMP), nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3 SR), strand displacement amplification (SDA), or smart amplification process version 2 (SMAP 2).

    [0105] It is understood that the embodiments of the present disclosure are not limited by the configuration of one or more commercially available instruments.

    Articles of Manufacture/Kits

    [0106] Embodiments of the present disclosure further provide for articles of manufacture or kits to detect HBV RNA (such as HBV RNA transcribed from cccDNA, such as HBV pgRNA). An article of manufacture can include primers and probes used to detect the HBV RNA (such as HBV RNA transcribed from cccDNA, such as HBV pgRNA) target, together with suitable packaging materials. Representative primers and probes for detection of HBV RNA, including HBV RNA transcribed from cccDNA, such as HBV pgRNA are capable of hybridizing to HBV target nucleic acid molecules (including HBV RNA transcribed from cccDNA, such as HBV pgRNA). In addition, the kits may also include suitably packaged reagents and materials needed for DNA immobilization, hybridization, and detection, such solid supports, buffers, enzymes, and DNA standards. Methods of designing primers and probes are disclosed herein, and representative examples of primers and probes that amplify and hybridize to HBV target nucleic acid molecules (HBV RNA, such as HBV RNA transcribed from cccDNA, such as HBV pgRNA) are provided.

    [0107] Articles of manufacture can also include one or more fluorescent moieties for labeling the probes or, alternatively, the probes supplied with the kit can be labeled. For example, an article of manufacture may include a donor and/or an acceptor fluorescent moiety for labeling the HBV probes (which may include probes that target HBV RNA, such as HBV pgRNA). Examples of suitable FRET donor fluorescent moieties and corresponding acceptor fluorescent moieties are provided above.

    [0108] Articles of manufacture can also contain a package insert or package label having instructions thereon for using the primers and probes to detect HBV (including HBV RNA, such as HBV pgRNA), in a sample. Articles of manufacture may additionally include reagents for carrying out the methods disclosed herein (e.g., buffers, polymerase enzymes, co-factors, or agents to prevent contamination). Such reagents may be specific for one of the commercially available instruments described herein.

    [0109] Embodiments of the present disclosure also provide for a set of primers and one or more detectable probes for the detection of HBV RNA, including HBV RNA transcribed from cccDNA, such as HBV pgRNA in a sample. Additional primers and probes can be provided for that target other polyA sites, such as the secondary or truncated polyA site for HBV transcripts that can originate from integrated HBV copies.

    [0110] Embodiments of the present disclosure will be further described in the following examples, which do not limit the scope of the invention described in the claims.

    EXAMPLES

    [0111] The following examples and figures are provided to aid the understanding of the subject matter, the true scope of which is set forth in the appended claims. It is understood that modifications can be made in the procedures set forth without departing from the spirit of the invention.

    [0112] The targeted region of the HBV includes HBV RNA, such as pgRNA. All nucleic acid sequences were aligned and all primers and probes were considered and scored for their predicted inclusivity for all known HBV isolates and other properties.

    Example 1

    HBV RNA poly-A Target Assay Design

    [0113] An HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2. The target is an HBV RNA (such as HBV RNA originating from HBV cccDNA, which has the standard polyA tail, which includes HBV pgRNA), as shown in FIGS. 1 and 2. The assay can also detect splice variants and other RNAs, including mRNA, containing a poly-A tail. The RT primer, which can also act as a reverse primer, has a poly-T section to bind to the poly-A tail of the target mRNA (for example HBV pgRNA, as depicted in FIGS. 1 and 2). The HBV-specific sequence of the RT primer is designed to provide specificity for HBV and reduce RT/reverse primer binding to human and other poly-A-tailed RNA or stretches of homopolymer in the genome, however the longer the HBV-specific sequence is, the more likely it is to bind to HBV DNA. Indeed, even a short HBV-specific sequence has demonstrated ability to amplify off-target (i.e., unwanted) HBV DNA, when the DNA is at a high concentration. A tag sequence can optionally be added to the RT oligo, so that a different non-HBV sequence reverse primer design can be used for more efficient PCR amplification.

    [0114] A competitive blocking oligonucleotide concept was incorporated to reduce the amplification of HBV DNA, by preferentially binding to the HBV DNA genome in place of the RT primer/reverse primer of the poly-A detection set (see, FIG. 2). This competitive blocking oligonucleotide is designed to be non-extensible, so it does not act as a primer. This may be accomplished, for example, by adding a C3 spacer on the 3-end (a phosphate group or other attached group or modification may also be used for the same purpose). In this example, the competitive blocking oligonucleotide addition has been shown to increase the specificity of the assay for its intended target. This concept is applied, in this example, to a poly-A target for HBV RNA, but may be applicable to other poly-A designs for other targets; or other competitive template or interference situations, such as spliced RNA target with a short intron that would allow the DNA genome to also be amplified, situations with paralogous genes, or pseudogenes related to a target, or a sample with mixed genotypes or related organisms where one is targeted and not others.

    [0115] In all of the examples of the present disclosure, the polymerase employed to detect and amplify HBV RNA was the modified Thermus Z05 polymerase known as Z05D. The Z05D modified polymerase has the sequence of wild type Thermus Z05 polymerase sequence, but with a D580G modification, as described in U.S. Pat. No. 8,962,293, which is incorporated herein by reference in its entirety. The Z05D polymerase is a nucleic acid polymerase has both reverse transcriptase (RT) and polymerase (DNA amplification) capabilities. The term nucleic acid polymerase refers to any polymerase enzyme that can polymerase nucleic acids, which includes DNA polymerases, RNA polymerase, reverse transcriptase (RT), DNA-dependent polymerase, RNA-dependent polymerases, and polymerases that exhibit reverse transcriptase (RT) and polymerase (DNA amplification) capabilities, such as the Z05D polymerase, employed in the examples of the present disclosure. Any polymerase that exhibits reverse transcriptase (RT) and polymerase (DNA amplification) capabilities can be used in the present disclosure to detect and amplify HBV RNA.

    Example 2

    Sensitivity and Linear Range of an HBV RNA poly-A Target Assay with a Competitive Blocking Oligonucleotide

    [0116] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA 3 end poly-A target, in the presence of a competitive blocking oligonucleotide. The sensitivity and linear range of the assay was ascertained (FIG. 3).

    [0117] Samples used for a real-time PCR assay were copies of an armored RNA containing the sequence for a HBV pgRNA 3end construct including a polyA tail sequence. The template was added to negative human plasma at varying concentrations (110.sup.0 copies/mL, 110.sup.1 copies/mL, 110.sup.2 copies/mL, and so on up to 110.sup.9 copies/mL) and extracted and eluted into the PCR reactions on the cobas 6800/8800. Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology.

    [0118] The oligonucleotides specific for HBV pgRNA used for the real-time PCR assay were the RT/reverse primers HBV_PA-V_5LNA_25_351 (SEQ ID NO:152) and HBV_PA-V_5LNA_25_351_MIX (SEQ ID NO:151), along with a forward primer (SEQ ID NO:387) and probe (SEQ ID NO:388). Two reverse primers are used in this and some other experiments because a common substitution at the 3 end of the HBV RNA sequence may affect the performance of some primer designs. Paired primers with a base change to cover the variant reduce the potential effect of this substitution in samples. Thus, employing two reverse primers, instead of one reverse primer, allows for hybridization to variants with substitutions commonly observed at the 3 end of HBV RNA sequences. That is, employing more than one (i.e., two) reverse primers, instead of just one reverse primer, overcomes the complication of common substitutions at the 3 end of HBV RNA sequences. In general, it can be useful to employ multiple primers to cover multiple variations (including common or rare variations, substitutions, or other mutation types). A competitive blocking oligonucleotide 25-1 (SEQ ID NO:11) was included in the master mix, as were oligonucleotides for an internal control (not shown). These sequences are shown in Table 4, below.

    TABLE-US-00004 TABLE4 SEQID Type NO: Sequence Modifications RT/R 152 GATCAACGTGTCACCGCCTATTCTAT<D_LNA_T>TTT Primer <D_LNA_T>TTT<D_LNA_T>TTT<D_LNA_T>T<D_LNA_T> TGAAGCTC RT/R 151 GATCAACGTGTCACCGCCTATTCTAT<D_LNA_T>TTT Primer <D_LNA_T>TTT<D_LNA_T>TTT<D_LNA_T>T<D_LNA_T> TGTAGCTC F.Primer 387 CATGCAACTTTTTCACCTCTGCCTF F=5-MethyldC Probe 388 ECCAAGCTGTGCCTTGGJGTGGFLLLGGGGFALGGP E=HEX;J=BHQ-2;F=5- MethyldC;L=5-PropynyldU; P=PPhosphate Blocking 11 GAGAG<pdU>AA<5_Me_dC><pdU><5_Me_dC><5_Me_dC> Oligo A<5_Me_dC>AGAAG<5_Me_dC>T<5_Me_dC>CAAA<pd U>TC<SpC_C3>

    [0119] The data show the performance of one example of the poly-A target PCR assay design on HBV pgRNA transcript containing the HBV poly-A site sequence with poly-A tail. The results, shown in FIG. 3, show greater amplicon production with greater amounts of starting HBV pgRNA transcript (in a dose-dependent fashion), reflecting the linear range as well as the sensitivity of the assay.

    [0120] Thus, these results, shown in FIG. 3, show real-time singleplex PCR growth curves, which demonstrate that the primers, competitive blocking oligonucleotides, and probes (SEQ ID NOs:11, 151, 152, 387, and 388) detect the presence of HBV pgRNA 3 in a real-time PCR assay.

    Example 3

    Specificity of HBV RNA poly-A Target Assay with a Competitive Blocking Oligonucleotide

    [0121] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The specificity of the assay was ascertained, by way of PCR fluorescent signal on samples that were HBV DNA-only samples.

    [0122] The reaction was run on HBV DNA template (armored DNA) at 250,000 IU/rxn, estimated equivalent to an input of 1 million IU/mL in a sample before extraction and processing steps. The oligonucleotides specific for HBV RNA used for the real-time PCR assay were the RT/reverse primer HBV_PA-Z 5LNA_25_351_MIX (SEQ ID NO:96), along with a HBV-specific forward primer (SEQ ID NO:387) and probe (SEQ ID NO:388). The same master mixes were run with and without the competitive blocking oligonucleotide 25-1 (SEQ ID NO:11). The oligonucleotide sequences are shown in Table 5, below.

    TABLE-US-00005 TABLE5 SEQID Type NO: Sequence Modifications RT/R. 96 GATCAACGTGTCACCGCCTATTCTAT<LNA-T> Primer TTT<LNA-T>TTT<LNA-T>TTT<LNA-T>T<LNA-T> TGTAGC F.Primer 387 CATGCAACTTTTTCACCTCTGCCTF F=5-MethyldC Probe 388 ECCAAGCTGTGCCTTGGJGTGGFLLLGGGGFALGGP E=HEX;J=BHQ-2;F=5- MethyldC;L=5-PropynyldU; P=PPhosphate Blocking 11 GAGAG<pdU>AA<5_Me_dC><pdU><5_Me_dC><5_Me_ Oligo dC>A<5_Me_dC>AGAAG<5_Me_dC>T<5_Me_dC>CAAA <pdU>TC<SpC_C3>

    [0123] The assay comparison was run on an LC480 PCR instrument. Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology. Final concentration of oligonucleotides in the master mix ranged from 150 nM to 300 nM. The results show amplicon production (off-target DNA amplification) in the presence of an RT primer without any blocker, and no amplicon production in the presence of an RT primer and a competitive blocking oligonucleotide.

    [0124] These results, shown in FIG. 4, demonstrate the specificity against HBV DNA for the HBV RNA poly-A target assay, and the improvement possible including a competitive blocking oligonucleotide in the master mix. Thus, the HBV RNA poly-A target assay is specific for HBV RNA and specific against HBV DNA.

    Example 4

    Specificity and Mixed Template Results of HBV RNA poly-A Target Assay with a Competitive Blocking Oligonucleotide

    [0125] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The specificity of the assay was ascertained by way of PCR performance on samples that were mixed HBV RNA (target) and HBV DNA (non-target) templates, as reflected by CT values.

    [0126] Samples used for a singleplex real-time PCR assay were copies of HBV pgRNA transcript at 110.sup.3 transcript/rxn and varying levels of HBV DNA construct (as shown on the x-axis of FIG. 5). The RNA assay was designed to detect the poly-A site on the transcript and be resistant to picking up the DNA, and a competitive blocking oligonucleotide is added to the assay in some conditions (where indicated in the legend of FIG. 5), in order to increase the specificity for RNA targets. The oligonucleotides specific for HBV RNA used for the real-time PCR assay were the RT/reverse primer HBV_PA-Z_25_351 (SEQ ID NO:43), along with a HBV-specific forward primer (SEQ ID NO:387) and probe (SEQ ID NO:388). The same master mixes were run with and without the competitive blocking oligonucleotide HBVpA_block2 (SEQ ID NO:2).

    [0127] CT values for mixed samples and RNA assay (depicted as squares and X-markers, respectively, in FIG. 5) were consistent with RNA-only results, up to 110.sup.6 copies of DNA (which indicates the signal up to that threshold is only from RNA with insignificant contribution from DNA cross-reactivity despite increasing DNA input) (see, FIG. 5). The control used was a DNA assay (circles, in FIG. 5) on mixed samples, and shows earlier CTs with higher DNA input, as expected.

    [0128] These results, shown in FIG. 5, demonstrate the specificity for HBV RNA (and against HBV DNA) for the HBV RNA poly-A target assay, and the improvement possible including a competitive blocking oligonucleotide in the master mix. Thus, the HBV RNA poly-A target assay is specific for HBV RNA and specific against HBV DNA (up to a certain titer of HBV DNA).

    Example 5

    Specificity and Mixed Template Fluorescence Results of HBV RNA poly-A Target Assay with a Competitive Blocking Oligonucleotide

    [0129] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The specificity of the assay was ascertained, by way of PCR fluorescent signal on samples that were mixed HBV RNA (target) and HBV DNA (non-target) templates, or HBV DNA-only samples.

    [0130] Samples used for a singleplex real-time PCR assay were copies of HBV pgRNA transcript at 110.sup.3 transcript/rxn and varying levels of a HBV DNA construct (as shown on the x-axis of FIG. 6). The RNA assay was designed to detect the poly-A site on the transcript and be resistant to picking up the DNA, and a competitive blocking oligonucleotide is added in some conditions (where indicated in the legend of FIG. 6), in order to increase the specificity for RNA targets. The oligos used are the same as for Example 4. That is, the oligonucleotides specific for HBV RNA used for the real-time PCR assay were the RT/reverse primer HBV_PA-Z_25_351 (SEQ ID NO:43), along with a HBV-specific forward primer (SEQ ID NO:387) and probe (SEQ ID NO:388). The same master mixes were run with and without the competitive blocking oligonucleotide HBVpA block2 (SEQ ID NO:2). Relative Fluorescence Intensity (RFI) values for mixed samples and the RNA assay (depicted as squares and X-markers, respectively, in FIG. 6) were consistent up to 110.sup.6 copies of DNA (which indicates the signal up to that threshold is only from RNA or has insignificant contribution from DNA cross-reactivity) (see, FIG. 6). DNA-only samples (depicted by triangle marker) drop out below 110.sup.5 copies/rxn DNA indicating that the RNA assay is not cross-reacting below that concentration of DNA (see, FIG. 6). DNA-only detection drops out at or below 110.sup.6 copies/rxn, when using a competitive blocking oligonucleotide with the RNA assay (depicted by diamond marker, in FIG. 6), demonstrating the increased specificity with the competitive blocking oligonucleotide (see, FIG. 6). The control used was a DNA assay (depicted as circles, in FIG. 6), showing consistent fluorescence across DNA input levels (see, FIG. 6).

    [0131] These results, shown in FIG. 6, demonstrate the specificity for HBV RNA (and against HBV DNA (up to a certain high titer input) for the HBV RNA poly-A target assay, and the improvement possible including a competitive blocking oligonucleotide in the master mix. Thus, the HBV RNA poly-A target assay is specific for HBV RNA and specific against HBV DNA.

    Example 6

    Specificity of HBV RNA poly-A Target Assay with a Competitive Blocking Oligonucleotide

    [0132] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The specificity of the assay was ascertained, by way of PCR fluorescent signal on samples that were HBV RNA-only samples and HBV DNA-only samples.

    [0133] The multiplex (with an internal control (IC) reaction) real-time PCR assay was tested on HBV armored RNA at 100 copies/mL in human serum, extracted and eluted into the PCR reactions on the cobas 6800/8800. The assay was tested both without a competitive blocking oligonucleotide and including a competitive blocking oligonucleotide. The oligonucleotides specific for HBV RNA used for the real-time PCR assay were the RT/reverse primers HBV_PA-V_5LNA_25_351 (SEQ ID NO:152) and HBV_PA-V 5LNA_25_351 MIX (SEQ ID NO:151) along with a HBV-specific forward primer (SEQ ID NO:387) and probe (SEQ ID NO:388). A competitive blocking oligonucleotide 25-1 (SEQ ID NO:11) was included in the master mix, as were oligonucleotides for an internal control (not shown). Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology. Final concentration of oligonucleotides in the master mix ranged from 150 nM to 1 M.

    [0134] The presence or absence of the competitive blocking oligo did not affect the performance of the assay on the RNA target. Levels of concentration of the competitive blocking oligonucleotide can be adjusted to maximize the specificity against the unintended template or preserve the sensitivity of the assay on its intended target.

    [0135] The same reaction mixes were run on HBV DNA (armored DNA) at 100,000 IU/mL in human serum, extracted and eluted into the PCR reactions on the cobas 6800/8800. This level of DNA had only a low level of fluorescent signal, however to demonstrate an alternative to increasing the Relative Fluorescence Intensity (RFI) cutoff to not call these off-target signals, the reaction was run including the competitive blocking oligo. The signals were eliminated in the presence of the blocker, therefore allowing greater sensitivity of the assay for RNA in the presence of up to 100,000 IU/mL DNA.

    [0136] These results, shown in FIG. 7, demonstrate the specificity for HBV RNA (and against HBV DNA (up to a certain high titer input) for the HBV RNA poly-A target assay, and the improvement possible including a competitive blocking oligonucleotide in the master mix. Thus, the HBV RNA poly-A target assay is specific for HBV RNA and specific against HBV DNA.

    Example 7

    Effect of Modifications of Primers in HBV RNA poly-A Target Assay

    [0137] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The performance of the assay when the RT/reverse primer design was varied was ascertained, by way of PCR fluorescent signal on samples that were HBV RNA samples.

    [0138] The reaction was run on HBV RNA template (armored RNA) at 25 copies/rxn, estimated equivalent to an input of 100 copies/mL in a sample before extraction and processing steps, in a background of 125 ng/rxn human DNA. The oligonucleotides specific for HBV RNA used for the real-time PCR assay were the RT/reverse primers HBV_PA-W_8pdU_25_351_MIX (SEQ ID NO:117), HBV_PA-V_8pdU_25_351_MIX (SEQ ID NO:116), HBV_PA_8pdU_25_351s2_MIX (SEQ ID NO:112), and HBV_PA-Z_5LNA_25_351_MIX (SEQ ID NO:96), along with a HBV-specific forward primer (SEQ ID NO:387) and probe (SEQ ID NO:388). The oligonucleotide sequences are shown in Table 6, below.

    TABLE-US-00006 TABLE6 SEQID Type NO: Sequence Modifications RT/R. 117 GATCAACGTGTCACCGCCTATTCTAT<pdU>T<pdU>T<p Primer dU>T<pdU><pdU><pdU>TTT<pdU>T<pdU>TGTAGCT RT/R. 116 GATCAACGTGTCACCGCCTATTCTA<pdU>T<pdU>T<pd Primer U>T<pdU><pdU><pdU>TTT<pdU>T<pdU>TGTAGCTC RT/R. 112 GATCAACGTGTCACCGCCTTT<pdU>T<pdU>T<pdU>T Primer <pdU><pdU><pdU>TTT<pdU>T<pdU>TGTAGCTCC RT/R. 96 GATCAACGTGTCACCGCCTATTCTAT<LNA- Primer T>TTT<LNA-T>TTT<LNA-T>TTT<LNA-T>T<LNA- T>TGTAGC F.Primer 387 CATGCAACTTTTTCACCTCTGCCTF F=5-MethyldC Probe 388 ECCAAGCTGTGCCTTGGJGTGGFLLLGGGGFALGGP E=HEX;J=BHQ-2;F=5- MethyldC;L=5-PropynyldU; P=PPhosphate

    [0139] The assay comparison (with an internal control (IC) reaction) was run on an LC480 PCR instrument. Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology. Final concentration of oligonucleotides in the master mix ranged from 150 nM to 300 nM. The results show amplicon production and fluorescent signal for all assays, but the assays with longer HBV-overlapping sequences at the polyA junction, with pdU modified bases in the polyT stretch of the primer, had greater signal. The assay with the LNA-T modified bases in the polyT stretch of the primer also had greater signal, even without a longer HBV-overlapping sequence at the polyA junction.

    [0140] These results, shown in FIG. 8, demonstrate the performance effects of adjusting the design of the RT/reverse primer and the inclusion of different chemical modifications in the primer.

    Example 8

    Effect of HBV DNA on HBV RNA Quantitation with a Competitive Blocking Oligonucleotide

    [0141] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The performance of the assay was ascertained, by way of PCR fluorescent signal on samples that were HBV RNA samples.

    [0142] The reaction was run on HBV RNA template (armored RNA) in a dilution series from 110.sup.9 to 10 copies/mL HBV RNA in negative human plasma. The oligonucleotides specific for HBV RNA used for the real-time PCR assay were the RT/reverse primers HBV_PA-V_5LNA_25_351 (SEQ ID NO:152) and HBV_PA-V 5LNA_25_351 MIX (SEQ ID NO:151) along with a HBV-specific forward primer (SEQ ID NO:387) and probe (SEQ ID NO:388). A competitive blocking oligonucleotide 25-1 (SEQ ID NO:11) was included in the master mix, as were oligonucleotides for an internal control (not shown).

    [0143] The multiplex (with an internal control (IC) reaction) real-time PCR assay was tested on HBV armored RNA in human plasma, extracted and eluted into the PCR reactions on the cobas 6800/8800. The assay was tested including a competitive blocking oligonucleotide. Ten replicates were tested per mixed concentration node. Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology. Final concentration of oligonucleotides in the master mix ranged from 333 nM to 1 M.

    [0144] The results, shown in FIG. 9, show tolerance of high HBV DNA input under conditions of mixed DNA+RNA samples. Without DNA added, the assay shows linearity from 110.sup.9 to 10 copies/mL HBV RNA. With HBV DNA added at the high level of 110.sup.9 IU/mL, the RNA assay is unaffected except at 100 and 10 copies/mL, where the DNA to RNA ratio is greater than 6.0 log (1 IU/mL HBV DNA is equivalent to >5 copies/mL of the DNA template).

    [0145] In a parallel experiment 110.sup.7 IU/mL of HBV DNA was shown to not affect accuracy of HBV RNA quantitation at 100 copies/mL and only a small effect at 10 copies/mL, confirming that the assay tolerates DNA input as long as the ratio between HBV DNA and HBV RNA is within 6 logs or less.

    [0146] Thus, Example 8 demonstrates the high tolerance of the HBV RNA assay for DNA input. These data demonstrate that the HBV RNA assay, including the competitive blocking oligonucleotide, is very specific for HBV RNA, even in the presence of large amounts of potentially interfering/competing DNA.

    Example 9

    Effect of Reverse Primer Length and Modifications on Amplification of RNA and DNA

    [0147] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The performance of the assay when the RT/reverse primer design was varied was ascertained, by way of PCR fluorescent signal on samples that were HBV RNA samples. The RT/revers primers used were SEQ ID NOs:94, 96, 116, 117, 119, 121, 123, 124, 151, 153, 155, and 157; the forward primer used was SEQ ID NO:387; the probe used was SEQ ID NO:388; and the blocking oligonucleotide used was SEQ ID NO:11.

    [0148] The reactions were run on HBV RNA template (armored RNA) at 25 copies/rxn, in a background of 12.5 ng/rxn human DNA. The reaction was also run on HBV DNA template at 250,000 IU/rxn. Assays were run including a competitive blocking oligonucleotide.

    [0149] The assay comparisons were run on an LC480 PCR instrument. Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology. An internal control was also run. The results show amplicon production and fluorescent signal for all assays on RNA, but the assays with longer HBV-overlapping sequences at the polyA junction, with either pdU modified bases in the polyT stretch or LNA-T modified bases in the polyT stretch of the primer, tended to have slightly earlier Ct values on the RNA template but also relatively earlier Ct values on the DNA template.

    [0150] These results, shown in the table below, demonstrate the performance effects of adjusting the design of the RT/reverse primer and the inclusion of different chemical modifications in the primer. In the table, the ranges of Ct values obtained for each primer design were as follows: [0151] A is Ct of 25-30 [0152] B is Ct of 30-32 [0153] C is Ct of 32-35 [0154] D is Ct >35 [0155] E is no reaction

    TABLE-US-00007 TABLE7 HBVRNACtat HBVDNACtat 25copies/rxn 250,000IU/rxn PRIMER SEQUENCE SEQIDNO: (12.5nghgDNA) withblocker HBV_PA-Z_5LNA_25_351_MIX GATCAACGTGTCACCGCCTATTCTAT<LNA-T>TTT<LNA-T>TTT<LNA-T>TTT<LNA-T>T 96 C E <LNA-T>TGTAGC HBV_PA-V_5LNA_25_351_MIX GATCAACGTGTCACCGCCTATTCTAT<D_LNA_T>TTT<D_LNA_T>TTT<D_LNA_T>TTT 151 B D <D_LNA_T>T<D_LNA_T>TGTAGCTC HBV_PA_5LNA_25_351_MIX GATCAACGTGTCACCGCCTATTCTA<D_LNA_T>TTT<D_LNA_T>TTT<D_LNA_T>TTT 153 B C <D_LNA_T>T<D_LNA_T>TGTAGCTCC HBV_PA9_5LNA_25_351_MIX GATCAACGTGTCACCGCCTATTCTA<D_LNA_T>TT<D_LNA_T>TTT<D_LNA_T>TTT 155 B C <D_LNA_T>T<D_LNA_T>TGTAGCTCCA HBV_PA10_5LNA_25_351_MIX GATCAACGTGTCACCGCCTATTCTA<D_LNA_T>TT<D_LNA_T>TT<D_LNA_T>TTT<D_LNA_T> 157 B C T<D_LNA_T>TGTAGCTCCAA HBV_PA-z_8pdU_25_351_MIX GATCAACGTGTCACCGCCTATTCTATT<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT 94 C E <pdU>T<pdU>TGTAGC HBV_PA-W_8PDU_25_351_MIX GATCAACGTGTCACCGCCTATTCTAT<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT<pdU> 117 C C T<pdU>TGTAGCT HBV_PA-V_8PDU_25_351_MIX GATCAACGTGTCACCGCCTATTCTA<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT<pdU>T 116 C C <pdU>TGTAGCTC HBV_PA_8PDU_351S2_MIX GATCAACGTGTCACCGCCTTT<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT<pdU>T 151 C B <pdU>TGTAGCTCC HBV_PA9_8PDU_351S2_MIX GATCAACGTGTCACCGCCTTT<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT<pdU>T 119 B B <pdU>TGTAGCTCCA HBV_PA10_8PDU_351S2_MIX GATCAACGTGTCACCGCCTTT<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT<pdU>T 121 B B <pdU>TGTAGCTCCAA HBV_PA11_8PDU_351S2_MIX GATCAACGTGTCACCGCCTTT<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT<pdU>T 123 A A <pdU>TGTAGCTCCAAA HBV_PA14_8PDU_351S2_MIX GATCAACGTGTCACCGCCTTT<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT<pdU>T 124 C B <pdU>TGTAGCTCCAAATTC

    Example 10

    Effect of Reverse Primer Modifications n Amplification of RNA

    [0156] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The performance of the assay when the RT/reverse primer design was varied was ascertained, by way of PCR fluorescent signal on samples that were HBV RNA samples. The RT/reverse primers employed were SEQ ID NOs: 142, 161, 162, 163, 164, 165, 166, 167, 168, 169, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, and 190; the forward primer employed was SEQ ID NO:387; the probe employed was SEQ ID NO:388; and the blocking oligonucleotide employed was SEQ ID NO:11.

    [0157] The reactions were run on HBV RNA template (armored RNA) at 25 copies/rxn, in a background of 12.5 ng/rxn human DNA. Assays were run including a competitive blocking oligonucleotide.

    [0158] The assay comparisons were run on an LC480 PCR instrument. Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology. Internal controls were also included. The results show amplicon production and fluorescent signal for all assays on RNA. However, there can be modest variations in Ct values depending on the number and arrangement of chemically modified bases included in the oligos, with some arrangements appearing to be more efficient in amplification of the target than others.

    [0159] These results, shown in the table below, demonstrate the performance effects of adjusting the design of the RT/reverse primer and the inclusion of different chemical modifications in the primer. In the table, the ranges of Ct values obtained for each primer design were as follows: [0160] A is Ct of 25-30 [0161] B is Ct of 30-32 [0162] C is Ct of 32-35 [0163] D is Ct >35 [0164] E is no reaction

    TABLE-US-00008 TABLE8 HBVRNACtat 25copies/rxn PRIMER SEQUENCE SEQIDNO: (12.5nghgDNA) HBV_PA_8LNA_25_351S2 GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T> 177 C T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGAAGCTCC HBV_PA_8LNA_25_351S2_MIX GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T> 176 C T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGTAGCTCC HBV_PA_8LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T> 173 C <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GAAGCTCC HBV_PA_8LNAEND_25_351_MIX GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T> 172 B <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GTAGCTCC HBV_PA_4LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTTTTTTTTTT<D_LNA_T><D_LNA_T><D_LNA_T> 169 C <D_LNA_T>GAAGCTCC HBV_PA_4LNAEND_25_351_MIX GATCAACGTGTCACCGCCTATTCTATTTTTTTTTTTT<D_LNA_T><D_LNA_T><D_LNA_T> 168 C <D_LNA_T>GTAGCTCC HBV_PA9_8LNA_25_351S2 GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T> 179 C T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGAAGCTCCA HBV_PA9_8LNA_25_351S2_MIX GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T> 178 B T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGTAGCTCCA HBV_PA9_8LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T> 175 C <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GAAGCTCCA HBV_PA9_8LNAEND_25_351_MIX GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T> 174 B <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GTAGCTCCA HBV_PA9_4LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTTTTTTTTTT<D_LNA_T><D_LNA_T><D_LNA_T> 171 C <D_LNA_T>GAAGCTCCA HBV_PA9_4LNAEND_25_351_MIX GATCAACGTGTCACCGCCTATTCTATTTTTTTTTTTT<D_LNA_T><D_LNA_T><D_LNA_T> 170 B <D_LNA_T>GTAGCTCCA HBV_PA-V_12PDU_351S2_MIX GATCAACGTGTCACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 186 C <pdU><pdU><pdU>GTAGCTC HBV_PA-V_12PDU_351S2 GATCAACGTGICACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 185 C <pdU><pdU><pdU>GAAGCTC HBV_PA_12PDU_351S2_MIX GATCAACGTGTCACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 142 B <pdU><pdU><pdU>GTAGCTCC HBV_PA9_12PDU_351S2 GATCAACGTGTCACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 161 B <pdU><pdU><pdU>GAAGCTCCA HBV_PA9_12PDU_351S2_MIX GATCAACGTGTCACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 162 B <pdU><pdU><pdU>GTAGCTCCA HBV_PA9_8PDU_351S2_MIX_TBB GATCAACGTGTCACCGCCTTT<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT<pdU>T 165 B <pdU>TGTAGCTCC<t_BB_dA> HBV_PA10_8PDU_351S2_MIX_TBB GATCAACGTGTCACCGCCTTT<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT<pdU>T 166 B <pdU>TGTAGCTCCA<t_BB_dA> HBV_PA11_8PDU_351S2_MIX_TBB GATCAACGTGTCACCGCCTTT<pdU>T<pdU>T<pdU>T<pdU><pdU><pdU>TTT<pdU>T 167 B <pdU>TGTAGCTCCAA<t_BB_dA> HBV_PA10_12PDU_351S2 GATCAACGTGTCACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 163 A <pdU><pdU><pdU>GAAGCTCCAA HBV_PA10_12PDU_351S2_MIX GATCAACGTGTCACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 164 A <pdU><pdU><pdU>GTAGCTCCAA HBV_PA10_8LNAEND_25_351_MIX GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T> 180 B <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GTAGCTCCAA HBV_PA10_8LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T> 181 B <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GAAGCTCCAA HBV_PA10_8LNA_25_351S2_MIX GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNAT_>T<D_LNA_T> 182 C T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGTAGCTCCAA HBV_PA10_8LNA_25_351S2 GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T> 183 C T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGAAGCTCCAA HBV_PA-Z_3LNA_25_351_MIX GATCAACGTGTCACCGCCTATTCTATTTTTTTTT<D_LNA_T>TTT<D_LNA_T>T<D_LNA_T> 184 D TGTAGC HBV_PA-V_8LNAEND_25_351_MIX GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T> 187 C <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GTAGCTC HBV_PA-V_8LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T> 188 D <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GAAGCTC HBV_PA-V_8LNA_25_351S2_MIX GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T> 189 C T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGTAGCTC HBV_PA-V_8LNA_25_351S2 GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T> 190 C T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGAAGCTC

    Example 11

    Effect of Reverse Primer Modifications on Amplification of RNA, on a Variant Template

    [0165] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The performance of the assay when the RT/reverse primer design was varied was ascertained, by way of PCR fluorescent signal on samples that were HBV RNA samples. The RT/Reverse Primer employed were SEQ ID NOs:141, 153, 157, 161, 163, 169, 171, 173, 175, 177, 179, 181, 183, 185, 188, and 190; the forward primer employed was SEQ ID NO:387; the probe employed was SEQ ID NO:388; and the blocking oligonucleotide employed was SEQ ID NO:11.

    [0166] The reactions were run on HBV RNA template (armored RNA) at 25 copies/rxn, in a background of 12.5 ng/rxn human DNA. Assays were run including a competitive blocking oligonucleotide. In these experiments a variant HBV template was used which was different in sequence than in Example 10.

    [0167] The assay comparisons were run on an LC480 PCR instrument. Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology. An internal control was also included. The results show amplicon production and fluorescent signal for all assays on RNA. However, there can be modest variations in Ct values depending on the number and arrangement of chemically modified bases included in the oligos, with some arrangements appearing to be more efficient in amplification of the target than others.

    [0168] These results, shown in the table below, demonstrate the performance effects of adjusting the design of the RT/reverse primer and the inclusion of different chemical modifications in the primer. In the table, the ranges of Ct values obtained for each primer design were as follows: [0169] A is Ct of 25-30 [0170] B is Ct of 30-32 [0171] C is Ct of 32-35 [0172] D is Ct >35 [0173] E is no reaction

    TABLE-US-00009 TABLE9 HBVRNACtat 25copies/nal PRIMER SEQUENCE SEQIDNO: (12.5nghgDNA) HBV_PA-V_8LNA_25_351S2 GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T 190 C <D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGAAGCTC HBV_PA-V_8LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T>LNA_T> 188 D <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GAAGCTC HBV_PA_8LNA_25_351S2 GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T> 177 C T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGAAGCTCC HBV_PA_8LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T> 173 C <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GAAGCTCC HBV_PA_4LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTTTTTTTTTT<D_LNA_T><D_LNA_T><D_LNA_T> 169 C <D_LNA_T>GAAGCTCC HBV_PA9_8LNA_25_351S2 GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T> 179 C T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGAAGCTCCA HBV_PA9_8LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T> 175 C <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GAAGCTCCA HBV_PA9_4LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTTTTTTT<D_LNA_T><D_LNA_T><D_LNA_T> 171 C <D_LNA_T>GAAGCTCCA HBV_PA10_8LNAEND_25_351 GATCAACGTGTCACCGCCTATTCTATTTT<D_LNA_T><D_LNA_T><D_LNA_T>LNA_T> 181 C <D_LNA_T><D_LNA_T><D_LNA_T><D_LNA_T>GAAGCTCCAA HBV_PA10_8LNA_25_351S2 GATCAACGTGTCACCGCCTT<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T<D_LNA_T>T 183 C <D_LNA_T>T<D_LNA_T>T<D_LNA_T>TGAAGCTCCAA HBV_PA-V_12PDU_351S2 GATCAACGTGTCACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 185 C <pdU><pdU><pdU>GAAGCTC HBV_PA_12PDU_351S2 GATCAACGTGTCACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 141 C <pdU><pdU><pdU>GAAGCTCC HBV_PA9_12PDU_351S2 GATCAACGTGTCACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 161 B <pdU><pdU><pdU>GAAGCTCCA HBV_PA10_12PDU_351S2 GATCAACGTGTCACCGCC<pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU><pdU> 163 A <pdU><pdU><pdU>GAAGCTCCAA HBV_PA_5LNA_25_351_MIX GATCAACGTGTCACCGCCTATTCTA<D_LNA_T>TTT<D_LNA_T>TTT<D_LNA_T>TTT<D_LNA_T> 153 C T<D_LNA_T>TGTAGCTCC HBV_PA_5LNA_25_351 GATCAACGTGTCACCGCCTATTCTA<D_LNA_T>TTT<D_LNA_T>TTT<D_LNA_T>TTT<D_LNA_T> 154 C T<D_LNA_T>TGAAGCTCC

    Example 12

    Effect of Competitive Blocking Oligo Modifications on Amplification of DNA

    [0174] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The assay utilizes a Competitive Blocking Oligonucleotide to improve the specificity of the assay against off-target amplification of HBV DNA. The performance of the assay when the blocker design primer design was varied was ascertained, by way of PCR fluorescent signal on samples that were HBV DNA samples.

    [0175] The reaction was run on HBV DNA template at 110.sup.6 copies/rxn. Assays were run including different competitive blocking oligonucleotides. In this experiment the RT/reverse primer used was HBV_PA_25_468 (SEQ ID NO:35), along with a forward primer (SEQ ID NO:387), and probe (SEQ ID NO:388). Here, the blocking oligonucleotides employed were SEQ ID NOs:1, 2, 3, 4, and 5.

    [0176] The assay comparison was run on an LC480 PCR instrument. Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology. The results show amplicon production and fluorescent signal on high input levels of DNA, with delays in the Ct values from the inclusion of the blocking oligonucleotide. There are modest variations in Ct values depending on the number and arrangement of chemically modified bases included in the blocking oligos, with some arrangements appearing to be more efficient in competition (decreasing primer binding to the DNA target) than others.

    [0177] These results, shown in the table below, demonstrate the performance effects of adjusting the design of the competitive blocking oligonucleotide and the inclusion of different chemical modifications in the blocking oligo. In the table, the ranges of Ct values obtained for each master mix were as follows: [0178] A is Ct of 25-30 [0179] B is Ct of 30-32 [0180] C is Ct of 32-35 [0181] D is Ct >35 [0182] E is no reaction

    TABLE-US-00010 TABLE10 HBVDNAat1E6 BLOCKER SEQUENCE SEQIDNO: copies/rxn Noblocker N/A B HBVPA_BLOCK1 AACTCCACAGAAGCTCCAAATTC<Spc_C3> 1 C HBVPA_BLOCK2 AGAGTAACTCCACAGAAGCTCCAAATTC<Spc_C3> 2 E HBVPA_BLOCK3 GAGAGTAACTCCACAGAAGCTC<Spc_C3> 3 C HBVPA_BLOCK5 GAGAGTAACTCCACAGAAGC<Spc_C3> 4 D HBVPA_BLOCK5L G<LNA-A>GAGT<LNA-A>AC<LNA-T>CCACA<LNA-G>AA 5 C <LNA-G>C<Spc_C3>

    Example 13

    Effect of Competitive Blocking Oligo Modifications on Amplification of DNA

    [0183] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The assay utilizes a Competitive Blocking Oligonucleotide to improve the specificity of the assay against off-target amplification of HBV DNA. The performance of the assay when the blocker design primer design was varied was ascertained, by way of PCR fluorescent signal on samples that were HBV DNA samples.

    [0184] The reaction was run on HBV DNA template at 110.sup.7 copies/rxn. Assays were run including different competitive blocking oligonucleotides. In this experiment the reverse primer used was different from that of Example 12. Here, the RT/reverse primer used was HBV_PA_25_351 (SEQ ID NO:34), along with a forward primer (SEQ ID NO:387), and probe (SEQ ID NO:388). Here, the blocking oligonucleotides employed were SEQ ID NO:2, 9, 10, 11, and 14.

    [0185] The assay comparison was run on an LC480 PCR instrument. Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology. The results show amplicon production and fluorescent signal on high input levels of DNA, with delays in the Ct values from the inclusion of the blocking oligonucleotide. There are modest variations in Ct values depending on the number and arrangement of chemically modified bases included in the blocking oligos, with some arrangements (generally longer oligos and/or oligos with more modified bases) appearing to be more efficient in competition (decreasing primer binding to the DNA target) than others.

    [0186] These results, shown in the table below, demonstrate the performance effects of adjusting the design of the competitive blocking oligonucleotide and the inclusion of different chemical modifications in the blocking oligo. In the table, the ranges of Ct values obtained for each master mix were as follows: [0187] A is Ct of 25-30 [0188] B is Ct of 30-32 [0189] C is Ct of 32-35 [0190] D is Ct >35 [0191] E is no reaction

    TABLE-US-00011 TABLE11 SEQ HBVDNAat1E7 BLOCKER SEQUENCE IDNO: copies/rxn Noblocker A HBVPA_BLOCK2 AGAGTAACTCCACAGAAGCTCCAAATTC<Spc_C3> 2 B HBVPA_BLOCK2-1 AGAGTAAC<pdU>CCA<5_Me_dC>AGAAG<5_Me_dC>T<5_Me_dC>CAAA<pdU>TC 9 C <Spc_C3> HBVPA_BLOCK2-2 AGAG<pdU>AAC<pdU><5_Me_dC>CA<5_Me_dC>AGAAG<5_Me_dC><pdU> 10 C <5_Me_dC><5_Me_dC>AAA<pdU>TC<Spc_C3> HBVPA_BLOCK25-1 GAGAG<pdU>AA<5_Me_dC><pdU><5_Me_dC><5_Me_dC>A<5_Me_dC>AGAAG 11 C <5_Me_dC>T<5_Me_dC>CAAA<pdU>TC<Spc_C3> HBVPA_BLOCK7 CAGAAGGCAAAAA<d_I>GAGAGTAACTCCACAGAAGCTCCAAATTCTTTATA<Spc_C3> 14 C

    Example 14

    Effect of Competitive Blocking Oligo Modifications on Amplification of DNA

    [0192] The HBV RNA poly-A target assay was designed using an RT primer (used as a reverse primer) as shown in FIGS. 1 and 2, with an HBV pgRNA target. The assay utilizes a Competitive Blocking Oligonucleotide to improve the specificity of the assay against off-target amplification of HBV DNA. The performance of the assay when the blocker design primer design was varied was ascertained, by way of PCR fluorescent signal on samples that were HBV DNA samples.

    [0193] The reaction was run on HBV DNA template at 210.sup.6 IU/rxn, in a background of 12.5 ng/rxn human DNA. Assays were run including different competitive blocking oligonucleotides. In this experiment the RT/reverse primer used was HBV_PA-V_5LNA_25_351 MIX (SEQ ID NO:151), along with a forward primer (SEQ ID NO:387) and probe (SEQ ID NO:388). Here, the blocking oligonucleotides were SEQ ID NOs:2, 10, 11, and 15.

    [0194] The assay comparison was run on an LC480 PCR instrument. Reagents used include cobas 6800/8800 generic PCR Master Mix, with the profile and conditions for use with the cobas 6800/8800, and using TaqMan amplification and detection technology. The results show amplicon production and fluorescent signal on high input levels of DNA, with delays in the Ct values from the inclusion of the blocking oligonucleotide. There are modest variations in Ct values depending on the number and arrangement of chemically modified bases included in the blocking oligos.

    [0195] These results, shown in the table below, demonstrate several designs of the competitive blocking oligonucleotide differing in length and the inclusion of different chemical modifications. In the table, the ranges of Ct values obtained for each master mix were as follows: [0196] A is Ct of 25-30 [0197] B is Ct of 30-32 [0198] C is Ct of 32-35 [0199] D is Ct >35 [0200] E is no reaction

    TABLE-US-00012 TABLE12 2E8IU/rxnHBV SEQ DNAin12.5ng BLOCKER SEQUENCE IDNO: hgDNA/rxn HBVPABLOCK25-1 GAGAG<pdU>AA<5_Me_dC><pdU><5_Me_dC><5_Me_dC>A<5_Me_dC>AGAAG 11 C <5_Me_dC>T<5_Me_dC>CAAA<pdU>TC<Spc_C3> HBVPA_BLOCK2 AGAGTAACTCCACAGAAGCTCCAAATTC<Spc_C3> 2 C HBVPA_BLOCK2-2 AGAG<pdU>AAC<pdU><5_Me_dC>CA<5_Me_dC>AGAAG<5_Me_dC><pdU> 10 C <5_Me_dC><5_Me_dC>AAA<pdU>TC<Spc_C3> HBVPA_BLOCK5L9 G<LNA-A>G<LNA-A>G<LNA-T>A<LNA-A>C<LNA-T>C<LNA-C>A<LNA-C>A<LNA- 15 C G>AA<LNA-G>C<Spc_C3> Noblocker N/A B

    [0201] While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. For example, all the techniques and apparatus described above can be used in various combinations. All publications, patents, patent applications, and/or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and/or other document were individually indicated to be incorporated by reference for all purposes.