GENETICALLY MODIFIED NON-HUMAN ANIMAL WITH HUMAN OR CHIMERIC GENES

20210045367 ยท 2021-02-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure relates to genetically modified non-human animals that express a human or chimeric (e.g., humanized) IL4R and/or IL4, and methods of use thereof.

    Claims

    1. A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a chimeric interleukin-4 receptor (IL4R), wherein the chimeric IL4R comprises an endogenous signal peptide.

    2. The animal of claim 1, wherein the sequence encoding the chimeric IL4R is operably linked to an endogenous regulatory element at the endogenous IL4R gene locus in the at least one chromosome.

    3. The animal of claim 1, wherein the chimeric IL4R comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 44.

    4. The animal of claim 1, wherein the chimeric IL4R comprises an amino acid sequence that is at least 80% identical to SEQ ID NO: 44.

    5. The animal of claim 1, wherein the chimeric IL4R consists of an amino acid sequence that is identical to SEQ ID NO: 44.

    6. The animal of claim 1, wherein the animal is a rodent.

    7. The animal of claim 1, wherein the animal is a mouse.

    8. The animal of claim 1, wherein the animal does not express endogenous IL4R.

    9. The animal of claim 1, wherein the animal has one or more cells expressing the chimeric IL4R.

    10.-20. (canceled)

    21. A method for making a genetically-modified, non-human animal, comprising: replacing in at least one cell of the animal, at an endogenous IL4R gene locus, a sequence encoding a region of an endogenous IL4R with a sequence encoding a corresponding region of human IL4R.

    22.-36. (canceled)

    37. The animal of claim 1, wherein the animal further comprises a sequence encoding human or chimeric IL4.

    38.-40. (canceled)

    41. A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human IL4, wherein the sequence is operably linked to: 1) a human regulatory element at an endogenous IL4 gene locus in the at least one chromosome; or 2) an endogenous regulatory element and an endogenous 3 UTR at an endogenous IL4 gene locus in the at least one chromosome.

    42. (canceled)

    43. The animal of claim 41, wherein the sequence encoding the human IL4 is operably linked to a human regulatory element at the endogenous IL4 gene locus in the at least one chromosome, and the human regulatory element comprises a 5 UTR of human IL4 gene.

    44.-49. (canceled)

    50. The animal of claim 41, wherein the animal is ft a rodent.

    51. The animal of claim 41, wherein the animal is a mouse.

    52. The animal of claim 41, wherein the animal does not express endogenous IL4.

    53.-78. (canceled)

    79. The animal of claim 41, wherein the animal further comprises a sequence encoding human or chimeric IL4R.

    80.-82. (canceled)

    83. A method of determining effectiveness of an IL4-IL4R pathway inhibitor for treating an allergic disorder, comprising: administering the IL4-IL4R pathway inhibitor to the animal of claim 37; and determining inhibitory effects of the IL4-IL4R pathway inhibitor.

    84. The method of claim 83, wherein the allergic disorder is asthma.

    85.-86. (canceled)

    87. The method of claim 83, wherein the IL4-IL4R pathway inhibitor is an anti-human IL4 antibody or an anti-human IL4R antibody.

    88.-99. (canceled)

    Description

    DESCRIPTION OF DRAWINGS

    [0108] FIG. 1 is a schematic diagram showing mouse and human IL4 gene locus.

    [0109] FIG. 2 is a schematic diagram showing humanized IL4 gene locus (replacing coding sequence).

    [0110] FIG. 3 is a schematic diagram showing humanized IL4 gene (replacing coding sequencing and 5-UTR and 3-UTR).

    [0111] FIG. 4 is a schematic diagram showing an IL4 gene targeting strategy.

    [0112] FIG. 5A is a graph showing recombinant vector digestion results, wherein No. 1, 2, 3 refer to 3 vector plasmids respectively, ck represents the undigested plasmid control, M is the Marker.

    [0113] FIG. 5B is a graph showing DNA ladder for the Marker.

    [0114] FIG. 6 is a graph showing PCR identification results of cells, wherein + is the positive control, WT is the wild-type control, M is the Marker, H.sub.2O is a blank control. The clones marked with the clone numbers were identified as positive clones.

    [0115] FIG. 7 is a graph showing Southern blot results.

    [0116] FIG. 8 is a schematic diagram showing an IL4 gene targeting strategy.

    [0117] FIG. 9A is a graph showing recombinant vector digestion results, wherein ck represents the undigested plasmid control, M is the Marker. The plasmids were treated with BamHI, EcoRI or ScaI, respectively.

    [0118] FIG. 9B is a graph showing DNA ladder for the Marker.

    [0119] FIG. 10 is a graph showing PCR identification results, wherein M is the Marker, + is the positive control, WT is the wild-type control, and H.sub.2O is a blank control. The lane marked with clone number 1-G9 was identified as a positive clone.

    [0120] FIG. 11 is a graph showing Southern blot results.

    [0121] FIG. 12 is a schematic diagram showing the FRT recombination process.

    [0122] FIG. 13A shows PCR identification results for F1 generation mice (short fragment replacement), wherein primer pairs WT-F and WT-R were used to amplify wild-type mouse IL4 gene exon 4. WT is wild-type, H.sub.2O is a blank control, and + is the positive control.

    [0123] FIG. 13B shows PCR identification results for F1 generation mice (short fragment replacement), wherein primer pairs Mut-F and WT-R were used to amplify the engineered exon 4 of the mouse IL4 gene to verify the correct insertion of the recombinant vector into the genomic locus; wherein WT is wild-type and + is the positive control.

    [0124] FIG. 13C shows PCR identification results for F1 generation mice (short fragment replacement), wherein primer pairs Frt-F and Frt-R are used to amplify the Neo fragment to determine whether the resistance gene NeoR was removed; wherein WT is wild-type, and + is the positive control.

    [0125] FIG. 13D shows PCR identification results for F1 generation mice (short fragment replacement), wherein primer pairs Flp-F and Flp-R were used to confirm the presence of the Flp fragment; wherein WT is wild-type and + is the positive control.

    [0126] FIG. 14A is a graph showing the ELISA detection results of the mouse IL4 protein in IL4 humanized mice. One wild-type C57BL/6 mouse and two IL4 humanized heterozygotes were selected, wherein +/+represents wild-type C57BL/6 mice; B-hIL4 (V1) H/+ represents the IL4 humanized mouse heterozygote obtained by short fragment replacement (replacing coding sequences); and B-hIL4 (V2) H/+ represents the IL4 humanized mouse heterozygote obtained by long fragment replacement (replacing coding sequences and 5- and 3-UTR).

    [0127] FIG. 14B is a graph showing the ELISA detection results of the human IL4 protein in IL4 humanized mice. One wild-type C57BL/6 mouse and two IL4 humanized heterozygotes were selected, wherein +/+ represents wild-type C57BL/6 mice; B-hIL4 (V1) H/+ represents the IL4 humanized mouse heterozygote obtained by short fragment replacement; and B-hIL4 (V2) H/+ represents the IL4 humanized mouse heterozygote obtained by long fragment replacement.

    [0128] FIG. 15 is a schematic diagram showing mouse and human IL4R gene locus.

    [0129] FIG. 16 is a schematic diagram showing humanized IL4R gene locus.

    [0130] FIG. 17 is a schematic diagram showing the targeting strategy for IL4R gene locus.

    [0131] FIG. 18 is a graph showing the recombinant vector restriction enzyme digestion results, wherein No. 1, 2, 3, 4 refer to 4 vector plasmids respectively, ck represents the undigested plasmid control, and M is the Marker.

    [0132] FIG. 19A is a graph showing the PCR identification results using primer pairs F1/R1, wherein + is the positive control, WT is the wild-type control, and M is the Marker.

    [0133] FIG. 19B is a graph showing the PCR identification results using primer pairs F2/R2, wherein + is the positive control, WT is the wild-type control, M is the Marker.

    [0134] FIG. 20 is a graph showing Southern blot results. WT is the wild-type.

    [0135] FIG. 21A shows PCR identification results of F1 generation mice, wherein primer pairs WT-F2 and WT-R2 were used to amplify wild-type mouse IL4Ra gene exon 7;

    [0136] wherein WT is wild-type, + is the positive control, H.sub.2O is a blank control, and M is the Marker.

    [0137] FIG. 21B shows PCR identification results of F1 generation mice, wherein primer pairs Mut-F2 and WT-R2 were used to amplify modified exon 7 of the mouse IL4Ra gene to confirm the insertion of the recombinant vector into the genomic locus; wherein WT is wild-type, + is the positive control and, M is the Marker.

    [0138] FIG. 22A shows PCR identification results of F1 generation mice, wherein primer pairs Flp-F2 and Flp-R2 were used to confirm the presence of the Flp fragment; wherein WT is wild-type, and + is the positive control.

    [0139] FIG. 22B shows PCR identification results of F1 generation mice, wherein primer pairs Frt-F2 and Frt-R2 were used to amplify the Neo fragment to verify whether the resistance gene Neo was removed; wherein WT is wild-type, and + is the positive control.

    [0140] FIG. 23A is a graph showing the flow cytometry analysis result of wild-type C57BL/6 mice, wherein cells were stained by anti-mouse IL4Ra antibody (mIL4RA PE) and anti-mouse CD19 antibody (mCD19 FITC).

    [0141] FIG. 23B is a graph showing the flow cytometry analysis result of anti-mouse CD3 antibody-stimulated wild-type C57BL/6 mice, wherein cells were stained by anti-mouse IL4Ra antibody (mIL4RA PE) and anti-mouse CD19 antibody (mCD19 FITC).

    [0142] FIG. 23C is a graph showing the flow cytometry analysis result of anti-mouse CD3 antibody-stimulated humanized IL4Ra gene heterozygous mice, wherein cells were stained by anti-mouse IL4Ra antibody (mIL4RA PE) and anti-mouse CD19 antibody (mCD19 FITC).

    [0143] FIG. 23D is a graph showing the flow cytometry analysis result of wild-type C57BL/6 mice, wherein cells were stained by anti-human IL4Ra antibody (hIL4RA APC) and anti-mouse CD19 antibody (mCD19 FITC).

    [0144] FIG. 23E is a graph showing the flow cytometry analysis result of anti-mouse CD3 antibody-stimulated wild-type C57BL/6 mice, wherein cells were stained by anti-human IL4Ra antibody (hIL4RA APC) and anti-mouse CD19 antibody (mCD19 FITC).

    [0145] FIG. 23F is a graph showing the flow cytometry analysis result of anti-mouse CD3 antibody-stimulated humanized IL4Ra gene heterozygous mice, wherein cells were stained by anti-human IL4Ra antibody (hIL4RA APC) and anti-mouse CD19 antibody (mCD19 FITC).

    [0146] FIG. 24A is a graph showing the results of sgRNA1-sgRNA7 activity assay, in which Con. is the negative control and PC is the positive control.

    [0147] FIG. 24B is a graph showing the results of sgRNA8-sgRNA15 activity assay, in which Con. is the negative control and PC is the positive control.

    [0148] FIG. 25A is the ELISA detection result showing mouse IL4 protein levels in unstimulated mouse serum, wherein three wild-type C57BL/6 mice and three double-humanized IL4/IL4Ra homozygous mice (B-hIL4/IL4R mice) were selected.

    [0149] FIG. 25B is the ELISA detection result showing human IL4 protein levels in unstimulated mouse serum, wherein three wild-type C57BL/6 mice and three double-humanized IL4/IL4Ra homozygous mice (B-hIL4/IL4R mice) were selected.

    [0150] FIG. 25C is the ELISA detection result showing mouse IL4 protein levels in stimulated mouse serum, wherein three wild-type C57BL/6 mice and three double-humanized IL4/IL4Ra homozygous mice (B-hIL4/IL4R mice) were selected.

    [0151] FIG. 25D is the ELISA detection result showing human IL4 protein levels in stimulated mouse serum, wherein three wild-type C57BL/6 mice and three double-humanized IL4/IL4Ra homozygous mice (B-hIL4/IL4R mice) were selected.

    [0152] FIG. 26A is a graph showing the flow cytometry analysis result of three unstimulated wild-type C57BL/6 mice, wherein cells were labeled by anti-mouse IL4Ra antibody (mIL4RA PE) and anti-mouse CD19 antibody (mCD19 APC-Cy7).

    [0153] FIG. 26B is a graph showing the flow cytometry analysis result of three unstimulated double-humanized IL4/IL4Ra homozygous (B-HIL4/IL4R (H/H)) mice, wherein cells were labeled by anti-mouse IL4Ra antibody (mIL4RA PE) and anti-mouse CD19 antibody (mCD19 APC-Cy7).

    [0154] FIG. 26C is a graph showing the flow cytometry analysis result of three anti-mouse CD3 antibody-stimulated wild-type C57BL/6 mice, wherein cells were labeled by anti-mouse IL4Ra antibody (mIL4RA PE) and anti-mouse CD19 antibody (mCD19 APC-Cy7).

    [0155] FIG. 26D is a graph showing the flow cytometry analysis result of three anti-mouse CD3 antibody-stimulated double-humanized IL4/IL4Ra homozygous (B-HIL4/IL4R (H/H)) mice, wherein cells were labeled by anti-mouse IL4Ra antibody (mIL4RA PE) and anti-mouse CD19 antibody (mCD19 APC-Cy7).

    [0156] FIG. 26E is a graph showing the flow cytometry analysis result of three unstimulated wild-type C57BL/6 mice, wherein cells were labeled by anti-human IL4Ra antibody (hIL4RA PE) and anti-mouse CD19 antibody (mCD19 APC-Cy7).

    [0157] FIG. 26F is a graph showing the flow cytometry analysis result of three unstimulated double-humanized IL4/IL4Ra homozygous (B-HIL4/IL4R (H/H)) mice, wherein cells were labeled by anti-human IL4Ra antibody (hIL4RA PE) and anti-mouse CD19 antibody (mCD19 APC-Cy7).

    [0158] FIG. 26G is a graph showing the flow cytometry analysis result of three anti-mouse CD3 antibody-stimulated wild-type C57BL/6 mice, wherein cells were labeled by anti-human IL4Ra antibody (hIL4RA PE) and anti-mouse CD19 antibody (mCD19 APC-Cy7).

    [0159] FIG. 26H is a graph showing the flow cytometry analysis result of three anti-mouse CD3 antibody-stimulated double-humanized IL4/IL4Ra homozygous (B-HIL4/IL4R (H/H)) mice, wherein cells were labeled by anti-human IL4Ra antibody (hIL4RA PE) and anti-mouse CD19 antibody (mCD19 APC-Cy7).

    [0160] FIG. 27A is a graph showing the flow cytometry analysis result of double-humanized IL4/IL4Ra homozygous mice, wherein the cells were labeled by anti-hIgG-AF647 and anti-mCD19 antibody (mCD19APC-Cy7).

    [0161] FIG. 27B is a graph showing the flow cytometry analysis result of double-humanized IL4/IL4Ra homozygous mice, wherein the cells were labeled by anti-IgG4-kappa hIgG-APC/anti-hIgG-AF647 and anti-mouse CD19 antibody (mCD19APC-Cy7).

    [0162] FIG. 27C is a graph showing the flow cytometry analysis result of double-humanized IL4/IL4Ra homozygous mice, wherein the cells were labeled by anti-human IL4Ra antibody (Dupilumab)/anti-hIgG-AF647 and anti-mouse CD19 antibody (mCD19APC-Cy7). The results show that Dupilumab binds well to IL4Ra expressed in the double-humanized homozygous mice.

    [0163] FIG. 28 is a graph showing LPS-induced spleen lymphocyte proliferation result, wherein G1 was induced only by LPS, G2 was induced by LPS and mIL4, G3 was induced by LPS and hIL4. The result shows that the level of IgE in double-humanized IL4/IL4Ra mice was comparable to that of wild-type C57BL/6 mice, and the lymphocytes of wild-type mice can only be induced by mIL4 to produce IgE, while lymphocytes of double-humanized IL4/IL4Ra mice can only be induced by hIL4.

    [0164] FIG. 29 is a graph showing IgE production induced by hIL4 in double-humanized IL4/IL4Ra mice was effectively blocked by anti-human IL4Ra antibody Dupilumab.

    [0165] FIG. 30 is the experimental protocol of using double-humanized IL4/IL4Ra mice to make an inducible asthma model.

    [0166] FIG. 31 is a graph showing serum IgE levels of control group (PBS) and the asthma model (OVA). The serum IgE levels in the asthma model mice are significantly higher than those in the PBS control group.

    [0167] FIG. 32 is a graph showing lung histology results of double-humanized IL4/IL4Ra mice induced by ovalbumin combined with aluminum hydroxide (OVA) or PBS (control group). The OVA-induced group had more darkly stained area than the PBS control group, showing higher rate of inflammatory cell infiltration and obvious pathological features of asthma.

    [0168] FIG. 33A is a graph showing total number of eosinophils (Eos) cells in bronchoalveolar lavage fluid (BALF) of double-humanized IL4/IL4Ra mice induced by ovalbumin combined with aluminum hydroxide or PBS (control group), wherein OVA-induced group had more Eos cells than the PBS control group.

    [0169] FIG. 33B is a graph showing the proportion of eosinophils cells (Eos %) in bronchoalveolar lavage fluid (BALF) of double-humanized IL4/IL4Ra mice induced by ovalbumin combined with aluminum hydroxide (OVA) or PBS (control group). The result shows mice in the OVA-induced group had significantly more eosinophils compared than the PBS control group, indicating a sensitizing phenotype.

    [0170] FIG. 33C is a graph showing the proportion of neutrophil cells (Neu %) in bronchoalveolar lavage fluid (BALF) of double-humanized IL4/IL4Ra mice induced by ovalbumin combined with aluminum hydroxide (OVA) or PBS (control group). The result shows mice in OVA-induced group had significantly more neutrophils compared with the PBS control group, indicating a sensitizing phenotype.

    [0171] FIG. 34 is the experimental design to assess treatment efficacy of anti-human IL4Ra antibody Dupilumab in the double-humanized IL4/IL4Ra mice induced by ovalbumin combined with aluminum hydroxide.

    [0172] FIG. 35A is a graph showing total number of leukocytes (CD45+ cells) in bronchoalveolar lavage fluid (BALF) of double-humanized IL4/IL4Ra mice induced by ovalbumin combined with aluminum hydroxide and control group, wherein OVA-induced group (G2) had slightly more leukocytes than the control group (G1) and the treatment groups (G3, G4).

    [0173] FIG. 35B is a graph showing total number of eosinophils (Eos) cells in bronchoalveolar lavage fluid (BALF) of double-humanized IL4/IL4Ra mice induced by ovalbumin combined with aluminum hydroxide, wherein OVA-induced group (G2) had the most eosinophils cells, and the treatment group (G3, G4) had slightly more eosinophils cells than the control group (G1).

    [0174] FIG. 35C is a graph showing the proportion of eosinophils (Eos %) cells in leukocytes (CD45+ cells) in bronchoalveolar lavage fluid (BALF) of double-humanized IL4/IL4Ra mice induced by ovalbumin combined with aluminum hydroxide, wherein OVA-induced group (G2) had the highest proportion, the treatment group (G3) had the lowest proportion, and the treatment group (G4) had slightly lower proportion than the control group (G1).

    [0175] FIG. 36 is a graph showing serum IgE levels of double-humanized IL4/IL4Ra mice induced by ovalbumin combined with aluminum hydroxide, wherein high serum IgE levels were only detected in OVA-induced group (G2).

    [0176] FIG. 37 is a graph showing airway tissue section H&E staining result of double-humanized IL4/IL4Ra mice induced by ovalbumin combined with aluminum hydroxide, wherein airway of the control group (G1) mice showed no inflammation while the OVA-induced group (G2) had peribronchial and perivascular inflammation and increased mucus secretion levels. The mice in the treatment group (G3, G4) had decreased inflammatory infiltration and mucus secretion as compared to the G2 group.

    [0177] FIG. 38 is the experimental design to assess treatment efficacy of anti-human IL4Ra antibody Dupilumab in the double-humanized IL4/IL4Ra mouse asthma model.

    [0178] FIG. 39A is a graph showing total number of leukocytes (CD45+ cells) in BALF in the double-humanized IL4/IL4Ra mouse asthma model, wherein OVA-induced groups (G2, G4) have significantly more leukocytes than the control group (G1) and the treatment group (G3).

    [0179] FIG. 39B is a graph showing total number of eosinophils cells in BALF in the double-humanized IL4/IL4Ra mouse asthma model, wherein OVA-induced groups (G2, G4) had significantly more eosinophils cells than the control group (G1) and the treatment group (G3).

    [0180] FIG. 39C is a graph showing total number of neutrophils cells in BALF in the double-humanized IL4/IL4Ra mouse asthma model, wherein OVA-induced groups (G2, G4) had significantly more neutrophils cells than the control group (G1) and the treatment group (G3).

    [0181] FIG. 40 is a graph showing serum IgE levels in the double-humanized IL4/IL4Ra mouse asthma model, wherein OVA-induced groups (G2, G4) had significantly higher serum IgE levels than the control group (G1) and the treatment group (G3).

    [0182] FIG. 41 is a graph showing airway tissue section H&E staining results in the double-humanized IL4/IL4Ra mouse asthma model, wherein airway of the control group (G1) mice had no inflammation while OVA-induced groups (G2, G4) had peribronchial and perivascular inflammation and increased mucus secretion levels. Decreased inflammatory infiltration and mucus secretion were observed in the treatment group (G3) as compared to the OVA-induced groups.

    [0183] FIG. 42 shows amino acid sequence alignment result between human IL4 protein and mouse IL4 protein.

    [0184] FIG. 43 shows amino acid sequence alignment result between human IL4Ra protein and mouse IL4Ra protein.

    [0185] FIG. 44A is a graph showing total number of leukocytes (CD45+ cells) in BALF in the double-humanized IL4/IL4Ra mouse asthma model.

    [0186] FIG. 44B is a graph showing total number of eosinophils cells in BALF in the double-humanized IL4/IL4Ra mouse asthma model.

    [0187] FIG. 45A is a graph showing serum IgE levels in the double-humanized IL4/IL4Ra mouse asthma model.

    [0188] FIG. 45B is a graph showing IgE levels in BALF of the double-humanized IL4/IL4Ra mouse asthma model.

    DETAILED DESCRIPTION

    [0189] This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) IL4R and/or IL4, and methods of use thereof.

    [0190] IL4/IL4R signaling is implicated in many immune diseases including e.g., allergies, autoimmune diseases, asthma, and atopic dermatitis. In the immune system, IL4 controls the development, survival, and maturation of B cells and the proliferation and differentiation of Th2 T lymphocytes. IL4 supports this enhanced proliferation and survival in part by inducing glucose uptake and metabolism. IL4 can also polarize macrophages to the M2 or alternatively activated phenotype.

    [0191] In normal tissues, IL4 receptor (IL4Ra) is often expressed on T and B lymphocytes, eosinophils, macrophages, endothelial cells, lung fibroblasts, bronchial epithelial cells, myeloid-derived suppressor cells (MDSCs), and smooth muscle cells. There are two types of IL4 receptors. Each type of receptors has two protein subunits that heterodimerize upon IL4 binding the IL4Ra subunit. The type I receptor is predominantly expressed by hematopoietic cells, and has the IL4Ra and common gamma C (c) subunits. The type II receptor can be expressed by non-hematopoetic cells, and has the IL13R1 and IL4Ra subunits. Interestingly, while the majority of normal epithelial tissues do not express IL4 receptors, the type II receptor is overexpressed on the surface of many solid tumors including, but not limited to, renal cell carcinoma, melanoma, breast cancer, ovarian cancer, colon cancer, AIDS-related kaposi's sarcoma, and head and neck squamous cell carcinoma, suggesting targeting the IL4/IL4R signaling axis can be a potential anti-tumor therapy (Bankaitis et al. Targeting IL4/IL4R for the treatment of epithelial cancer metastasis. Clinical & experimental metastasis 32.8 (2015): 847-856).

    [0192] Unlike type I receptor, the type II receptor can also bind to IL13. IL13 signaling through the type II receptor on airway epithelial cells can lead to the airway hyper-responsiveness and increased mucus secretion in asthma. It was hypothesized that continued IL13 signaling through the type II receptor may contribute to the limited clinical efficacy of IL4-targeted treatments in asthma. Therefore, blocking the receptor subunit, IL4Ra, to inhibit both IL4- and IL13-induced signaling was an enticing alternative. However, the use of monoclonal antibodies against IL4Ra has yielded mixed results in patients. The humanized anti-IL4Ra antibody, AMG317, showed no clinical efficacy in asthma patients, and development was abandoned after phase II clinical trials. A second monoclonal antibody directed against IL4Ra, Dupilumab, has shown efficacy in the treatment of atopic dermatitis, and is possibly more effective for the treatment of asthma.

    [0193] Experimental animal models are an indispensable research tool for studying the effects of these antibodies before clinical trials. Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish and so on. However, there are differences between human and animal genes and protein sequences, and many human proteins cannot bind to the animal's homologous proteins to produce biological activity, leading to that the results of many clinical trials do not match the results obtained from animal experiments. A large number of clinical studies are in urgent need of better animal models. With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal's endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means. In this context, the genetically engineered animal model, that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug screening at animal levels. Furthermore, because of interaction between human IL4R and human IL4, a desirable animal model for the investigation of anti-IL4R or anti-IL4 antibodies should faithfully mimic the interaction between human IL4R and human IL4, elicit robust responses from both the innate and adaptive immunity, and recapitulate side effects of IL4 blockade in human patients.

    [0194] Unless otherwise specified, the practice of the methods described herein can take advantage of the techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology. These techniques are explained in detail in the following literature, for examples: Molecular Cloning A Laboratory Manual, 2nd Ed., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glovered., 1985); Oligonucleotide Synthesis (M. J. Gaited., 1984); Mullisetal U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Hames& S. J. Higginseds. 1984); Transcription And Translation (B. D. Hames& S. J. Higginseds. 1984); Culture Of Animal Cell (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984), the series, Methods In ENZYMOLOGY (J. Abelson and M. Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols. 154 and 155 (Wuetal. eds.) and Vol. 185, Gene Expression Technology (D. Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Caloseds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Hand book Of Experimental Immunology, Volumes V (D. M. Weir and C. C. Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1986); each of which is incorporated herein by reference in its entirety.

    Interleukin 4 (IL4)

    [0195] The interleukin 4 (IL4) has a compact, globular fold (similar to other cytokines), stabilized by 3 disulfide bonds. One half of the structure is dominated by a 4 alpha-helix bundle with a left-handed twist. The helices are anti-parallel, with 2 overhand connections, which fall into a 2-stranded anti-parallel beta-sheet.

    [0196] IL4 is a cytokine that induces differentiation of naive helper T cells (Th0 cells) to Th2 cells. Upon activation by IL4, Th2 cells subsequently produce additional IL4 in a positive feedback loop. The cell that initially produces IL4, thus inducing Th2 differentiation, has not been identified, but recent studies suggest that basophils may be the effector cell. It is closely related and has functions similar to interleukin 13.

    [0197] Tissue macrophages play an important role in chronic inflammation and wound repair. The presence of IL4 in extravascular tissues promotes alternative activation of macrophages into M2 cells and inhibits classical activation of macrophages into M1 cells. An increase in repair macrophages (M2) is coupled with secretion of IL10 and TGF- that result in a diminution of pathological inflammation. Release of arginase, proline, polyaminase and TGF- by the activated M2 cell is tied with wound repair and fibrosis.

    [0198] A detailed description of IL4 and its function can be found, e.g., in Pillai et al. Evolution of IL4 and pathogen antagonism. Growth Factors 29.4 (2011): 153-160; Li-Weber et al. Regulation of IL4 gene expression by T cells and therapeutic perspectives. Nature Reviews Immunology 3.7 (2003): 534; which are incorporated by reference herein in the entirety.

    [0199] In human genomes, IL4 gene (Gene ID: 3565) locus has 4 exons, exon 1, exon 2, exon 3, and exon 4. The nucleotide sequence for human IL4 mRNA is NM_000589.3 (SEQ ID NO: 3), and the amino acid sequence for human IL4 is NP_000580.1 (SEQ ID NO: 4). The location for each exon and each region in human IL4 nucleotide sequence and amino acid sequence is listed below:

    TABLE-US-00001 TABLE 1 NM_000589.3 NP_000580.1 Human IL4 642 bp 153 aa (approximate location) (SEQ ID NO: 3) (SEQ ID NO: 4) Exon 1 1-200 1-45 Exon 2 201-248 46-61 Exon 3 249-425 62-120 Exon 4 426-618 121-153 Signal peptide 66-137 1-24 Donor region in 66-527 1-153 Example FIG. 4 Donor region in 1-642 1-153 Example FIG. 8

    [0200] In mice, IL4 gene locus has 4 exons, exon 1, exon 2, exon 3, and exon 4. The nucleotide sequence for mouse IL4 mRNA is NM_021283.2 (SEQ ID NO: 1), the amino acid sequence for mouse IL4 is NP_067258.1 (SEQ ID NO: 2). The location for each exon and each region in the mouse IL4 nucleotide sequence and amino acid sequence is listed below:

    TABLE-US-00002 TABLE 2 NM_021283.2 NP_067258.1 Mouse IL-4 605 bp 140 aa (approximate location) (SEQ ID NO: 1) (SEQ ID NO: 2) Exon 1 1-191 1-44 Exon 2 192-239 45-60 Exon 3 240-392 61-111 Exon 4 393-586 112-140 Signal peptide 60-119 1-20 Replaced region in 60-482 1-140 Example FIG. 4 Replaced region in 1-605 1-140 Example FIG. 8

    [0201] The mouse IL4 gene (Gene ID: 16189) located in Chromosome 11 of the mouse genome, which is located from 53612460 to 53618665, of NC_000077.6 (GRCm38.p4, GCF_000001635.24). The 5-UTR is from 53618669 to 53618607, exon 1 is from 53618606 to 53618475, the first intron is from 53618474 to 53618218, exon 2 is from 53618217 to 53618170, the second intron is from 53618169 to 53614057, exon 3 is from 53614056 to 53613904, the third intron is from 53613903 to 53612654, exon 4 is from 53612653 to 53612564, the 3-UTR is from 53612563 to 53612460, based on transcript NM_021283.2. All relevant information for mouse IL4 locus can be found in the NCBI website with Gene ID: 16189, which is incorporated by reference herein in its entirety.

    [0202] FIG. 42 shows the alignment between human IL4 amino acid sequence (NP_000580.1; SEQ ID NO: 4) and mouse IL4 amino acid sequence (NP_067258.1; SEQ ID NO: 2). Thus, the corresponding amino acid residue or region between human and mouse IL4 can also be found in FIG. 42.

    [0203] IL4 genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for IL4 in Rattus norvegicus is 287287, the gene ID for IL4 in Macaca mulatta (Rhesus monkey) is 574281, the gene ID for IL4 in Canis lupus familiaris (dog) is 403785, and the gene ID for IL4 in Cavia porcellus (domestic guinea pig) is 100720403. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database, which are incorporated herein by reference in the entirety.

    [0204] The present disclosure provides human or chimeric (e.g., humanized) IL4 nucleotide sequence and/or amino acid sequences. In some embodiments, the entire sequence of mouse signal peptide, exon 1, exon 2, exon 3, and/or exon 4, are replaced by the corresponding human sequence.

    [0205] In some embodiments, a region or portion of mouse signal peptide, exon 1, exon 2, exon 3, and/or exon 4 is replaced by the corresponding human sequence.

    [0206] In some embodiments, the region or portion can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to signal peptide, exon 1, exon 2, exon 3, and/or exon 4. In some embodiments, a region, a portion, or the entire sequence of mouse signal peptide, exon 1, exon 2, exon 3 and/or exon 4 is replaced by a region, a portion, or the entire sequence of human signal peptide, exon 1, exon 2, exon 3, and/or exon 4.

    [0207] In some embodiments, a region or portion of mouse signal peptide, exon 1, exon 2, exon 3, and/or exon 4 is deleted.

    [0208] Thus, in some embodiments, the present disclosure also provides a chimeric (e.g., humanized) IL4 nucleotide sequence and/or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sequence are identical to or derived from mouse IL4 mRNA sequence (e.g., SEQ ID NO: 1), mouse IL4 amino acid sequence (e.g., SEQ ID NO: 2), or a portion thereof (e.g., exon 1, exon 2, exon 3, and/or exon 4); and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sequence are identical to or derived from human IL4 mRNA sequence (e.g., SEQ ID NO: 3), human IL4 amino acid sequence (e.g., SEQ ID NO: 4), or a portion thereof (e.g., exon 1, exon 2, exon 3, and/or exon 4).

    [0209] In some embodiments, the sequence encoding full-length amino acid sequence of mouse IL4 (SEQ ID NO: 2) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human IL4 (e.g., full-length amino acid sequence of human IL4 (SEQ ID NO: 4)).

    [0210] In some embodiments, the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse IL4 promotor, a human IL4 promotor, an inducible promoter, a human enhancer, a mouse enhancer, and/or mouse or human regulatory elements.

    [0211] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, or 60 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from a portion of or the entire mouse IL4 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, or SEQ ID NO: 1).

    [0212] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, or 60 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire mouse IL4 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, or SEQ ID NO: 1).

    [0213] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from a portion of or the entire human IL4 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, or SEQ ID NO: 3).

    [0214] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire human IL4 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, or SEQ ID NO: 3).

    [0215] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire mouse IL4 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, SEQ ID NO: 2).

    [0216] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire mouse IL4 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, SEQ ID NO: 2).

    [0217] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire human IL4 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, or SEQ ID NO: 4).

    [0218] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire human IL4 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, or SEQ ID NO: 4).

    [0219] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 2 or 4 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

    [0220] Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) IL4 from an endogenous non-human IL4 locus.

    [0221] In one aspect, the disclosure provides a genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric IL4.

    [0222] In some embodiments, the sequence encoding the human or chimeric IL4 is operably linked to an endogenous regulatory element, or a human regulatory element at the endogenous IL4 gene locus in the at least one chromosome.

    [0223] In some embodiments, the sequence encoding a human or chimeric IL4 comprises a sequence encoding an amino acid sequence that is at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to human IL4 (SEQ ID NO: 4).

    [0224] In some embodiments, the animal is a mammal, e.g., a monkey, a rodent or a mouse. In some embodiments, the animal is a BALB/c mouse or a C57BL/6 mouse.

    [0225] In some embodiments, the animal does not express endogenous IL4. In some embodiments, the animal has one or more cells expressing human or chimeric IL4.

    [0226] In some embodiments, the animal has one or more cells expressing human or chimeric IL4, and the expressed human or chimeric IL4 can bind to endogenous IL4R. In some embodiments, the animal has one or more cells expressing human or chimeric IL4, and the expressed human or chimeric IL4 cannot bind to endogenous IL4R.

    [0227] In another aspect, the disclosure is related to a genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous IL4 with a sequence encoding a corresponding region of human IL4 at an endogenous IL4 gene locus.

    [0228] In some embodiments, the sequence encoding the corresponding region of human IL4 is operably linked to an endogenous regulatory element, or a human regulatory element at the endogenous IL4 locus, and one or more cells of the animal expresses a chimeric IL4.

    [0229] In some embodiments, the animal is a mouse, and the replaced endogenous IL4 locus is exon 1, exon 2, exon 3, and/or exon 4 of the endogenous mouse IL4 gene.

    [0230] In some embodiments, the animal is heterozygous with respect to the replacement at the endogenous IL4 gene locus. In some embodiments, the animal is homozygous with respect to the replacement at the endogenous IL4 gene locus.

    [0231] In another aspect, the disclosure is related to methods for making a genetically-modified, non-human animal. The methods involve replacing in at least one cell of the animal, at an endogenous IL4 gene locus, a sequence encoding a region of an endogenous IL4 with a sequence encoding a corresponding region of human IL4.

    [0232] In some embodiments, the sequence encoding the corresponding region of human IL4 comprises exon 1, exon 2, exon 3 and/or exon 4 of a human IL4 gene.

    [0233] In some embodiments, the sequence encoding the corresponding region of IL4 comprises at least 50, 75, 100, 125, 150, 175, or 200 nucleotides of exon 1, exon 2, exon 3 and/or exon 4 of a human IL4 gene.

    [0234] In some embodiments, the sequence encoding the corresponding region of human IL4 encodes a sequence that is at least 90% identical to full-length amino acid sequence of SEQ ID NO: 4.

    [0235] In some embodiments, the animal is a mouse, and the locus is exon 1, exon 2, exon 3, and/or exon 4 of the mouse IL4 gene.

    [0236] In another aspect, the disclosure is also related to a non-human animal comprising at least one cell comprising a nucleotide sequence encoding a chimeric IL4 polypeptide, wherein the chimeric IL4 polypeptide comprises at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human IL4, wherein the animal expresses the chimeric IL4.

    [0237] In some embodiments, the chimeric IL4 polypeptide comprises a sequence that is at least 90%, 95%, or 99% identical to full-length amino acid sequence of SEQ ID NO: 4.

    [0238] In some embodiments, the nucleotide sequence is operably linked to an endogenous IL4 regulatory element of the animal, a human IL4 regulatory element, a mouse 5-UTR, a mouse 3-UTR, a human 5-UTR, or a human 3-UTR.

    [0239] In some embodiments, the nucleotide sequence is integrated to an endogenous IL4 gene locus of the animal.

    [0240] In some embodiments, the chimeric IL4 has at least one mouse IL4 activity and/or at least one human IL4 activity.

    [0241] In another aspect, the disclosure is also related to methods of making a genetically-modified mouse cell that expresses a chimeric IL4. The methods involve replacing, at an endogenous mouse IL4 gene locus, a nucleotide sequence encoding a region of mouse IL4 with a nucleotide sequence encoding a corresponding region of human IL4, thereby generating a genetically-modified mouse cell that includes a nucleotide sequence that encodes the chimeric IL4, wherein the mouse cell expresses the chimeric IL4.

    [0242] In some embodiments, the nucleotide sequence encoding the chimeric IL4 is operably linked to an endogenous regulatory region, or a human IL4 regulatory region, e.g., promoter.

    [0243] In some embodiments, the animal further comprises a sequence encoding an additional human or chimeric protein (e.g., IL4R, Interleukin 33 (IL33), Interleukin 13 (IL13), programmed cell death protein 1 (PD-1), cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), Lymphocyte Activating 3 (LAG-3), B And T Lymphocyte Associated (BTLA), Programmed Cell Death 1 Ligand 1 (PD-L1), CD27, CD28, T-Cell Immunoreceptor with Ig and ITIM Domains (TIGIT), T-cell Immunoglobulin and Mucin-Domain Containing-3 (TIM-3), Glucocorticoid-Induced TNFR-Related Protein (GITR), CD137, TNF Receptor Superfamily Member 4 (OX40), CD47, or Signal Regulatory Protein alpha (SIRPa)).

    [0244] In some embodiments, the additional human or chimeric protein is IL4R.

    [0245] In one aspect, the disclosure also provides methods of determining effectiveness of an IL4 antagonist (e.g., an anti-IL4 antibody) for reducing inflammation. The methods involve administering the IL4 antagonist to the animal described herein, wherein the animal has an inflammation; and determining the inhibitory effects of the IL4 antagonist to the reduction of inflammation.

    [0246] In one aspect, the disclosure also provides methods of determining effectiveness of an IL4 antagonist (e.g., an anti-IL4 antibody) for treating autoimmune disorder or allergy. The methods involve administering the IL4 antagonist to the animal described herein, wherein the animal has an autoimmune disorder or allergy; and determining the inhibitory effects of the IL4 antagonist to the treatment of autoimmune disorder or allergy.

    [0247] In one aspect, the disclosure also provides methods of determining effectiveness of an IL4 antagonist (e.g., an anti-IL4 antibody) for treating cancer. The methods involve administering the IL4 antagonist to the animal as described herein, wherein the animal has a tumor; and determining the inhibitory effects of the IL4 antagonist to the tumor.

    [0248] In some embodiments, the animal further comprises a sequence encoding a human or chimeric IL4R. In some embodiments, the additional therapeutic agent is an anti-IL4R antibody.

    [0249] In some embodiments the additional therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-CTLA4 antibody, an anti-CD20 antibody, an anti-EGFR antibody, or an anti-CD319 antibody.

    [0250] In another aspect, the disclosure further provides methods of determining toxicity of an agent (e.g., an IL4 antagonist). The methods involve administering the agent to the animal as described herein; and determining weight change of the animal. In some embodiments, the method further involve performing a blood test (e.g., determining red blood cell count).

    [0251] In one aspect, the disclosure relates to proteins comprising an amino acid sequence, wherein the amino acid sequence is one of the following: [0252] (a) an amino acid sequence set forth in SEQ ID NO: 4; [0253] (b) an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4; [0254] (c) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 4 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and [0255] (d) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 4.

    [0256] In some embodiments, provided herein are cells comprising the proteins disclosed herein. In some embodiments, provided herein are animals having the proteins disclosed herein.

    [0257] In another aspect, the disclosure relates to nucleic acids comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following: [0258] (a) a sequence that encodes the protein as described herein; [0259] (b) SEQ ID NO: 3; [0260] (c) a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3, 8, 9, 10, 11, 23, 24, or 25;

    [0261] In some embodiments, provided herein are cells comprising the nucleic acids disclosed herein. In some embodiments, provided herein are animals having the nucleic acids disclosed herein.

    [0262] In another aspect, the disclosure also provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal's endogenous IL4 gene, wherein the disruption of the endogenous IL4 gene comprises deletion of exon1, exon2, exon 3 and/or exon 4 or part thereof of the endogenous IL4 gene.

    [0263] In some embodiments, the disruption of the endogenous IL4 gene further comprises deletion of one or more exons or part of exons selected from the group consisting of exon 1, exon 2, exon 3 and/or exon 4 of the endogenous IL4 gene.

    [0264] In some embodiments, the disruption of the endogenous IL4 gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 1, intron 2, and/or intron 3 of the endogenous IL4 gene.

    [0265] In some embodiments, wherein the deletion can comprise deleting at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 10, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500 or more nucleotides.

    [0266] In some embodiments, the disruption of the endogenous IL4 gene comprises the deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides of exon 1, exon 2, exon 3, and/or exon 4 (e.g., deletion of the entire exon 1, exon 2, exon 3, and exon 4).

    Interleukin 4 Receptor (IL4R)

    [0267] The interleukin 4 receptor (IL4R), also named as interleukin 4 receptor subunit alpha, or interleukin 4 receptor (IL4Ra), is a type I cytokine receptor. It is encoded by IL4Ra gene. The N-terminal (extracellular) portion of interleukin-4 receptor is related in overall topology to fibronectin type III modules and folds into a sandwich comprising seven antiparallel beta sheets arranged in a three-strand and a four-strand beta-pleated sheet. They are required for binding of IL4 to the receptor alpha chain, which is a crucial event for the generation of a Th2-dominated early immune response.

    [0268] The IL4Ra gene encodes the alpha chain of the IL4 receptor. The IL4 receptor is a type I transmembrane protein that can bind IL4 and IL13 to regulate IgE antibody production in B cells. Among T cells, the encoded protein also can bind IL4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by an alternate splice variant or by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitis, asthma, or eczema. Two transcript variants encoding different isoforms, a membrane-bound and a soluble form, have been found for this gene. Interactions of IL4 with TNF promote structural changes to vascular endothelial cells, thus playing an important role in tissue inflammation.

    [0269] The binding of IL4 or IL13 to the IL4 receptor on the surface of macrophages results in the alternative activation of those macrophages. Alternatively activated macrophages (AAM) downregulate inflammatory mediators such as IFN during immune responses, particularly with regards to helminth infections.

    [0270] A detailed description of IL4R and its function can be found, e.g., in Bankaitis et al. Targeting IL4/IL4R for the treatment of epithelial cancer metastasis. Clinical & experimental metastasis 32.8 (2015): 847-856; Zhang et al. Association of IL4 and IL4R polymorphisms with multiple sclerosis susceptibility in Caucasian population: a meta-analysis. Journal of the neurological sciences 363 (2016): 107-113; which are incorporated by reference herein in the entirety.

    [0271] In human genomes, IL4Ra gene (Gene ID: 3566) locus has 11 exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and exon 11.

    [0272] The IL4R protein has an extracellular region, a transmembrane region, and a cytoplasmic region. The nucleotide sequence for human IL4Ra mRNA is NM_000418.3 (SEQ ID NO: 41), and the amino acid sequence for human IL4R is NP_000409.1 (SEQ ID NO: 42). The location for each exon and each region in human IL4Ra nucleotide sequence and amino acid sequence is listed below:

    TABLE-US-00003 TABLE 3 NM_000418.3 NP_000409.1 Human IL4R 3710 bp 825 aa (approximate location) (SEQ ID NO: 41) (SEQ ID NO: 42) Exon 1 1-112 Non-coding sequence Exon 2 48-245 Non-coding sequence Exon 3 224-333 1-23 Exon 4 312-472 24-70 Exon 5 454-624 71-121 Exon 6 606-776 122-171 Exon 7 758-933 172-223 Exon 8 915-1033 224-257 Exon 9 1015-1112 258-283 Exon 10 1094-1162 284-300 Exon 11 1144-3689 301-825 Signal peptide 264-338 1-25 Extracellular 339-959 26-232 Transmembrane 960-1031 233-256 Cytoplasmic 1032-2738 257-825 Donor Range 351-911 30-216

    [0273] In mice, IL4Ra gene locus has 11 exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10 and exon 11 (FIG. 15). The mouse IL4R protein also has an extracellular region, a transmembrane region, and a cytoplasmic region. The nucleotide sequence for mouse IL4Ra mRNA is NM_001008700.3 (SEQ ID NO: 39), the amino acid sequence for mouse IL4R is NP_001008700.1 (SEQ ID NO: 40). The location for each exon and each region in the mouse IL4Ra nucleotide sequence and amino acid sequence is listed below:

    TABLE-US-00004 TABLE 4 NM_001008700.3 NP_001008700.1 Mouse IL4Ra 5122 bp 810 aa (approximate location) (SEQ ID NO: 39) (SEQ ID NO: 40) Exon 1 1-47 Non-coding sequence Exon 2 48-223 Non-coding sequence Exon 3 224-311 1-23 Exon 4 312-453 24-71 Exon 5 454-605 72-121 Exon 6 606-757 122-172 Exon 7 758-914 173-224 Exon 8 915-1014 225-258 Exon 9 1015-1093 259-284 Exon 10 1094-1143 285-301 Exon 11 1144-5094 302-810 Signal peptide 242-316 1-25 Extracellular 317-940 26-233 Transmembrane 941-1012 234-257 Cytoplasmic 1013-2671 258-810 Replaced region in 329-892 30-217 Example

    [0274] The mouse IL4Ra gene (Gene ID: 16190) located in Chromosome 7 of the mouse genome, which is located from 125552282 to 125579474, of NC_000073.6 (GRCm38.p4, GCF_000001635.24). The 5-UTR is from 125,552,120 to 125,552,328, 125,564,552 to 125,564,727 and, 125,565,637 to 125,565,654, exon 1 is from 125,552,120 to 125,552,328, the first intron is from 125,552,329 to 125,564,551, exon 2 is from 125,564,552 to 125,564,727, the second intron is from 125,564,728 to 125,565,636, exon 3 is from 125,565,637 to 125,565,724, the third intron is from 125,565,725 to 125,567,155, exon 4 is from 125,567,156 to 125,567,297, the fourth intron is from 125,567,298 to 125,569,022, exon 5 is from 125,569,023 to 125,569,174, the fifth intron is from 125,569,175 to 125,569,941, exon 6 is from 125,569,942 to 125,570,093, the sixth intron is from 125,570,094 to 125,571,433, exon 7 is from 125,571,434 to 125,571,590, the seventh intron is from 125,571,591 to 125,572,850, exon 8 is from 125,572,851 to 125,572,950, the eighth intron is from 125,572,951 to 125,574,637, exon 9 is from 125,574,638 to 125,574,716, the ninth intron is from 125,574,717 to 125,575,139, exon 10 is from 125,575,140 to 125,575,189, the ten intron is from 125,575,190 to 125,575,523, exon 11 is from 125,575,524 to 125,579,474, the 3-UTR is from 125577055 to 125,579,474, based on transcript NM_001008700.3. All relevant information for mouse IL4Ra locus can be found in the NCBI website with Gene ID: 16190, which is incorporated by reference herein in its entirety.

    [0275] FIG. 43 shows the alignment between human IL4R amino acid sequence (NP_000409.1; SEQ ID NO: 42) and mouse IL4R amino acid sequence (NP_001008700.1; SEQ ID NO: 40). Thus, the corresponding amino acid residue or region between human and mouse IL4R can also be found in FIG. 43.

    [0276] IL4Ra genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for IL4Ra in Rattus norvegicus is 25084, the gene ID for IL4Ra in Macaca mulatta (Rhesus monkey) is 705404, the gene ID for IL4Ra in Canis lupus familiaris (dog) is 489957, and the gene ID for IL4Ra in Sus scrofa (pig) is 397614. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database.

    [0277] The present disclosure provides human or chimeric (e.g., humanized) IL4Ra nucleotide sequence and/or amino acid sequences. In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, the signal peptide, the extracellular region, the transmembrane region, and/or the cytoplasmic region are replaced by the corresponding human sequence.

    [0278] In some embodiments, a region or portion of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, signal peptide, the extracellular region, the transmembrane region, and/or the cytoplasmic region is replaced by the corresponding human sequence. The term region or portion can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, or 400 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, or 150 amino acid residues.

    [0279] In some embodiments, the region or portion can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, signal peptide, the extracellular region, the transmembrane region, and/or the cytoplasmic region. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or exon 11 (e.g., exon 4, exon 5, exon 6, and exon 7) is replaced by a region, a portion, or the entire sequence of human exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or exon 11 (e.g., exon 4, exon 5, exon 6, and exon 7).

    [0280] In some embodiments, a region or portion of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, signal peptide, the extracellular region, the transmembrane region, and/or the cytoplasmic region is deleted. For example, a region or a portion of exon 4, exon 5, exon 6, and exon 7 is deleted.

    [0281] Thus, in some embodiments, the present disclosure also provides a chimeric (e.g., humanized) IL4Ra nucleotide sequence and/or amino acid sequences, wherein in some to embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sequence are identical to or derived from mouse IL4Ra mRNA sequence (e.g., SEQ ID NO: 39), mouse IL4R amino acid sequence (e.g., SEQ ID NO: 40), or a portion thereof (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or exon 11). In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sequence are identical to or derived from human IL4Ra mRNA sequence (e.g., SEQ ID NO: 41), human IL4R amino acid sequence (e.g., SEQ ID NO: 42), or a portion thereof (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or exon 11).

    [0282] In some embodiments, the sequence encoding amino acids 30-217 of mouse IL4R (SEQ ID NO: 40) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human IL4R (e.g., amino acids 30-216 of human IL4R (SEQ ID NO: 42).

    [0283] In some embodiments, the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse IL4R promotor, an inducible promoter, an enhancer, and/or mouse or human regulatory elements.

    [0284] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from a portion of or the entire mouse IL4Ra nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or SEQ ID NO: 39).

    [0285] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire mouse IL4Ra nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or SEQ ID NO: 39).

    [0286] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from a portion of or the entire human IL4Ra nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or SEQ ID NO: 41).

    [0287] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire human IL4Ra nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or SEQ ID NO: 41).

    [0288] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire mouse IL4R amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or NP_001008700.1 (SEQ ID NO: 40)).

    [0289] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire mouse IL4R amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or NP_001008700.1 (SEQ ID NO: 40)).

    [0290] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire human IL4R amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or SEQ ID NO: 42).

    [0291] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire human IL4R amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or SEQ ID NO: 42).

    [0292] The present disclosure also provides a humanized IL4R mouse amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

    [0293] a) an amino acid sequence shown in SEQ ID NO: 44;

    [0294] b) an amino acid sequence having a homology of at least 90% with or at least 90% identical to the amino acid sequence shown in SEQ ID NO: 44;

    [0295] c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 44 under a low stringency condition or a strict stringency condition;

    [0296] d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 44;

    [0297] e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 44 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or

    [0298] f) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 44.

    [0299] The present disclosure also relates to a nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

    [0300] a) a nucleic acid sequence as shown in SEQ ID NO: 39, 41, or 43, or a nucleic acid sequence encoding a homologous IL4R amino acid sequence of a humanized mouse;

    [0301] b) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 39, 41, or 43 under a low stringency condition or a strict stringency condition;

    [0302] c) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence as shown in SEQ ID NO: 39, 41, 43, 48, 49, 50, or 51;

    [0303] d) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90% with or at least 90% identical to the amino acid sequence shown in SEQ ID NO: 40, 42, or 44;

    [0304] e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 40, 42, or 44;

    [0305] f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 40, 42, or 44 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and/or g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 40, 42, or 44.

    [0306] The present disclosure further relates to an IL4R genomic DNA sequence of a humanized mouse. The DNA sequence is obtained by a reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence homologous to the sequence shown in SEQ ID NO: 39, 41, or 43.

    [0307] The disclosure also provides an amino acid sequence that has a homology of at least 90% with, or at least 90% identical to the sequence shown in SEQ ID NO: 40, 42, or 44, and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 40, 42, or 44 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

    [0308] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 40, 42, or 44 is at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

    [0309] The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90% identical to the sequence shown in SEQ ID NO: 39, 41, or 43, and encodes a polypeptide that has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 39, 41, or 43 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

    [0310] Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) IL4R from an endogenous non-human IL4R locus.

    [0311] In one aspect, the disclosure also provides methods of determining effectiveness of an IL4R antagonist (e.g., an anti-IL4R antibody) for reducing inflammation. The methods involve administering the IL4R antagonist to the animal described herein, wherein the animal has an inflammation; and determining the inhibitory effects of the IL4R antagonist to the reduction of inflammation.

    [0312] In one aspect, the disclosure also provides methods of determining effectiveness of an IL4R antagonist (e.g., an anti-IL4R antibody) for treating autoimmune disorder or allergy. The methods involve administering the IL4R antagonist to the animal described herein, wherein the animal has an autoimmune disorder or allergy; and determining the inhibitory effects of the IL4R antagonist to the treatment of autoimmune disorder or allergy.

    [0313] In one aspect, the disclosure also provides methods of determining effectiveness of an IL4R antagonist (e.g., an anti-IL4R antibody) for treating cancer. The methods involve administering the IL4R antagonist to the animal described herein, wherein the animal has a tumor; and determining the inhibitory effects of the IL4R antagonist to the tumor. In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal. In some embodiments, determining the inhibitory effects of the IL4R antagonist (e.g., an anti-IL4R antibody) to the tumor involves measuring the tumor volume in the animal.

    [0314] In another aspect, the disclosure also provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal's endogenous IL4R gene, wherein the disruption of the endogenous IL4R gene comprises deletion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 (e.g., exon 4, exon 5, exon 6 and/or exon 7) or part thereof of the endogenous IL4R gene.

    [0315] In some embodiments, the disruption of the endogenous IL4R gene comprises deletion of one or more exons or part of exons selected from the group consisting of exon 4, exon 5, exon 6 and/or exon 7 of the endogenous IL4R gene.

    [0316] In some embodiments, the disruption of the endogenous IL4R gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 4, intron 5, and/or intron 6 of the endogenous IL4R gene.

    [0317] In some embodiments, wherein the deletion can comprise deleting at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 10, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500 or more nucleotides.

    [0318] In some embodiments, the disruption of the endogenous IL4R gene comprises the deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 (e.g., exon 4, exon 5, exon 6 and/or exon 7)

    Genetically Modified Animals

    [0319] As used herein, the term genetically-modified non-human animal refers to a non-human animal having genetic modification (e.g., exogenous DNA) in at least one chromosome of the animal's genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% of cells of the genetically-modified non-human animal have the genetic modification in its genome. The cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a modified endogenous IL4R or IL4 locus that comprises an exogenous sequence (e.g., a human sequence), e.g., a replacement of one or more non-human sequences with one or more human sequences. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.

    [0320] As used herein, the term chimeric gene or chimeric nucleic acid refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wild-type nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species. In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.

    [0321] As used herein, the term chimeric protein or chimeric polypeptide refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one portion of the sequences of the protein or the polypeptide does not correspond to wild-type amino acid sequence in the animal. In some embodiments, the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.

    [0322] In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized IL4R gene or a humanized IL4R nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human IL4R gene, at least one or more portions of the gene or the nucleic acid is from a non-human IL4R gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes an IL4R protein. The encoded IL4R protein is functional or has at least one activity of the human IL4R protein or the non-human IL4R protein, e.g., binding to human or non-human IL4, and/or upregulating immune response.

    [0323] In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized IL4R protein or a humanized IL4R polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human IL4R protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human IL4R protein. The humanized IL4R protein or the humanized IL4R polypeptide is functional or has at least one activity of the human IL4R protein or the non-human IL4R protein.

    [0324] In some embodiments, the humanized IL4R protein or the humanized IL4R polypeptide can bind to mouse IL4, and/or upregulate immune response. In some embodiments, the humanized IL4R protein or the humanized IL4R polypeptide cannot bind to mouse IL4, thus cannot upregulate immune response.

    [0325] In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized IL4 gene or a humanized IL4 nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human IL4 gene, at least one or more portions of the gene or the nucleic acid is from a non-human IL4 gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes an IL4 protein. The encoded IL4 protein is functional or has at least one activity of the human IL4 protein or the non-human IL4 protein, e.g., binding to human or non-human IL4R, and/or upregulating immune response.

    [0326] In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized IL4 protein or a humanized IL4 polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human IL4 protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human IL4 protein. The humanized IL4 protein or the humanized IL4 polypeptide is functional or has at least one activity of the human IL4 protein or the non-human IL4 protein.

    [0327] In some embodiments, the humanized IL4 protein or the humanized IL4 polypeptide can bind to mouse IL4R, and/or upregulate immune response. In some embodiments, the humanized IL4 protein or the humanized IL4 polypeptide cannot bind to mouse IL4R, thus cannot upregulate immune response.

    [0328] The genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey). For the non-human animals where suitable genetically modifiable embryonic stem (ES) cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.

    [0329] In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamster, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rats, and zokors). In some embodiments, the genetically modified rodent is selected from a true mouse or rat (family Muridae), a gerbil, a spiny mouse, and a crested rat. In some embodiments, the non-human animal is a mouse.

    [0330] In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/Ola. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm), 129S2, 129S4, 129S5, 12959/SvEvH, 129S6 (129/SvEvTac), 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999); Auerbach et al., Establishment and Chimera Analysis of 129/SvEv- and C57BL/6-Derived Mouse Embryonic Stem Cell Lines (2000), both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL/6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL/6 strains. In some embodiments, the mouse is a BALB strain, e.g., BALB/c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50% BALB/c-50% 12954/Sv; or 50% C57BL/6-50% 129).

    [0331] In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

    [0332] The animal can have one or more other genetic modifications, and/or other modifications, that are suitable for the particular purpose for which the humanized IL4R or IL4 animal is made. For example, suitable mice for maintaining a xenograft, can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and/or immune cells by chemical means (e.g., administering a toxin), physical means (e.g., irradiating the animal), and/or genetic modification (e.g., knocking out one or more genes). Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD/SCID mice, IL2R knockout mice, NOD/SCID/cnull mice (Ito, M. et al., NOD/SCID/cnull mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100(9): 3175-3182, 2002), nude mice, and Rag1 and/or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, a genetically modified mouse is provided that can include a humanization of at least a portion of an endogenous non-human IL4R or IL4 locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD/SCID mice, IL-2R knockout mice, NOD/SCID/c null mice, nude mice, Rag1 and/or Rag2 knockout mice, and a combination thereof. These genetically modified animals are described, e.g., in US20150106961, which is incorporated herein by reference in its entirety. In some embodiments, the mouse can include a replacement of all or part of mature IL4R or IL4 coding sequence with human mature IL4R or IL4 coding sequence.

    [0333] Genetically modified non-human animals can comprise a modification of an endogenous non-human IL4 or IL4R locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature IL4 or IL4R protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the mature IL4 or IL4R protein sequence). Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells), in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous IL4 or IL4R locus in the germline of the animal.

    [0334] Genetically modified animals can express a human IL4 or IL4R (or a chimeric IL4 or IL4R) from endogenous mouse loci, wherein the endogenous mouse gene has been replaced with a human gene and/or a nucleotide sequence that encodes a region of human IL4 or IL4R sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70&, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the human IL4 or IL4R sequence. In various embodiments, an endogenous non-human locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature protein.

    [0335] In some embodiments, the genetically modified mice express the human IL4 or IL4R (or chimeric IL4 or IL4R) from endogenous loci that are under control of mouse promoters and/or mouse regulatory elements. The replacement(s) at the endogenous mouse loci provide non-human animals that express human protein or chimeric protein in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. The human protein or the chimeric protein expressed in animal can maintain one or more functions of the wild-type mouse or human protein in the animal. For example, IL4R can bind to human or non-human IL4, and upregulate immune response, e.g., upregulate immune response by at least 10%, 20%, 30%, 40%, or 50%. As used herein, the term endogenous IL4R refers to IL4R protein that is expressed from an endogenous IL4R nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification. Similarly, the term endogenous IL4 refers to IL4 protein that is expressed from an endogenous IL4 nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.

    [0336] The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 40, 42, or 44, and/or a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 4.

    [0337] The genome of the genetically modified animal can comprise a replacement at an endogenous IL4R gene locus of a sequence encoding a region of endogenous IL4R with a sequence encoding a corresponding region of human IL4R. In some embodiments, the sequence that is replaced is any sequence within the endogenous IL4R gene locus, e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 5-UTR, 3UTR, the first intron, the second intron, and the third intron, the fourth intron, the fifth intron, the sixth intron, the seventh intron, the eighth intron, the ninth intron, the tenth intron or the eleventh intron, etc. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous IL4R gene. In some embodiments, the sequence that is replaced is exon 4, exon 5, exon 6 and/or exon 7 or part thereof, of an endogenous mouse IL4R gene locus.

    [0338] The genetically modified animal can have one or more cells expressing a human or chimeric IL4R (e.g., humanized IL4R) having an extracellular region and a cytoplasmic region, wherein the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99% identical to the extracellular region of human IL4R. In some embodiments, the extracellular region of the humanized IL4R has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 amino acids (e.g., contiguously or non-contiguously) that are identical to human IL4R.

    [0339] The genome of the genetically modified animal can comprise a replacement at an endogenous IL4 gene locus of a sequence encoding a region of endogenous IL4 with a sequence encoding a corresponding region of human IL4. In some embodiments, the sequence that is replaced is any sequence within the endogenous IL4 gene locus, e.g., exon 1, exon 2, exon 3, exon 4, 5-UTR, 3UTR, the first intron, the second intron, or the third intron, etc. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous IL4 gene. In some embodiments, the sequence that is replaced is within the regulatory region of the human IL4 gene.

    [0340] Because human protein and non-human protein sequences, in many cases, are different, antibodies that bind to human protein will not necessarily have the same binding affinity with non-human protein or have the same effects to non-human protein. Therefore, the genetically modified animal expressing human IL4 and the genetically modified animal having a human or a humanized extracellular region of IL4R can be used to better evaluate the effects of anti-IL4 or IL4R antibodies in an animal model. In some embodiments, the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that corresponds to part or the entire sequence of exon 4, exon 5, exon 6 and/or exon 7 of human IL4R, part or the entire sequence of the extracellular region of human IL4R (with or without signal peptide), or part or the entire sequence of amino acids 30-216 of SEQ ID NO: 42.

    [0341] In some embodiments, the non-human animal can have, at an endogenous IL4R gene locus, a nucleotide sequence encoding a chimeric human/non-human IL4R polypeptide, wherein a human portion of the chimeric human/non-human IL4R polypeptide comprises a portion of human IL4R extracellular region, and wherein the animal expresses a functional IL4R on a surface of a cell of the animal. The human portion of the chimeric human/non-human IL4R polypeptide can comprise a portion of exon 4, exon 5, exon 6 and/or exon 7 of human IL4R. In some embodiments, the human portion of the chimeric human/non-human IL4R polypeptide can comprise a sequence that is at least 80%, 85%, 90%, 95%, or 99% identical to amino acids 30-216 of SEQ ID NO: 42.

    [0342] In some embodiments, the non-human portion of the chimeric human/non-human IL4R polypeptide comprises the transmembrane region, and/or the cytoplasmic region of an endogenous non-human IL4R polypeptide. There may be several advantages that are associated with the transmembrane and/or cytoplasmic regions of an endogenous non-human IL4R polypeptide. For example, once IL4 binds to IL4R, they can properly transmit extracellular signals into the cells and regulate the downstream pathway. A human or humanized transmembrane and/or cytoplasmic regions may not function properly in non-human animal cells. In some embodiments, a few extracellular amino acids that are close to the transmembrane region of IL4R are also derived from endogenous sequence.

    [0343] In some embodiments, the humanized IL4R locus lacks a human IL4R 5-UTR. In some embodiment, the humanized IL4R locus comprises a rodent (e.g., mouse) 5-UTR. In some embodiments, the humanization comprises a human 3-UTR. In appropriate cases, it may be reasonable to presume that the mouse and human IL4R genes appear to be similarly regulated based on the similarity of their 5-flanking sequence. As shown in the present disclosure, humanized IL4R mice that comprise a replacement at an endogenous mouse IL4R locus, which retain mouse regulatory elements but comprise a humanization of IL4R encoding sequence, do not exhibit obvious pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized IL4R are grossly normal.

    [0344] In some embodiments, the humanized IL4 locus has a human IL4 5-UTR or an endogenous IL4 5-UTR. In some embodiment, the humanized IL4 locus comprises a rodent (e.g., mouse) 5-UTR. In some embodiments, the humanization comprises a human 3-UTR or an endogenous 3-UTR. In appropriate cases, it may be reasonable to presume that the mouse and human IL4 genes appear to be similarly regulated based on the similarity of their 5-flanking sequence. As shown in the present disclosure, humanized IL4 mice that comprise a replacement at an endogenous mouse IL4 locus, which has mouse or human regulatory elements, do not exhibit obvious pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized IL4 are grossly normal.

    [0345] The present disclosure further relates to a non-human mammal generated through the method mentioned above. In some embodiments, the genome thereof contains human gene(s). In some embodiments, the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.

    [0346] In some embodiments, the non-human mammal expresses a protein encoded by a humanized IL4R or IL4 gene.

    [0347] In addition, the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse).

    [0348] The present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.

    [0349] The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized IL4R or IL4 in the genome of the animal.

    [0350] In some embodiments, the non-human mammal comprises the genetic construct as described herein. In some embodiments, a non-human mammal expressing human or humanized IL4R or IL4 is provided. In some embodiments, the tissue-specific expression of human or humanized IL4R or IL4 protein is provided.

    [0351] In some embodiments, the expression of human or humanized IL4R or IL4 in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance.

    [0352] Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein. Preferred non-human mammals are mammals, (e.g., rodents). In some embodiments, the non-human mammal is a mouse.

    [0353] Genetic, molecular and behavioral analyses for the non-human mammals described above can performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.

    [0354] The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cell can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The integration of genetic constructs containing DNA sequences encoding human IL4R or IL4 protein can be detected by a variety of methods.

    [0355] There are many analytical methods that can be used to detect exogenous DNA, including methods at the level of nucleic acid (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies). In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized IL4R or IL4 protein.

    [0356] The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any amino acid sequence as described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, 400, 500, or 600 nucleotides. In some embodiments, the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid residues.

    [0357] In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.

    [0358] In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.

    [0359] To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90%, 95%, or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For purposes of the present disclosure, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

    [0360] The percentage of residues conserved with similar physicochemical properties (percent homology), e.g. leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues having similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). The homology percentage, in many cases, is higher than the identity percentage.

    [0361] Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) amino acid sequence from an endogenous non-human IL4R or IL4 locus.

    Vectors

    [0362] The present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5 end of a region to be altered (5 arm), which is selected from the IL4Ra or IL4 gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired/donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3 end of the region to be altered (3 arm), which is selected from the IL4Ra or IL4 gene genomic DNAs in the length of 100 to 10,000 nucleotides.

    [0363] In some embodiments, a) the DNA fragment homologous to the 5 end of a conversion region to be altered (5 arm) is selected from the nucleotide sequences that have at least 90% homology to the NCBI accession number NC_000077.6; c) the DNA fragment homologous to the 3 end of the region to be altered (3 arm) is selected from the nucleotide sequences that have at least 90% homology to the NCBI accession number NC_000077.6.

    [0364] In some embodiments, a) the DNA fragment homologous to the 5 end of a region to be altered (5 arm) is selected from the nucleotides from the position 53622826 to the position 53618607 of the NCBI accession number NC_000077.6; c) the DNA fragment homologous to the 3 end of the region to be altered (3 arm) is selected from the nucleotides from the position 53612065 to the position 53607981 of the NCBI accession number NC_000077.6.

    [0365] In some embodiments, a) the DNA fragment homologous to the 5 end of a region to be altered (5 arm) is selected from the nucleotides from the position 53625623 to the position 53620071 of the NCBI accession number NC_000077.6; c) the DNA fragment homologous to the 3 end of the region to be altered (3 arm) is selected from the nucleotides from the position 53612200 to the position 53607005 of the NCBI accession number NC_000077.6.

    [0366] In some embodiments, a) the DNA fragment homologous to the 5 end of a conversion region to be altered (5 arm) is selected from the nucleotide sequences that have at least 90% homology to the NCBI accession number NC_000073.6; c) the DNA fragment homologous to the 3 end of the region to be altered (3 arm) is selected from the nucleotide sequences that have at least 90% homology to the NCBI accession number NC_000073.6.

    [0367] In some embodiments, a) the DNA fragment homologous to the 5 end of a region to be altered (5 arm) is selected from the nucleotides from the position 125562909 to the position 125567172 of the NCBI accession number NC_000073.6; c) the DNA fragment homologous to the 3 end of the region to be altered (3 arm) is selected from the nucleotides from the position 125572100 to the position 125576624 of the NCBI accession number NC_000073.6.

    [0368] In some embodiments, the length of the selected genomic nucleotide sequence in the targeting vector can be about or at least 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb or 10 kb.

    [0369] In some embodiments, the region to be altered is exon 1, exon 2, exon 3, and/or exon 4 of IL4 gene (e.g., exon 1, exon 2, exon 3 and/or exon 4 of mouse IL4 gene).

    [0370] In some embodiments, the region to be altered is exon 4, exon 5, exon 6, and/or exon 7 of IL4Ra gene (e.g., exon 4, exon 5, exon 6 and/or exon 7 of mouse IL4Ra gene).

    [0371] The targeting vector can further include a selected gene marker.

    [0372] In some embodiments, the sequence of the 5 arm is shown in SEQ ID NO: 5; and the sequence of the 3 arm is shown in SEQ ID NO: 6.

    [0373] In some embodiments, the sequence of the 5 arm is shown in SEQ ID NO: 20; and the sequence of the 3 arm is shown in SEQ ID NO: 21.

    [0374] In some embodiments, the sequence of the 5 arm is shown in SEQ ID NO: 45; and the sequence of the 3 arm is shown in SEQ ID NO: 46.

    [0375] In some embodiments, the sequence is derived from human (e.g., 132674051-132682587 of NC_000005.10, or 132672342-132682914 of NC_000005.10). For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human IL4, preferably exon 1, exon 2, exon 3 and/or exon 4 of the human IL4. In some embodiments, the nucleotide sequence of the humanized IL4 encodes the entire or the part of human IL4 protein (e.g., SEQ ID NO: 4).

    [0376] In some embodiments, the sequence is derived from human (e.g., 27342138-27352674 of NC_000016.10). For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human IL4Ra, preferably exon 4, exon 5, exon 6 and/or exon 7 of the human IL4Ra. In some embodiments, the nucleotide sequence of the humanized IL4Ra encodes the entire or the part of human IL4Ra protein (e.g., SEQ ID NO: 42).

    [0377] In some embodiments, the target region is derived from human. In some embodiments, the target region is a part or entirety of the nucleotide sequence of a humanized IL4R. In some embodiments, the nucleotide sequence is shown as one or more of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10 and/or exon 11 of the human IL4R. In some embodiments, the target region is a part or entirety of the nucleotide sequence of a humanized IL4. In some embodiments, the nucleotide sequence is shown as one or more of exon 1, exon 2, exon 3, and/or exon 4 of the human IL4.

    [0378] In some embodiments, the nucleotide sequence of the human IL4R encodes the human IL4R protein with the NCBI accession number NP_000409.1 (SEQ ID NO: 42). In some emboldens, the nucleotide sequence of the human IL4R is selected from the nucleotides from the position 27342138 to the position 27352674 of NC_000016.10 (SEQ ID NO: 47).

    [0379] In some embodiments, the nucleotide sequence of the human IL4 encodes the human IL4 protein with the NCBI accession number NP_000580.1 (SEQ ID NO: 4). In some emboldens, the nucleotide sequence of the human IL4R is selected from the nucleotides from the position 132674051 to the position 132682587 of NC_000005.10 (SEQ ID NO: 7), or position 132672342 to the position 132682914 of NC_000005.10 (SEQ ID NO: 22).

    [0380] The disclosure also relates to a cell comprising the targeting vectors as described herein.

    [0381] In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein. In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.

    [0382] In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.

    [0383] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell.

    Methods of Making Genetically Modified Animals

    [0384] Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ), homologous recombination (HR), zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN), and the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., Delivery technologies for genome editing, Nature Reviews Drug Discovery 16.6 (2017): 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.

    [0385] Thus, in some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous IL4Ra or IL4 gene locus, a sequence encoding a region of an endogenous IL4R or IL4 with a sequence encoding a corresponding region of human or chimeric IL4R or IL4. In some embodiments, the replacement occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.

    [0386] FIG. 17 shows a humanization strategy for a mouse IL4R locus. In FIG. 17, the targeting strategy involves a vector comprising the 5 end homologous arm, human IL4Ra gene fragment, 3 homologous arm. The process can involve replacing endogenous IL4Ra sequence with human sequence by homologous recombination. FIG. 4 and FIG. 8 show a humanization strategy for a mouse IL4 locus. In FIG. 4 and FIG. 8, the targeting strategy involves a vector comprising the 5 end homologous arm, human IL4 gene fragment, 3 homologous arm. The process can involve replacing endogenous IL4 sequence with human sequence by homologous recombination. In some embodiments, the cleavage at the upstream and the downstream of the target site (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strand break, and the homologous recombination is used to replace endogenous IL4Ra or IL4 sequence with human IL4Ra or IL4 sequence.

    [0387] Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous IL4Ra locus (or site), a nucleic acid encoding a sequence encoding a region of endogenous IL4R with a sequence encoding a corresponding region of human IL4R. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10 and/or exon 11 of a human IL4Ra gene. In some embodiments, the sequence includes a region of exon 4, exon 5, exon 6 and/or exon 7 of a human IL4Ra gene (e.g., amino acids 30-216 of SEQ ID NO: 42). In some embodiments, the region is located within the extracellular region of IL4R. In some embodiments, the endogenous IL4Ra locus is exon 4, exon 5, exon 6 and/or exon 7 of mouse IL4Ra.

    [0388] Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous IL4 locus (or site), a nucleic acid encoding a sequence encoding a region of endogenous IL4 with a sequence encoding a corresponding region of human IL4. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, and/or exon 4 of a human IL4 gene. In some embodiments, the sequence includes a region of exon 1, exon 2, exon 3 and/or exon 4 of a human IL4 gene (e.g., full-length sequence of SEQ ID NO: 4). In some embodiments, the endogenous IL4 locus is exon 1, exon 2, exon 3 and/or exon 4 of mouse IL4.

    [0389] In some embodiments, the methods of modifying an IL4Ra or IL4 locus of a mouse to express a chimeric human/mouse IL4R or IL4 peptide can include the steps of replacing at the endogenous mouse IL4Ra or IL4 locus a nucleotide sequence encoding a mouse IL4R or IL4 with a nucleotide sequence encoding a human IL4R or IL4, thereby generating a sequence encoding a chimeric human/mouse IL4R or IL4.

    [0390] In some embodiments, the nucleotide sequence encoding the chimeric human/mouse IL4R can include a first nucleotide sequence encoding a region of the extracellular region of mouse IL4R (with or without the mouse or human signal peptide sequence); a second nucleotide sequence encoding a region of the extracellular region of human IL4R; a third nucleotide sequence encoding the transmembrane region, and/or the cytoplasmic region of a mouse IL4R.

    [0391] In some embodiments, the nucleotide sequences as described herein do not overlap with each other (e.g., the first nucleotide sequence, the second nucleotide sequence, and/or the third nucleotide sequence do not overlap). In some embodiments, the amino acid sequences as described herein do not overlap with each other.

    [0392] The present disclosure further provides a method for establishing an IL4Ra or IL4 gene humanized animal model, involving the following steps:

    [0393] (a) providing the cell (e.g. a fertilized egg cell) based on the methods described herein;

    [0394] (b) culturing the cell in a liquid culture medium;

    [0395] (c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal;

    [0396] (d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c).

    [0397] In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL/6 or BALB/c mouse).

    [0398] In some embodiments, the non-human mammal in step (c) is a female with pseudo pregnancy (or false pregnancy).

    [0399] In some embodiments, the fertilized eggs for the methods described above are C57BL/6 or BALB/c fertilized eggs. Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, FVB/N fertilized eggs, DBA/1 fertilized eggs and DBA/2 fertilized eggs.

    [0400] Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the fertilized egg cells are derived from rodents. The genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the method described above.

    Methods of Using Genetically Modified Animals

    [0401] Replacement of non-human genes in a non-human animal with homologous or orthologous human genes or human sequences, at the endogenous non-human locus and under control of endogenous promoters and/or regulatory elements, can result in a non-human animal with qualities and characteristics that may be substantially different from a typical knockout-plus-transgene animal. In the typical knockout-plus-transgene animal, an endogenous locus is removed or damaged and a fully human transgene is inserted into the animal's genome and presumably integrates at random into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and/or protein assay and/or functional assay. Inclusion in the human transgene of upstream and/or downstream human sequences are apparently presumed to be sufficient to provide suitable support for expression and/or regulation of the transgene.

    [0402] In some cases, the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal. The disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal's physiology.

    [0403] Genetically modified animals that express human or humanized IL4R and/or IL4 protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and/or efficacy of these human therapeutics in the animal models.

    [0404] In various aspects, genetically modified animals are provided that express human or humanized IL4R and/or IL4, which are useful for testing agents that can decrease or block the interaction between IL4R and IL4 or the interaction between IL4R and other IL4R ligands, testing whether an agent can increase or decrease the immune response, and/or determining whether an agent is an IL4R or IL4 agonist or antagonist. The genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (a knock-in or knockout). In various embodiments, the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, e.g., a human solid tumor or a blood cell tumor (e.g., a lymphocyte tumor, e.g., a B or T cell tumor).

    [0405] In one aspect, the disclosure also provides methods of determining effectiveness of an IL4R or IL4 antagonist (e.g., an anti-IL4R or an anti-IL4 antibody) for reducing inflammation. The methods involve administering the IL4R or IL4 antagonist to the animal described herein, wherein the animal has an inflammation; and determining the inhibitory effects of the IL4R or IL4 antagonist to the reduction of inflammation.

    [0406] In one aspect, the disclosure also provides methods of determining effectiveness of an IL4R or IL4 antagonist (e.g., an anti-IL4R or anti-IL4 antibody) for treating an immune disorder (e.g., an autoimmune disorder or allergy). The methods involve administering the IL4R or IL4 antagonist to the animal described herein, wherein the animal has an immune disorder; and determining the inhibitory effects of the IL4R or IL4 antagonist.

    [0407] In one aspect, the disclosure also provides methods of determining effectiveness of an IL4R or IL4 antagonist (e.g., an anti-IL4R or anti-IL4 antibody) for treating cancer. The methods involve administering the IL4R or IL4 antagonist to the animal described herein, wherein the animal has a tumor; and determining the inhibitory effects of the IL4R or IL4 antagonist to the tumor. In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal. The inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment), a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc. The tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MM or CT.

    [0408] In some embodiments, the anti-IL4R antibody or anti-IL4 antibody prevents IL4 from binding to IL4R. In some embodiments, the anti-IL4R antibody or anti-IL4 antibody cannot prevent IL4 from binding to IL4R (e.g., endogenous IL4R).

    [0409] In some embodiments, the genetically modified animals can be used for determining whether an anti-IL4R antibody is an IL4R agonist or antagonist. In some embodiments, the genetically modified animals can be used for determining whether an anti-IL4 antibody is an IL4 agonist or antagonist. In some embodiments, the methods as described herein are also designed to determine the effects of the agent (e.g., anti-IL4R or anti-IL4 antibodies) on IL4R and/or IL4, e.g., whether the agent can stimulate macrophages, and/or whether the agent can upregulate the immune response or downregulate immune response. In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., an immune disorder, an allergy, or autoimmune diseases.

    [0410] In some embodiments, the inhibitory effects of treating inflammation are evaluated by serum IgE levels; pathological lung histology features; number of leukocytes (CD45+ cells), eosinophils (Eos) or neutrophils in bronchoalveolar lavage fluid (BALF); or ratio of eosinophils or neutrophils cells in CD45+ cells in bronchoalveolar lavage fluid (BALF).

    [0411] The inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and/or determining tumor (volume) inhibition rate (TGI.sub.TV). The tumor growth inhibition rate can be calculated using the formula TGI.sub.TV (%)=(1TVt/TVc)100, where TVt and TVc are the mean tumor volume (or weight) of treated and control groups.

    [0412] In some embodiments, the anti-IL4R or anti-IL4 antibody is designed for treating various cancers. As used herein, the term cancer refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term tumor as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. As IL-4 blockade improves the response to anti-OX40 antibody or CpG oligodeoxynucleotide immunotherapies, in some embodiments, the anti-IL4R antibody or anti-IL4 antibody are used in connection with anti-OX40 antibody or CpG oligodeoxynucleotide immunotherapies.

    [0413] In some embodiments, the antibody is designed for treating various autoimmune diseases or allergy (e.g., allergic rhinitis, sinusitis, asthma, or eczema). Thus, the methods as described herein can be used to determine the effectiveness of an antibody in inhibiting immune response.

    [0414] The present disclosure also provides methods of determining toxicity of an antibody (e.g., anti-IL4R antibody or anti-IL4 antibody). The methods involve administering the antibody to the animal as described herein. The animal is then evaluated for its weight change, red blood cell count, hematocrit, and/or hemoglobin. In some embodiments, the antibody can decrease the red blood cells (RBC), hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%.

    [0415] The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

    [0416] In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.

    [0417] The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the IL4R or IL4 gene function, human IL4R or IL4 antibodies, drugs for human IL4R or IL4 targeting sites, the drugs or efficacies for human IL4R or IL4 targeting sites, the drugs for immune-related diseases and antitumor drugs.

    Genetically Modified Animal Model with Two or More Human or Chimeric Genes

    [0418] The present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes. The animal can comprise a human or chimeric IL4Ra gene and a sequence encoding one or more additional human or chimeric protein (e.g., IL4). Alternatively, the animal can comprise a human or chimeric IL4 gene and a sequence encoding one or more additional human or chimeric protein (e.g., IL4R).

    [0419] In some embodiments, the additional human or chimeric protein can be IL4, IL4R, Interleukin 33 (IL33), Interleukin 13 (IL13), programmed cell death protein 1 (PD-1), cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), Lymphocyte Activating 3 (LAG-3), B And T Lymphocyte Associated (BTLA), Programmed Cell Death 1 Ligand 1 (PD-L1), CD27, CD28, T-Cell Immunoreceptor with Ig and ITIM Domains (TIGIT), T-cell Immunoglobulin and Mucin-Domain Containing-3 (TIM-3), Glucocorticoid-Induced TNFR-Related Protein (GITR), CD137, TNF Receptor Superfamily Member 4 (TNFRSF4 or OX40), CD47 or SIRPa.

    [0420] The methods of generating genetically modified animal model with two or more human or chimeric genes (e.g., humanized genes) can include the following steps:

    [0421] (a) using the methods of introducing human IL4R gene or chimeric IL4Ra gene as described herein to obtain a genetically modified non-human animal;

    [0422] (b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes.

    [0423] In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric IL4, IL33, IL13, PD-1, CTLA-4, LAG-3, BTLA, PD-L1, CD27, CD28, TIGIT, TIM-3, GITR, OX40, CD137, CD47, CD40, CD3e or SIRPa. Some of these genetically modified non-human animal are described, e.g., in PCT/CN2017/090320, PCT/CN2017/099577, PCT/CN2017/099575, PCT/CN2017/099576, PCT/CN2017/099574, PCT/CN2017/106024, PCT/CN2017/110494, PCT/CN2017/110435, PCT/CN2017/117984, PCT/CN2017/120388, PCT/CN2018/091846, PCT/CN2018/091845, PCT/CN2018/120713, PCT/CN2018/110069; each of which is incorporated herein by reference in its entirety.

    [0424] Similarly, the methods of generating genetically modified animal model can include the following steps:

    [0425] (a) using the methods of introducing human IL4 gene or chimeric IL4 gene as described herein to obtain a genetically modified non-human animal;

    [0426] (b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes.

    [0427] In some embodiments, the humanization is directly performed on a genetically modified animal having a human or chimeric IL4, IL4R, IL33, IL13, PD-1, CTLA-4, BTLA, PD-L1, CD27, CD28, TIGIT, TIM-3, GITR, CD137, OX40, CD47, CD40, CD3e or SIRPa gene.

    [0428] In some embodiments, the IL4R humanization is directly performed on a genetically modified animal having a human or chimeric IL4. In some embodiments, the IL4 humanization is directly performed on a genetically modified animal having a human or chimeric IL4R.

    [0429] As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., an anti-IL4R antibody and an additional therapeutic agent for the treatment. The methods include administering the anti-IL4R antibody and/or the anti-IL4 antibody, and the additional therapeutic agent to the animal, wherein the animal has a tumor; and determining the inhibitory effects of the combined treatment to the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to IL4, IL4R, IL33, IL13, PD-1, CTLA-4, BTLA, PD-L1, CD27, CD28, TIGIT, TIM-3, GITR, CD137, OX40, CD47, CD40, CD3e or SIRPa. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab), an anti-CD20 antibody (e.g., rituximab), an anti-EGFR antibody (e.g., cetuximab), and an anti-CD319 antibody (e.g., elotuzumab), or anti-PD-1 antibody (e.g., nivolumab).

    EXAMPLES

    [0430] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

    Materials and Methods

    [0431] The following materials were used in the following examples.

    [0432] C57BL/6 mice were purchased from the China Food and Drugs Research Institute National Rodent Experimental Animal Center.

    [0433] AIO kit was obtained from Beijing Biocytogen Co., Ltd. (Catalog number: BCG-DX-004).

    [0434] Mouse IL-4 ELISA kit was obtained from RayBiotech, Inc. (Catalog number ELM-IL4-1).

    [0435] Human IL-4 ELISA kit was obtained from RayBiotech, Inc. (Catalog number ELH-IL4-5).

    [0436] BamHI, HindIII, XhoI, EcoRI, EcoRV, NotI, NdeI, SacI, BglII, AseI, MfeI and SmaI restriction enzymes were purchased from NEB with Catalog numbers: R3136M, R3104M, R0146S, R3101M, R0195S, R3189M, R3193M, R3156M, R0144M, R0526M, R3589S and R0141S, respectively.

    [0437] Bacterial Artificial Chromosome (BAC) bacteria containing mouse IL4 and IL4R genes, and BAC bacteria containing human IL4 and IL4R genes were ordered from Invitrogen (Catalog number RPCI23.0 and RPCI11.C).

    [0438] Purified NA/LE Hamster anti-mouse CD3e (mCD3) antibody was purchased from Becton, Dickinson and Company (BD Biosciences, Catalog number 553057).

    [0439] FITC anti-mouse CD19 antibody (mCD19 FITC) was purchased from Biolegend (Catalog number 115506).

    [0440] APC anti-human CD124 (IL4Ra) antibody (hIL4RA APC) was purchased from Biolegend (Catalog number: 355006).

    [0441] PE anti-mouse CD124 (IL4Ra) antibody (mIL4RA PE) was purchased from Biolegend (Catalog number 144804).

    [0442] APC/Cy7 anti-mouse CD19 antibody (mCD19 APC-Cy7) was purchased from Biolegend (Catalog number: 115530).

    [0443] PE anti-human CD124 (IL-4Ra) antibody (hIL4RA PE) was purchased from Biolegend (Catalog number 355003).

    [0444] Alexa Fluor 647 AffiniPure F(ab).sub.2 Fragment Goat Anti-Human IgG, Fc fragment specific (anti-hIgG-AF647) was purchased from Jackson ImmunoResearch Inc. (Catalog number: 109-606-170).

    [0445] In vivo Grade Human IgG4 kappa Isotype ControlCrownVivo Antibody (anti-IgG4-kappa hIgG-APC) was purchased from Crown Bio Inc. (Catalog number: C0004).

    Example 1: Mice with Humanized IL4 Gene

    [0446] The transcript of mouse IL4 gene (NCBI Gene ID: 16189, Primary source: MGI: 96556, UniProt ID: P07750) is NM_021283.2 (SEQ ID NO: 1) with the corresponding protein NP_067258.1 (SEQ ID NO: 2). The transcript of human IL4 gene (NCBI Gene ID: 3565, Primary source: HGNC: 6014, UniProt ID: P05112) is NM_000589.3 (SEQ ID NO: 3) with the corresponding protein NP_000580.1 (SEQ ID NO: 4). A schematic diagram that compares the mouse IL4 gene and the human IL4 gene was shown in FIG. 1.

    [0447] Two humanization strategies were used to introduce a gene sequence encoding a human IL4 protein into the endogenous mouse IL4 locus. In one method, the mouse IL4 gene sequence was replaced with human IL4 gene sequences at the endogenous IL4 locus. About 8.5 kb sequence starting from ATG (start codon) to TGA (stop codon) was replaced with the corresponding human DNA sequence to obtain a humanized IL4 locus (FIG. 2; version 1, the mRNA sequence of the engineered mouse IL4 after humanization was shown in SEQ ID NO: 80). The sequence is still under the control of mouse IL4 regulatory elements, and has mouse 5-UTR and 3-UTR. Another humanization strategy is shown in FIG. 3 (version 2). A longer sequence at the IL4 locus was replaced. The sequence includes human 5-UTR and human 3-UTR, and is under the control of human IL4 regulatory elements.

    [0448] Mouse and human IL4 DNA were obtained using Bacterial Artificial Chromosome (BAC) RP23-464K4 and RP11-17K19, respectively. As shown in the schematic diagram of the targeting strategy in FIG. 4, the recombinant vector contained the homology arm sequence upstream and downstream of mouse IL4 (4220 bp upstream of ATG of endogenous IL4 gene and 4085 bp downstream of TGA), and 8537 bp human IL4 Sequence (extending from start codon ATG in exon 1 to stop codon TGA in exon 4). The upstream homology arm sequence (5 homology arm, SEQ ID NO: 5) was identical to the nucleotide sequence of 53622826-53618607 with NCBI accession number NC_000077.6, and the downstream homology arm sequence (3 homology arm, SEQ ID NO: 6) was identical to the nucleotide sequence of 53612065-53607981 with NCBI accession number NC_000077.6. The DNA fragment sequence of human IL4 (SEQ ID NO: 7) was identical to the nucleotide sequence of 132674051-132682587 with NCBI accession number NC_000005.10. The sequence containing the human IL4 gene and the upstream connection site at the mouse locus was designed as 5-ACTTTAACTCTATATATAGAGAGACCTCTGCCAGCATTGCATTGTTAGCAT CTCTTGATAAACTTAATTGTCTCTCGTCACTGACGGCACAGAGCTATTGATGG GTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGGCA ACTTTGTCCACGGACACAAGTGCGATATCACCTTACAGGAGA-3 (SEQ ID NO: 8), wherein the G in the sequence TATTG was the last nucleotide of the mouse sequence, and the A in the sequence ATGGG was the first nucleotide of the human sequence.

    [0449] The sequence containing the human IL4 gene and the downstream connection site at the mouse locus was designed as 5-TGGAAAACTTCTTGGAAAGGCTAAAGACGATCATGAGAGAGAAATATTCA AAGTGTTCGAGCTGATACTGAGCCACCATGCTTTAACTTATGAATTTTTAATG GTTTTATTTTTAATATTTATATATTTATAATTCATAAAATAAAATA-3 (SEQ ID NO: 9), wherein the A in the sequence GCTGA was the last nucleotide of the human sequence, and the T in the sequence TACTG was the first nucleotide of the mouse sequence.

    [0450] The targeting vector also included an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase Neo), and two Frt recombination sites on both sides of the antibiotic resistance gene. The locus formed a Neo cassette. The connection between the 5 end of the Neo cassette and the mouse IL4 locus was designed as 5-ACATGCCTGTAGGCAAGACACCCACACACATAAAAACAAAATAAAATAA GGATAGAAAGGCCAGGGGGATGAATCCTCGAGGTCGACGGTATCGATAAGC TTGATATCGAATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAGGT CT-3 (SEQ ID NO: 10), wherein the C of the sequence GAATC was the last nucleotide of the mouse sequence, and the C of the sequence CTCGA was the first nucleotide of the Neo cassette. The connection between the 3 end of the Neo cassette with the mouse IL4 locus was designed as 5-AGAAAGTATAGGAACTTCATCAGTCAGGTACATAATGG TGGATCCATTAATCAGAGGTAGAAGAAAACTTATTCC-3 (SEQ ID NO: 11), wherein the last T of the sequence TTAAT was the last nucleotide of the Neo cassette, and the C of the sequence CAGAG was the first nucleotide of the mouse sequence. In addition, a coding gene with a negative selectable marker (a gene encoding diphtheria toxin A subunit (DTA)) was also inserted downstream of the 3 homology arm of the recombinant vector.

    [0451] Vector construction can be carried out by restriction enzyme digestion and ligation. The constructed recombinant vector sequence can be initially verified by restriction enzyme digestion. The verification results were shown in FIGS. 5A-5B. The restriction enzyme digestion results were verified by using three groups of enzymes. Among them, EcoRI+NotI should generate 634 bp+1678 bp+5953 bp+16413 bp fragments, EcoRV+NdeI should generate 587 bp+2637 bp+8928 bp+12526 bp fragments, BglII+XhoI should generate 1183 bp+5178 bp+6292 bp+12025 bp fragments. The results of restriction enzyme digestion were in line with expectations and the sequences of plasmids 1 and 2 were verified by sequencing.

    [0452] The correct recombinant vector was electroporated and transfected into embryonic stem cells of C57BL/6 mice. The positive selectable marker gene was used to screen the cells, and the integration of exogenous genes was confirmed by PCR and Southern Blot. PCR and Southern Blot results (digested with EcoRI or AseI, respectively, and hybridized with 3 probes) for some of the clones were shown in FIG. 6 and FIG. 7. As shown in FIG. 7, among the 12 PCR-positive clones, 11 clones were selected and identified as positive heterozygous clones and no random insertions were detected.

    [0453] The following primers were used in PCR:

    TABLE-US-00005 F: (SEQIDNO:12) 5-GACAACTTTCAGGGAGGGAGTCAG-3, R: (SEQIDNO:13) 5-ATCGCACTTGTGTCCGTGGAC-3.

    [0454] The following probes were used in Southern Blot assays:

    TABLE-US-00006 5Probe: F: (SEQIDNO:14) 5-GCCTCTCTCAACCCAGTATAAC-3, R: (SEQIDNO:15) 5-CTTGGAGTCAACCACCTCTG-3; 3Probe: F: (SEQIDNO:16) 5-GATCTTTCACTGAAACTTGACTG-3, R: (SEQIDNO:17) 5-CTCCAACTACATCTACTTTCTG-3; NeoProbe: F: (SEQIDNO:18) 5-GGATCGGCCATTGAACAAGATGG-3, R: (SEQIDNO:19) 5-CAGAAGAACTCGTCAAGAAGGCG-3.

    [0455] Another IL4 mouse humanization strategy was to perform a sequence substitution for a longer sequence near the IL4 locus. The humanized mouse IL4 locus was shown in FIG. 3, and the targeting strategy was shown in FIG. 8. The recombinant vector contained an upstream homology arm sequence of 5553 bp and a downstream homology arm sequence of 5196 bp of the mouse IL4 locus, and a 10573 bp sequence containing human IL4 DNA fragments. The upstream homology arm sequence (5 homology arm, SEQ ID NO: 20) was identical to the nucleotide sequence of 53625623-53620071 of NCBI accession number NC_000077.6, and the downstream homology arm sequence (3 homology arm, SEQ ID NO: 21) was identical to the nucleotide sequence at position 53612200-53607005 of NCBI Accession No. NC_000077.6; the sequence of human IL4 DNA fragment (SEQ ID NO: 22) was identical to the nucleotide sequence of 132672342-132682914 with NCBI accession number NC_000005.10.

    [0456] The sequence containing the human IL4 gene and the upstream connection site of the mouse locus was designed as 5-TGGGGTATGGTGGCTTATATCTGTAACTTCAACACTTGAGAGGTGGAG GCAGGAGAGTGACCATGAATCTGAGGGCTTCCAGAATAAATTCATAGGGAG GCCCAGGCACAGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAGG-3 (SEQ ID NO: 23), wherein the last G of the sequence GAGGG was the last nucleotide of the mouse sequence, and the first C of the sequence CTTCC was the first nucleotide of the human sequence.

    [0457] Downstream of the sequence containing the human IL4 gene was linked to the Neo cassette, and the connection site was designed as 5-GGGGTTCCCTCTCGAGTTAGGGACATAACACACAAGATAATTAAAGAACA CAAGGCCATACAAGATGTAAATAAGACACCTTGGGTCCAAGAGTGCGTCGA CGGTATCGATAAGCTTGATATCGAATTCCGAAGTTCCTATTCTCTAGAAAGTA TAGGAACTTCAGGTCTGAAGAGGAGTTTACGTCCAGCCAAGC-3 (SEQ ID NO: 24), wherein the C of the sequence GAGTGC was the last nucleotide of the human sequence, and the first G of the sequence GTCGA was the first nucleotide of the Neo cassette.

    [0458] The Neo cassette downstream was connected to the mouse sequence, and the connection sequence was designed as 5-TGCGGAACCCTTCGAAGTTCCTATTCTCTAGAAAGTATA GGAACTTCATCAGTCAGGTACATAATGGTGGATCCTAACTCAAGTTCTGGGG GAGCTGATGCTCTCCTCTGGCCTCCTGTGGAGGTACACAGACCACATGCCTGT AGGCAA-3 (SEQ ID NO: 25), wherein the last C of the sequence GATCC was the last nucleotide of the Neo cassette, and the first T of the sequence TAACT was the first nucleotide of the mouse sequence.

    [0459] In addition, a coding gene with a negative selectable marker (a gene encoding the diphtheria toxin A subunit (DTA)) was also inserted downstream of the 3 homology arm of the recombinant vector. The verified results of the constructed recombinant vector digestion were shown in FIGS. 9A-9B, wherein BamHI should generate 9938 bp+6990 bp+5266 bp+3577 bp+2930 bp fragments, EcoRI should generate 9606 bp+6558 bp+5432 bp+4470 bp+2178 bp+457 bp fragments, ScaI should generate 10389 bp+7026 bp+5739 bp+2818 bp+2074 bp+655 bp fragments. The results of restriction enzyme digestion were in line with expectations and the plasmid was verified by sequencing.

    [0460] The embryonic stem cells from C57BL/6 mice were transfected with the correct recombinant vector, screened, then confirmed by PCR and Southern Blot. Some of the PCR and Southern Blot (digested with MfeI, BamHI or EcoRV, respectively, and hybridized with 3 probes) results were shown in FIG. 10 and FIG. 11. As shown in FIG. 11, the results showed that among the 12 PCR-positive clones, except for 1-E11 and 2-F2, the remaining 10 clones were confirmed as positive heterozygous clones and no random insertions were detected.

    [0461] The following primers were used in PCR:

    TABLE-US-00007 F: (SEQIDNO:26) 5-CTGTGATCATGGTTCCTTATCTGG-3, R: (SEQIDNO:27) 5-CCTCCCCGAGTAGCTGGGACTAC-3.

    [0462] The following probe were used in Southern Blot assays:

    TABLE-US-00008 5Probe: F: (SEQIDNO:28) 5-CCACTAGGGGTCCACAGCTAGTCAT-3, R: (SEQIDNO:29) 5-CTTCAGTGAAACCTCCTGAGCCTGG-3; 3Probe: F: (SEQIDNO:30) 5-AGTCAGAGCTACAGAAGTGGAGGGT-3, R: (SEQIDNO:31) 5-CTGCTCTGCAGGAAGTAAGGGTTCC-3; NeoProbeF:SEQIDNO:18; NeoProbeR:SEQIDNO:19.

    [0463] The positive clones that had been screened (black mice) were introduced into isolated blastocysts (white mice), and the obtained chimeric blastocysts were transferred to the culture medium for short-term culture and then transplanted to the fallopian tubes of the recipient mother (white mice) to produce the F0 chimeric mice (black and white). The F2 generation homozygous mice can be obtained by backcrossing the F0 generation chimeric mice with wild-type mice to obtain the F1 generation mice, and then mating the F1 generation heterozygous mice with each other. The positive mice can also be mated with the Flp tool mice to remove the positive selectable marker gene (the schematic diagram of the process was shown in FIG. 12), and then the humanized IL4 homozygous mice expressing human IL4 protein can be obtained by mating with each other. The genotype of the progeny mice can be identified by PCR, and the results for the F1 generation mice (Neo-removed) were shown in FIGS. 13A-13D, wherein the mice numbered 1 and 2 were positive heterozygous mice. The following primers were used in PCR:

    TABLE-US-00009 WT-F: (SEQIDNO:32) 5-ccacatcactgaaagacttcctgg-3; WT-R: (SEQIDNO:33) 5-gatcaagtagacaggcaggcaagac-3; Mut-F: (SEQIDNO:34) 5-ctgtgatcatggttccttatctgg-3; WT-R:(SEQIDNO:33); Frt-F: (SEQIDNO:35) 5-agggacagatgcaggctggg-3; Frt-R: (SEQIDNO:36) 5-gagatgcgtgttagaggttttggga-3; Flp-F: (SEQIDNO:37) 5-tcagcgatattaagaacgttgatccg-3; Flp-R: (SEQIDNO:38) 5-tgaagaattgccggtcctatttactcg-3.

    [0464] The expression of humanized IL4 protein in positive mice can be confirmed by ELISA. 7.5 g of anti-mouse CD3 antibody (mCD3) was intraperitoneally injected into the mice. After 1.5 hours, serum was taken and diluted 5 to measure the levels of mouse IL4 and human IL4 protein. The measurement results were shown in FIGS. 14A-14B. FIG. 14A showed that the expression of mouse IL4 protein was detected in wild-type C57BL/6 mice and the two versions of IL4 humanized heterozygotes. FIG. 14B showed that the expression of human IL4 protein was not detected in wild-type C57BL/6 mice, and human IL4 protein expression was detected in both versions of IL4 humanized mice.

    Example 2: Mice with Humanized IL4Ra Genes

    [0465] The transcript of mouse IL4Ra gene (NCBI Gene ID: 16190, Primary source: MGI: 105367, UniProt ID: P16382) is NM_001008700.3 (SEQ ID NO: 39) with the corresponding protein NP_001008700.1 (SEQ ID NO: 40). The transcript of human IL4Ra gene (NCBI Gene ID: 3566, Primary source: HGNC: 6015, UniProt ID: P24394) is NM_000418.3 (SEQ ID NO: 41) with the corresponding protein NP_000409.1 (SEQ ID NO: 42). A schematic diagram that compared the mouse IL4Ra gene locus and the human IL4Ra gene locus was shown in FIG. 15.

    [0466] The extracellular region of the endogenous mouse IL4Ra gene was replaced with the human IL4Ra gene sequence. Two humanization strategies were used. One was to replace a 4.4 kb sequence encoding the extracellular region of the mouse IL4Ra from exon 4 to exon 7 with a 10.5 kb sequence spanning from exon 4 to exon 7 of the human IL4Ra locus. This humanized strategy resulted in a humanized IL4Ra gene as shown in FIG. 16. The mRNA sequence of the engineered mouse IL4Ra after humanization and its encoded protein sequence were shown in SEQ ID NO: 43 and SEQ ID NO: 44, respectively.

    [0467] Mouse and human IL4Ra DNA were obtained using Bacterial Artificial Chromosome (BAC) RP23-261H16 and RP11-16E24, respectively. As shown in the schematic diagram of the targeting strategy in FIG. 17, the recombinant vector contained the homology arm sequence upstream and downstream of mouse IL4Ra sequence (4264 bp upstream of exon 4 of endogenous IL4Ra gene and 4525 bp downstream of exon 7), and 10537 bp human IL4Ra sequence (extending from part of exon 4 to exon 7). The upstream homology arm sequence (5 homology arm, SEQ ID NO: 45) was identical to the nucleotide sequence of 125562909-125567172 with NCBI accession number NC_000073.6, and the downstream homology arm sequence (3 homology arm, SEQ ID NO: 46) was identical to the nucleotide sequence of 125572100-125576624 with NCBI accession number NC_000073.6; the DNA fragment sequence of human IL4Ra (SEQ ID NO: 47) was identical to the nucleotide sequence of 27342138-27352674 with NCBI accession number NC_000016.10. The sequence containing the human IL4Ra gene and the upstream of the connecting site at the mouse locus was designed as 5-CCTCCCTCTGACCTTAGTGGTGGGAGCCCCTGACCATGCCACCACTGATCT GGCCGTTCTGTCTCTGCAGGGAGCATCAAGGTCCTGCAGGAGCCCACCTGCG TCTCCGACTACATGAGCATCTCTACTTGCGAGTGGAAGATGAATGGTCCCACC AATTGCAGCACCGAGCTCCGCCTGTTG-3 (SEQ ID NO: 48), wherein the G of the sequence TCCTG was the last nucleotide of the mouse sequence, and the C of the sequence CAGGA was the first nucleotide of the human sequence. The sequence containing the human IL4Ra gene and the downstream of the connection site at the mouse locus was designed as 5-CAGCACCCTGAAGTCTGGGATTTCCTACAGGGCA CGGGTGAGGGCCT GGGCTCAGTGCTATAACACCACCTGGAGTGAGTGGAGCCCTAGCATCACGTG GTACAACCGTGAGTATCAGGGTCGTAGGCTGTGAGGATCTCTACAGCCGTGT ATATTCTCTGTTCAGAAATTCCCTCTGGCTGA-3 (SEQ ID NO: 49), wherein the C of the sequence GGAGC was the last nucleotide of the human sequence, and the first C of the sequence CCTAG was the first nucleotide of the mouse sequence.

    [0468] The connection sequence between the 5 end of the Neo cassette and the mouse IL4Ra locus was designed as 5-AGGCCCGGAGTTTAAATCCCCAGAGCCCACGTAAAAGCCTGATATCGAA TTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC-3 (SEQ ID NO: 50), wherein the T of the sequence AGCCT was the last nucleotide of the mouse sequence, and the first G of the sequence GATAT was the first nucleotide of the Neo cassette.

    [0469] The connection sequence of the 3 end of the Neo cassette with the mouse IL4Ra locus was designed as 5-GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCATCAGTCAGGTACATAATG GTGGATCCAAGCTTTGCGCAGTAGCACGCATGCGTAATCCTGATGGAGCAAT TAGGAGAAGCCGGTGGCCGGCTAGCCTGTGCAGACTGTGAAAACAGAGCATC TGAAGCTGTGTGAAAGGCTAGCTCGC-3 (SEQ ID NO: 51), wherein the last T of the sequence AGCTT was the last nucleotide of the Neo cassette, and the T of the sequence TGCGC was the first nucleotide of the mouse sequence. In addition, a coding gene with a negative selectable marker (a gene encoding the diphtheria toxin A subunit (DTA)) was also added downstream of the 3 homology arm of the recombinant vector.

    [0470] The constructed recombinant vector sequences were verified by restriction enzyme digestion as shown in FIG. 18. The restriction enzyme digestion results were verified by using three groups of enzymes. Among them, HindIII+EcoRV should generate 1866 bp+2513 bp+10385 bp+12455 bp fragments, XhoI+SmaI should generate 481 bp+1375 bp+2818 bp+3815 bp+5670 bp+13060 bp fragments, BglII should generate 754 bp+1610 bp+1856 bp+3705 bp+19294 bp fragments, and the results of restriction enzyme digestion were in line with expectations. Plasmid 3 was selected and the sequence was further verified by sequencing.

    [0471] The recombinant vector was electroporated and transfected into embryonic stem cells of C57BL/6 mice. The positive selectable marker gene was used to screen the cells, and the integration of exogenous genes was confirmed by PCR and Southern Blot. Positive clones identified by PCR (see FIGS. 19A-19B for part of the cloning result) were then confirmed by Southern Blot (digested with SacI, HindIII or BglII, respectively, and hybridized with 3 probes). As shown in FIG. 20, the results indicated that four clones (1-A9, 1-D10, 1-F4, A-G5) were positive heterozygous clones and no random insertions were detected.

    [0472] The following primers were used in PCR assays:

    TABLE-US-00010 F1: (SEQIDNO:81) 5-GGGAGGGTGAGTGGAGTCCCA-3; R1: (SEQIDNO:82) 5-CAGCGCAGGCTTACTCGGAGAG-3; F2: (SEQIDNO:52) 5-CGCATTGTCTGAGTAGGTGTC-3; R2: (SEQIDNO:53) 5-GCTGTTCAATGAATGGCCTCTGTG-3;

    [0473] The following probes were used in Southern Blot assays:

    [0474] 5 Probe:

    TABLE-US-00011 F: (SEQIDNO:54) 5-GTGGCCACCGTTTCTGGGAAC-3; R: (SEQIDNO:55) 5-TCAACAATCTAAGCACGGACCT-3; 3Probe: F: (SEQIDNO:56) 5-GTGCTGAGGCCAGGGTTCCTC-3; R: (SEQIDNO:57) 5-GCTGTTCAATGAATGGCCTCTGTG-3; NeoProbe: F:SEQIDNO:18, R:SEQIDNO:19.

    [0475] The positive clones (black mice) were introduced into isolated blastocysts (white mice), according to the techniques known in the art (for example, the method as described in A. Nagy, et al., Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), Cold Spring Harbor Laboratory Press, 2003). The obtained chimeric blastocysts were transferred to a culture medium for a short-term culture and then transplanted into the fallopian tubes of the recipient mother mice (white mice) to produce the F0 generation chimeric mice (black and white). The F1 generation mice were obtained by backcrossing the F0 generation chimeric mice with wild-type mice. F2 generation homozygous mice were then obtained by mating the F1 generation heterozygous mice with each other. The positive mice were also mated with the Flp tool mice to remove the positive selectable marker gene, and then the humanized IL4Ra gene homozygous mice expressing human IL4Ra protein were obtained by mating with each other. The genotype of the progeny mouse can be identified by PCR and the identification results of the F1 generation mice (Neo-removed) were shown in FIG. 21 and FIG. 22, wherein the mice number F1-1 to F1-7 were positive heterozygous mice in FIG. 20.

    [0476] The following primers were used in PCR assays:

    TABLE-US-00012 WT-F2: (SEQIDNO:58) 5-gacacacgtgtctgccagctctgt-3; WT-R2: (SEQIDNO:59) 5-cacggtcagccagagggaatttctg-3; Mut-F2: (SEQIDNO:60) 5-gtggggtcagctaacgacagcaac-3; Frt-F2: (SEQIDNO:61) 5-cgtgtcaaaagcagaaacgcaggag-3; Frt-R2: (SEQIDNO:62) 5-gcgtatgtcaggatctgaggagcac-3; Flp-F2: (SEQIDNO:63) 5-gacaagcgttagtaggcacatatac-3; Flp-R2: (SEQIDNO:64) 5-gctccaatttcccacaacattagt-3.

    [0477] The expression of humanized IL4Ra protein in mice can be confirmed by routine detection methods. For example, IL4Ra protein expression can be detected by staining the mouse spleen cells with anti-mouse IL4Ra antibody (mIL4RA PE) combined with anti-mouse CD19 antibody (mCD19 FITC), or anti-human IL4Ra antibody (hIL4RA APC) combined with anti-mouse CD19 antibody (mCD19 FITC), followed by flow cytometry analysis. The results of the flow cytometry analysis (see FIGS. 23A-23F) showed that the mouse IL4Ra protein (FIG. 23C) and the humanized IL4Ra protein (FIG. 23F) were detected in the spleen of the humanized IL4Ra gene heterozygous mice upon stimulation by anti-mCD3 antibody. In the spleen of wild-type C57BL/6 mice, the mouse IL4Ra protein was detected regardless whether the mouse was stimulated by anti-mCD3 antibody (FIGS. 23A-23B), and no expression of human or humanized IL4Ra protein were detected in the wildtype mice (FIGS. 23D-23E).

    [0478] A CRISPR/Cas system was also used in gene editing to obtain humanized IL4Ra mice. The target sequence in this system determines sgRNA targeting specificity and the efficiency of Cas9-induced cleavage at the target gene. Therefore, selection and design of an efficient and specific target sequence are prerequisites for the construction of sgRNA expression vector. A group of sgRNA sequences recognizing the 5-end target site (sgRNA1-sgRNA7) and the 3-end target site (sgRNA8-sgRNA15) were designed and synthesized. The 5-end target site and the 3-end target site were located in exon 4 and exon 7 of the IL4Ra gene, respectively. The sequence of the target site of each sgRNA on IL4Ra was as follows:

    TABLE-US-00013 sgRNA1targetsitesequence(SEQIDNO:65): 5-AACATAGACTGGCGTTCACCTGG-3 sgRNA2targetsitesequence(SEQIDNO:66): 5-TCCGCACTTCCACGTGTGAGTGG-3 sgRNA3targetsitesequence(SEQIDNO:67): 5-GTGGTTCCTGGATAGCGCTGTGG-3 sgRNA4targetsitesequence(SEQIDNO:68): 5-ATCCAGGAACCACTCACACGTGG-3 sgRNA5targetsitesequence(SEQIDNO:69): 5-TATGTTGTGCTGTATGCTTGTGG-3 sgRNA6targetsitesequence(SEQIDNO:70): 5-CTCAGCTCTGCCTACACTACAGG-3 sgRNA7targetsitesequence(SEQIDNO:71): 5-AGAACATCAGCCTGTAGTGTAGG-3 sgRNA8targetsitesequence(SEQIDNO:72): 5-CTACTATACGGCGCGTGTGAGGG-3 sgRNA9targetsitesequence(SEQIDNO:73): 5-GATGTCAGGGGTCTACTATACGG3 sgRNA10targetsitesequence(SEQIDNO:74): 5-TATAGTAGACCCCTGACATCAGG-3 sgRNA11targetsitesequence(SEQIDNO:75): 5-ACGTGTGTCGGTTCCCAGCCTGG-3 sgRNA12targetsitesequence(SEQIDNO:76): 5-CTGACATCAGGATGTTGATCGGG-3 sgRNA13targetsitesequence(SEQIDNO:77) 5-GTTGATCGGGAAGCTCAGCCTGG-3 sgRNA14targetsitesequence(SEQIDNO:78): 5-ATGTGACCTACAAGGAACCCAGG-3 sgRNA15targetsitesequence(SEQIDNO:79): 5-AGTCTATAATGTGACCTACAAGG-3

    [0479] The activity of multiple sgRNAs were detected using the UCA kit. The results showed that sgRNAs had different activities, and the detection results were shown in FIGS. 24A-24B and the table below. Two of the sgRNAs (sgRNA1 and sgRNA14 respectively) were selected for subsequent experiments. The positive clones can be obtained by transfecting the embryonic stem cells of C57BL/6 mice with the sgRNA1, sgRNA14 and Cas9 mRNAs together with the recombinant vector. In addition, due to the double-strand breakage of genomic DNA caused by Cas9-induced cleavage, the homologous recombination repair mechanism can randomly introduce insertions/deletions. Therefore, this method can also generate IL4Ra knockout mice.

    TABLE-US-00014 TABLE 5 sgRNA activity test results 5-end target site 3-end target site detection result detection result Con. 1.00 Con. 1.00 PC 335.74 PC 403.91 sgRNA-1 181.76 sgRNA-8 57.47 sgRNA-2 13.08 sgRNA-9 90.55 sgRNA-3 63.34 sgRNA-10 141.49 sgRNA-4 100.09 sgRNA-11 41.83 sgRNA-5 189.77 sgRNA-12 88.48 sgRNA-6 10.68 sgRNA-13 53.77 sgRNA-7 62.37 sgRNA-14 196.53 / / sgRNA-15 89.55

    Example 3: Mice with Both Humanized IL4/IL4Ra Genes

    [0480] Mice containing the humanized IL4 or IL4Ra gene prepared using the methods as described in the present disclosure can also be used to further prepare an animal model with double-humanized IL4/IL4Ra genes or additional humanized genes. For example, the fertilized egg cells used in the microinjection and embryo transfer process can be selected from the embryos of genetically modified mice (e.g., the fertilized egg cells of IL4 mice and/or IL4Ra mice) and can be genetically edited to obtain IL4 and IL4Ra double humanized mice, or mice with additional gene modifications. Mice with humanized IL4 mice and mice with humanized IL4Ra (homozygous or heterozygous) can also mate each other or mate with other genetically modified homozygous or heterozygous mice. Their offspring can be screened. According to Mendel's laws, there is a chance to obtain the IL4 and IL4Ra double humanized mice, or multiple-gene modified heterozygous mice. The obtained heterozygotes can mate each other to finally obtain homozygotes with double- or multiple modified genes.

    [0481] The mouse IL4 and IL4Ra genes are located on chromosomes 11 and 7, respectively. IL4 humanized mice (V1) and IL4Ra humanized mice were selected for mating. Positive cloned progeny mice were screened to obtain double-humanized IL4/IL4Ra mice (B-hIL4/hIL4Ra mouse). The protein expression of double-humanized IL4/IL4Ra mice was examined. Three double-humanized IL4/IL4Ra homozygous mice and three wild-type C57BL/6 mice were selected. Retro-orbital blood from these mice was collected. The mice were then stimulated by intraperitoneal injection of 7.5 g anti-mouse CD3 (mCD3) antibody. Serum and spleen samples were taken after 1.5 hours of stimulation, and the protein levels of IL4 and IL4Ra were detected by ELISA and flow cytometry. ELISA results showed that expression of mouse or human IL4 protein cannot be detected in either unstimulated double-humanized IL4/IL4Ra mouse homozygotes or wild-type C57BL/6 mice (FIG. 25A and FIG. 25B); however, human IL4 but not mouse IL4 protein expression was detected in anti-mCD3 antibody stimulated double-humanized IL4/IL4Ra homozygous mice. In contrast, in anti-mCD3 antibody stimulated wild-type C57BL/6 mice, only mouse IL4 protein expression was detected but no human IL4 protein was detected (FIGS. 25C-25D).

    [0482] The anti-mouse IL4Ra antibody (mIL4RA PE) combined with anti-mouse CD19 antibody (mCD19 APC-Cy7), or anti-human IL4Ra antibody (hIL4RA PE) combined with anti-mouse CD19 antibody (mCD19 APC-Cy7) were used to detect the expression of IL4Ra protein in mouse spleen cells by flow cytometry. The results showed that the expression of humanized IL4Ra protein was detected in double-humanized IL4/IL4Ra mice, but the expression of mouse IL4Ra protein was not detected. No human or humanized IL4Ra protein was detected in wild type C57BL/6 mice. The detection results were shown in FIGS. 26A-26H.

    [0483] The binding activity of humanized IL4Ra expressed in homozygous double-humanized IL4/IL4Ra mice to anti-human IL4Ra antibody was analyzed. Spleen cells from double-humanized IL4/IL4Ra homozygous mice stimulated by anti-mCD3 antibody were selected and divided into 3 groups. One randomly selected group was added with anti-human IL4Ra antibody (Dupilumab)/anti-hIgG-AF647 and anti-mouse CD19 antibody (mCD19 APC-Cy7) for staining. The control group was added with anti-IgG4-kappa (hIgG-APC)/anti-hIgG-AF647 or only anti-hIgG-AF647, and anti-mouse CD19 antibody (mCD19 APC-Cy7) for staining. The stained cells were washed with PBS, and then protein expression was detected by flow cytometry. The results showed that the anti-human IL4Ra antibody (Dupilumab) binds well to IL4Ra expressed in the double-humanized homozygotes (FIG. 27C) compared to the control groups (FIG. 27A or 27B).

    [0484] Spleen cells from unstimulated double-humanized IL4/IL4Ra mice were further analyzed, and lymphocytes were sorted and compared to cells from wild-type C57BL/6 mice. Blood tests and other biochemical tests were performed on double-humanized IL4/IL4Ra mice and no obvious differences were observed as compared to wildtype mice.

    [0485] In addition, spleen lymphocytes from double-humanized IL4/IL4Ra mice and wild-type C57BL/6 mice were divided into 3 groups. Lipopolysaccharide (LPS) was added to group G1, mIL4 was added to group G2, and hIL4 (50 ng/mL) was added to group G3. IgE levels of each group were determined on day 6, and the results were shown in FIG. 28, indicating that the in vitro induced IgE levels of spleen lymphocytes from double-humanized IL4/IL4Ra mice were comparable to the IgE levels from wild-type C57BL/6 mice. It further indicated that spleen cells isolated from double-humanized IL4/IL4Ra mice had functional IL4/IL4Ra signaling pathway.

    [0486] In another experiment, double-humanized IL4/IL4Ra mouse spleen lymphocytes were first treated with different doses of anti-human IL4Ra antibody Dupilumab (0.01 ng/mL, 0.1 ng/mL, 1 ng/mL, 10 ng/mL). After incubation for 0.5 hours, LPS and hIL4 (50 ng/mL) were added, and IgE levels of each group were determined on day 6. The results were shown in FIG. 29, indicating that at each test concentration, in vitro IgE production by exposing B cells to hIL4 was effectively blocked by anti-human IL4Ra antibody Dupilumab.

    Example 4: Ovalbumin (OVA) Combined with Aluminum Hydroxide-Induced Asthma Model

    [0487] Single-gene (IL4Ra) or double-humanized IL4/IL4Ra mice (5-8 weeks) were selected and exposed 3 times to ovalbumin (OVA) combined with aluminum hydroxide by intraperitoneal injection. After 3 weeks of the first injection, nebulization with 2% OVA was performed continuously for 5 days to make an inducible asthma model (modeling protocol was shown in FIG. 30). In the control group, OVA was replaced by PBS. All samples were obtained for analysis on day 26. When modeled with double-humanized IL4/IL4Ra mice, compared to the control group (PBS), the mice had typical symptoms such as elevated serum IgE levels and pathological lung histology features (FIGS. 31-32). Infiltrating cell analysis in bronchoalveolar lavage fluid (BALF) suggested an increase in total number and proportion of eosinophils (Eos) cells among CD45+ cells (FIGS. 33A-33C), indicating that double-humanized IL4/IL4Ra mice have IL4/IL4Ra signaling pathway in vivo. Treatment results with anti-human IL4 antibody or anti-human IL4Ra antibody can be evaluated by routine methods such as airway reactivity test, hematoxylin and eosin (HE) staining, immunohistochemistry (IHC) pathology detection, inflammatory cells and IgE detection to assess the efficacy of antibodies.

    [0488] A number of double-humanized IL4/IL4Ra mice were randomly divided into 4 groups. The asthma model was induced according to the method above, in which the G3 and G4 groups were administered with Dupilumab. Different dosing schedules were followed after sensitization by intraperitoneal injection with anti-human IL4RA antibody Dupilumab (25 mg/kg) (see FIG. 34 for the dosing schedule). The results showed that the number of leukocytes (CD45+ cells) and eosinophils cells (Eos) in bronchoalveolar lavage fluid (BALF) was slightly higher in the OVA-inducing group (G2) than in the control group (G1) and the treatment group (G3, G4). The ratio of eosinophils cells (Eos) in CD45+ cells was the highest in the OVA-induced group (G2), the lowest in the G3 treatment group, and slightly lower in the G4 treatment group than in the control group (G1) (FIGS. 35A-35C). High serum IgE levels were only detected in the OVA-inducing group (G2) (FIG. 36). H&E staining showed that the airway of the control (G1) (PBS) mice had no inflammation, whereas peribronchial and perivascular inflammation was significantly increased in the OVA-induced group (G2) mice, with increased mucus secretion levels. In both of the treatment groups (G3, G4), inflammatory infiltration and mucus secretion were observed (compared to the G2 group) at reduced levels (FIG. 37).

    TABLE-US-00015 TABLE 6 Alum/ ovalbumin Group Mice sensitization Challenge Drug G1 B-hIL4/hIL4Ra PBS PBS NA G2 B-hIL4/hIL4Ra Al (OH).sub.3 + 2% OVA NA OVA G3 B-hIL4/hIL4Ra Al (OH).sub.3 + 2% OVA Dupilumab OVA (25 mg/kg) G4 B-hIL4/hIL4Ra Al (OH).sub.3 + 2% OVA Dupilumab OVA (25 mg/kg)

    [0489] In another experiment, C57BL/6 wild-type mice and humanized IL4/IL4Ra mice were selected according to a similar scheme. The specific groupings were shown in the table below. The treatment group (G3) dosage schedule was shown in FIG. 38. All samples were obtained for analysis on day 26, and the results were consistent with the previous ones. The number of leukocytes (CD45+ cells), eosinophils (Eos) and neutrophils in bronchoalveolar lavage fluid (BALF) was higher in the OVA induction group (G2, G4), and was lower in the control group (G1) and the treatment group (G3) (see FIG. 39). Higher serum IgE levels were detected in the OVA-induced group (G2, G4) (FIG. 40). H&E staining results showed that the airway of the control (G1) (PBS) mice showed no inflammation, while the peribronchial and perivascular inflammation of the G2 and G4 mice in the OVA-induced group increased significantly with increased mucus secretion levels. Decreased inflammatory infiltration and mucus secretion were observed in the treatment group (G3) mice compared to the OVA-induced groups (see FIG. 41).

    TABLE-US-00016 TABLE 7 Alum/ ovalbumin Group Mice sensitization Challenge Drug G1 B-hIL4/hIL4Ra PBS PBS NA G2 B-hIL4/hIL4Ra Al (OH).sub.3 + 2% OVA NA OVA G3 B-hIL4/hIL4Ra Al (OH).sub.3 + 2% OVA Dupilumab OVA (25 mg/kg) G4 C57BL/6 WT Al (OH).sub.3 + 2% OVA NA OVA

    Example 5: Mouse Asthma Models with Both Humanized IL4 (Version 2) and IL4Ra Genes

    [0490] IL4 humanized mice (Version 2) and IL4Ra humanized mice were selected for mating to obtain double-humanized IL4/IL4Ra mice (B-hIL4 (V2)/hIL4Ra mouse). Similar protein expression and phenotypic analysis were performed using B-hIL4 (V2)/hIL4Ra mouse. The mice appeared normal. A few B-hIL4 (V2)/hIL4Ra mice were selected and randomly divided into 3 groups. The asthma model mice were induced and treated according to the G3 dosing schedule in FIG. 34. Different groups were shown in Table 8. All samples were collected for analysis on day 26, and the results were consistent with the results in Example 4. The number of leukocytes (CD45+ cells), eosinophils (Eos) and neutrophils in bronchoalveolar lavage fluid (BALF) in isotype control group (G2) was higher than treatment group (G3). The control group (G1) had the lowest level of leukocytes (CD45+ cells), eosinophils (Eos) and neutrophils in BALF (FIGS. 44A-44B). Higher serum IgE levels were detected in the isotype control group (G2) (FIGS. 45A-45B). H&E staining results were consistent with the B-hIL4/hIL4Ra mouse results in Example 4.

    TABLE-US-00017 TABLE 8 Alum/ ovalbumin Group Mice sensitization Challenge Drug G1 B-hIL4(V2)/ PBS PBS NA hIL4Ra G2 B-hIL4(V2)/ Al (OH).sub.3 + 2% OVA hIgG4 hIL4Ra OVA (25 mg/kg) G3 B-hIL4(V2)/ Al (OH).sub.3 + 2% OVA DUPIXENT hIL4Ra OVA (25 mg/kg)

    [0491] The experiments above (both Examples 4 and 5) showed that the anti-human IL4Ra antibody Dupilumab can block the IL4/IL4Ra signaling pathway in humanized IL4/IL4Ra mice, thereby reducing the number of eosinophils (Eos) in bronchoalveolar lavage fluid (BALF) and reducing IgE levels in serum to reduce inflammatory symptom. The results indicated that the humanized IL4/IL4Ra mice can be used as asthma models, can be used in the preclinical studies to screen and evaluate the in vivo efficacy of anti-human IL4/IL4Ra antibodies, and can be used to characterize anti-human IL4 and/or IL4Ra antibody characteristics.

    OTHER EMBODIMENTS

    [0492] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.