TRANSGENIC SILKWORMS EXPRESSING HAGFISH THREAD KERATIN
20210047655 ยท 2021-02-18
Inventors
Cpc classification
A01K2217/07
HUMAN NECESSITIES
A01K2267/01
HUMAN NECESSITIES
C07K14/78
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
A01K2227/706
HUMAN NECESSITIES
C12N15/90
CHEMISTRY; METALLURGY
A01K67/0339
HUMAN NECESSITIES
International classification
Abstract
Transgenic silkworms stably expressing hagfish thread keratin genes or composite silkworm/hagfish thread keratin genes are disclosed. The exogenous hagfish thread keratin genes are stably integrated into a defined site of the fibroin heavy chain intron or a fibroin light chain intron of silkworms. Synthetic hagfish thread keratin proteins and composite hagfish thread keratin-silkworm genes and proteins are provided. The expression of exogenous hagfish thread keratin genes is driven by the endogenous fibroin heavy chain promoter, improving the genetic stability of transgenic silkworms. The composite silkworm/hagfish thread keratin fibers exhibit exceptional mechanical performance, compared to normal silkworm silk fibers and other transgenic silkworm fibers.
Claims
1. A transgenic silkworm comprising an exogenous hagfish thread keratin gene operably linked to an endogenous silkworm promoter.
2. The transgenic silkworm of claim 1, wherein the exogenous synthetic hagfish thread keratin gene is stably integrated.
3. The transgenic silkworm of claim 1, wherein the exogenous hagfish thread keratin gene is operably linked to an endogenous silkworm promoter in the silkworm gland.
4. The transgenic silkworm of claim 1, wherein the exogenous hagfish thread keratin gene is greater than about four kilobases (4 kb) in length.
5. The transgenic silkworm of claim 1, wherein the exogenous hagfish thread keratin gene is greater than about six kilobases (6 kb) in length.
6. The transgenic silkworm of claim 1, wherein the transgenic silkworm stably expresses the hagfish thread keratin gene.
7. The transgenic silkworm of claim 1, wherein the exogenous hagfish thread keratin gene is stably integrated in the intron of a fibroin heavy chain gene, FibH.
8. The transgenic silkworm of claim 7, wherein the exogenous hagfish thread keratin gene is stably integrated in a first intron of the fibroin heavy chain gene, FibH.
9. The transgenic silkworm of claim 1, wherein the exogenous hagfish thread keratin gene is stably integrated in an intron of a fibroin light chain gene, FibL.
10. The transgenic silkworm of claim 9, wherein the exogenous hagfish thread keratin gene is stably integrated in a sixth intron of the fibroin light chain gene, FibL.
11. The transgenic silkworm of claim 1, wherein the endogenous silkworm promoter is the silkworm-specific FibL promoter.
12. The transgenic silkworm of claim 1, wherein the exogenous hagfish thread keratin gene comprises a gene encoding Eptatretus stoutii thread keratin or a gene encoding Eptatretus stoutii thread keratin .
13. The transgenic silkworm of claim 1, wherein the exogenous hagfish thread keratin gene comprises SEQ ID NO: 1, SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 2 or a fragment of either thereof.
14. The transgenic silkworm of claim 1, wherein the transgenic silkworm is Bombyx sp or Bombyx mori.
15. A progeny silkworm of the transgenic silkworm of claim 1, wherein the exogenous hagfish thread keratin gene is stably integrated.
16. An isolated nucleic acid comprising a hagfish thread keratin gene, the isolated nucleic acid comprising SEQ ID NO: 1, SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 2 or a fragment of either thereof, operably linked to an endogenous silkworm promoter.
17. The isolated nucleic acid of claim 16, wherein the isolated nucleic acid comprises SEQ ID NO: 1 or SEQ ID NO: 2.
18. A composition comprising: a protein encoded by the isolated nucleic acid of claim 16; and silkworm protein.
19. A vector comprising the isolated nucleic acid of claim 16.
20. A method for producing a transgenic silkworm, the method comprising: introducing a hagfish thread keratin gene into a defined site of the silkworm genome using a CRISPR/Cas9 system, such that the hagfish thread keratin gene is operably linked to an endogenous silkworm promoter, wherein the exogenous nucleic acid is stably integrated into the silkworm genome, the silkworm genome comprising a silkworm fibroin light chain gene, FibL and a silkworm fibroin heavy chain gene, FibH.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0017] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0018] A detailed description of the invention is hereafter provided with specific reference being made to the drawings in which:
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION
[0026] Various aspects are described below with reference to the drawings. The relationship and functioning of the various elements of the aspects may better be understood by reference to the following detailed description. However, aspects are not limited to those illustrated in the drawings or explicitly described below. It should be understood that the drawings are not necessarily to scale, and in certain instances details may have been omitted that are not necessary for an understanding of aspects disclosed herein, such as conventional fabrication and assembly. Headings are provided for the convenience of the reader and to assist organization of the disclosure and should not be construed to limit or otherwise define the scope of the invention.
[0027] The silkworm Bombyx mori or Bombyx mandarina can be used as a platform for producing recombinant silkworm/spider silk fibers. B. mori has a similar natural fiber spinning process to that of spiders, is a prolific silk producer, and can be farmed commercially. In some aspects, therefore, the silkworm is Bombyx mori.
[0028] In the silk gland, micellar-like structures are formed because of the aggregation of the silk proteins under a remarkably high concentration, and then -sheet crystals are formed due to shear forces imposed as the protein liquid flows along the duct. The protein structure in the fiber occurs as the fiber is pulled out of the spigot of the spider or the mouth of the silkworm, further increasing the shear stress.
[0029] In one aspect, the disclosure provides transgenic silkworms stably expressing hagfish thread keratin genes or composite hagfish thread keratin-silkworm genes.
[0030] As used herein, the term hagfish thread keratin gene is understood to include a gene sequence or resulting gene expression product (e.g., protein) that encompasses some or all of the native gene sequence or gene expression product, but is removed or otherwise isolated from its native host. As such, a hagfish thread keratin gene is understood to include a DNA sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the native hagfish thread keratin gene over at least a 20 base pair (bp) contiguous segment of the gene or that produces a gene expression product having at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% protein sequence identity with the native hagfish thread keratin protein over at least a 20 amino acid contiguous segment of the protein. The hagfish thread keratin gene can be referred to as a synthetic gene. The term synthetic may be used herein interchangeably with the terms exogenous or transgenic, particularly when describing a synthetic gene sequence that is derived from an organism different from its current host.
[0031] In some aspects, transgenically-produced hagfish thread keratin or composite hagfish thread keratin-silkworm silk reflects about 10-15% of the total silk production by the silkworm. In other aspects, transgenically-produced hagfish thread keratin or composite hagfish thread keratin-silkworm silk reflects over 15%, over 20%, over 25%, over 30%, over 35%, over 40%, over 45%, over 50%, over 55%, over 60%, over 65%, over 70%, over 75%, over 80%, over 85%, over 90%, over 95%, over 99%, or about 100% of the total silk production by the silkworm.
[0032] In this respect, the engineered hagfish thread keratin may substantially replace endogenous production of one or more of the silkworm's own silk-associated proteins, such as the silkworm fibroin protein.
[0033] It is understood that the protein fibroin, including the fibroin heavy chain and fibroin light chain, is the core protein component of silk in silkworms. Thus, the terms fibroin or silk protein may in some cases be used interchangeably herein with reference to silk, as appropriate.
[0034] The limitations of prior technology have made it difficult to produce transgenic silkworms that stably integrate a transgene larger than about 3 kb in length in silkworms. In some aspects, a transgenic silkworm is disclosed, the transgenic silkworm having a stably-integrated hagfish thread keratin gene. In some aspects, the hagfish thread keratin gene may be greater than about three kilobases (3 kb) in length. In certain embodiments, the stably-integrated hagfish thread keratin gene is greater than about 4 kb in length; greater than about 5 kb in length; or greater than about 6 kb in length.
[0035] As used herein, the term stably integrated means that the introduced transgenic material is capable of successfully passing through cell division to daughter cells and/or offspring, for example, into the second generation, third generation, etc., without substantial change in sequence or the transgenic material being lost. Thus, in some aspects, a stably integrated transgene is present in the first generation, second generation, third generation, etc. of a transgenic silkworm (i.e., in progeny). In certain aspects, the stably integrated transgene is expressed in the first generation, second generation, third generation, etc. of a transgenic silkworm (i.e., in progeny).
[0036] It is also understood that stable integration of an exogenous nucleotide sequence into a host gene, such as through a CRISPR/Cas9 mediated knock-in system, may produce a composite (i.e., hybrid) gene including both exogenous and endogenous nucleic material. Thus, in some aspects, a transgenic silkworm is disclosed, the transgenic silkworm having a composite hagfish thread keratin-silkworm gene.
[0037] It is further understood that expression of such a composite gene sequence may produce a composite (i.e., hybrid or fusion) protein or proteins. Thus, in some aspects, a transgenic silkworm is disclosed that stably expresses a hagfish thread keratin gene or a composite/hybrid hagfish thread keratin-silkworm gene.
[0038] In embodiments, integrated genes are expressed under control (i.e., operably linked) of an endogenous promoter in the silkworms. In some aspects, a hagfish thread keratin gene is operably linked to an endogenous promoter. For example, exogenous hagfish genetic material may be introduced into the single intron of the silkworm fibroin heavy chain gene, FibH, with stable expression of the integrated transgene driven by an endogenous promoter. In another example, exogenous hagfish genetic material may be introduced into any of the six introns of the silkworm fibroin light chain gene, FibL, with stable expression of the integrated transgene driven by an endogenous promoter. Expression of Eptatretus stoutii thread keratin or Eptatretus stoutii thread keratin in silkworm, driven by an endogenous fibroin promoter, appears to improve genetic stability in transgenic silkworms. In specific aspects, the endogenous silkworm promoter is the silkworm-specific FibH or FibL promoter.
[0039] In some aspects, the exogenous hagfish thread keratin gene may comprise the Eptatretus stoutii thread keratin gene (SEQ ID NO: 1 or SEQ ID NO: 47), Eptatretus stoutii thread keratin (SEQ ID NO: 2 or SEQ ID NO: 48), or synthetic variants thereof.
[0040] The disclosed hybrid proteins may be larger and more stable than previous transgenic silk proteins. In embodiments, the transgenic hagfish thread keratin proteins and/or composite hagfish thread keratin-silkworm silk proteins have mechanical properties comparable to or superior to natural hagfish thread keratin.
[0041] A silk composition is provided that may include a hagfish thread keratin proteins and/or composite hagfish thread keratin-silkworm silk proteins. In other aspects, a vector is provided that may include a hagfish thread keratin gene operably linked to an endogenous silkworm promoter.
[0042] In one aspect, methods are disclosed for producing transgenic silkworms. Current genome editing technologies facilitate introducing site-specific modifications in the genomes of cells and organisms and provide a means to deliver exogenous genes at precise target sites in silkworms. Preliminary applications of the latest genomic editing technologies such as zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeat (CRISPR) system in silkworms have mostly focused on the silkworm phenotype gene (BmBLOS2) or the non-phenotype gene (Bmku70). For example, researchers disrupted the fibroin heavy chain (FibH) gene of silkworm glands using a customized ZFN. Applications of these genome editing techniques in silkworms are generally limited to the knockout phase, however.
[0043] Thus, in some aspects, a hagfish thread keratin gene and/or composite hagfish thread keratin-silkworm silk gene is expressed in the silk gland of a silkworm. In other embodiments, a hagfish thread keratin gene and/or composite hagfish thread keratin-silkworm silk gene is expressed in other tissues or organs of a silkworm.
[0044] The CRISPR/Cas9 system has been used in different research models, including insect cells, plants and human cells. The advantages of this system are the relatively easy production and design of constructs, time-saving production of transgenic organisms, and binding stability to the genomic DNA.
[0045] CRISPR has two components: a guide RNA (gRNA) and a non-specific CRISPR-associated endonuclease (Cas9). CRISPR creates DNA double strand breaks (DSBs) at a defined position in a chromosome. The Cas9-mediated DSBs can be spontaneously repaired via the independent pathway of homology-directed repair (HDR) or non-homologous, end-joining (NHEJ).
[0046] The homologous recombination-mediated knock-in system has been the preferred technology to introduce foreign genes into desired hosts. For example, using the CRISPR/Cas9 system, an exogenous DNA fragment has been added through precise and controlled homologous recombination (HR) repair systems in Caenorhabditis elegans. One limitation of this approach is that it is difficult to incorporate large DNA fragments into the target organism.
[0047] Nonhomologous end-joining (NHEJ), which acts independently of the HR pathway(s), is highly efficient. For example, a 15 kb inducible gene expression cassette has been introduced at a defined locus in human cell lines using NHEJ. But NHEJ is associated with potentially damaging nucleotide insertions and deletions (indels) and/or substitutions in the DSB region, which can reduce transgene stability and expression.
[0048] Thus, in some aspects, the CRISPR/Cas9 system employs non-homologous recombination (end-joining) to facilitate introduction of large exogenous nuclear material, while targeting an integration site that is not affected by adjacent mutations.
[0049] In some aspects, an optimized CRISPR/Cas9 system is utilized to introduce relatively large hagfish thread keratin genes into silkworm. This strategy overcomes the limitations of random integrations of transposon-based piggyBac system and other systems known in the art, including other applications of CRISPR itself. The disclosed methods facilitate insertion of large exogenous DNA fragments at defined sites within the silkworm genome. In some aspects, fragments of the disclosed hagfish thread keratin genes are introduced into a silkworm.
[0050] Methods for introducing the isolated nucleotide include, but are not limited to, physical methods of transfection including electroporation, microinjection and biolistic delivery with a gene gun. Chemical transfection methods may use calcium phosphate co-precipitation, diethylaminoethyl-dextran, or cationic lipid-based transfection reagents.
[0051] In a specific embodiment, a method is disclosed for producing a transgenic silkworm, the method comprising: introducing an exogenous hagfish thread keratin gene operably linked to an endogenous silkworm promoter.
[0052] In a specific embodiment, a method is disclosed for producing a transgenic silkworm, the method comprising: introducing an isolated nucleic acid having SEQ ID NO: 1, SEQ ID NO: 47, SEQ ID NO: 48, or SEQ ID NO: 2, or a fragment of either thereof, into a defined site of the silkworm genome using a CRISPR/Cas9 system, such that the isolated nucleic acid is operably linked to an endogenous silkworm promoter, wherein the exogenous nucleic acid is stably integrated into the silkworm genome.
[0053] In certain aspects, the disclosed methods do not require use of exogenous promoters in the HC/LC-NHEJ donors.
[0054] For example, using the methods disclosed herein, two large hagfish thread keratin genes may be successfully integrated at the defined locus of the fibroin heavy/light chain gene using optimized CRISPR/Cas9 initiated non-homologous end joining. The incorporated hagfish thread keratin genes may be fully expressed under the endogenous FibH/FibL promoter of silkworm.
[0055] An optimized CRISPR/Cas9 system, as used herein, may be specifically designed for efficient and stable integration and expression of a transgenic sequence in silkworm. In some aspects, the CRISPR/Cas9 system is optimized for silkworms using the silkworm-specific U6 promoter. The CRISPR/Cas9 system may be further optimized by targeting silkworm genomic sequences (e.g., introns) that are not disrupted by introduction of exogenous nucleic acid material.
[0056] In certain aspects, relatively large hagfish thread keratin genes are thus successfully integrated into the intron of the FibH gene and/or into an intron of the FibL gene. In some aspects, the hagfish thread keratin gene may be integrated into the intron of the FibH gene and the hagfish thread keratin gene may be integrated into the intron of the FibL gene. In some aspects, the hagfish thread keratin gene may be integrated into the intron of the FibH gene and the hagfish thread keratin gene may be integrated into the intron of the FibL gene. In some aspects, the exogenous hagfish thread keratin gene may be integrated into the first intron of the FibH gene. In some aspects, the exogenous hagfish thread keratin gene may be integrated into the sixth intron of the FibL gene.
[0057] The following examples are provided to illustrate certain features and/or aspects of the disclosure. The examples should not be construed to limit the disclosure to the particular features or aspects described therein.
EXAMPLES
Example 1. Hagfish Thread Keratin Transgenes in FibL Intron
[0058] An optimized silkworm-specific CRISPR/Cas9 system was used with NHEJ. Expression was driven by the endogenous FibL promoter in the transgenic silkworm glands to improve yields and ensure genetic stability.
[0059] Construction of Cas9 and sU6 gRNA Expression Vectors for Silkworm.
[0060] To ensure the CRISPR/Cas9 system was well expressed in BmN cells and/or silkworms, the coding region of cas9 was constructed into a pIEx-1 vector under the hr5 enhancer and IE1 promoter to form the pIEx-1-Cas9 plasmid.
[0061] To construct the expression vector of Cas9 in silkworms, the coding region of Cas9 was excised from Px330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230) with AgeI and NotI (NEB, R3552S and R3189S), gel-purified (Qiagen, No. 28704), recovered and sub-cloned into the corresponding sites downstream of the hr5 enhancer and IE1 promoter in pIEx-1 (Novagen, No. 71241-3) to form pIEx-1-Cas9.
[0062] This gBlock DNA fragment was PCR-amplified (primer 1: AGGTTATGTAGTACACATTG [SEQ ID NO: 3] and primer 2: TTAATGCCAACTTTGTACA [SEQ ID NO: 4]) and then sub-cloned into the pGEM-T easy vector system (Promega, A3600) to form pGEM-T-sU6 (silkworm U6). Oligo gRNAs (gRNA_sU6_FibH_1-3 and gRNA_sU6_FibL_5, 6) having 19-20 nucleotides. See Table 1, below, which shows the gRNAs design of the CRISPR/Cas9 system. Sequences listed in Table 1 labeled gRNA_sU6_FibL_5, 6 are SEQ ID NOS: 5-6, respectively. Sequences listed in Table 1 labeled gRNA_sU6_FibH_1, 2, 3 are SEQ ID NOS: 12, 13, and 14, respectively.
TABLE-US-00001 TABLE1 Name TargetSequence GenomeLocation gRNA_sU6_FibH_1 GCTAATAGGTAGGGAAAAC AF226688:63141-63159 gRNA_sU6_FibH_2 ATGTGACCATAAAATCTCG AF226688:63194-63212 gRNA_sU6_FibH_3 AACTCGTTCCAGATCAGCGC AF226688:63341-63360 gRNA_sU6_FibL_5(g5) AGAACTTTAAATTATATCT M76430.1:13857-13875 gRNA_sU6_FibL_6(g6) TCACTATGAGACTTAAGCT M76430.1:13880-13898
[0063] The oligos, including sgRNA targeting sites and part of sgRNA frame, were also ordered from Integrated DNA Technologies and were annealed and extended to form double strand DNAs. These double strand DNAs were gel-purified (Qiagen, No. 28704) and sub-cloned into the MfeI-digested pGEM-T-sU6 using Gibson Assembly Master Mix (NEB, E2611S) to form final sgRNA expression vector pGEM-T-sU6-sgRNA. A codon-optimized U6 promoter (sU6) (SEQ ID NO:7) was used to construct silkworm-specific gRNA (sgRNA) expression vectors. The hagfish silk genes (alpha and gamma) were designed and codon optimized for Bombyx mori, synthesized (Life Technologies), and concatenated to form two, three, and four repeats (alpha (2, 3, and 4) and gamma (2, 3, and 4)) using the enzymes Age and BspEI (NEB, R3552S and R0540S). To form the full FibH- and FibL-hagfish alpha and gamma vectors, the fragments of Alpha (3) and gamma (4) had been cut out from the original vectors by SalI and EcoRV (NEB, R3138S and R3195S). Then they were used to annealed with the PCR fragments (FibH-eGFP-DsRed-CTD and the FibL-NTD-eGFP-CTD) to form the full vectors of the FibH-eGFP-Alpha (3) or Gamma (4)-DsRed-CTD and the FibL-NTD-eGFP-Alpha (3) or Gamma (4)-CTD by Gibson assembly (NEB, E2611S). Designed PCR primers (Table 2) and the high fidelity master mix (NEB, M0541S) were used to get the fragments of the FibH-eGFP-DsRed-CTD and the FibL-NTD-eGFP-CTD from the previous spider silk constructs, the FibH-pSK-NTD-eGFP-MaSp1/MiSp1(8)-DsRed-CTD and the FibL-NTD-eGFP-MaSp1(6)-CTD.
TABLE-US-00002 TABLE 2 Primers used for Gibson Assembly for HC- and LC- Alpha and Gamma Constructs Name Sequence HC-Alpha-F SEQ ID NO: 15 HC-Alpha-R SEQ ID NO: 16 HC-Gamma-F SEQ ID NO: 17 HC-Gamma-R SEQ ID NO: 18 LC-GA-alpha-F SEQ ID NO: 19 LC-GA-alpha-R SEQ ID NO: 20 LC-GA-Gamma-F SEQ ID NO: 21 LC-GA-Gamma-R SEQ ID NO: 22
[0064] The hagfish thread keratin amino acid sequence is SEQ ID NO: 8. The hagfish thread keratin amino acid sequence is SEQ ID NO: 9. The amino acid sequence for the Bombyx mori FibH is SEQ ID NO: 10. The amino acid sequence for the Bombyx mori FibL is SEQ ID NO: 11.
[0065] Transgenic Silkworm Isolation.
[0066] A silkworm strain with white cocoon was used for transformations, which facilitates the detection of the eGFP-tagged FibL-alpha/gamma proteins in FibL-transgenic cocoons. The FibH- and FibL-silkworm embryos were designed as zero generation (Go) and their offspring were designed as the first and the second generations (G.sub.1 and G.sub.2). The green fluorescence of the FibH- or FibL-transgenic cocoons was detected under UV light in a dark room. The electroporation equipment, CUY21EDIT in vivo square wave electroporator and CUY495P10 chamber were purchased from Sonidel Limited. Fresh eggs were collected within 1-2 h after being laid by purebred moths (Haoyue). The electroporation procedure is as follows: a) Prepare electroporation buffer (EP buffer) by adding ddH2O (385 l), 2% PVP (polyvinylpyrrolidone) solution (250 l), 10% Tween 20 (15 l), 0.1 M spermidine solution (50 l), DNA plasmid(s) solution (100 g) specific for each transformed group to a 1.5 ml Eppendorf tube and mix; then add 100 l 2.5 M CaCl.sub.2, mixing well again; b) collect and briefly wash the silkworm eggs with purified water; c) place the eggs (500-1000 eggs) into the EP buffer in a 9 cm petri dish; d) treat the silkworm eggs with pressure reduction by placing the dish with eggs on ice in a vacuum chamber for 10-20 min; e) run electroporation for the eggs on ice by placing them into the electroporation chamber, adding 1 ml EP buffer into the electroporation chamber (eggs were cooled prior to electroporation by allowing them to sit in the chamber, on ice, for 2 min), and running the electroporation under 15 V, 50 ms (pulse), 75 ms (interval), 10-20 repeats, then leaving eggs in the chamber for 10-20 min on ice to allow the eggs to cool; f) place the eggs on ice and leave them for at least 1 h; g) eggs are then placed in a 9 cm petri dish with 7 cm diameter paper; and h) they are left in the dark at 25 C. for hatching.
[0067] Identification of the Transgenic Silkworms
[0068] After laying their eggs, the moths (heads, wings and abdomens) in each transgenic group (FibH-Alpha or Gamma; FibL-Alpha or Gamma) were subjected to genomic DNA extraction using the E.Z.N.A Insect DNA Isolation Kit (Omega Bio-Tek, C0926-01). The extracted genomic DNA was subjected to PCR for detection of the eGFP gene or stored at 20 C. The FibL or FibH-genome: junction testing had been performed by using the previous method 1. Briefly, the 3- and 5-end genome: transgene junction sequences were amplified using the designed primers. The first round of PCR amplification was performed with NEBNext High-Fidelity 2PCR Master Mix (NEB, M0541S) and second round PCRs were performed using the PCR products purified from the first round of amplifications (Qiagen, Taq PCR Master Mix, No. 201443). Amplified fragments were gel-purified (Qiagen, No. 28704) and cloned into the pGEM-T easy vector system (Promega, A3600) for sequencing. The sequencing data was analyzed using Blast at the National Center for Biotechnology Information (NCBI). The primers for eGFP detection and genome: junction testing please see Table 3.
[0069]
TABLE-US-00003 TABLE 3 Name Sequence Primer Combinations for PCRs eGFP eGFP-SalI-F SEQ ID NO: 23 First - Forward eGFP-HindIII-R SEQ ID NO: 24 First - Reverse DsRed Dsred-BamHI SEQ ID NO: 25 First - Forward Dsred-XbaI SEQ ID NO: 26 First - Reverse HC_DsRed_1_F SEQ ID NO: 27 Secondary - Forward HC_DsRed_1_R SEQ ID NO: 28 Secondary - Reverse HC_DsRed_2_F SEQ ID NO: 29 Secondary - Forward HC_DsRed_2_R SEQ ID NO: 30 Secondary - Reverse FibH FibH62454-F SEQ ID NO: 31 5 First - Forward H1-R SEQ ID NO: 32 5 First - Reverse FibH62737-F SEQ ID NO: 33 5 Secondary - Forward FibH-donor-R SEQ ID NO: 34 5 Secondary - Reverse PSK-F SEQ ID NO: 35 3 First - Forward FibH63746-R SEQ ID NO: 36 3 First - Reverse PSK-F2 SEQ ID NO: 37 3 Secondary - Forward FibH63575-R SEQ ID NO: 38 3 Secondary - Reverse FibL LC-NHEJ-LJ13201-F SEQ ID NO: 39 5 First - Forward LC-NHEJ-LJ13389-F SEQ ID NO: 40 5 Secondary - Forward LJ-R1 SEQ ID NO: 41 5 Secondary - Reverse LS-R SEQ ID NO: 42 5 First - Reverse PSK-F SEQ ID NO: 43 3 First - Forward PSK-F2 SEQ ID NO: 44 3 Secondary - Forward LC-NHEJ-RJ14589-R SEQ ID NO: 45 3 Secondary - Reverse Sac1-14600-R-R SEQ ID NO: 46 3 First - Reverse
[0070] Western Blot Analysis of the FibH- or FibL-Alpha/Gamma Proteins.
[0071] The FibH or FibL-transgenic silkworm glands (FibH- or FibL-Alpha/Gamma) were dissected from the FibH or FibL-transgenic silkworms at the third day of the fifth larval stage, washed with 1PBS, and then stored at 80 C. The FibH or FibL-middle gland contents were homogenized in 2SDS lysis buffer (3% SDS, 6 M urea, 40 mM Dithiothreitol, 10% w/v Glycerol, 0.01% Bromophenol blue, and 62.5 mM Tris-HCl pH 6.8), boiled at 100 C. for 15-20 min, and loaded onto 4-20% gradient gels (Thermo, Scientific), at 100 V for 1.5 h. After the SDS-PAGE, the FibH or FibL-middle gland proteins were transferred to Immobilon-P Transfer Membrane (EMD Millipore, IPVH00010) using Tris-Glycine-Methanol buffer (25 mM Tris, 192 mM Glycine, and 10% methanol), at 45 V, overnight. The antibody staining process was performed as follows: 1) block the membrane for 1 h at room temperature (5% nonfat dry milk in 1TBST as the blocking buffer); 2) incubate the membrane at 4 C. overnight with the diluted primary anti-eGFP antibody (1:1,000) (Thermo Scientific, MA1-952) or the diluted primary dsRed-2 antibody (1:500) (Santa Cruz Biotechnology, sc-101529) in the blocking buffer; 3) wash the membrane three times with 1TBST, 15 min each; 4) incubate the membrane with the diluted secondary antibody (1:1,000), Anti-Mouse IgG (H+L), alkaline phosphatase conjugated at room temperature for 1 h in the blocking buffer; 5) wash the membrane three times with 1TBST, 15 min each; 6) the antibody-antigen reactions were performed using 1-Step NBT/BCIP substrate solution. The proteins of the non-transgenic silkworm glands were used as controls in all the experiments mentioned above. Each FibH or FibL-transgenic protein samples had three replicates as well as the control.
[0072]
[0073] Mechanical Properties of the Hagfish Thread Keratin Fibers.
[0074] The transgenic and control (non-transgenic) cocoon fibers were degummed (0.05% sodium bicarbonate, 0.05% SDS, and 0.01% sodium carbonate solution) at 85 C. for 30-45 min with a silk: solution ratio (weight/volume) of 1:50 until the silk became transparent. Then the degummed fibers were rinsed twice with warm water (50-60 C.) using the same material: solvent ratio. The degummed fibers were dried at room temperature overnight. Individual fibers from spiders and transgenic silkworms were gently separated to avoid stretching and deformation and then attached to C shaped cards using liquid super glue. Three individual fibers were taken from each cocoon in each group. The gauge length was 19.1 mm and diameters for each fiber were determined by taking an average of nine measurements with a Motic Optical 5A310 light microscope and Motic Images Plus 2.0 software. Each C card with the attached fiber was then loaded into a MTS Synergie 100 (MTS Systems) equipped with both a 50 N load cell and a custom 10 g load cell (Transducer Techniques) for mechanical testing. Using TestWorks 4 software, the attached fiber was uniaxially tested by pulling the fiber at a speed of 50 mm/min with a data acquisition rate of 120 Hz until the fiber broke. All tests were performed in ambient conditions (20-22 C. and 20-26% humidity). Data were then exported and further analyzed using Microsoft Excel. Mean values and standard deviations (SD) were calculated from the raw data.
[0075] Table 4 below reports data showing the mechanical performance of the transgenic silkworm/hagfish thread keratin gamma fibers.
TABLE-US-00004 TABLE 4 Diameter Ultimate Tensile Energy to Break Elastic Ultimate (microns) Strength (Ma) (MJ/m.sup.{circumflex over ()}3) Modulus (GPa) Strain Mean Std Mean Std Mean Std Mean Std Mean Std Control 9.42 0.22 617.37 51.06 78.20 9.00 8.17 0.45 0.20 0.03 Gamma4 8.23 0.5 759.33 62.04 116.84 25.92 9.06 1.07 0.25 0.05
[0076] The incorporation of the hagfish thread keratin gamma protein averagely made the transgenic fibers stronger and more flexible than the control fibers. Compared to the non-transgenic silkworm fibers, the average ultimate tensile strength of the transgenic hagfish-gamma/silkworm fibers was 759 MPa, increased 20% compared to the non-transgenic silkworm fibers. The average value of the energy to break was 117 MJ/m{circumflex over ()}3, a 50% increase in the transgenic hagfish-gamma/silkworm fibers. The average value of elastic modulus was 9 GPa, about a 11% increase in the transgenic hagfish-gamma/silkworm fibers. Additionally, the average value of the ultimate strain was increased 25% in the transgenic hagfish-gamma/silkworm fibers.