Glucose oxidase CnGODA and gene and application thereof

Abstract

Provided are a glucose oxidase CnGODA, an encoding gene thereof, a recombinant expression vector comprising the gene, and a recombinant strain; the amino acid sequence of the glucose oxidase CnGODA is as represented in SEQ ID NO:1 or SEQ ID NO:2. Further provided is a method for use in preparing glucose oxidase CnGODA, and application of glucose oxidase CnGODA.

Claims

1. A method of producing glucose oxidase having the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, comprising the steps of: (1) transforming a prokaryotic or eukaryotic host cell in culture with a polynucleotide comprising a nucleotide sequence encoding said glucose oxidase to obtain a recombinant host cell; (2) cultivating the recombinant host cell to induce expression of said glucose oxidase; and (3) isolating and recovering said glucose oxidase.

2. The method of claim 1, wherein the method further comprises the step of preparing a feed, food, medicine, test paper or biosensor comprising said glucose oxidase.

3. The method of claim 1, wherein said glucose oxidase has an optimal pH of 7.0, an optimal temperature of 30 C., pH stability within pH 6.0 to 9.0, and maintains more than 50% of activity between 15 C. and 50 C.

Description

BRIEF DESCRIPTIONS OF THE DRAWINGS

(1) FIG. 1 shows optimum pH values for the recombinant glucose oxidase.

(2) FIG. 2 shows pH stabilities for the recombinant glucose oxidase.

(3) FIG. 3 shows optimum temperature for the recombinant glucose oxidase.

(4) FIG. 4 shows thermostability for the recombinant glucose oxidase.

EMBODIMENT

(5) The present invention is further illustrated with reference to the following Examples and the appended drawings, which should by no means be construed as limitations of the present invention.

(6) Test Materials and Reagents

(7) 1. Strains and vectors: Pichia pastoris strain GS115 (Invitrogen); and vetor pPIC9 (Invitrogen, San Diego, Calif.).

(8) 2. Enzymes and other biochemical reagents: restriction endonucleases (TaKaRa); ligase (Invitrogen); and birch xylan(Sigma) 3. Medium:

(9) (1) Enzyme production medium (/L): 172.11 g of glucose, 11.05 g of corn syrup, 52.29 g calcium carbonate, 0.5 g of (NH.sub.4)H.sub.2PO.sub.4, 0.125 g of MgSO.sub.4.7H.sub.2O, 0.125 g of FeSO.sub.4.7H.sub.2O, which are sterilized at 121 C. for 20 min.

(10) (2) E. coli. LB medium: 1% of peptone, 0.5% of yeast extract, and 1% of NaCl, natural pH.

(11) (3) BMGY medium: 1% of yeast extract; 2% of peptone; 1.34% of YNB, 0.00004% of Biotin; and 1% of glycerol(V/V).

(12) (4) BMMY medium: 1% of yeast extract; 2% of peptone; 1.34% of YNB, 0.00004% of Biotin; and 0.5% of methanol (V/V).

(13) Suitable biology laboratory methods not particularly mentioned in the examples as below can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other kit laboratory manuals.

Example 1 Cloning Glucose Oxidase Gene God from Cladosporiumneopsychrotolerns SL-16

(14) (1) Isolating the Total RNA of Cladosporiumneopsychrotolerns SL-16

(15) First, bacteria cells cultured in enzyme-producing medium for 3 days were collected on the filter paper and pressed dry, followed by adding liquid nitrogen to a high-temperature sterilized mortar and quickly ground the bacteria into powder. Then, the grounded powder was transferred to a centrifuge tube with 800 L of Trizol, blended well and left in the room temperature for 5 min 200 L of chloroform was added, shaken violently for 15 s, placed at room temperature for 3 min, and centrifuged at 4 C. at 12,000 RPM for 15 min. The supernatant was obtained, and isopropanol of the equal volume was added to be mixed well, placed at room temperature for 10 min and centrifuged at 4 C. at 12,000 RPM for 10 min. The supernatant was removed and the precipitation was washed twice with 70% of ethanol followed by drying in the air for 5 min, and an appropriate amount of DNase/Rnase-free deionized water was added to dissolve RNA.

(16) (2) Obtaining the cDNA Sequence Encoding the Glucose Oxidase

(17) One chain of total cDNA was obtained with Oligo (dT) 20 and the reverse transcriptase, and then primers F and R (SEQ ID NO: 5 and 6, respectively) with EcoR I and Not I restriction sites were designed as list in the table 1 to perform PCR on the coding region of CnGODA mature protein to obtain the cDNA sequence of glucose oxidase.

(18) TABLE-US-00005 TABLE1 Primers Length Primer SEQUENCE(5---3) (bp) F ACTGAATTCCTTCCCAATCA 40 AACGCGAGCTGACAAAGCCC R GAGTGCGGCCGCTCAATGTC 40 CCTGATCTTCCTTAATCATC

Example 2 Preparing the Recombinant Cell Comprising Glucose Oxidase Gene

(19) (1) Constructing the expression vector and expressing in Pichiapastoris GS115 The expression vector pPIC9-CngodA comprising the full-length gene encoding glucose oxidase was constructed by inserting the gene at the downstream of the signal peptide of the plasmid to form the correct reading frame, followed to transform Ecoli cell Trans1 to screen the positive transformants for sequencing. The transformants with the correct sequence were used to prepare the recombinant plasmid in a large amount. The DNA of the expression vector was lined with restriction enzyme Bgl II, followed by electronically transforming Pichia pastoris strain GS115, and being cultured at 30 C. for 2 to 3 days to screen the transformants on the MD plate for expressing assays. The particular operation refers to Pichia pastoris expression manual.

(20) The recombinant expression vector comprising the gene including the signal peptide was constructed as same as above.

(21) (2) Screening the Transformants with High Glucose Oxidase Activity

(22) The single colony on the MD plate was selected with a sterilized toothpick and numbered on the MD plates which were incubated at 30 C. for 1 to 2 days until the colony grown. The transformants were inoculated in a centrifuge tube containing 3 mL BMGY medium, and cultured according to their number, cultured at 30 C. and 220 RPM for 48 h followed by centrifuging at 3,000g for 15 min to remove supernatant, and adding lint, BMMY medium containing 0.5% of methanol into the centrifuge tube for induction culturing at 30 C. and 220 RPM for 48 h to collect the supernatant by centrifuging at 3,000g for 5 min for detecting the activity. Finally, the transformant with high glucose oxidase activity were screened out. The particular operation refers to Pichia pastoris expression manual.

Example 3 Recombinant Pichia Pastoris Fermenting to Produce Recombinant Enzyme

(23) The screened transformants were incubated in 300 mL of BMGY for 48 h at 30 C. and 220 rpm, and then the cells were spun down by centrifuging at 4,500 rpm for 5 min and suspended in 100 mL of BMMY containing 0.5% of methanol to induce the glucose oxidase gene expression for 72 hours with addition of methanol solution every 24 hours to keep concentration of methanol as 0.5% by compensating the loss of methanol. After induction, the supernatant was recovered by spinning at 12,000g for 10 min to test the activity of the enzyme and performing SDS-PAGE.

(24) (1) Purifying the Recombinant Glucose Oxidase

(25) The supernatant of the recombinant glucose oxidase expressed in the shaking bottle was collected followed by being concentrated with 10 kDa membrane package while replacing the medium of the fermentation broth with low salt buffer, and further concentrated with 10 kDa ultrafiltration tube. The concentrated solution was further purified with ion exchange chromatography by loading 2.0 mL of CnGODA concentrate into HiTrap Q Sepharose XL anion column pre-balanced with 20 mMPBS (pH 6.9), and eluting with NaCL in linear gradient of 0 to 1 mol/L, to detect enzyme activity and determine protein concentration of the eluent collected step by step.

Example 4 Measuring the Properties of the Recombinant Glucose Oxidase

(26) The activity of glucose oxidase was measured with a spectrophotometry by keeping 5 mL of the reaction system comprising 2.5 mL of adjacent anisidine buffer, 0.3 mL of 18% glucose solution, 0.1 mL of horseradish peroxidase is 90 U/mL, and 0.1 mL of appropriate diluted enzyme solution reacted at pH 6.0 and 30 C. for 3 min, followed by adding 2 mL of sulfuric acid in 2M to terminate the reaction, and determining the absorption value at OD.sub.540 after cooling.

(27) Definition of glucose oxidase activity unit (U): the enzyme amount decomposing 1 mol of -D-glucose into D-gluconic acid and hydrogen peroxide.

(28) (1) Optimum pH Values and pH Stability for the Recombinant Glucose Oxidase

(29) The glucose oxidase purified in example 2 was reacted in the different pHs to determine optimum pH. The adjacent anisidine solution with different pHs was prepared with the glycine-hydrochloric acid buffer with pH 1.0 to 3.0, and citric acid-disodium hydrogen phosphate buffer with pH 8.0 to 10.0, for determining the optimum pH at 30 C. As shown in FIG. 1, the activity of the recombinant glucose oxidase varied with pHs. The highest activity was observed at pH 7.0. The recombinant glucose oxidase was stable at pH 6.0 to 8.0 and maintained more than 90% of activity.

(30) The pH stability of the glucose oxidase was researched by detecting its activity at optimum pH after being treated for 60 min at 25 C. and different pHs. As shown in FIG. 2, the recombinant glucose oxidase has good pH stability in that it maintains more than 80% of activity at pH 6.0 to 9.0, 60% and 70% of activity treated at pH 5.0 and 10.0 respectively.

(31) (2) Optimum Temperature and Heat Stability for the Recombinant Glucose Oxidase

(32) The glucose oxidase was reacted in the different temperatures from 0 to 55 C. at pH 6.0 to determine its optimum temperature. As shown in FIG. 3, the optimum temperature for this enzyme was 30 C., and it maintained more than 50% of activity between 15 C. and 50 C.

(33) The thermostability was determined by detecting the enzyme activity of the glucose oxidase after being treated at 30 C., 35 C., 40 C. for the different time. As shown by FIG. 4, more than 70% of enzyme activity was kept after being treated at 35 C. for 60 min, but only 20% of enzyme activity was kept after being treated at 40 C. for 20 min.