METHOD FOR DETECTING GUT MICROORGANISM IN A SAMPLE USING NORMAL GUT FLORA AS INTERNAL CONTROL

20210071228 ยท 2021-03-11

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a method for detecting a nucleic acid of a gut microorganism in a sample using a nucleic acid of a bacterium as an internal control nucleic acid selected from a normal gut flora, and to a composition for nucleic acid amplification used in the method. The internal control according to the present invention is present in the sample from the beginning, and thus there is no inconvenience of separately adding an internal control after the sample collection process, and may be used as an internal control for the sample collection process, an internal control for the nucleic acid extraction process, and an internal control for the nucleic acid amplification process. In addition, the presence or absence of the nucleic acid of the gut microorganism in the sample may be detected with a high accuracy through the minimization of false negative and false-positive determinations by using the nucleic acid of the bacterium as the internal control selected from the normal gut flora.

    Claims

    1. A method for detecting a nucleic acid of a gut microorganism in a sample using a nucleic acid of a bacterium as an internal control nucleic acid selected from a normal gut flora, the method comprising: collecting and preparing the sample; performing an amplification reaction of a nucleic acid in the sample using (i) a pair of primers for amplifying the nucleic acid of the gut microorganism; and (ii) a pair of primers for amplifying the nucleic acid of the bacterium as the internal control nucleic acid selected from the normal gut flora; detecting a resultant of the amplification reaction; determining a validity of the amplification reaction of the nucleic acid of the gut microorganism by using a resultant of the amplification reaction of the internal control nucleic acid; and determining whether the nucleic acid of the gut microorganism is present or not in the sample by (i) the determined validity and (ii) the resultant of the amplification reaction of the nucleic acid of the gut microorganism.

    2. The method according to claim 1, wherein the preparation of the sample comprises extracting nucleic acids from the sample.

    3. The method according to claim 2, wherein the nucleic acid of the bacterium selected from the normal gut flora is used as an internal control nucleic acid for the steps of collecting the sample, extracting the nucleic acids from the sample and/or amplifying the extracted nucleic acids.

    4. (canceled)

    5. (canceled)

    6. The method according to claim 1, wherein the resultant of the amplification reaction of the nucleic acid of the gut microorganism is determined to be invalid when the internal control nucleic acid is not detected.

    7. The method according to claim 1, wherein the normal gut flora is a human normal gut flora.

    8. The method according to claim 1, wherein the bacterium selected from the normal gut flora is Bacteroides spp. or Lactobacillus spp.

    9. The method according to claim 1, wherein the nucleic acid of the bacterium selected from the normal gut flora comprises a nucleotide sequence encoding 16s rRNA.

    10. The method according to claim 1, wherein the sample is a rectal swab sample, a stool sample, or a urine sample.

    11. The method according to claim 1, wherein the detecting of the resultant of the amplification reaction is performed in a post-amplification detection manner or in a real-time detection manner.

    12. The method according to claim 1, wherein the amplification reaction further comprises (i) a probe for detecting the nucleic acid of the gut microorganism; and (ii) a probe for detecting the nucleic acid of the bacterium selected from the normal gut flora.

    13. The method according to claim 12, wherein the pair of primers or the probe for the nucleic acid of the bacterium selected from the normal gut flora comprises a nucleotide sequence that specifically hybridizes with a nucleotide sequence selected from the group consisting of the sequences of SEQ ID NO:1 and 2 and complementary sequences thereof.

    14. The method according to claim 1, wherein the amplification reaction is performed by a fast PCR method.

    15. The method according to claim 1, wherein the gut microorganism is a drug-resistant gut microorganism.

    16. A composition for amplifying a nucleic acid of a gut microorganism in a sample using a nucleic acid of a bacterium as an internal control nucleic acid selected from a normal gut flora, the composition comprising: (i) a pair of primers for amplifying the nucleic acid of the gut microorganism; and (ii) a pair of primers for amplifying the nucleic acid of the bacterium selected from the normal gut flora.

    17. The composition according to claim 16, wherein the nucleic acid of the bacterium selected from normal gut flora is used as an internal control nucleic acid for the steps of collecting the sample, extracting nucleic acids from the sample and/or amplifying the extracted nucleic acids.

    18. The composition according to claim 16, wherein the normal gut flora is a human normal gut flora.

    19. The composition according to claim 16, wherein the bacterium selected from the normal gut flora is Bacteroides spp. or Lactobacillus spp.

    20. The composition according to claim 16, wherein the nucleic acid of the bacterium selected from the normal gut flora comprises a nucleotide sequence encoding 16s rRNA.

    21. The composition according to claim 16, wherein the composition further comprises (i) a probe for detecting the nucleic acid of the gut microorganism; and (ii) a probe for detecting the nucleic acid of the bacterium selected from the normal gut flora.

    22. The composition according to claim 21, wherein the pair of primers or the probe for the nucleic acid of the bacterium selected from the normal gut flora comprises a nucleotide sequence that specifically hybridizes with a nucleotide sequence selected from the group consisting of the sequences of SEQ ID No: 1, SEQ ID No: 2 and complementary sequences thereof.

    23. The composition according to claim 16, wherein the gut microorganism is a drug-resistant gut microorganism.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0120] FIG. 1 shows SEQ ID NO: 1 and SEQ ID NO: 2.

    [0121] FIG. 2a shows Ct values as detection results of nucleic acids of Lactobacillus spp. and HBB for 24 rectal swab samples collected using eNAT.

    [0122] FIG. 2b shows Ct values as detection results of nucleic acids of Lactobacillus spp. and HBB for 48 rectal swab samples collected using Fecal Swab.

    [0123] FIG. 2c shows the detection rates (%) and average Ct values of nucleic acids of Lactobacillus spp. and HBB according to the results shown in FIGS. 1a and 1b.

    [0124] FIG. 3a shows Ct values as detection results of nucleic acids of Bacteroides spp. and HBB for 32 rectal swab samples.

    [0125] FIG. 3b shows Ct values as detection results of nucleic acids of Bacteroides spp. and HBB for 40 rectal stool samples.

    [0126] FIG. 3c shows the detection rates (%) and average Ct values of nucleic acids of Bacteroides spp. and HBB according to the results shown in FIGS. 2a and 2b.

    [0127] FIG. 4 shows the detection results in VanR positive sample and VanR negative samples employing the detection method according to the present invention using a nucleic acid of Lactobacillus spp. as an internal control.

    [0128] FIG. 5 shows the detection results in VanR positive sample and VanR negative samples employing the detection method according to the present invention using a nucleic acid of Bacteroides spp. as an internal control.

    [0129] Hereinafter, the present invention will be described in detail with reference to examples. It would be obvious to those skilled in the art that these examples are intended to be more concretely illustrative and the scope of the present invention as set forth in the appended claims is not limited to or by the examples.

    EXAMPLES

    Example 1: Confirmation of Detection Rates of Normal Gut Flora in Various Samples

    [0130] The present inventors investigated whether nucleic acids of Lactobacillus spp. and Bacteroides spp., which are bacteria selected from a normal gut flora, may be used as internal control nucleic acids in the gut microorganism detection method using nucleic acid amplification.

    [0131] To this end, the present inventors checked the detection rates of nucleic acids of Lactobacillus spp. and Bacteroides spp. in samples collected from a plurality of persons, and compared the checked detection rates with the detection rate of human beta globin (HBB) gene used as a conventional endogenous internal control.

    Example 1-1: Preparation of Oligonucleotides

    [0132] As target nucleic acids of Lactobacillus spp. and Bacteroides spp., nucleic acids encoding 16s rRNAs thereof were used. The detection of the nucleic acids employed the TOCE technique whereby a plurality of targets may be detected using signals by duplexes formed depending on the presence of target nucleic acid sequences (WO 2012/096523).

    [0133] Sequences of pairs of primers for detecting target nucleic acids encoding 16s rRNAs of Lactobacillus spp. and Bacteroides spp., probing and tagging oligonucleotide (PTO), and capturing and templating oligonucleotide (CTO) are shown in Table 1. For HBB, a pair of primers for HBB detection (5-globin (human) primer set (Cat. No. 3868; TAKARA)) and PTO and CTO designed based on the pair of primers were used.

    TABLE-US-00001 TABLE1 <Example1-1>Oligonucleotidesofcompositionfor nucleicacidamplification SEQ Oligo- Normalgut ID nucleotide flora NO type Sequence(5-3) Lactobacillus 3 Forward CTTGAGTGCAGAAGAGGASAGTG spp. primer Lactobacillus 4 Reverse CRGCACTGAGAGGCGGAAAC spp. primer Lactobacillus 5 PTO GTCGACAGTAGGGGTCTGYAACTGACGCTGAGGCTC spp. [C3spacer] Lactobacillus 6 CTO [BHQ-2] spp. TTTTATTTATTTTTTTTTTT[T(Quasar670)] TCACCCCTACTGTCGAC[C3spacer] Bacteroides 7 Forward GGGGATGCGTTCCATTAG Spp. primer Bacteroides 8 Reverse CAATATTCCTCACTGCTGCC Spp primer Bacteroides 9 PTO CATAGGGTTGGCGGGTTCTGAGAGGAAGGTCCCCCAC Spp [C3spacer] Bacteroides 10 CTO [BHQ-2] Spp TTTTATTTATTTATTTTTTT[T(Quasar670)] TTCCCGCCAACCCTATG[C3spacer]

    Example 1-2: Comparison of Detection Rates Between Lactobacillus spp. and HBB

    [0134] The extraction of nucleic acids was performed using the extraction automation equipment Microlab NIMBUS IVD (Cat. No. 65415-02, Hamilton) and the extraction reagent STARMag 96X4 Universal Cartridge Kit (Cat. No. 744300.4.UC384, Seegene Inc.) for 24 rectal swab samples collected using eNAT (eNAT PM 2ML REGULAR APPLICATOR; Copan) and 48 rectal swab samples collected using Fecal Swab (Cat. No. 480CE; Copan) for sexually transmitted disease testing or gut-related disease testing. Each sample for nucleic acid extraction was used in a volume of 200 l, and an eluent was used in a volume of 100 l. The obtained nucleic acid extract was used for real-time polymerase chain reaction.

    [0135] Taq DNA polymerase having 5-nuclease activity was used for the extension of forward and reverse primers, the cleavage of PTO, and the extension of CTO.

    [0136] For the comparison of detection rates between the target nucleic acid of Lactobacillus spp. and the HBB gene in the nucleic acid extract obtained from the same sample, two tubes each containing 5 l of the nucleic acid extract were prepared. In a first tube (tube 1) of the two tubes were placed 4 pmol of the forward primer (SEQ ID NO: 3) and 4 pmol of the reverse primer (SEQ ID NO: 4) for amplifying a target nucleic acid encoding Lactobacillus spp. 16s rRNA, 4 pmol of PTO (SEQ ID NO: 5), and 1 pmol of CTO (SEQ ID NO: 6), and in a second tube (tube 2) of the two tubes were placed oligonucleotides (forward and reverse primers, PTO, and CTO) for HBB detection in the same amounts as the oligonucleotides for Lactobacillus spp. detection. In each of the two tubes, 5 l of 4enzyme mixture [ultimately 3.2 mM dNTPs, 3.2 mM MgCl.sub.2, and 4U Taq DNA polymerase] and 5 l of 4enzyme buffer [ultimately 0.04% BSA] were added to prepare a reaction mixture with a final volume of 20 l. The prepared reaction mixtures were used to perform real-time PCR. The tubes containing the reaction mixtures were placed in a real-time thermocycler (CFX96, Bio-Rad), and then the reaction mixtures were subjected to denaturation at 90 C. for 15 min followed by 45 cycles of 10 sec at 95 C. 15 sec at 60 C. and 10 sec at 72 C. The detection of signals was performed at 60 C. every cycle.

    [0137] As a result, it was confirmed as shown in FIGS. 2a-2c that the detection rate was 100% for Lactobacillus spp. and 95.83% for HBB in the rectal swab samples collected using eNAT, and the detection rate was 97.92% for Lactobacillus spp. and 70.83% for HBB in the rectal swab samples collected using Fecal Swab. It was also confirmed that the average Ct value of Lactobacillus spp. was 27.36 for the rectal swab samples collected using eNAT and 29.07 for the rectal swab samples collected using Fecal Swab, whereas the average Ct value of HBB was 35.59 for the rectal swab samples collected using eNAT and 33.23 for the rectal swab samples collected using Fecal Swab, and thus the average Ct value of Lactobacillus spp. was lower than the average Ct value of HBB.

    [0138] These results mean that the nucleic acid of Lactobacillus spp., as an internal control, has an excellent detection rate at a more stable level (that is, having a lower Ct value than HBB) compared with the HBB gene, indicating that the nucleic acid of Lactobacillus spp. can be more favorably used as an internal control than the HBB gene, which is generally frequently used as an internal control.

    Example 1-3: Comparison of Detection Rates Between Bacteroides spp. and HBB

    [0139] The extraction of nucleic acids was performed using the extraction automation equipment Microlab NIMBUS IVD (Cat. No. 65415-02, Hamilton) and the extraction reagent STARMag 96X4 Universal Cartridge Kit (Cat. No. 744300.4.UC384, Seegene Inc.) for 40 stool samples and 42 rectal swab samples (collected using Fecal Swab) for sexually transmitted disease testing or gut-related disease testing. The stool samples were additionally subjected to a pretreatment step, and for the pretreatment of the stool samples, about 100-200 mg of stool was disintegrated in 1 mL of ASL buffer (Cat. No. 19082, Qiagen), followed by being incubation at room temperature for 10 min, and then a supernatant obtained by centrifugation at 20,000g (14,000 rpm) for 2 min was used. Each sample for nucleic acid extraction was used in a volume of 200 l, and an eluent was used in a volume of 100 l for the rectal swab samples and 50 l for the stool samples. The obtained nucleic acid extract was used for real-time polymerase chain reaction.

    [0140] Taq DNA polymerase having 5-nuclease activity was used for the extension of forward and reverse primers, the cleavage of PTO, and the extension of CTO.

    [0141] For the comparison of detection rates between the target nucleic acid of Bacteroides spp. and the HBB gene in the nucleic acid extract obtained from the same sample, two tubes each containing 5 l of the nucleic acid extract were prepared. In a first tube (tube 1) of the two tubes were placed 4 pmol of the forward primer (SEQ ID NO: 7) and 4 pmol of the reverse primer (SEQ ID NO: 8) for amplifying a target nucleic acid encoding Bacteroides spp. 16s rRNA, 4 pmol of PTO (SEQ ID NO: 9), and 1 pmol of CTO (SEQ ID NO: 10), and in a second tube (tube 2) of the two tubes were placed oligonucleotides (forward and reverse primers, PTO, and CTO) for HBB detection in the same amounts as the oligonucleotides for Bacteroides spp. detection. In each of the two tubes, 5 l of 4enzyme mixture [ultimately 3.2 mM dNTPs, 3.2 mM MgCl.sub.2, and 4U Taq DNA polymerase] and 5 l of 4enzyme buffer [ultimately 0.04% BSA] were added to prepare a reaction mixture with a final volume of 20 l. The prepared reaction mixtures were used to perform real-time PCR. The tubes containing the reaction mixtures were placed in a real-time thermocycler (CFX96, Bio-Rad), and then the reaction mixtures were subjected to denaturation at 90 C. for 15 min followed by 45 cycles of 10 sec at 95 C. 15 sec at 60 C. and 10 sec at 72 C. The detection of signals was performed at 60 C. every cycle.

    [0142] As a result, as shown in FIGS. 3a-3c, for the rectal swab samples, the detection rate of Bacteroides spp. was 90.6% and the average Ct value therefor was 23.30, and the detection of HBB was 78.1% and the average Ct value thereof was 31.91. For the stool samples, the detection rate of Bacteroides spp. was 80% and the average Ct value therefor was 19.01 and the detection of HBB was 85%, which was somewhat higher than that of Bacteroides spp., but the average Ct value therefor was 34.72, which was higher than that of Bacteroides spp.

    [0143] These results mean that the nucleic acid of Bacteroides spp., as an internal control, also has an excellent detection rate at a more stable level (that is, having a lower Ct value than HBB) compared with the HBB gene, indicating that the nucleic acid of Bacteroides spp. can be more favorably used as an internal control than the HBB gene, which is generally frequently used as an internal control.

    Example 2: Use of Normal Gut Flora as Internal Control

    [0144] The present inventors detected, as internal controls, nucleic acids of Lactobacillus spp. and Bacteroides spp., which are bacteria selected from a normal gut flora, together with the detection of a nucleic acid of a gut microorganism.

    [0145] The present inventors detected vancomycin resistant Enterococci (VRE) as gut microorganisms, and used the oligonucleotides contained in Anyplex VanR Real-time Detection product (Seegene Inc., Korea) as the oligonucleotides for detecting a nucleic acid of vancomycin resistant Enterococci and the same oligonucleotides as used in example 1 above as the oligonucleotides for detecting an internal control nucleic acid.

    Example 2-1: Use of Lactobacillus Spp. as Internal Control

    [0146] For objectivity and clarity of the present test, rectal swab samples, diagnosis results of which were confirmed for the presence or absence of vancomycin resistant Enterococci (VRE) by performing a phenotypic antibiotic susceptibility test, which is a gold standard method for drug resistance, and single PCR, were collected and used.

    [0147] The extraction of nucleic acids from the collected rectal swab samples was performed using the extraction automation equipment Microlab NIMBUS IVD (Cat. No. 65415-02, Hamilton) and the extraction reagent STARMag 96X4 Universal Cartridge Kit (Cat. No. 744300.4.UC384, Seegene Inc.). Each sample for nucleic acid extraction was used in a volume of 200 l, and an eluent was used in a volume of 100 l. The obtained nucleic acid extract was used for real-time polymerase chain reaction.

    [0148] Taq DNA polymerase having 5-nuclease activity was used for the extension of forward and reverse primers, the cleavage of PTO, and the extension of CTO.

    [0149] For 5 l of each of the nucleic acid extracts obtained from samples confirmed for the presence of vancomycin resistant Enterococci and samples confirmed for the absence of vancomycin resistant Enterococci, (i) 4 pmol of the forward primer (SEQ ID NO: 3) and 4 pmol of the reverse primer (SEQ ID NO: 4) for amplifying a target nucleic acid encoding Lactobacillus spp. 16s rRNA, 4 pmol of PTO (SEQ ID NO: 5), and 1 pmol of CTO (SEQ ID NO: 6), and (ii) oligonucleotides (forward and reverse primers, PTO, and CTO) for detecting the nucleic acid of vancomycin resistant Enterococci in the same amounts as the oligonucleotides for Lactobacillus spp. were added, and 5 l of 4enzyme mixture [ultimately 3.2 mM dNTPs, 3.2 mM MgCl.sub.2, and 4U Taq DNA polymerase] and 5 l of 4enzyme buffer [ultimately 0.04% BSA] were added, to prepare reaction mixtures with a final volume of 20 l. The prepared reaction mixtures were used to perform real-time PCR. The tubes containing the reaction mixtures were placed in a real-time thermocycler (CFX96, Bio-Rad), and then the reaction mixtures were subjected to denaturation at 95 C. for 15 min followed by 45 cycles of 10 sec at 95 C., 15 sec at 60 C., and 10 sec at 72 C. The detection of signals was performed at 60 C. every cycle.

    [0150] As a result, as shown in FIG. 4, the nucleic acid of vancomycin resistant Enterococci (Ct value: 29.08) and the nucleic acid of Lactobacillus spp. (Ct value: 20.56) were detected for the samples confirmed for the presence of vancomycin resistant Enterococci.

    [0151] However, the nucleic acid of vancomycin resistant Enterococci and the nucleic acid of Lactobacillus spp. were not detected for the samples confirmed for the absence of vancomycin resistant Enterococci. The non-detection of the internal control indicates that there was a problem in the sample collection process, the nucleic acid extraction process, or the nucleic acid amplification process, and as a result of carrying out an aerobic culture of the corresponding samples, it was confirmed that there was no bacteria growing in media. This indicates that the collection has not been normally executed in the sample collection process, and since the internal control nucleic acid was not detected, the target nucleic acid detection result may be determined to be an invalid result.

    [0152] These test results verify that the nucleic acid of Lactobacillus spp. can be favorably used as an internal control in the procedure of detecting vancomycin resistant Enterococci.

    Example 2-2: Use of Bacteroides Spp. as Internal Control

    [0153] For objectivity and clarity of the present test, rectal swab samples, of which diagnosis results were confirmed for the presence or absence of vancomycin resistant Enterococci (VRE) by performing a phenotypic antibiotic susceptibility test, which is a gold standard method for drug resistance, and single PCR, were collected and used.

    [0154] The extraction of nucleic acids from the collected rectal swab samples was performed using the extraction automation equipment Microlab NIMBUS IVD (Cat. No. 65415-02, Hamilton) and the extraction reagent STARMag 96X4 Universal Cartridge Kit (Cat. No. 744300.4.UC384, Seegene). Each sample for nucleic acid extraction was used in a volume of 200 l, and an eluent was used in a volume of 100 l. The obtained nucleic acid extract was used for real-time polymerase chain reaction.

    [0155] Taq DNA polymerase having 5-nuclease activity was used for the extension of forward and reverse primers, the cleavage of PTO, and the extension of CTO.

    [0156] For 5 l of each of the nucleic acid extracts obtained from samples confirmed for the presence of vancomycin resistant Enterococci and samples confirmed for the absence of vancomycin resistant Enterococci, (i) 4 pmol of the forward primer (SEQ ID NO: 7) and 4 pmol of the reverse primer (SEQ ID NO: 8) for amplifying a target nucleic acid encoding Bacteroides spp. 16s rRNA, 4 pmol of PTO (SEQ ID NO: 9), and 1 pmol of CTO (SEQ ID NO: 10), and (ii) oligonucleotides (forward and reverse primers, PTO, and CTO) for detecting the nucleic acid of vancomycin resistant Enterococci in the same amounts as the oligonucleotides for Bacteroides spp. were added, and 5 l of 4enzyme mixture [ultimately 3.2 mM dNTPs, 3.2 mM MgCl.sub.2, and 4U Taq DNA polymerase] and 5 l of 4enzyme buffer [ultimately 0.04% BSA] were added, to prepare reaction mixtures with a final volume of 20 l. The prepared reaction mixtures were used to perform real-time PCR. The tubes containing the reaction mixtures were placed in a real-time thermocycler (CFX96, Bio-Rad), and then the reaction mixtures were subjected to denaturation at 95 C. for 15 min followed by 45 cycles of 10 sec at 95 C., 15 sec at 60 C., and 10 sec at 72 C. The detection of signals was performed at 60 C. every cycle.

    [0157] As a result, as shown in FIG. 5, the nucleic acid of vancomycin resistant Enterococci (Ct value: 34.26) and the nucleic acid of Bacteroides spp. (Ct value: 22.9) were detected for the samples confirmed for the presence of vancomycin resistant Enterococci.

    [0158] However, the nucleic acid of vancomycin resistant Enterococci and the nucleic acid of Bacteroides spp. were not detected for the samples confirmed for the absence of vancomycin resistant Enterococci. The non-detection of the internal control indicates that there was a problem in the sample collection process, the nucleic acid extraction process, or the nucleic acid amplification process, and as a result of carrying out an aerobic culture of the corresponding samples, it was confirmed that there was no bacteria growing in media. This indicates that the collection has not been normally executed in the sample collection process, and since the internal control nucleic acid was not detected, the target nucleic acid detection result may be determined to be an invalid result.

    [0159] These results verify that the nucleic acid of Bacteroides spp. can be favorably used as an internal control in the procedure of detecting vancomycin resistant Enterococci.

    [0160] Therefore, it can be seen from the above test results that nucleic acids from a normal gut flora, such as Lactobacillus spp. and Bacteroides spp., can be favorably used as internal controls in the gut microorganism detection method using nucleic acid amplification.

    [0161] Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.