MESENCHYMAL STEM CELLS OR STROMAL CELLS HARBORING MODIFIED RNAS ENCODING VEGF AND BMP POLYPEPTIDES
20210052776 ยท 2021-02-25
Inventors
Cpc classification
A61L27/3821
HUMAN NECESSITIES
C07K14/51
CHEMISTRY; METALLURGY
A61K38/1875
HUMAN NECESSITIES
A61K35/51
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A61L2430/02
HUMAN NECESSITIES
C12N5/0663
CHEMISTRY; METALLURGY
A61K35/28
HUMAN NECESSITIES
A61K35/50
HUMAN NECESSITIES
International classification
A61K35/28
HUMAN NECESSITIES
A61K35/50
HUMAN NECESSITIES
A61K35/51
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A61L27/54
HUMAN NECESSITIES
C07K14/51
CHEMISTRY; METALLURGY
Abstract
This disclosure relates to compositions including mesenchymal stem or stromal cells (MSCs) that harbor one or more modified RNA molecules encoding a bone morphogenetic protein (BMP), e.g., human BMP, and one or more modified RNA molecules encoding vascular endothelial growth factor (VEGF), e.g., human VEGF or VEGF-A, or first and second separate pluralities of MSCs, wherein each MSC in the first plurality of MSCs harbors one or more modified RNA molecules encoding BMP, and wherein each MSC in the second plurality of MSCs harbors one or more modified RNA molecules encoding VEGF; and a carrier, e.g., a solid or semi-solid carrier. The disclosure also relates to methods and uses of these compositions to treat bone defects.
Claims
1. A composition comprising (a) a mesenchymal stem or stromal cell (MSC) composition comprising either one or both of: (i) a plurality of MSCs, wherein each MSC harbors one or more modified RNA molecules encoding bone morphogenetic protein (BMP) and one or more modified RNA molecules encoding vascular endothelial growth factor (VEGF), or (ii) first and second separate pluralities of MSCs, wherein each MSC in the first plurality of MSCs harbors one or more modified RNA molecules encoding bone morphogenetic protein (BMP), and wherein each MSC in the second plurality of MSCs harbors one or more modified RNA molecules encoding vascular endothelial growth factor A (VEGF-A); and (b) a carrier.
2. The composition of claim 1, wherein the carrier comprises a gel, hydrogel, paste, or a solid carrier.
3. The composition of claim 2, wherein the carrier comprises one or more of a bioceramic, bioactive glass, polymer, nanofiber, nanomaterial, hydroxyapatite, collagen, non-toxic lipid nanoparticles, or a gel-based or silica-based hydrogel.
4. The composition of claim 1, wherein the VEGF polypeptide is a human VEGF-A polypeptide and the BMP polypeptide is a human BMP-2 polypeptide.
5. The composition of claim 1, wherein the MSCs are bone marrow-derived MSCs (BMSCs), adipose/fat-derived MSCs, peripheral blood-derived MSCs, umbilical cord-derived MSCs, or placental-derived MSCs.
6. The composition of claim 1, wherein the MSCs are allogenic cells or autologous cells.
7. The composition of claim 1, wherein the MSCs harboring the modified RNA molecules are prepared by (i) transient transfection or electroporation with the modified RNA molecules or (ii) exposure to lipid nanoparticles comprising the modified RNA molecules.
8. The composition of claim 1, wherein the total amount of the modRNAs used in the composition is in the range of 100 ng to 12 mg.
9. The composition of claim 1, wherein the total number of cells in the composition is in the range of about 2010.sup.4 to about 12010.sup.6.
10. The composition of claim 1, wherein the dose of mRNA transcripts within the MSCs is about 1 pg/cell to 1 ng/cell.
11. The composition of claim 1, wherein the composition comprises about 25 g to about 2.5 mg of modRNA in about 250,000 cells to about 2510.sup.6 cells at a dose of about 10 pg/cell, and secretes about 10 ng to about 1 mg of the BMP and VEGF polypeptides over a period of 5 days.
12. The composition of claim 1, wherein a ratio of BMP to VEGF is in a range of 10:1 to 1:1.
13. The composition of claim 1, wherein the ratio of BMP-VEGF is about 3:1 to about 6:1.
14. A method of treating a bone defect in a subject, the method comprising identifying a subject with a bone defect; and administering to the bone defect a composition of claim 1.
15. The method of claim 14, wherein the bone defect comprises a site of osteoporosis, a bone tumor, a bone break, a site of bone trauma, a nonunion bone fracture, a bone tumor resection, or a bone affected by craniomaxillofacial surgery.
16. The method of claim 14, wherein the carrier comprises a gel, hydrogel, paste, or a solid carrier.
17. The method of claim 14, wherein the VEGF polypeptide is a human VEGF-A polypeptide and the BMP polypeptide is a human BMP-2 polypeptide.
18. The method of claim 14, wherein the MSCs are bone marrow-derived MSCs (BMSCs), adipose/fat-derived MSCs, peripheral blood-derived MSCs, umbilical cord-derived MSCs, or placental-derived MSCs.
19. The method of claim 14, wherein the MSCs are allogenic cells or autologous cells.
20. The method of claim 14, wherein the composition is administered by one or more of the following: (i) injection to the bone defect; (ii) vascular catheterization; (iii) using MSCs engineered to migrate to a site of the bone defect; or (iv) a surgical procedure to render access to the bone defect.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0040] This patent or application contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
DETAILED DESCRIPTION
[0090] The present disclosure is based, at least in part, on the discovery that if one uses compositions of mesenchymal stem/stromal cells (MSCs), e.g., BMSCs, adipose/fat derived MSCs, peripheral blood derived MSCs, umbilical MSCs, or placental-derived MSCs, combined with solid or semisolid carriers, e.g., biodegradable carriers, wherein the MSCs harbor modified RNA molecules that encode VEGF polypeptides and BMP polypeptides, one can use those MSCs to deliver a controlled dosage of both of these proteins for a controlled length of time to provide an improved therapy to heal bone defects, including otherwise non-healing bone defects. The MSCs can be either used in autologous cell therapy in which the subject's (patient's) own cells are removed, engineered to add the modRNA, and then administered back into the same subject, or in allogeneic cell therapy, in which a composition of engineered MSCs from some other subject are administered to a subject.
[0091] Chemically modified mRNAs (mod RNAs) are a novel technology platform for restoring or enhancing expression of polypeptides (Zangi et al., Nat. Biotechnol., 31, 898-907 (2013); Carlsson et al., Mol. Ther. Methods Clin. Dev., 9, 330-346 (2018); Gan et al., Nat. Commun., 10, 871 (2019)). Unlike gene therapy, modified mRNAs deliver a transient burst of therapeutic protein expression while evading immune detection of the host cells. As described herein, this the onset and duration of this burst can be controlled.
[0092] The present disclosure relates to the therapeutic use of modRNA to repair bone defects, specifically the use of modRNA encoding two known factors, Bone Morphogenetic Protein, e.g., BMP-2 or BMP-7, and Vascular Endothelial Growth Factor, e.g., VEGF-A, which are key developmental and reparative regulators of bone growth (Wei et al., Tissue Eng. Pt. A, 24, 584-594 (2018); Hu et al., J. Clin. Invest., 126, 509-526 (2016)). We hypothesized that the co-expression of modRNAs coding for the human BMP-2 and VEGF-A gene could better accelerate bone healing and regeneration by enhancing osteogenesis through the simultaneous stimulation of angiogenesis. As described in more detail below, we first investigated the osteogenic potential of BMP-2 modRNA (modBMP2) together with the angiogenic potential of VEGF-A modRNA (modVEGF-A) in vitro using rat-derived BMSCs. BMSCs were transfected with modBMP2 and modVEGF-A at high efficiency. Following transfection of BMSCs, elevated levels of biologically active VEGF-A and BMP2 protein were detected for more than 5 days. The transfection of these modRNAs effectively induced osteogenic differentiation of BMSCs in vitro. In addition, the levels of transcripts associated with osteogenesis and angiogenesis were significantly increased for up to 2 weeks post-transfection.
[0093] We also investigated and confirmed the benefits of these methods in vivo by loading modBMP2 and modVEGF-A pre-treated-BMSCs into a collagen scaffold that we then implanted into calvarial defects in rats. As early as 4 weeks post-operation the animals receiving BMSCs pre-treated with modVEGF-A and modBMP2 showed significant bone healing. By 12 weeks post-operation the BMP2+VEGF-A modRNA treated group revealed significant levels of new bone formation. These experiments confirm the efficacy and synergistic effect of these methods to deliver low doses of BMP2 and VEGF-A using modRNAs to regenerate bone. These results provide insights to a novel, safe, efficient, and cost-effective approach for bone tissue regeneration.
Modified RNA
[0094] Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5 untranslated region (UTR), a 3 untranslated region (UTR), a 5 cap, and a poly-A tail. Building on this wild type modular structure, the present disclosure expands the scope of functionality of traditional mRNA molecules by providing polynucleotides or primary RNA constructs which maintain a modular organization, but which comprise one or more structural and/or chemical modifications or alterations that impart useful properties to the polynucleotide. In some embodiments, modified RNAs comprise a modification to the 5 cap, such as a 5 diguanosine cap. In some embodiments, modified RNAs comprise a modification to a coding region. In some embodiments, modified RNAs comprise a modification to a 5 UTR. In some embodiments, modified RNAs comprise a modification to a 3 UTR. In other embodiments, modified RNAs comprise a modification to a poly-A tail. In some embodiments, modified RNAs comprise any combination of modifications to a coding region, 5 cap, 5 UTR, 3 UTR, or poly-A tail.
[0095] In some embodiments, a modified RNA can optionally be treated with an alkaline phosphatase. Examples of modifications to RNA molecules are disclosed in U.S. Patent Application Publication No. 2014/0073687, U.S. Patent Application Publication No. 2015/0051268, and U.S. Pat. No. 9,061,059, the contents of which are all incorporated herein by reference in their entireties.
Modified RNA Encoding BMP Polypeptide
[0096] As described in more detail in the Examples below, modified RNA molecules can be prepared that encode a BMP polypeptide, e.g., a human BMP, e.g., a BMP-2 polypeptide, which can be any one of a large family of BMP proteins that are known to play a central role in TGF--signaling and in modulating bone and cartilage biology. It will be appreciated by those of skill in the art that for any particular BMP gene there may exist one or more variants or isoforms.
[0097] A non-limiting example of the sequence of human BMP-2 polypeptide and the nucleic acid sequence that encodes this BMP-2 polypeptide, which can be used in accordance with the present disclosure, is available online at NM Ref. NM_001200.4 at the NCBI database. Other BMP-2 polypeptides and nucleic acid sequences are publicly available and can be used in the compositions and methods described herein. For example, the specific nucleic acids encoding BMP-2 and BMP-7 are known, and can be found in, e.g., van der Kraan et al., 2010, Osteoarthritis Cartilage. 2010 June; 18(6):735-41; and Lissenberg-Thunnissen et al., Int. Orthop. 2011 September; 35(9):1271-80.
[0098] Proper dosing of BMP polypeptide is important, because too much BMP polypeptide is known to cause unacceptable side effects. For example, while BMP polypeptides can promote bone formation, they also induce adverse effects, including cyst-like bone formation and significant soft tissue swelling. Several studies have shown these significant and unacceptable side effects. For example, one study evaluated multiple BMP2 doses in different rat models to determine dose-dependent effects (Zara et al., Tissue Eng., Volume 17, Numbers 9 and 10 (2011), DOI:10.1089/ten.tea.2010.0555). Results showed that only a mid-level dosage was able to fuse a bone defect without adverse effects (30 mg/mL, total dose 2.25 mg in 75 mg total volume), while a lower dose was ineffective, and a higher concentration range of BMP2 (150, 300, and 600 mg/mL, total dose 11.25, 22.5, and 45 mg in 75 mg total volume) was able to fuse the defect, but with formation of cyst-like bony shells filled with histologically confirmed adipose tissue. In addition, compared to control, 4 mg/mL BMP-2 also caused significant tissue inflammatory infiltrates and exudates in a femoral onlay model that was accompanied by increased numbers of osteoclast-like cells at 3, 7, and 14 days. Overall, the study shows that BMP-2 side effects of cyst-like bone and soft tissue swelling are caused when using high BMP-2 concentrations approaching the typical human dose of 1500 mg/mL
[0099] On the other hand, the present disclosure provides controlled concentrations of BMP, e.g., BMP-2, expression that provide effect healing of bone defects, but without the side effects described in the prior art. As described in more detail below, in the examples, modified mRNA in vivo expression kinetics are highly favorable over recombinant protein and adeno-viral associated gene delivery. Advantages of modified RNA include, but are not limited to, dosable and controlled protein levels, fast delivery, negligible immune reactions, and a transient signal.
Modified RNA Encoding VEGF Polypeptide
[0100] As described in more detail in the Examples below, modified RNA molecules can be prepared that encode a VEGF polypeptide, e.g., a human VEGF, e.g., a VEGF-A polypeptide, which can be any one of a large family of VEGF proteins that play a central role in the control of cardiovascular physiological function (Holmes D. I. et al, Genome Biol, (2005)6(2):209). It will be appreciated by those of skill in the art that for any particular VEGF gene there may exist one or more variants or isoforms.
[0101] Non-limiting examples of the VEGF-A polypeptides that can be used in accordance with the present disclosure are listed in Table 1. These polypeptides and the nucleic acid molecules that encode them are publically available online at the NCBI database. Other VEGF polypeptides and nucleic acid sequences are publicly available and can be used in the compositions and methods described herein.
TABLE-US-00001 TABLE 1 Homo sapiens VEGF-A mRNA Isoforms Description NM Ref Homo sapiens VEGF-A, transcript variant NM_001025366.3 1, mRNA Homo sapiens VEGF-A, transcript variant NM_003376.6 2, mRNA Homo sapiens VEGF-A, transcript variant NM_001025367.3 3, mRNA Homo sapiens VEGF-A, transcript variant NM_001025368.3 4, mRNA Homo sapiens VEGF-A, transcript variant NM_001025369.3 5, mRNA Homo sapiens VEGF-A, transcript variant NM_001025370.3 6, mRNA Homo sapiens VEGF-A, transcript variant NM_001033756.3 7, mRNA Homo sapiens VEGF-A, transcript variant NM_001171622.2 8, mRNA Homo sapiens VEGF-A, transcript variant NM_001204385.2 9, mRNA Homo sapiens VEGF-A, transcript variant NM_001287044.2 10, mRNA
Mesenchymal Stem/Stromal Cells
[0102] Mesenchymal Stem/Stromal Cells (SMCs) can be obtained from various sources, and can be obtained directly from the subject, engineered to harbor modRNA (and optionally cultured to increase the cell population, either before or after the modRNA is added), and then administered back into the same subject (autologous cell therapy) or the MSCs can be obtained from a first subject, engineered to add the modRNA (and optionally cultured to increase the cell population, either before or after the modRNA is added), and then administered to some other subject (allogeneic cell therapy), e.g., after storage, and thus can be available to treat a subject much more rapidly than using autologous cell therapy.
[0103] One example of MSCs are bone marrow stem cells (BMSCs), which can be directly isolated from subjects for use in autologous or allogenic cell therapies. U.S. Patent Application US20080279828A1 discloses methods of mobilization of bone marrow stem cells into the peripheral blood of a donor for harvesting the bone marrow stem cells, and is incorporated herein by reference in its entirety. The method comprises administering to the donor an effective amount of at least one copper chelate, to thereby expand the bone marrow stem cells in vivo, while at the same time reversibly inhibiting differentiation of the bone marrow stem cells; and harvesting the bone marrow stem cells by leukopheresis.
[0104] Alternatively, cells that differentiate into BMSCs (BMSC precursors) can be isolated from subjects and then exposed to one or more chemical or biological agents to differentiate into BMSCs in culture. U.S. Pat. No. 5,486,359 describes the isolation of human mesenchymal stem cells, which can differentiate into more than one tissue type (e.g. bone, cartilage, muscle, or marrow stroma) and a method for isolating, purifying, and culturally expanding human mesenchymal stem cells.
[0105] Additional sources of MSCs from adult niches including adipose/fat-derived MSCs and peripheral blood derived MSCs. In addition, MSCs from the pre/neo-natal environment can be used in the methods described herein, including umbilical and placental-derived MSCs. Human umbilical cord and placenta-derived MSCs, as well as peripheral blood derived MSCs can be isolated from patients using methods known in the art, e.g., through a combination of tissue explant cultures and/or by gradient density separation through centrifugation (Beeravolu et al., J. Vis. Exp., 122 (2017); Chong et al., J Orthop Res., 30(4):634-42 (2012). For the isolation of adipose/fat-derived MSCs, the cells can first be isolated using for example, methods involving liposuction and resection (Schneider et al., Eur. J. Med. Res., 22(1):17 (2017). Although some functional diversity exists within mesenchymal stromal cells derived from different patients and/or different tissue sources, for mesenchymal stem/stromal cells to maintain their identity they should possess three functional attributes: 1) self-renewal potential; 2) ability to grow on plastics; and 3) ability to differentiate into three major cell types including osteoblast (bone), chondrocyte (cartilage) and adipocyte (fat). Additionally, regardless of the source of MSCs, the MSCs should have differentiation markers such as CD73, CD90 and the lack of CD14, CD34, and CD45 (Ullah et al., Biosci. Rep., 35(2) (Apr. 28, 2015); Fitzsimmons et al., Stem Cells Int. 2018: 8031718 (2018)).
Preparation of Compositions of MSCs Harboring Modified RNA Encoding BMP Polypeptide and Modified RNA Encoding VEGF Polypeptide
[0106] Modified RNA encoding BMP polypeptide and/or modified RNA encoding VEGF polypeptide can be delivered into MSCs by methods known in the art. Methods include, but are not limited to, electroporation, transfection (e.g., methods using cationic-lipid transfection reagents), and lipid nanoparticle encapsulating the modified RNAs.
[0107] In particular, one can prepare the MSCs described herein using the following steps.
[0108] Delivering modRNA into MSCs BMSCs are grown in culturee.g., seeded at 20-3010.sup.4 cells/well in 6-well plates or flasks and seeded at approximately 4,000-6,000 cells per cm.sup.2 in 0.2-0.4 mL/cm.sup.2 media. For example, MSCs grown in T-75 flasks are generally seeded at 300,000 cells/flask in 15 mL of media. ModRNA complexes are formed with a cationic-lipid transfection reagent and incubated with BMSCs in culture. For example, the modRNA complexes can bee.g., formed by using 2.5 l Lipofectamine MessengerMAX Reagent (RNAiMax Reagent and Lipofectamine 2,000 Reagent and 3,000 Reagent are also effective) per 1 g modRNA. Calculations are performed to transfect BMSCs at a dose of 10 pg/cell modRNA (i.e., Luciferase, GFP, mCherry, hBMP-2 or VEGF-A). Ratios of modified mRNA to cells can range from 1 pg/cell to 100 pg/cell.
[0109] In some embodiment, the concentration of modified mRNA can be increased or decreased from 1 g/l to enable a lower or higher dose and thus, different levels of the modified mRNA in the cells. In some embodiments different ratios of the modRNA transcripts can be used, e.g., other than 1:1 ratios. For example, ratios of 2:1, 3:1, 4:1, and 5:1 of the modRNA encoding VEGF and the modRNA encoding BMP, as well as ratios of these same polypeptides of 1:5, 1:4, 1:3, and 1:2 can be envisioned depending on the specific bone defect and subject.
[0110] In some embodiments, the cells can be single-transfected in two groups to obtain specific dosages of mRNA transcripts in each group, and then combined at a later time, or the transfections can be tailored so that the same cells harbor different doses/concentrations of the mRNA transcripts.
[0111] Transfection Methods
[0112] MSCs can be grown in culture and transfected, e.g., electroporated, with specific doses of modRNA. In some embodiments, the human MSCs, e.g., hBMSCs, are transfected with modRNA using Nucleofector 2b and the hMSC Nucleofector kit (Lonza) according to the manufacturer's instructions. In brief, cells are resuspended in 100 L Nucleofector solution, mixed with modified mRNA (e.g., at 100 ng-100 g per 1 million cells), transferred to a cuvette, and electroporated using program U-23 of the Nucleofector device. Nucleofected samples can be placed in pre-warmed medium to recover or resuspended in a low glucose DMEM solution supplemented with FBS and Pen/strep (such as Lonza hMSC-GM) and 10% DMSO, and frozen at 80 C. (and can be stored in liquid nitrogen tanks at 180 C.) until further use.
[0113] Fabrication and Functionalization of Solid and Semi-Solid Carriers
[0114] Carriers can be made of one or more of the following bio-inert or bioactive materials that may or may not be biodegradable and/or bioabsorbable: bioceramics, bioactive glasses, polymer components/nano fibers (e.g., polyfumarates, polycaprolactone, polylactic acid (PLA), polyglycolic acid (PGA), copolymers of PLA and PGA (PLGA), nanomaterials (e.g., nanotubes), hydroxyapatite (HA) (in the form of crystals or other), collagen fibers/sponges, collagen molecules, non-toxic lipid nanoparticles, and/or gel/silica-based hydrogels. Various other pharmaceutically acceptable polymers can also be used, as long as they can be used to deliver the compositions described herein to a specific site of a bone defect, and maintain all or at least some of the compositions at that site for a sufficient duration, e.g., 1, 2, 3, 4, 5, 6, or 7, or more days, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more weeks, or for 1, 2, 3, 4, 5, 6 or more months. The carriers can be designed to biodegrade at a known rate to help control the duration of treatment with the engineered MSCs.
[0115] In one example, collagen sponges can be prepared, for example, by partially dissociating in 0.1 mol/L acetic acid and frozen at 80 C., then freeze-dried at 50 C. under a vacuum, e.g., for a sufficient time, e.g., 24 hours, subsequently cross-linked, e.g., with 25 mM EDC and 25 mM NHS with 95% ethanol solution for a sufficient time, e.g., 24 hours, thoroughly washed with a washing solution, such as 5 wt % glycine solution and distilled water, e.g., three times, and freeze-dried a second time at 50 C. to obtain a collagen scaffold.
[0116] Preparation of modRNA-BMSCs/Scaffold Constructs and Surgical Procedures
[0117] The modRNA-transfected cells can be trypsinized after 4 hours of modified mRNA transfection, centrifuged, and resuspended in osteoblast inducing conditional medium. The cells (510.sup.6 cells/ml) can be evenly seeded into cross-linked collagen scaffolds, e.g., 50 l/scaffold, thus 2.510.sup.5 cells/scaffold. Osteogenic medium can be added after 4 hour incubation at 37 C., and the BMSCs/scaffold constructs are incubated overnight prior to implantation. The absorbable collagen sponges are biodegradable. The inoculation of the mRNA-loaded BMSCs in biomaterials help control growth factor release locally at the site of a bone defect, as well as enhance secretion and expression over longer periods of time until the support material is completely degraded.
[0118] When made and used according to the methods described herein, the new MSC compositions provide a synergistic effect from the combination of VEGF-A and BMP-2 polypeptides, because as shown in
[0119] Methods of Treatment
[0120] The methods described herein include methods for the treatment of bone defects, such as non-healing bone defects in subjects, such as human subjects. Generally, the methods include administering a therapeutically effective amount of MSCs harboring modRNA encoding BMP-2 polypeptide and modRNA encoding VEGF-A polypeptide as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment.
[0121] As used in this context, to treat means to ameliorate or partially or fully heal the bone defect. Often, treatment with the compositions described hereinMSCs harboring modRNA encoding BMP-2 polypeptide and modRNA encoding VEGF-A polypeptide-results in partial or complete healing of the bone defect.
[0122] In particular, one can treat a subject with the compositions described herein by administering, e.g., locally administering, the compositions described herein to the site of a bone defect. Such administration can include injection to a small site, or a surgical procedure to make the site of the bone defect sufficiently accessible so that the compositions can be applied directly to the bone defect. For example, cells harboring modified mRNAs can be delivered via systemic or local injection and/or infusion through vascular catheterization procedures. In addition, the cells can be engineered to migrate to the areas of bone defect, using known techniques. If the BMSCs harboring modRNA are included in biomaterials to form the compositions described herein, delivery routes to bone may require surgical procedures including, but not limited to, core decompression, which involves drilling into the bone, often in diseased/injured areas for cell/bone grafting (Steinberg M E, Can J Surg., 1995 February; 38 Suppl., 1:S18-24).
[0123] Therapeutically effective amounts of the new compositions are determined by the total number of cells administered and by the concentration of modRNA in each cell. The correct dose of cells harboring the mRNA will depend on multiple parameters including degree of injury, the size/weight of the subject, and the overall health of the subject. Based on data acquired in rat model systems as described herein, and on data regarding FTIH studies (Gan et al., Nat. Commun., 10(1):871 (2019)), the physiological dose range needed to repair a bone defect in human subjects would be in the range of about, e.g., about 2 g to about 12 mg of modified mRNA, e.g., about 5 g to about 1.0 mg, or about 10 g to about 500 g, and this dose depends in large part on the size of the bone defect to be repaired.
[0124] As discussed below and illustrated in
[0125] The modRNA can be administered as a single dose or as multiple doses that add up to the total dose over several administrations.
[0126] The dose of the BMP polypeptides expressed by the MSCs in the new compositions described herein is carefully controlled to avoid delivery of too high a dose of the BMP polypeptides. For example, a high dose rhBMP2 (40 mg) product called AMPLIFY by Medtronic was administered to patients with degenerative lumbar disease and at 2 year follow-up patients had over a 300% increase in cancer cases in their treated patients (Panel OaRDA P050u36, 2010; Carragee et al., J. Bone Joint Surg. Am., 95:1537-45 (2013); Dimar et al., J. Bone Joint Surg. Am., 91:1377-1386 (2009)). On the other hand the INFUSE clinical trial used 6 and 12 mg doses and have reported a lower cancer risk (Simmonds et al., Ann. Intern. Med., 158(12):877-889 (2013)). See also, Epstein, Complications due to the use of BMP/INFUSE in spine surgery: The evidence continues to mount, Surg. Neurol. Int., 4(supp15):5343-5352 (2013).
[0127] Without wishing to be bound to a particular theory, a useful dose of the BMP component delivered by the new compositions described herein is in the range of about 2 g-12 mg, e.g., 2, 5, 10, 25, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 pg, ng, or g, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, or more mg. Similar levels of VEGF polypeptides should also be delivered. The particular dose is also determined by the amount of modRNA molecules in the cells. A useful dosage range of the cells harboring the modified mRNAs is about 1 pg/cell to 100 ng/cell, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pg/cell, with a total useful range of between 1 pg/cell to 100 ng/cell, e.g., 200, 300, 400, 500, 600, 700, 800, 900, or 1000 pg/cell. Cell number determines final dose of modified mRNAs as it is an additive effect. Thus, the cell number range administered to the site of the bone defect should be in the range of about 2010.sup.4 to about 12010.sup.6 cells, e.g., 2010.sup.5, 110.sup.6, 2010.sup.6, 5010.sup.6, or 10010.sup.6.
[0128] The duration of the burst of polypeptide or protein is determined by a combination of both cell number and the level of modified mRNA transcripts that are introduced within the cells. The burst of secreted polypeptides or proteins should be selected to last between 2 and 5 days, but due to the half-life of the newly accumulated protein, they may be detected for up to 2 weeks.
EXAMPLES
[0129] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
Materials
[0130] Dulbecco's modified eagle medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco (Thermo Fisher Scientific, USA). Trypsin-EDTA (0.25%, 1 solution), Dulbecco's phosphate buffered saline (DPBS), and antibiotics (100 U/mL penicillin G and 0.1 mg/mL streptomycin) were purchased from Gibco (Invitrogen Grand Island, N.Y.). Cell Counting Kit-8 (CCK-8) was obtained from Dojindo Laboratories (Dojindo, Kumamoto, Japan). Alizarin Red S was purchased from SolarbioLife Sciences, Alkaline phosphatase (ALP) staining kit (BCIP/NBT Alkaline Phosphatase Color Development Kit) was purchased from Beyotime Institute of Biotechnology. Collagen was obtained from Sichuan Mingrang Tech., China, and collagen cross-linking agent N-(3-(dimethylamino)-propyl)-N-Ethylcarbodiimide hydrochloride crystalline (EDC) and N-Hydroxysulfosuccinimide sodium salt (NHS) were purchased from Aladdin Industrial Corporation, Shanghai, China. All materials were utilized as received, without any further purification.
Example 1Demonstration that Bone Marrow Stem Cells (BMSCs) Transiently Transfected with Modified RNA (modRNA) Exhibit Expression with Low Cytotoxicity
[0131] To determine BMSCs can be co-transfected with two modRNAs with low cytotoxicity, BMSCs were transiently co-transfected with modRNAs encoding green fluorescent protein (GFP) and modRNAs encoding mCherry. Expression of the fluorescent proteins was measured along with cytotoxicity by a cell counting and proliferation assays.
Methods
[0132] Generation of Chemically Modified mRNA (modRNA) Encoding GFP, mCherry, Luciferase, Human BMP2 (hBMP-2), and Human VEGF-A Complexes
[0133] MRNA was synthesized in vitro using T7 RNA polymerase-mediated transcription from a linearized DNA template, which incorporates the 5 UTR, 3UTR, and a poly-A tail as previously described (Richner, J. M., et al. Cell 169, 176 (2017)). RNA was purified using Ambion MEGA clear spin columns and then treated with Antarctic Phosphatase (New England Biolabs) for 30 min at 37 C. to remove residual 5-phosphates. Treated RNA was re-purified and quantified by Nanodrop (Thermo Scientific). After purification, modRNA was resuspended in 10 mM Tris HCl, 1 mM EDTA at 1 g/l for use. In mRNA, uridine was fully replaced by N1-methylpseudouridine. GFP, mCherry, firefly luciferase, and human VEGF-A (165) ORF sequences were the same as previously described (Zangi, L., et al. Nat Biotechnol 31, 898-907 (2013)).
[0134] The open reading frame sequence for human BMP-2 modRNA was:
TABLE-US-00002 (SEQIDNO:1) 5-ATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGT CCTCCTGGGCGGCGCGGCTGGCCTCGTTCCGGAGCTGGGCCGCAGGAAGT TCGCGGCGGCGTCGTCGGGCCGCCCCTCATCCCAGCCCTCTGACGAGGTC CTGAGCGAGTTCGAGTTGCGGCTGCTCAGCATGTTCGGCCTGAAACAGAG ACCCACCCCCAGCAGGGACGCCGTGGTGCCCCCCTACATGCTAGACCTGT ATCGCAGGCACTCAGGTCAGCCGGGCTCACCCGCCCCAGACCACCGGTTG GAGAGGGCAGCCAGCCGAGCCAACACTGTGCGCAGCTTCCACCATGAAGA ATCTTTGGAAGAACTACCAGAAACGAGTGGGAAAACAACCCGGAGATTCT TCTTTAATTTAAGTTCTATCCCCACGGAGGAGTTTATCACCTCAGCAGAG CTTCAGGTTTTCCGAGAACAGATGCAAGATGCTTTAGGAAACAATAGCAG TTTCCATCACCGAATTAATATTTATGAAATCATAAAACCTGCAACAGCCA ACTCGAAATTCCCCGTGACCAGACTTTTGGACACCAGGTTGGTGAATCAG AATGCAAGCAGGTGGGAAAGTTTTGATGTCACCCCCGCTGTGATGCGGTG GACTGCACAGGGACACGCCAACCATGGATTCGTGGTGGAAGTGGCCCACT TGGAGGAGAAACAAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCT TTGCACCAAGATGAACACAGCTGGTCACAGATAAGGCCATTGCTAGTAAC TTTTGGCCATGATGGAAAAGGGCATCCTCTCCACAAAAGAGAAAAACGTC AAGCCAAACACAAACAGCGGAAACGCCTTAAGTCCAGCTGTAAGAGACAC CCTTTGTACGTGGACTTCAGTGACGTGGGGTGGAATGACTGGATTGTGGC TCCCCCGGGGTATCACGCCTTTTACTGCCACGGAGAATGCCCTTTTCCTC TGGCTGATCATCTGAACTCCACTAATCATGCCATTGTTCAGACGTTGGTC AACTCTGTTAACTCTAAGATTCCTAAGGCATGCTGTGTCCCGACAGAACT CAGTGCTATCTCGATGCTGTACCTTGACGAGAATGAAAAGGTTGTATTAA AGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGTCGCTAG-3.
[0135] Isolation and Culture of Rat BMSCs
[0136] A cell isolation process was performed as previously described (Li et al., Cytotechnology, 65:323-334 (2013); Li et al., Biomaterials, 74:155-166 (2016)). Primary BMSCs were harvested from the limbs (ulnae, radii, femora and tibiae) of 1-week old male Sprague-Dawley rats (Shanghai SLAC Experimental Animal Center, Shanghai, People's Republic of China) and the bone marrow was flushed by 26 G needle attached to a 1 ml disposable aseptic syringe containing DMEM medium. The cells were filtered through a 70 m filter mesh to remove bone spicules and cell clumps, resuspended in complete low glucose DMEM medium containing 10% FBS, Gibco, 100 IU/ml penicillin and 100 IU/ml streptomycin, incubated at 37 C. with 5% CO.sub.2 in a humidified chamber and were passaged 2-3 times for down-stream experimentation. BMSCs that were isolated following the described protocols above were characterized by flow cytometry and multi-lineage differentiation assays using known techniques. To enhance osteogenic differentiation, BMSCs were cultured with osteogenic medium following modRNA transfection. The osteogenic differentiation medium (i.e. 10% FBS, 10 mM -glycerophosphate, 0.05 mM ascorbic acid, and 10 nM dexamethasone) was prepared in advance. The hBMP-2, VEGF-A and hBMP-2+VEGF-A modRNA was transfected into the BMSCs as previously described. The medium was exchanged with osteogenic medium 4 h post-transfection for all groups. Transfected cells were sustained under osteogenic conditions for up to 14 days and the medium was changed every 2-3 days. Non-transfected cells, served as a control group, were cultured under the same terms and conditions.
[0137] ModRNA Preparation and BMSCs Transfection
[0138] BMSCs were transfected using Lipofectamine MessengerMAX Reagent (Invitrogen, Life Technologies, USA) according to the manufacturer's instructions. Briefly, BMSCs were seeded at 2010.sup.4 cells/well in 6-well plates. After incubation of 24 hours, cell culture medium was replaced with fresh reduced-serum medium Opti-MEM (Gibco, Life Technologies, USA). ModRNA complexes were formed by using 2.5 l Lipofectamine MessengerMAX Reagent per 1 g modRNA. Calculations were performed in order to transfect BMSCs at a dose of 10 pg/cell modRNA (i.e. Luciferase, GFP, mCherry, hBMP-2 or VEGF-A). Briefly, in tube A, 2 l of modRNA (1 g/l) was added to every 48 l Opti-MEM and incubated for 5 min; in tube B, 5 l Lipofectamine was added to every 45 l Opti-MEM and incubated for 5 min. Subsequently, tube A and B were mixed and incubated at room temperature for 15 min. Next, old medium was removed from the cells and 1.5 ml fresh Opti-MEM was added to each well (Lui, K. O., et al. Cell Res 23, 1172-1186 (2013)). Finally, 100 l of AB mixture was added to each well containing 2 g modRNA/well. At 4 hours after transfection, medium was replaced with complete DMEM. The cells were further cultured under standard conditions for up to 7 days until analysis.
[0139] Verification of Translation from Co-Transfected Modified mRNAs in BMSCs
[0140] To confirm expression of two simultaneous modRNA transfections in BMSCs, two constructsa GFP modRNA and an mCherry modRNAwere transfected singly or in combination. BMSCs were divided into 1 of 3 treatment groups: 1) GFP modRNA transfection only; 2) mCherry modRNA transfection only; 3) GFP modRNA combined with mCherry modRNA. At 24 hours post-transfection, cells were analyzed using fluorescence microscopy.
[0141] Statistical Analysis
[0142] The statistical analyses were performed using GraphPad Prism Version 7.00 (GraphPad Software, CA, USA). Results were expressed as meanstandard deviation (SD) and unpaired Student's t-test was employed to analyze the differences between the untransfected and transfected group. One-way ANOVA were performed to analyze comparison of multiple groups. ANOVA analyses were corrected for multiple comparison by Tukey (Gaussian distribution) and Kruskal-Wallis or Dunn's (non-Gaussian distribution) tests. Experiments were performed in triplicate and differences were considered statistically significant at the levels of *p<0.05, **p<0.01 and ***p<0.001.p<0.05 represents statistical significance.
Results
[0143] The mRNA molecule encoding GFP and mRNA molecule encoding mCherry were modified by the full replacement of uridine-5-triphosphate with N.sup.1-methylpseudo-uridine-5-triphosphate (m1). Co-transfections were performed into BMSCs of reporter modRNAs; a GFP and an mCherry modRNA construct. At 24 hours post-transfection, expression kinetics of the co-transfected modified mRNAs in BMSCs were analyzed using fluorescence microscopy and photomicrographic images are represented in
[0144] GFP expression was visualized within several hours after transfection (
Example 2Demonstration that BMSCs Co-Transfected with BMP-2 modRNA and VEGF-A modRNA Express and Secrete High Levels of BMP-2 and VEGF-A Proteins
[0145] Towards assessing the co-transfection of BMSCs with two modRNAsone encoding human BMP-2 and the other encoding human VEGF-ABMSCs isolated from rats were co-transfected with said modRNAs and the modRNA expression and levels of proteins encoding by the modRNAs were evaluated by quantitative real-time PCR (qRT-PCR) and by western blotting, respectively. Additionally, the propensity of the BMSCs co-transfected with BMP-2 modRNA and VEGF-A modRNA for osteogenic differentiation was inferred by measuring expression of select genes with roles is osteogenesis and markers of osteogenic differentiationspecifically, alkaline phosphatase activity and calcium deposition. Finally, angiogenesis potential of the BMSCs co-transfected with BMP-2 modRNA and VEGF-A modRNA was assessed using an endothelial tube formation assay.
Methods
[0146] BMSCs were prepared as described in Example 1. BSMCs were co-transfected with VEGF-A modRNA and BMP2 modRNA as described in Example 1.
[0147] Expression and Quantification of VEGF-A and hBMP-2 using Western Blotting
[0148] For western blot analysis, BMSCs were washed with PBS and lysed by protease inhibitor-containing RIPA buffer at 4 C. for 30 minutes. The lysates were centrifuged and samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, MA). The membrane was blocked with 5% bovine serum albumin (BSA) and probed with the primary antibodies from Abcam. The rat -actin was used as internal control. The primary antibodies were rabbit anti-Rat VEGF and rabbit anti-Rat BMP-2. After rinsing, the membranes were incubated with horseradish peroxidase-conjugated secondary goat anti-rabbit IgG (1:1000, Beyotime) for 1 hour at room temperature. Then the target bands were acquired with an ECL Plus Western Blotting Detection System (GE Healthcare, IL, USA).
[0149] Quantification of BMP2 and VEGF-A Secretion by ELISA
[0150] To quantify the BMP2 and VEGF-A expression following BMSC transfection, the supernatant was sampled at different days post-transfection (dpt) for ELISA analysis using the human BMP-2 ELISA kit (Quantikine, R&D Systems, USA) and human VEGF ELISA kit (Quantikine, R&D Systems, USA), respectively, according to the manufacturer's instructions. The absorbance was measured at 450 nm. Wavelength correction was set at 570 nm. Experiments were performed in triplicates, and the protein content was determined using a standard curve (range: 0-1000 pg/ml BMP-2 and 0-1000 pg/ml VEGF).
[0151] Osteogenic Differentiation in Vitro
[0152] To enhance osteogenic differentiation, BMSCs were cultured with osteogenic medium following modRNA transfection. The osteogenic differentiation medium (i.e., 10% FBS, 10 mM -glycerophosphate, 0.05 mM ascorbic acid, and 10 nM dexamethasone) was prepared in advance. hBMP-2, VEGF-A and hBMP-2+VEGF-A modRNA was transfected into the BMSCs as previously described (Insert Reference). The medium was exchanged with osteogenic medium 4 h post-transfection for all groups. Transfected cells were sustained under osteogenic conditions for up to 14 days and the medium was changed every 2-3 days. Non-transfected cells cultured under the same conditions served as a control group.
[0153] qRT-PCR and Western Blotting Analysis for Osteogenesis in Vitro
[0154] At 7 days post-osteogenic induction (DPOI) total RNA was extracted from transfected BMSCs using EZ-press RNA Purification Kit, according to the manufacturer's instructions as previously described. The osteo-related gene expression levels were determined by qRT-PCR analysis with a real-time thermal cycler using 2SYBR Green PCR master mix with 1.5 g of RNA. For qRT-PCR, primers specific for alkaline phosphatase (ALP), type I collagen (COL1), osteocalcin (OCN) and runt-related transcription factor 2 (RUNX2) genes (Table 2) were used.
TABLE-US-00003 TABLE2 RatPrimersusedinqRT-PCRAnalysis Product SEQ Primers Sequence(5-3) size(bp) IDNO: GAPDH-F GCCATCAACGACCCCTTCAT 136 2 GAPDH-R AGATGGTGATGGGTTTCCCG 3 ALP-F CCTTAAGGGCCAGCTACACC 100 4 ALP-R AGCGTTGGTGTTGTACGTCT 5 COI-F TGGTGAGACGTGGAAACCTG 193 6 COI-R CTTGGGTCCCTCGACTCCTA 7 OCN-F GGTGGTGAATAGACTCCGGC 117 8 OCN-R AGCTCGTCACAATTGGGGTT 9 RUNX2-F ACTACTCTGCCGAGCTACGA 86 10 RUNX2-R GCTCCGGCCTACAAATCTCA 11
[0155] Alternatively, cell samples were harvested at 3 dpoi washed with PBS and lysed by protease inhibitor-containing RIPA buffer at 4 C. for 30 min, then followed by western blot. The rat -actin was used as internal control. The primary antibodies were rabbit anti-Rat ALP, rabbit anti-Rat COL1, rabbit anti-Rat OCN, and rabbit anti-Rat RUNX2 (all from Abcam). The secondary antibody was HRP-conjugated goat anti-rabbit IgG (1:1000, Beyotime). Then the target bands were acquired with an ECL Plus Western Blotting Detection System (GE Healthcare, IL, USA).
[0156] Alkaline Phosphatase Activity Assay
[0157] Alkaline phosphatase activity (n=3) was assessed utilizing an ALP assay kit according to the manufacturer's protocol, as described previously (Yao, Q., et al. Electro-responsive BMP2 Release and Enhancement of Osteogenic Differentiation. 9, 39962-39970 (2017); Fahimipour, F., et al. Dent Mater 33, 1205-1216 (2017)). After osteogenic induction culture for 7 days, the cell layers were washed gently with cold PBS and digested with 0.25% trypsin-EDTA for 1 minute. The cell lysates were centrifuged at 1500 rpm for 5 min at 4 C. Then cell precipitate was lysed in 200 l of 0.2% Triton X-100 for 30 min. Next, 30 l of the supernatant was mixed with 150 l of the working solution following the manufacturer's protocol (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The substrate of ALP, namely, the resultant of p-nitrophenol from p-nitrophenylphosphate, was evaluated by measuring the absorbance at 520 nm with a microplate reader (SpectraMax i3x, Molecular Devices, Sunnyvale, Calif., USA). The ALP activity was calculated by the ratio of experimental samples to standard and was expressed by milligrams of p-nitrophenol produced per minute per gram of protein (king unit/gprot). Furthermore, BMSCs were subject to alkaline phosphatase staining at 7 dpoi as described previously (Zhou, G., et al. Int. J. Nanomedicine, 12, 7577-7588 (2017)).
[0158] Alizarin Red Staining and Quantification
[0159] To detect mineralization, BMSCs were subject to Alizarin red staining at 14 dpoi as described previously (Liao, Y. H., et al. Biomaterials 35, 4901-4910 (2014)). After removing the medium, the cells were washed twice with PBS and fixed with 4% paraformaldehyde for 30 minutes. Then cells were rinsed with PBS twice, and stained with 0.2% Alizarin Red S solution (pH 4.2) for 5 minutes, followed by three times PBS wash extensively to remove unspecific staining or verisimilar sediments. Calcified nodules are stained as red spots and were photographed by a microscope. To quantify the calcium deposition, after washing with dH.sub.2O, the stain was solubilized with 10% cetylpyridinium chloride monohydrate (CPC, Sigma-Aldrich) in 0.1M PBS (pH 7.0) by shaking for 15 min and the absorbance was read at 570 nm (Lopa, S., et al. Eur Cell Mater 27, 298-311 (2014)). The calcium deposition was expressed as optical density (OD).
Results
[0160] RNA was isolated from BMSCs 24 hours post-transfection of BMP2 and VEGF-A modRNA. Consequently, mRNA transcript levels were quantified by qRT-PCR. Compared to untransfected BMSCs, the modRNA transfections resulted in significantly higher levels of mRNA inside the cells (***p<0.001), (
[0161] To evaluate BMP2 and VEGF-A target protein expression levels after lipofectamine transfection, protein levels of cell lysates at 24 hours post-transfection were quantified. The protein levels were significantly increased above basal levels compared to untransfected groups (
[0162] Alkaline phosphatase (ALP) is an early in vitro indicator of osteogenic differentiation, therefore increased ALP activity in our modRNA-transfected BMSCs would be a desirable feature. The ALP activity of BMSCs was assessed following transfection of modBMP2 alone, modVEGF alone, or as a combinatorial treatment together (modBMP2+modVEGF-A). ALP expression was observed in the modBMP2 and BMP2+VEGF-A modRNA treatment groups at 7 days post transfection, but not in the modVEGF-A transfected group. In addition, quantitative analysis of ALP activity through a colorimetric assay revealed a significant increase in contrast to untransfected BMSCs (
[0163] Calcium deposition is a late stage marker for osteogenic differentiation (Birmingham et al., Eur. Cells Mater., 23, 13-27 (2012)). Microscopic analysis of alizarin red staining at 14 days post-transfection revealed an increased number of calcium nodules in the modBMP2 group and a more pronounced effect in the BMP2+VEGF-A modRNA treatment group. Mineralization did not appear to occur in the modVEGF-A treatment group as alizarin red staining levels were consistent with levels seen in the control group. Quantitative assessment of the alizarin red staining (
[0164] The expression of osteogenic related genes was quantified at 7 days post osteogenic induction (dpoi) by qRT-PCR, as shown in
[0165] In addition, the potential for modVEGF-A to induce angiogenesis was assessed using an endothelial tube formation assay, shown in
Example 3Demonstration that Transplantation of Biomaterials Combined with Modified mRNA-Treated BMSCs Enhanced Bone Repair In Vivo
[0166] Towards assessing the therapeutic potential of BMSCs harboring two modRNAsone encoding human BMP-2 and the other encoding human VEGF-ABMSCs isolated from rats were co-transfected with said modRNAs and prepared with a collagen fiber matrix. The prepared composition was surgically implanted at the orthotropic site in rats following cranial defect surgery. The therapeutic potential of the composition was assessed by imaging the bone and staining the bone to quantify new bone growth and bone repair.
Methods
[0167] Fabrication and Functionalization of Collagen Sponges
[0168] Collagen sponges were dissolved in 0.1 mol/L acetic acid and frozen at 80 C., then freeze-dried at 50 C. under a vacuum for 24 hours, subsequently cross-linked by 25 mM EDC and 25 mM NHS with 95% ethanol solution for 24 hours, thoroughly washed with 5 wt % glycine solution and distilled water three times, and freeze-dried a second time at 50 C. to obtain collagen scaffold.
[0169] Preparation of Rat modRNA-BMSC/Scaffold Constructs and Surgical Procedures
[0170] The modRNA-transfected cells were trypsinized 4 hours post-transfection, centrifuged, and resuspended in osteoblast inducing conditional medium. The cells (510.sup.6 cells/ml) were evenly seeded into cross-linked collagen scaffold in the 48-well plate, 50 l/scaffold, thus 2.510.sup.5 cells/scaffold. Osteogenic medium was added after 4 hours of incubation at 37 C., and the BMSC/scaffold constructs were incubated overnight prior to implantation (Lo et al., Biomaterials, 124, 1-11 (2017)).
[0171] Eight week-old male Sprague Dawley rats were purchased from the animal experimental center of Shanghai ninth people's hospital (China), where they were housed and looked after in the experimental animal house. Two weeks later, the rats were anesthetized by intraperitoneal injection of 10% chloral hydrate (4 mg/kg body weight). In order to expose the parietal bone adequately, a sagittal incision (1.8 cm) in the scalp was made and the pericranium was removed by gentle scraping. The skull was washed by sterile phosphate buffered solution (PBS). Two critical-sized (5 mm in diameter) defects were created on both sides of the sagittal suture on the parietal bone, without disturbing the underlying dura and superior sagittal sinus vein, using a sterile medical bone drill. The constructs were implanted into the defects and gently pressed. The incision was carefully closed in layers by a 5-0 biodegradable suture and a 6-0 silk thread. Five treatment regimens were employed in this study, where defects were implanted with one of the following: 1) empty collagen scaffold (n=6); 2) nave BMSC loaded collagen scaffold (n=6); 3) BMSCs treated with modRNA encoding VEGF-A -loaded collagen scaffold (n=6); 4) BMSCs treated with modRNA encoding hBMP-2-loaded collagen scaffold (n=6); and 5) BMSCs treated with modRNA encoding hBMP-2+VEGF-A -loaded collagen scaffold (n=6). No antibiotics were given postoperatively but carefully housed in the experimental animal house.
[0172] For the luciferase study, collagen scaffolds loaded with BMSCs transfected with modRNA encoding luciferase (n=3) were implanted in the defect site. D-Luciferin, Sodium Salt (CAS 103404-75-7; Yeasen, Shanghai, China) was injected intraperitoneally using a 27 gauge needle at a dosage of 150 mg/kg body-weight under general anesthesia. In the following days, bioluminescence imaging was performed using a Xenogen IVIS Lumina XRMS Series III live animal biophotonic imaging system (Caliper Life Sciences, USA). IVIS images were recorded at 1, 2, 3, and 4 days following surgery in 3 animals per time point. Image analysis was performed using the software Living Image (Caliper, USA).
[0173] Micro Computed Tomography (pCT)
[0174] Rats were sacrificed and the calvarial bones were removed at 4 and 12 weeks post-surgery, and four samples per group were harvested. The samples were fixed in 4% paraformaldehyde for 24 h, and then were scanned using a SkyScan-1176 micro-computed tomography (CT) (Bruker micro CT, Belgium) system. Scans were performed using 17.93 voxel size, 90 KV, 278 pA and 0.5 degrees rotation step (180 degrees angular range). For bone analysis, micro-CT evaluation was performed on a 5 mm diameter circle, 1 mm height cylinder region in the defect area. The 1.6 version of NR econ software was used for 3D reconstruction and viewing of images. After 3D reconstruction, the 1.13 version of CT software was used for bone analysis. The index including directly measured bone volume (BV, mm.sup.3), tissue volume (TV, mm.sup.3), and the ratio BV/TV (%), were calculated for the bone formed in the defect area.
[0175] Histological and Immunohistochemical Staining
[0176] After CT scanning, the removed calvarial bones were decalcified with mild EDTA-decalcifier-solution (Boster Biological Technology Co., Ltd.), followed by paraffin embedding and sectioning. The sections (10 mm thick) from mid-defect regions were stained with H&E or subjected to Masson trichrome staining, which detects the collagen formation activity and is a sign of bone remodeling, that is, an essential process to complete bone healing. Briefly, the sections were deparaffined and rehydrated for immunohistochemical staining of osteocalcin (OCN) or CD31. The antigen retrieval was performed by incubation with trypsin for 20 minutes at 37 C. The primary antibodies used were mouse anti-rat OCN (1:150 dilution, abcam) or anti-CD31 MAb (1:200 dilution, Servicebio). The secondary antibody used was goat anti-mouse HRP-conjugated MAb (1:1000 dilution, Abcam). For Masson, OCN, and CD31 staining, the nuclei were stained with Gill Hematoxylin (Sigma) at the end of procedures according to the manufacturer's instructions.
[0177] Gene Expression Analysis by qRT-PCR
[0178] Newly formed bone tissues in the defect areas of the crania were sampled after the rats were euthanized 4 and 12 weeks after surgery. Total RNA was extracted from the bone tissue using a trizol reagent (Invitrogen, CA) according to the manufacturer's instructions. Then, the uniform real-time (RT) primer was used for the reverse transcription and quantitative RT-PCR was performed using a real-time thermal cycler (Stratagene Mx3000P QPCR System, CA, USA) and 2SYBR Green PCR master mix (EZBioscience, MN, USA).
[0179] Western Blot Analysis
[0180] Whole bone tissue isolations were extracted using a total protein lysis buffer. Tissue samples were lysed in RIPA lysis buffer (Sigma-Aldrich) containing a proteasome inhibitor (Beyotime) and then followed by western blot as previously described (El Rashidy et al., Acta Biomater., 2017 Oct. 15; 62:1-28). Finally, the target bands were acquired with an ECL Plus Western Blotting Detection System (GE Healthcare, IL, USA).
Results
[0181] To evaluate the in vivo protein expression kinetics following the introduction of modRNA-treated BMSCs, bioluminescence imaging was performed. At 24 hr time intervals following implantation, animals were sedated and non-invasively imaged. Luciferase expression was detected and peaked after 1 day with an average value of 1.010.sup.5 photons/sec/cm.sup.2/sr. Signal intensities declined gradually over the course of 3 days (
[0182] To assess for efficacy, cranial defect surgery was performed on rats as previously described (El-Rashidy et al., Acta Biomater., 62:1-28 (2017)). A collagen fiber matrix was loaded with modRNA-transfected BMSCs and surgically implanted at the orthotropic site (
[0183] The combinatorial treatment of BMP2+VEGF-A modRNA was most capable of generating new bone tissue deposition that rapidly filled the defect space at both 4 and 12 weeks compared to the individual treatment of BMP2 modRNA or VEG-A modRNA (
[0184] Thus, the combination therapy as described herein provided a synergistic effect compared to the single polypeptide dosing, because only half the delivered dose of the BMP-2 and VEGF-A in the combination was clearly more effective at regenerating and healing the bone defect than either polypeptide delivered to the bone defect alone.
[0185] Histological staining was performed to evaluate bone regeneration from the modRNA-transfected collagen scaffolds at week 4 and 12 post-surgery and transplantation. Distinct patterns of orthotopic bone tissue formation were observed following the administration of different modRNA-transfected BMSC scaffolds. The BMP2+VEGF-A modRNA transfection group acquired the largest area of newly regenerated bone tissue, compared to all other treatment and control groups (
[0186] In contrast, histological analysis from the control groups, those either treated with empty collagen or receiving no treatment, presented with negligible neobone formation and instead stained pink from fibrous connective tissue (
[0187] To further characterize how the modRNA-transfected BMSCs stimulated neobone formation, immunohistochemical (IHC) analysis was performed. Briefly, tissue sections were stained for osteocalcin (OCN) at 4 and 12 weeks post-surgery and treatment. Both the non-transfected control group as well as the acellular treatment group failed to provide positive staining for OCN at 4 weeks, with remote negligible expression of OCN at 12 weeks post-surgery. OCN was found to be up-regulated in the modBMP2 and BMP2+VEGF-A modRNA groups as early as 4 weeks post treatment, indicating efficient and effective osteogenic stimulation from these two treatment regimens. At 12 weeks post treatment, positive staining for OCN was observed in all the groups, however OCN activity increased significantly in the BMP2+VEGF-A modRNA group suggesting that this combination has higher osteogenic compatibility. Quantitative analysis further supported these findings (
[0188] Histological evaluation of CD31 revealed weak and inconsistent signals in the control and acellular treatment groups, indicating poor neovascularization following these treatments. The treatment groups exhibited positive staining of CD31 at 4 weeks and 12 weeks post-transplantation, with varying intensities. When quantified, significantly higher abundances of CD31.sup.+ blood vessels were found in the BMP2+VEGF-A modRNA group (
[0189] To investigate the potential of our modRNA-BMSC materials to act on genes that regulate or promote bone formation, RNA and protein was analyzed from regenerating bone tissue from all treatment groups (
Example 4Demonstration that BMP and VEGF-A Modified mRNA-Treated BMSCs Induce Favorable Osteo-Inductive Properties at Different Ratios, Over Recombinant Proteins In Vitro and In Vivo
[0190] To assess the osteo-inductive effects of BMSCs harboring two modRNAs at different ratios (one encoding human BMP-2 and the other encoding human VEGF-A), BMSCs isolated from rats were co-transfected with these modRNAs or treated with recombinant human proteins (rh proteins) of these genes. The transfected BMSCs were cultured in the absence of dexamethasone (a known osteogenic compound) where mineralization and calcium deposition was assessed together with gene expression profiles of known osteogenic markers. Later a composition including modRNA or rh protein-treated BMSCs together with a collagen fiber matrix were surgically implanted at the orthotopic site in rats following cranial defect surgery. The therapeutic potential of the composition was assessed by imaging the bone and staining the bone to quantify new bone growth and bone repair.
Methods
[0191] In vitro Assessment of Osteogenesis in the Absence of Dexamethasone
[0192] Alkaline phosphatase activity assay and staining was carried out after osteogenic induction culture for 7 days. Alizarin red staining and quantification was carried out to detect mineralization at 14 days post transfection. Molecular analysis for major osteogenic genes were carried out using qRT-PCR and western blotting at 7 days post transfection. BMSCs were treated with different ratios of modified mRNAs, namely 1:1 ratio of BMP-2 to VEGF-A (BV), a 3:1 ratio of BMP-2 to VEGF-A (3B1V), a 1:3 ratio of BMP-2 to VEGF-A (1B3V), or treated with recombinant human proteins, i.e., recombinant human protein BMP (rB), recombinant human protein VEGF (rV) or both (rBV), and compared against control groups which were either BMSCs transfected with an inert modRNA construct, Luciferase (Luc), or naive untreated BMSCs (ctrl).
[0193] Fabrication and Functionalization of Collagen Sponges
[0194] Collagen sponges were partially dissociated in 0.1 mol/L acetic acid and frozen at -80 C., then freeze-dried at 50 C. under a vacuum for 24 hours, subsequently cross-linked by 25 mM EDC and 25 mM NHS with 95% ethanol solution for 24 hours, thoroughly washed with 5 wt % glycine solution and distilled water three times, and freeze-dried a second time at 50 C. to obtain a collagen scaffold.
[0195] Preparation of Rat modRNA-BMSC/Scaffold Constructs and Surgical Procedures
[0196] The modRNA-transfected cells were trypsinized 4 hours post-transfection, centrifuged, and resuspended in osteoblast inducing conditional medium. The cells (510.sup.6 cells/ml) were evenly seeded into cross-linked collagen scaffold in the 48-well plate, 50 l/scaffold, thus 2.510.sup.5 cells/scaffold. Osteogenic medium was added after 4 hours of incubation at 37 C., and the BMSC/scaffold constructs were incubated overnight prior to implantation (Lo et al., Biomaterials, 124, 1-11 (2017)).
[0197] Eight week-old male Sprague Dawley rats were housed in an experimental animal house. Two weeks later, the rats were anesthetized by intraperitoneal injection of 10% chloral hydrate (4 mg/kg body weight). To expose the parietal bone adequately, a sagittal incision (1.8 cm) in the scalp was made and the pericranium was removed by gentle scraping. The skull was washed by sterile phosphate buffered solution (PBS). Two critical-sized (5 mm in diameter) defects were created on both sides of the sagittal suture on the parietal bone, without disturbing the underlying dura and superior sagittal sinus vein, using a sterile medical bone drill. The constructs were implanted into the defects and gently pressed. The incision was carefully closed in layers by a 5-0 biodegradable suture and a 6-0 silk thread.
[0198] Four treatment regimens were employed in this study, where defective areas received implants with one of the following: 1) BMSCs treated with modRNA encoding Luciferase-loaded into a collagen scaffold 2) BMSCs treated with modRNA encoding hBMP2:VEGFA(in a 3:1 ratio)-loaded into a collagen scaffold 3) BMSCs treated with modRNA encoding hBMP-2:VEGF-A (in a 1:3 ratio)-loaded into a collagen scaffold and 4) BMSCs treated with recombinant protein BMP-2+VEGFA (1:1) loaded into a collagen scaffold.
[0199] Micro Computed Tomography (CT)
[0200] Rats were sacrificed and the calvarial bones were removed at 4 weeks post-surgery, and n=3 samples per group were harvested. The samples were fixed in 4% paraformaldehyde for 24 h, and then were scanned using a SkyScan-1176 micro-computed tomography (CT) (Bruker micro CT, Belgium) system. Scans were performed using 17.93 m voxel size, 90 KV, 278 A and 0.5 degrees rotation step (180 degrees angular range). For bone analysis, micro-CT evaluation was performed on a 5 mm diameter circle, 1 mm height cylinder region in the defect area. The 1.6 version of NR econ software was used for 3D reconstruction and viewing of images. After 3D reconstruction, the 1.13 version of CT software was used for bone analysis. The index including directly measured bone volume (BV, mm.sup.3), tissue volume (TV, mm.sup.3), and the ratio BV/TV (%), were calculated for the bone formed in the defect area.
[0201] Histological and Immunohistochemical Staining
[0202] After CT scanning, the removed calvarial bones were decalcified with mild EDTA-decalcifier-solution (Boster Biological Technology Co., Ltd.), followed by paraffin embedding and sectioning. The sections (10 mm thick) from mid-defect regions were stained with H&E or subjected to Masson trichrome staining, which detects the collagen formation activity and is a sign of bone remodeling, that is, an essential process to complete bone healing. Briefly, the sections were deparaffined and rehydrated for immunohistochemical staining of osteocalcin (OCN) or CD31. The antigen retrieval was performed by incubation with trypsin for 20 minutes at 37 C. The primary antibodies used were mouse anti-rat OCN (1:150 dilution, abcam) or anti-CD31 MAb (1:200 dilution, Servicebio). The secondary antibody used was goat anti-mouse HRP-conjugated MAb (1:1000 dilution, Abcam). For Masson, OCN, and CD31 staining, the nuclei were stained with Gill Hematoxylin (Sigma) at the end of procedures according to the manufacturer's instructions.
[0203] Gene Expression Analysis by qRT-PCR
[0204] Newly formed bone tissues in the defect areas of the crania were sampled after the rats were euthanized 4 and 12 weeks after surgery. Total RNA was extracted from the bone tissue using a trizol reagent (Invitrogen, CA) according to the manufacturer's instructions. Then, the uniform real-time (RT) primer was used for the reverse transcription and quantitative RT-PCR was performed using a real-time thermal cycler (Stratagene Mx3000P QPCR System, CA, USA) and 2SYBR Green PCR master mix (EZBioscience, MN, USA).
[0205] Western Blot Analysis
[0206] Whole bone tissue isolations were extracted using a total protein lysis buffer. Tissue samples were lysed in RIPA lysis buffer (Sigma-Aldrich) containing a proteasome inhibitor (Beyotime) and then followed by western blot as previously described (El Rashidy et al., Acta Biomater., 2017 Oct. 15; 62:1-28). Finally, the target bands were acquired with an ECL Plus Western Blotting Detection System (GE Healthcare, IL, USA).
Results
[0207] Evaluation of osteo-inductive activity in the absence of dexamethasone was analyzed in BMSCs undergoing different modRNA or recombinant protein treatments. Microscopic evaluation showed increased ALP and calcium deposition stemming from the 3B1V (3:1 BMP to VEGF ratio) treatment group as well as the 1:1 (BV) treatment ratio as compared to control groups (Ctrl, Luc) and recombinant protein groups (single or double treatment groups i.e. rB, rV and rBV) (see
[0208] A collagen fiber matrix was loaded with modRNA-transfected or protein treated BMSCs and surgically implanted at the orthotropic site (as previously shown in
[0209] The combinatorial treatment of BMP2+VEGF-A modRNA at a ratio of 3:1 (3B1V) was most capable of generating new bone tissue deposition that partially filled the defect space as early as 4 weeks post-implantation, compared to the recombinant protein treatment groups, controls, and alternative ratios (i.e., 1B3V), (
[0210] Histological staining in the form of H&E and Masson's staining were performed to evaluate bone regeneration from the modRNA-treated or recombinant protein-treated BMSCs in collagen scaffolds at 4 weeks post-surgery and transplantation. The histological evaluation revealed that the 3B1V treatment group gave rise to distinct patterns of orthotopic bone tissue formation. Specifically, the 3B1V treatment gave rise to more bony union structure and the appearance of significantly more osteoblast-like cells in the underlying matrix (
[0211] In contrast, histological analysis from the control (Luciferase treated) group, and 1B3V ratio group presented with negligible neobone formation and instead stained pink from fibrous connective tissue (
[0212] Further, the 3B1V treatment group gave rise to more densely contained collagen fibers, an indication of more complete bone growth, as made evident by regions of dark blue Masson's staining (
[0213] To further characterize how the different ratios of BMP and VEGF modRNA-transfected BMSCs stimulated neobone formation, immunohistochemical (IHC) analysis was performed. Briefly, tissue sections were stained for osteocalcin (OCN) at 4 weeks post-surgery and treatment. Increased levels of OCN were verified in the 3B1V treatment group over controls and significantly higher than the 1B3V ratio group (
[0214] Both of the 3B1V and 1B3V treatment groups exhibited positive staining of CD31 at 4 weeks post-transplantation, with varying intensities (
[0215] To investigate the heightened potential of our modRNA-BMSC materials to act on genes that regulate or promote bone formation, RNA and protein were analyzed from regenerating bone tissue from these different modRNA ratio treatments and compared to those levels found from recombinant protein or control treatment groups (
[0216] Similarly, when assessing gene expression at the protein level of these osteogenic marker genes, again significant increases in gene expression were noted from the 3B1V treatment group compared with the 1B3V group as well as the modLuc and recombinant protein control groups (
Other Embodiments
[0217] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.