Carbonyl reductase variant and its use in preparation of (R)-4-chloro-3-hydroxybutyrate
10961515 ยท 2021-03-30
Assignee
Inventors
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
International classification
C12N15/74
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
Abstract
Disclosed herein are a carbonyl reductase variant and its use in the preparation of (R)-4-chloro-3-hydroxybutyrate. The carbonyl reductase variant is obtained by mutating phenylalanine-85 in an amino acid sequence as shown in SEQ ID NO:4 to methionine. An amino acid or amino acids at one or more positions other than position 85 in the amino acid sequence of the carbonyl reductase may be further replaced. The application also provides a recombinant expression vector carrying the gene encoding the carbonyl reductase variant, a genetically-engineered bacterium carrying the carbonyl reductase variant gene and glucose dehydrogenase gene, and an application of this bacterium in the asymmetric reduction of 4-chloroacetoacetate to prepare (R)-4-chloro-3-hydroxybutyrate.
Claims
1. A carbonyl reductase variant, wherein the carbonyl reductase variant is obtained by: mutating phenylalanine-85 in the amino acid sequence as shown in SEQ ID NO:4 to methionine.
2. A carbonyl reductase variant, wherein the carbonyl reductase variant is obtained by: mutating phenylalanine-85 in the amino acid sequence as shown in SEQ ID NO:4 to methionine; and replacing an amino acid at one or more positions other than position 85 in the amino acid sequence as shown in SEQ ID NO: 4; wherein the amino acid at one or more positions is tyrosine-128, phenylalanine-132 or valine-162, or a combination thereof.
3. The carbonyl reductase variant of claim 2, wherein the tyrosine-128 is replaced with alanine, methionine, glycine, leucine, valine or isoleucine; the phenylalanine-132 is replaced with alanine, methionine, glycine, leucine, valine or isoleucine; and the valine-162 is replaced with alanine, methionine, glycine, leucine or isoleucine.
4. An isolated nucleic acid encoding the carbonyl reductase variant of claim 1.
5. A recombinant expression vector comprising the nucleic acid of claim 4.
6. A genetically-engineered bacterium, comprising: the recombinant expression vector of claim 5; and a recombinant expression vector carrying glucose dehydrogenase gene.
7. A method for preparing (R)-4-chloro-3-hydroxybutyrate, comprising: reducing substrate 4-chloroacetoacetate (I) at 20-50 C. in an initial reaction system at pH of 6-10 to produce the (R)-4-chloro-3-hydroxybutyrate (II), as shown in the following reaction scheme: ##STR00005## wherein: R is a linear or branched-chain C.sub.1-C.sub.8 alkyl, a C.sub.3-C.sub.8 cycloalkyl, or a mono-substituted or poly-substituted aryl or aralkyl; the initial reaction system comprises the substrate 4-chloroacetoacetate (I), an enzyme catalyst, glucose, an organic solvent immiscible with water and a buffer solution; and the enzyme catalyst is a whole cell of the genetically-engineered bacterium of claim 6, or a crude enzyme obtained by the lysis of the whole cell of the genetically-engineered bacterium.
8. The method of claim 7, wherein, based on a total volume of the initial reaction system, the substrate 4-chloroacetoacetate (I) has a concentration of 0.10-0.30 g/mL; the organic solvent has a volume percentage of 5%-40%; the buffer solution has a volume percentage of 95%-60%; the enzyme catalyst calculated as wet bacterial cells is 20%-200% by weight of the substrate 4-chloroacetoacetate (I); and a molar ratio of the glucose to the substrate 4-chloroacetoacetate (I) is 1-4:1.
9. The method of claim 7, wherein the organic solvent is toluene.
10. The method of claim 7, wherein the buffer solution is phosphate buffered solution.
11. The method of claim 7, wherein an alkaline solution is added to keep the pH at 6-10 during the reaction.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
DETAILED DESCRIPTION OF EMBODIMENTS
(3) As used herein, the term alkyl refers to a linear or branched alkyl having 1-10 carbon atoms, preferably 1-8 carbon atoms, and more preferably 1-5 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl and n-hexyl.
(4) In the application, the C.sub.3-C.sub.8 cycloalkyl includes, but is not limited to cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl.
(5) As used herein, the term aryl refers to monocyclic, polycyclic or fused-ring aryl having 6-36 carbon atoms, preferably 6-14 carbon atoms, such as phenyl, naphthyl, anthryl, phenanthryl, biphenyl and binaphthyl. The aryl may be a mono-substituted or polysubstituted aryl, for example, the aryl can be substituted with one or more substituents, such as alkyl.
(6) As used herein, the term aralkyl refers to an alkyl in which at least one hydrogen atom is substituted with aryl group, preferably a C.sub.7-C.sub.15 aralkyl, such as benzyl, 1-phenylethyl, 2-phenylethyl, 1-phenylpropyl and 3-naphthylpropyl, etc. The aryl group of the aralkyl can be mono-substituted or polysubstituted accordingly with one or more substituents, such as alkyl.
(7) As used herein, the term phenylalanine-85 refers to the phenylalanine at position 85. The application will be described in detail below with reference to the embodiments, but is not limited thereto.
Example 1 Site-Directed Mutagenesis and Construction of Recombinant Expression Vector pET28b-YOL151W.SUP.F85M
(8) The site-directed mutagenesis was accomplished using the TransStartFastPfu Fly DNA polymerase. First, the mutation primers containing the mutation site F85M were designed as follows:
(9) forward primer: GGCCTCTCCAATGTGCTTTGATATCACTGACAGT (SEQ ID NO:1);
(10) reverse primer: TATCAAAGCACATTGGAGAGGCCGTATGTAGAAC (SEQ ID NO:2);
(11) The PCR reaction system had a total volume of 50 L and consisted of 50 ng of wild-type pET28b-YOL151W template, 10 L 5 TransStartFastPfu Fly buffer solution, 8 L dNTP (2.5 mM for each), a pair of the mutation primers each for 1 L (10 M), 10 L of 5PCR Stimulant, 2.5 U of TransStartFastPfu Fly DNA polymerase and sterile distilled water.
(12) The PCR amplification was programmed as follows: denaturation at 98 C. for 3 min; 20 cycles with each consisting of denaturation at 98 C. for 20 seconds, annealing at 65 C. for 30 seconds and extension at 72 C. for 8 min; and extension at 72 C. for 10 min. The PCR product was stored at 4 C. for use.
(13) The PCR product was digested by endonuclease DpnI at 37 C. for 1 h and then transformed into E. coli DH5 cells, which were smeared onto an LB solid medium containing kanamycin (50 g/mL) and cultured overnight at 37 C. After that, positive clones were selected, inoculated into a LB medium containing kanamycin (50 g/mL) and cultured for approximately 8 h. Plasmids were extracted and sequenced, and the plasmids with the correct sequence were the recombinant expression vector pET28b-YOL151W.sup.F85M.
Example 2 Expression and Purification of pET28b-YOL151W.SUP.F85M
(14) The recombinant expression vector pET28b-YOL151W.sup.F85M constructed in Example 1 was transformed into E. coli BL21 (DE3) cells. Monoclones were selected and inoculated to a LB liquid medium containing kanamycin (50 g/mL) and activated for 8 h (37 C., 200 rpm). Then the activated culture was transferred to 500 mL of a LB liquid medium containing kanamycin (50 g/mL) at an inoculation amount of 1/100 and cultured at 37 C. and 200 rpm. When the optical density OD.sub.600 of the culture medium reached 0.6, 0.1 mM IPTG was added for induction, where the induction was performed at 18 C. and 200 rpm for 18 h. The culture medium was centrifuged, and wet bacterial cells (approximately 2 g) were collected and resuspended in 20 mL of a lysis buffer. The resuspension was mixed uniformly, ultrasonicated centrifuged at 4 C. and 18,000 rpm for 30 min to give a supernatant. The supernatant was loaded to a column containing 2-3 mL of Ni-NTA resin pretreated with the lysis buffer. The column was placed in an ice bath and subjected to oscillation on a horizontal oscillator for 30 min. The effluent was discarded, and the resin was washed with 220 mL of a washing buffer. The proteins bonded to the resin were eluted with an elution buffer, and 10 ingredients were collected, each for 1 mL. The ingredients were measured at 280 nm for the absorbance by spectrophotometer NanoDrop One, and those with high absorbance were combined. The combined protein solution was concentrated, allowed to flow through a PD-10 desalting column equilibrated with a storing buffer in advance and finally eluted with the storing buffer, and thus the purified YOL151W.sup.F85M variant without imidazole and excess salt was produced, which was demonstrated by SDS-PAGE to have a protein purity higher than 90% (shown in
(15) As used above, the lysis buffer was composed of 50 mM phosphate buffer (pH 7.5), 300 mM NaCl, 10 mM imidazole and 10% (v/v) glycerin;
(16) the washing buffer was composed of 50 mM phosphate buffer (pH 7.5), 300 mM NaCl, 20 mM imidazole and 10% (v/v) glycerin;
(17) the elution buffer was composed of 50 mM phosphate buffer (pH 7.5), 300 mM NaCl, 250 mM imidazole and 10% (v/v) glycerin; and
(18) the storing buffer was composed of 50 mM phosphate buffer (pH 7.5), 300 mM NaCl and 10% (v/v) glycerin.
Example 3 Construction of Genetically-Engineered Bacteria E. coli BL21(DE3)/pET28b-YOL151W.SUP.F85M./pACYC-GDH and Induced Expression of YOL151W.SUP.F85M .Gene
(19) The plasmid pET28b-YOL151W.sup.F85M constructed in Example 1 and the plasmid pACYC-GDH stored in the laboratory were together transformed into the expression host E. coli BL21(DE3), and positive clones were obtained through screening, and named E. coli BL21(DE3)/pET28b-YOL151W.sup.F85M/pACYC-GDH. The genetically-engineered bacteria were inoculated to 5 mL of a LB liquid medium containing kanamycin (25 g/mL) and chloramphenicol (12.5 g/mL), activated for 8 h (37 C., 200 rpm). Then the activated culture was transferred to 500 mL of the LB liquid medium containing kanamycin (50 g/mL) and chloramphenicol (12.5 g/mL) at an inoculation of 1/100 and cultured at 37 C. and 200 rpm. When the optical density OD.sub.600 of the culture medium reached 0.6, 0.1 mM IPTG was added for induction, where the induction was performed at 18 C. for 18 h. After the induction, the culture medium was centrifuged, and the wet bacterial cells were collected as the genetically-engineered bacteria whole-cell biocatalyst.
Example 4 Asymmetric Synthesis of ethyl (R)-4-chloro-3-hydroxybutyrate (Hectogram Scale) Under the Catalysis of Genetically-Engineered Bacteria E. coli BL21(DE3)/pET28b-YOL151WF85M/pACYC-GDH Whole Cell
(20) 346.8 g of ethyl 4-chloroacetoacetate (2.11 mol) was added into a reactor, to which toluene (534 mL) was added under stirring. The reactor was kept at 30 C. Then 570.9 g of glucose (3.17 mol) was added, and the reaction mixture was stirred for 5 min and added with a bacterial suspension, where the bacterial suspension was prepared by mixing 260 g of the whole-cell biocatalyst prepared in Example 3 with 1.2 L 100 mM phosphate buffered solution (pH 6.7) uniformly. After the reaction started, pH was monitored in real time and kept at 6.7 with 2 M aqueous K.sub.2CO.sub.3 solution.
(21) After the reaction was monitored by GC-MS to be completed, the reaction mixture was added with 300 mL of ethyl acetate, stirred for 5 min and centrifuged at 9,500 rpm for 20 min. The organic phase was collected, and the aqueous phase was extracted with the equal volume of ethyl acetate three times and centrifuged at 9,500 rpm for 20 min to collect the organic phases. The organic phases were combined, dried with anhydrous sodium sulfate and evaporated under rotation to give 319.4 g of a product (91% yield) with a specific rotation of [].sup.25.sub.D=+21.5 (c=5.0, CHCl.sub.3) ([].sup.25.sub.D=+22.3 (c=5.0, CHCl.sub.3) in Org. Biomol. Chem., 2011, 9, 5463-5468).
(22) .sup.1H NMR (CDCl.sub.3, 400 MHz): /ppm 4.31-4.25 (m, 1H), 4.18 (q, J=7.2 Hz, 2H), 3.63-3.58 (m, 2H), 3.15 (s, 1H), 2.68-2.61 (m, 2H), 1.30 (t, J=7.2 Hz, 3H).
(23) .sup.13C NMR (CDCl.sub.3, 100 MHz): /ppm 172.0, 67.8, 60.6, 48.2, 38.7, 14.0.
(24) The product ethyl (R)-4-chloro-3-hydroxybutyrate was derivatized to compound X-1 via the following reaction for the purpose of accurately determining an enantiomeric excess (ee) of the product.
(25) ##STR00002##
(26) The derivatization was performed as follows. 10 mL of a dichloromethane solution containing 1 mmol of ethyl (R)-4-chloro-3-hydroxybutyrate, 5 mmol of pyridine, 1.5 mmol of 4-nitrobenzoyl chloride and 0.05 mmol of DMAP was stirred at 30 C. for 6 h. Then 5 mL of saturated aqueous sodium bicarbonate solution was added for extraction, and the reaction mixture was separated to obtain an organic layer. The organic layer was washed with 1 M hydrochloride solution, saturated aqueous sodium bicarbonate solution and saturated NaCl solution, respectively, dried with anhydrous Na.sub.2SO.sub.4 and concentrated to give a crude product. The crude product was purified by silica gel column chromatography (ethyl acetate:petroleum ether=1:3 (v/v)) to give 0.91 mmol of the compound X-1 (91% yield).
(27) .sup.1H NMR (CDCl.sub.3, 400 MHz): /ppm 8.54-8.18 (m, 4H), 5.71 (m, 1H), 4.18 (q, J=7.2 Hz, 2H), 3.91 (qd, J=12.0, 4.5 Hz, 2H), 2.95 (d, J=6.6 Hz, 2H), 1.31 (t, J=7.2 Hz, 3H).
(28) The chiral HPLC measurement was carried out under conditions of: AS-H chromatographic column; mobile phase: n-hexane:isopropanol=85:15; flow rate: 0.5 mL/min; column temperature 24 C.; and wavelength: 215 nm (shown in
Example 5 Asymmetric Synthesis of methyl (R)-4-chloro-3-hydroxybutyrate (Hectogram Scale) Under the Catalysis of Genetically-Engineered Bacteria E. coli BL21(DE3)/pET28b-YOL151WF85M/pACYC-GDH Whole Cell
(29) 115.6 g of methyl 4-chloroacetoacetate (0.77 mol) was added into a reactor, to which toluene (115 mL) was added under stirring. The reactor was kept at 30 C. Then 253.7 g of glucose (1.41 mol) was added, and the reaction mixture was stirred for 5 min and added with a bacterial suspension, where the bacterial suspension was prepared by mixing 115.6 g of whole-cell biocatalyst prepared in Example 3 with 463 mL of 100 mM phosphate buffered solution (pH 6.7) uniformly. After the reaction started, pH was monitored in real time and kept at 6.7 with 2M aqueous K.sub.2CO.sub.3 solution.
(30) After the reaction was monitored by GC-MS to be completed, the reaction mixture was added with 100 mL of ethyl acetate, stirred for 5 min, and centrifuged at 9,500 rpm for 20 min. The organic phase was collected, and the aqueous phase was extracted with an equal volume of ethyl acetate three times and centrifuged at 9,500 rpm for 20 min to collect the organic phase. The organic phases were combined, dried with anhydrous sodium sulfate and evaporated under rotation to give 103.1 g of a product (88% yield).
(31) .sup.1H NMR (CDCl.sub.3, 400 MHz): /ppm 4.31-4.24 (m, 1H), 3.73 (s, 3H), 3.64-3.57 (m, 2H), 3.06 (s, 1H), 2.68-2.61 (m, 2H).
(32) .sup.13C NMR (CDCl.sub.3, 100 MHz): /ppm 172.1, 67.7, 51.9, 48.3, 38.3.
(33) The product ethyl (R)-4-chloro-3-hydroxybutyrate was derivatized to compound X-2 via the following reaction for the purpose of accurately determining an ee of the product.
(34) ##STR00003##
(35) The derivatization was performed as follows. 10 mL of a dichloromethane solution containing 1 mmol of methyl (R)-4-chloro-3-hydroxybutyrate, 5 mmol of pyridine, 1.5 mmol of 4-nitrobenzoyl chloride and 0.05 mmol of DMAP was stirred at 30 C. for 6 h. Then 5 mL of saturated aqueous sodium bicarbonate solution was added for extraction and the reaction mixture was separated to obtain an organic layer. The organic layer was washed with 1 M hydrochloride solution, saturated aqueous sodium bicarbonate solution, and saturated NaCl solution, respectively, dried with anhydrous Na.sub.2SO.sub.4 and concentrated to give a crude product. The crude product was purified by silica gel column chromatography (ethyl acetate:petroleum ether=1:3 (v/v)), to give 0.93 mmol of the compound X-2 (93% yield).
(36) .sup.1H NMR (CDCl.sub.3, 400 MHz): /ppm 8.52-8.17 (m, 4H), 5.73 (m, 1H), 3.93 (qd, J=12.0, 4.8 Hz, 2H), 3.74 (s, 3H), 2.94 (d, J=6.8 Hz, 2H).
(37) The chiral HPLC measurement was carried out under conditions of: AS-H chromatographic column; mobile phase: n-hexane:isopropanol=85:15 solution; flow rate: 0.5 mL/min; column temperature 24 C.; and wavelength: 215 nm. The measurement result showed that an ee of the product was 98%.
Example 6 Asymmetric Synthesis of tert-butyl (R)-chloro-3-hydroxybutyrate (Hectogram Scale) Under the Catalysis of Genetically-Engineered Bacteria E. coli BL21(DE3)/pET28b-YOL151WF85M/pACYC-GDH Whole Cell
(38) 173.4 g of tert-butyl 4-chloroacetoacetate (0.90 mol) was added into a reactor, to which toluene (534 mL) was added under stirring. The reactor was kept at 30 C. Then 325.1 g of glucose (1.8 mol) was added, and the reaction mixture was stirred for 5 min and added with a bacterial suspension, where the bacterial suspension was prepared by mixing 346.8 g of whole-cell biocatalyst prepared in Example 3 with 1.2 L of 100 mM phosphate buffered solution (pH 6.7) uniformly. After the reaction started, pH was monitored in real time and kept at 6.7 with 2 M aqueous K.sub.2CO.sub.3 solution.
(39) After the reaction was monitored by GC-MS to be completed, the reaction mixture was added with 600 mL of ethyl acetate, stirred for 5 min and centrifuged at 9,500 rpm for 20 min to collect an organic phase. The aqueous phase was extracted with an equal volume of ethyl acetate three times and centrifuged at 9,500 rpm for 20 min to collect the organic phases. The organic phases were combined, dried with anhydrous sodium sulfate and evaporated under rotation to give 157.7 g of a product (90% yield).
(40) .sup.1H NMR (CDCl.sub.3, 400 MHz): /ppm 4.30-4.23 (m, 1H), 3.66-3.58 (m, 2H), 3.08 (s, 1H), 2.68-2.61 (m, 2H), 1.29 (s, 9H).
(41) .sup.13C NMR (CDCl.sub.3, 100 MHz): /ppm 173.0, 82.1, 69.5, 51.5, 38.6, 28.8.
(42) The product tert-butyl (R)-4-chloro-3-hydroxybutyrate was derivatized to compound X-3 via the following reaction for the purpose of accurately determining an ee of the product.
(43) ##STR00004##
(44) The derivatization was performed as follows. 10 mL of a dichloromethane solution containing 1 mmol of tert-butyl (R)-4-chloro-3-hydroxybutyrate, 5 mmol of pyridine, 1.5 mmol of 4-nitrobenzoyl chloride and 0.05 mmol of DMAP was stirred at 30 C. for 6 h. Then 5 mL of saturated aqueous sodium bicarbonate solution was added for extraction, and the reaction mixture was separated to obtain an organic layer. The organic layer was washed with 1 M hydrochloride solution, saturated aqueous sodium bicarbonate solution and saturated NaCl solution, respectively, dried with anhydrous Na.sub.2SO.sub.4 and concentrated to give a crude product. The crude product was purified by silica gel column chromatography (ethyl acetate:petroleum ether=1:3 (v/v)) to give 0.88 mmol of compound X-3 (88% yield).
(45) .sup.1H NMR (CDCl.sub.3, 400 MHz): /ppm 8.53-8.17 (m, 4H), 5.70 (m, 1H), 3.89 (qd, J=11.8, 4.8 Hz, 2H), 2.92 (d, J=6.6 Hz, 2H), 1.31 (s, 9H)
(46) Chiral HPLC measurement was carried out under conditions of: AS-H chromatographic column; mobile phase: n-hexane:isopropanol=85:15; flow rate: 0.5 mL/min; column temperature: 24 C.; and wavelength: 215 nm. The measurement result showed that an ee of the product was 97%.
(47) Described above are merely preferred embodiments of the present application, which are merely illustrative of the present invention without limiting. Any changes, replacements and modifications made without departing from the spirit of the present application should fall within the scope as defined by the appended claims.