Pharmaceutical Composition For Preventing Or Treating Tissue Adhesion Comprising Integrin a2ß1 Inhibitors

20210070866 · 2021-03-11

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed herein are a pharmaceutical composition comprising an integrin 21 inhibitor as an active ingredient for prevention or treatment of tissue adhesion, a method for screening a material prophylactic of or therapeutic for tissue adhesion, an anti-adhesion composition comprising the pharmaceutical composition for prevention or treatment of tissue adhesion as an active ingredient, and a method for prevention or treatment of tissue adhesion. The present disclosure can be advantageously used for preventing or treating tissue adhesion.

Claims

1. A method for prevention or treatment of tissue adhesion, the method comprising a step of administering a pharmaceutical composition comprising an integrin 21 inhibitor as an active ingredient to a subject.

2. The method of claim 1, wherein the integrin 21 inhibitor is selected from the group consisting of an antibody, an aptamer, a natural extract, and a compound.

3. The method of claim 1, wherein the integrin 21 inhibitor is selected from the group consisting of an anti-integrin 21 antibody or an antigen-binding fragment thereof, BTT 3016, BTT 3033, BTT 3034, and rhodocetin.

4. The method of claim 1, wherein the tissue adhesion is selected from the group consisting of peritoneal adhesion, pelvic adhesion, pericardial adhesion, peritendinous adhesion, and peridural adhesion.

5. The method of claim 1, wherein the pharmaceutical composition is in a formulation form selected from the group consisting of a medicine for internal use, an injection, a gel, a film, a perfusate, a spray liquid, an atomizing or vaporizing liquid, a foaming aerosol, and an infusion.

6. A method for screening a material for prevention or treatment of tissue adhesion, the method comprising the steps of: (a) co-culturing macrophage-like THP-1 cells with collagen I-expressing cells or cells transformed to express collagen I; (b) treating the co-cultured collagen I-expressing cells with a candidate material; (c) measuring an expression level of an integrin 21 protein or gene in the collagen I-expressing cell treated with the candidate material; and (d) determining the candidate material to be a material for prevention or treatment of tissue adhesion when the measured expression level of the integrin 21 protein or gene in step (c) is reduced, compared to untreated, collagen I-expressing cells.

7. The method of claim 6, wherein the tissue adhesion is selected from the group consisting of peritoneal adhesion, pelvic adhesion, pericardial adhesion, peritendinous adhesion, and peridural adhesion.

8. An anti-adhesion composition comprising an integrin 21 inhibitor and a biocompatible hydrogel.

9. The anti-adhesion composition of claim 8, wherein the integrin 21 inhibitor is selected from the group consisting of an antibody, an aptamer, a natural extract, and a compound.

10. The anti-adhesion composition of claim 8, wherein the integrin 21 inhibitor is selected from the group consisting of an anti-integrin 21 antibody or an antigen-binding fragment thereof, BTT 3016, BTT 3033, BTT 3034, and rhodocetin.

11. The anti-adhesion composition of claim 8, wherein the adhesion is selected from the group consisting of peritoneal adhesion, pelvic adhesion, pericardial adhesion, peritendinous adhesion, and peridural adhesion.

12. The anti-adhesion composition of claim 8, being in a form of a gel or a film.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0083] FIG. 1 shows the sufficient attachment of human dura mater tissues to a collagen-coated culture dish under the load of cell culture plates for 3 days.

[0084] FIG. 2 shows time-lapse microscopic images of hDMCs on days 3, 7, and 14;

[0085] FIG. 3 shows microscopic images of hDMCs after immunocytochemical staining for vimentin, cytokeratin, GFAP, and synaptophysin;

[0086] FIG. 4 shows microscopic images hDMCs after immunocytochemical staining for S-100 and neuron-specific enolase;

[0087] FIG. 5 shows cell viability and flow cytometry analysis results between nave and co-cultured hDMCs;

[0088] FIG. 6 is an overall view of adhesion assay results;

[0089] FIG. 7 shows quantitative analysis results of adhesion of nave hDMCs to extracellular matrix components;

[0090] FIG. 8 shows quantitative analysis results of nave hDMCs and co-cultured hDMCs to extracellular matrix components;

[0091] FIG. 9 shows expression levels of focal adhesion kinase (FAK) in nave hDMCs and co-cultured hDMCs as measured by western blotting;

[0092] FIG. 10 shows quantitative analysis results of expression levels of focal adhesion kinase (FAK) in nave hDMCs and co-cultured hDMCs;

[0093] FIG. 11 shows cell viability of nave hDMCs as measured by flow cytometry;

[0094] FIG. 12 shows expression patterns of integrin subtypes in nave hDMCs as measured by immunofluorescence flow cytometry;

[0095] FIG. 13 shows expression patterns of integrin subtypes in nave hDMCs and co-cultured hDMCs as measured by immunofluorescence flow cytometry;

[0096] FIG. 14 shows quantitative analysis results of expression patterns of integrin subtypes in nave hDMCs and co-cultured hDMCs as measured by immunofluorescence flow cytometry;

[0097] FIG. 15 shows changes in cell viability of hDMCs by treatment with BTT 3033;

[0098] FIG. 16 shows quantitative assay for adhesion ability of co-cultured hDMCs treated with BTT 3033;

[0099] FIG. 17 shows levels of MMP, TIMP, and VEGF in culture media of nave hDMCs and co-cultured hDMCs as measured by ELISA;

[0100] FIG. 18 shows relative levels of MMP, TIMP, and VEGF on the basis of log.sub.2 (co-cultured cells/[hDMCs+M]);

[0101] FIG. 19 shows quantitative real-time PCR analysis of MMP-1 and MMP-3 in nave and co-cultured cells of M and hDMCs, as measured for relative expression level ratios; and

[0102] FIG. 20 is a schematic illustration of hDMC adhesion to ECM during inflammation.

DETAILED DESCRIPTION

[0103] A better understanding of the present disclosure may be obtained through the following examples which are set forth to illustrate, but are not to be construed as limiting the present disclosure.

EXAMPLES

Example 1

Collection of Human Dura Mater Tissue

[0104] Human dura mater tissues were obtained from patients who had undergone neurosurgical procedures. Specimens were collected from 10 patients with the following characteristics (Table 1, eight males and two females, mean age 53.021.0 years; four pieces of 1 cm.sup.2 dura mater from each patient).

TABLE-US-00001 TABLE 1 Past medical history Surgical Diabetes Hyper No. Age Sex Diagnosis operation Mellitus tension Alcohol Smoking Others 1 20 F acute subdural decompressive hemorrhage with craniectomy and skull fracture duroplasty 2 61 M cerebral infarction decompressive + + arrhythmia with intracranial craniectomy and hemorrhage duroplasty 3 78 F subarachnoid decompressive + hemorrhage craniectomy and duroplasty 4 58 M cerebral infarction decompressive + + + Hypo-thyroidism craniectomy and duroplasty 5 19 M epidural decompressive hemorrhage with craniectomy and hemorrhagic duroplasty contusion 6 71 M intracranial decompressive + + benign hemorrhage with craniectomy and prostatic intraventricular duroplasty hyper-plasia hemorrhage 7 53 M acute subdural decompressive + + + hemorrhage with craniectomy and hemorrhagic duroplasty contusion 8 51 M acute subdural decompressive + + hemorrhage with craniectomy and skull fracture duroplasty 9 77 M acute subdural decompressive + + hemorrhage craniectomy and duroplasty 10 42 M epidural decompressive hemorrhage with craniectomy and skull fracture duroplasty

[0105] All specimens were immediately placed in DMEM (Welgene, Gyeongsangbuk-do, Republic of Korea) at 4 C. and transferred to the laboratory.

[0106] This study adhered to the guidelines and protocols approved by the local institutional review board of the hospital of the present inventors.

Example 2

Immunostaining

[0107] The cells were fixed in 4% (w/v) paraformaldehyde (Electron Microscopy Sciences; Hatfield, Pa.) for 10 min at 37 C. and washed with PBS (pH 7.4; Welgene) before the cell membrane was permeabilized by addition of 0.5% (v/v) Triton X-100 (Sigma-Aldrich) in PBS for 10 min at room temperature. After being washed with PBS, the cells were immersed in PBS containing 1% (w/v) bovine serum albumin (Sigma-Aldrich), 22.52 mg/ml glycine (Sigma-Aldrich), and 0.1% (v/v) Tween 20 (Sigma-Aldrich) for 30 min to block non-specific binding.

[0108] The primary antibodies used for immunostaining were antibodies against vimentin (M7020, 1:100; Dako, Agilent, Santa Clara, Calif., USA), cytokeratin and GFAP (glial fibrillary acidic protein) (M3515, M0761, 1:100; Dako), synaptophysin (CMC336A, 1:100; Cell Marque, Darmstadt, Germany), S-100 (sc-53438, 1:100; Santa Cruz Biotechnology, Dallas, Tex., USA), and enolase (sc-51880, 1:100; Santa Cruz Biotechnology). Alexa Fluor 488 goat anti-mouse and anti-rabbit IgG antibodies were used as secondary antibodies.

[0109] For nuclear staining, 4, 6-diamidino-2-phenylindole (DAPI)(Thermo Fisher Scientific, Waltham, Mass., USA) was used.

[0110] Optical microscopic images were obtained using an Olympus IX71 inverted microscope and DP70 camera (with UPlanFL 4/0.13 numerical aperture and LUCPlanFL 10/0.30 numerical aperture objective lens) (Olympus; Tokyo, Japan).

[0111] Fluorescence and confocal laser scanning images were acquired using a Carl Zeiss Axio Observer Z1, AxioCam HRc camera, and LSM700 system (with EC Plan-Neofluar 10/0.30 numerical aperture objective lens) (Carl Zeiss, Gttingen, Germany). For imaging, 405 nm and 488 nm continuous-wave lasers and an HBO 100 illuminator were coupled with 420-465 nm and 500-550 nm filters (Carl Zeiss). ImageJ software was used for image processing.

Example 3

Human Dura Mater Cell (hDMC) Culture

[0112] Primary Culture Method

[0113] Dura mater tissues were washed three times with Hank's balanced saline solution (HBSS) [containing 1% (w/v) penicillin/streptomycin (P/S; Gibco, Grand Island, N.Y., USA)] to remove any blood clots and other contaminants. Then, the tissues were placed on a collagen-coated 100 mm culture dish, with the outer portion of the dura mater facing downward. The tissues were incubated in DMEM [containing 10% (v/v) fetal bovine serum (Gibco), 1% (w/v) P/S, and 1% (v/v) MEM nonessential amino acid supplement (Gibco)] at 37 C. in a 5% (v/v) carbon dioxide atmosphere. The cells were detached with Accutase (BD Biosciences, San Jose, Calif., USA) solution, followed by multiple washes with HBSS to isolate confluent cells. If the cells were not needed immediately, they were preserved in liquid nitrogen and then thawed using conventional methods. The isolated or thawed hDMCs were plated at a density of 2.010.sup.4 cells/well into collagen I-coated 6-well plates, with each well containing 4 mL medium. Cultivation of the tissues or cells was performed at 37 C. in a humidified atmosphere containing 5% (v/v) carbon dioxide. Collagen-coated dishes or plates were used for all procedures to cultivate dura mater tissues and hDMCs. Collagen-coated dishes and plates were prepared by adding 5 g/cm.sup.2 bovine collagen I (Gibco) at a concentration of 50 g/mL to 20 mM acetic acid. After the dishes or plates were left at room temperature for 1 hour, the solution was carefully aspirated, and the dishes or plates were washed three times with HBSS. The dishes and plates were either used immediately or stored at 4 C. until use.

[0114] Culture Results

[0115] The human dura mater tissue adhered sufficiently to the collagen-coated dishes and plates with 3 days of gentle compression (FIG. 1). After 3 days, hDMCs, which had a similar morphology to fibroblasts, appeared at the edge of the explanted tissues. The cells initially became elongated or formed multiple protruding pseudopods before migrating away from the tissue. After an average of 14 days, full confluence of the hDMCs was achieved with good viability (FIG. 2). Even after the frozen cells were thawed, the hDMCs had good viability with no specific alterations in morphology or growth until the fourth or fifth passage.

[0116] The isolated cells were strongly positive for vimentin, negative for cytokeratin and GFAP (glial fibrillary acidic protein), and weakly positive for synaptophysin, which implies that these cells had a fibroblast-like phenotype (FIG. 3).

[0117] In addition, the isolated cells were negative for S-100 protein and neuron-specific enolase. Based on the results, it was concluded that neuronal phenotype was not presented in the isolated cells (FIG. 4).

Example 4

Co-Culture of Activated Macrophage-Like THP-1 Cells (M) and Human Dura Mater Cells (hDMCs)

[0118] The human acute monocytic leukemia cell line THP-1 (Korea Cell Line Bank, Republic of Korea) was maintained in RPMI-1640 medium (Welgene) supplemented with 10% (v/v) fetal bovine serum (FBS, Gibco, Grand Island, N.Y.), 1% (w/v) penicillin/streptomycin (P/S; Gibco), and 0.05 mmol/L 2-mercaptoethanol (Sigma-Aldrich).

[0119] In order to differentiate THP-1 cells into macrophage-like cells, the medium was replaced with 4 ml DMEM [containing 10% (v/v) FBS, 1% (w/v) P/S, and 160 nmol/L phorbol 12-myristate 13-acetatate] 72 hours prior to co-culture and analysis.

[0120] For all experiments, hDMCs from the first or second passage were detached using Accutase (BD Biosciences, San Jose, Calif.), washed twice with HBSS, and plated into six-well plates at 2.010.sup.4 cells/well in 4 ml DMEM [containing 10% (v/v) FBS, 1% (w/v) P/S]. After 3 days, the medium was changed to 4 mL DMEM [containing 1% (v/v) FBS, 1% (w/v) P/S], and activated macrophage-like THP-1 cells (M) were detached using Accutase and added to the six-well culture plates in 1 ml DMEM containing 1% (v/v) FBS, 1% (w/v) P/S. After 24 hours, the medium was collected and stored at 80 C., and the cells were used for further experiments.

[0121] 4-1. Phenotypic Identification of THP-1 and Induction of Inflammation Response in Co-Cultured hDMCs

[0122] For phenotypic analysis of THP-1, direct immunofluorescence flow cytometric assay was conducted. FACS was performed using the LSR Fortessa X-20 cell analyzer (BD Biosciences, San Jose, Calif., USA) (FlowJo ver. 10 software (FlowJo, Ashland, Oreg., USA)).

[0123] For direct immunofluorescence flow cytometric assays, anti-CD14 mouse monoclonal IgG.sub.1-fluorescein isothiocyanate (ab28061; Abcam), anti-CD80 mouse monoclonal IgG.sub.1-phycocyanin (ab69778; Abcam), anti-CD163 mouse monoclonal IgG.sub.1-PE/Cy7 (ab233653; Abcam), and anti-mannose receptor (CD206) rabbit monoclonal IgG-allophycocyanin (ab223961; Abcam) antibodies were used.

[0124] As a result, macrophage-like THP-1 cells (M) showed decreased expression levels of CD14, CD163, and CD206 and an increased expression level of CD80 (Table 2). Macrophages are divided into M1 and M2 macrophages. M1 macrophages encourage inflammation and can be identified by their specific expression of the markers CD40, CD80, and CD86 while M2 macrophages show an anti-inflammatory effect and are characterized by the expression of the markers CD163 and CD206.

[0125] That is, the results indicate that the M of the present invention has a characteristic of M1 macrophages rather than the M2 macrophages.

TABLE-US-00002 TABLE 2 THP-1 cell M p value CD14 1.000 0.075 0.912 0.078 p < 0.001 CD80 1.000 0.920 1.176 0.160 p < 0.001 CD163 1.000 0.047 0.498 0.038 p < 0.001 CD206 1.000 0.034 0.262 0.028 p < 0.001

[0126] In order to determine whether an inflammatory response was induced in the co-cultured human dura mater cells, ELISA was performed for inflammatory cytokine change. Inflammatory responses were assayed for IL-1, IL-6, IL-12, and TNF- using DuoSet ELISA Development System kits (IL-1b: DY201, IL-6: DY206, IL-12: DY1270, TNF-: DY210).

[0127] As understood from the ELISA data, TNF- showed about 4-fold increased expression in the co-culture compared to the simple sum of the human dura mater cells and M (Table 3).

TABLE-US-00003 TABLE 3 hDMCs + Fold hDMCs M only M only Co-culture change IL-1 (pg/mL) 2.19 1.19 3.40 0.51 5.59 0.51 3.87 1.24 0.69 0.22 IL-6 (pg/mL) 6.87 3.11 3.67 1.48 10.5 1.48 16.4 7.54 1.56 0.72 TNF- (pg/mL) 0.94 0.29 0.90 0.53 1.83 0.53 7.25 0.63 ** 3.96 0.34 ** p < 0.01 (n = 3-6 per group, unpaired two-tailed t-test). All data are means standard error of the mean.

[0128] Taken together, the data of phenotype analysis for THP-1 cells and ELISA for secretary cytokines suggest that the co-culture of THP-1 cells and hDMCs had successfully induced an inflammatory response.

[0129] 4-2. Cytotoxicity Assay of Co-Culture of Activated Macrophage-Like THP-1 (M) and hDMCs

[0130] To assay adverse effects of inflammatory responses induced by the co-culture, measurements were made of cell viability of nave hDMCs, M, and co-cultured hDMCs.

[0131] To evaluate cell viability, EZ-Cytox cell viability assay kit (Daeillab Service Ltd., Seoul, Republic of Korea) was used according to the manufacturer's instructions. Water-soluble tetrazolium salt (WST) reagent was added to each well. After 1 hour of incubation, the absorbance of the supernatant was measured at the wavelength of 450 nm on a microplate absorbance reader. The viability was assessed by normalized absorbance values.

[0132] Furthermore, flow cytometry was used as an additional experiment to evaluate cell viability. Reference may be made to Example 6 with respect to flow cytometry.

[0133] As measured by the cell viability assay kit, cell viability of co-cultured hDMCs was reduced by 28.0% compared to the nave (1.000.09 for nave, 0.720.12 for co-cultured; p<0.001).

[0134] However, flow cytometry analysis showed a 5.5% decrease in live cells ratio of the co-cultured hDMCs, compared the nave cells (54.4% for nave and 48.9% for co-cultured) (FIG. 5).

[0135] The serum starvation process which had performed 24 hours before the initiation of co-culturing and the ratio increment of early apoptosis cells upon co-culture (9.53% for nave and 23.8% for co-culture) might have an influence on the result of cell viability assay.

[0136] Based on results of the flow cytometry, the inflammatory response induced by the co-culture might not greatly influence the apoptosis and might be acceptable to proceed the following experiments.

Example 5

Assay for Adhesion of hDMCs to ECM

[0137] Collagen is the most abundant protein in vivo, and it plays major roles in cellular function. For example, collagen I is a major extracellular matrix (ECM) component produced by fibroblasts during wound healing, and collagen IV is involved in various cellular interactions. In addition, fibronectin, which is produced by both fibroblasts and macrophages, also contribute to fibroblast chemotaxis during inflammation.

[0138] Hence, evaluation was made of the involvement of fibronectin, collagens I and IV, laminin I, and fibrinogen, which are major components of the ECM related to cell adhesion, in hDMCs.

[0139] 5-1. Adhesion Assay for Ability of hDMCs to Adhere to ECM

[0140] Adhesion assays identifying ECM components adhering to hDMC were performed using CytoSelect 48-well cell adhesion assay kits (Cell Biolabs Inc., San Diego, Calif.).

[0141] After detachment of nave hDMCs and M-co-cultured hDMCs, cell suspensions were prepared in serum-free DMEM. A total of 1.510.sup.3 cells in 150 l serum-free medium were added to each well and incubated for 1 hour at 37 C. After removal of the medium, the cells were washed four times with 150 l PBS.

[0142] Cell staining and protein extraction were performed according to the manufacturer's instructions. Cellular adhesion was assessed by measuring the optical density at 560 nm on a Gemini XPS Microplate Reader (Molecular Devices, Sunnyvale, Calif.).

[0143] The nave hDMCs exhibited partial staining for collagen I and IV in the adhesion assay. In addition, increased staining for collagen I and IV was observed in the hDMCs co-cultured with M, compared to the nave hDMCs (FIG. 6).

[0144] Absorbance analysis quantitated the adhesion of nave hDMCs to EMC components, revealing that the nave hDMCs adhered through collagen I (2.000.84), collagen IV (2.551.22), and fibronectin (1.290.25) (p<0.01), but with no significant values for laminin I (1.010.08) or fibrinogen (0.960.05) (FIG. 7).

[0145] Adhesion of hDMCs was increased through all ECM components in the M-co-cultured hDMCs (FIG. 8, p<0.001). Specifically, the adhesion of the co-cultured hDMCs increased by 6.4-fold (12.802.12) through collagen I and by 5.0-fold (12.70479) through collagen IV, 1.6-fold (2.040.56) through fibronectin, by 1.6-fold (1.550.39) through laminin I, and by 3.1-fold (2.991.74) through fibrinogen, compared with the adhesion of nave cells.

[0146] 5-2. Western Blot Analysis for FAK Expression in Co-Cultured hDMCs

[0147] To specifically determine whether inflammation increases the adhesion of hDMCs, levels of focal adhesion kinase (FAK), which is a factor associated with cell adhesion, migration, and viability were analyzed via western blotting.

[0148] Cell lysates from nave hDMCs and M-co-cultured hDMCs were subjected to western blot analysis to evaluate the expression of FAK.

[0149] As primary antibodies for the western blotting, an anti-FAK antibody (ab40794, 1:1,000; Abcam, Cambridge, Mass., USA), and anti-GAPDH antibody (sc-47724, 1:1,000; Santa Cruz Biotechnology, Dallas, Tex., USA) were used.

[0150] The secondary antibodies were horseradish peroxidase (HRP)-conjugated goat anti-rabbit and anti-mouse polyclonal IgG antibodies (anti-rabbit: GTX213110-01, 1:500; anti-mouse: GTX213111-01, 1:500; GeneTex, Irvine, Calif., USA).

[0151] FAK expression increased about 1.5-fold in the co-cultured cells (1.510.59) compared to the nave cells (1.000.77) (FIGS. 9 and 10). The data indicate that an increase in FAK level of the co-cultured cells drives the activation of cell adhesion.

Example 6

Flow Cytometry Assay for Role of Integrin Subtype in hDMC Adhesion Upon Inflammatory Response

[0152] Because integrins play an important role in cell adhesion to ECM components, hDMC integrin expression was investigated.

[0153] The roles of integrin subtypes in the adhesion of hDMCs in inflammation were analyzed by Annexin V-fluorescein isothiocyanate/propidium iodide apoptosis assay, specifically, by fluorescence-activated cell sorting (FACS) using BD Pharmingen FITC Annexin V Apoptosis Detection Kit I (CAT No. 556547, BD Biosciences). For phenotypic analysis of hDMCs, direct and indirect immunofluorescence labeling and FACS analysis were performed using the LSR Fortessa X-20 cell analyzer (BD Biosciences) running FlowJo ver. 10 software (FlowJo, Ashland, Oreg., USA).

[0154] In this regard, the primary antibodies used were anti-integrin .sub.1 and anti-integrin .sub.2.sub.1 (anti-integrin .sub.1: ab34445, anti-integrin .sub.2.sub.1: ab30483; Abcam), anti-integrin .sub.V.sub.3 (bs-1310R; Bioss Antibodies, Woburn, Mass., USA), and anti-integrin .sub.IIb.sub.3 (MA1-21188; Thermo Fisher Scientific).

[0155] Mouse IgG.sub.1 monoclonal and rabbit IgG monoclonal antibodies (mouse IgG.sub.1: ab81032, rabbit IgG: ab199376; Abcam) were used for the isotype control.

[0156] The secondary antibodies included goat anti-mouse IgG APC and anti-rabbit IgG-APC polyclonal IgG antibodies (anti-mouse IgG-APC: A865, anti-rabbit IgG-APC: A-10931; Thermo Fisher Scientific).

[0157] 6-1. Assay for Cell Viability of Nave hDMCs by Flow Cytometry

[0158] The nave hDMCs were evaluated to be alive at a rate of 75.2%, as measured by the Annexin V-fluorescein isothiocyanate/propidium iodide apoptosis assay. Following cell gating, a population composed of more than 95% live cells was selected for integrin analysis (FIG. 11). This cell gating was also applied for other analyses. In the population selected through cell gating, expressions of integrin subtypes were evaluated.

[0159] 6-2. Assay for Integrin Subtype Expression in Nave hDMCs by Flow Cytometry

[0160] The direct immunofluorescence labeling and FACS results showed that integrins 1, 21, and IIb3 were expressed at higher levels than V3. Expressing cells were counted to be 192.4149.9 for integrin 1, 97.4177.6 for integrin 21, 43.4154.2 for integrin IIb3, and 4.410.0 for integrin V3 (FIG. 12).

[0161] From the results, it was understood that nave hDMCs expressed integrins 1 and 21 at higher levels than integrin IIb3 and V3.

[0162] 6-3. Assay for Relationship Between Inflammation and Integrin Subtype Expression by Flow Cytometry

[0163] To determine the relationship between inflammation and integrin expression, the expression of integrins was compared between M-co-cultured and nave cells (FIG. 13). Compared with nave cells, the co-cultured cells increased the expression of integrin 21 by 6.3-fold (142.7222.8 for nave and 898.8859.1 for co-cultured; p<0.001) and IIb3 by 2-fold (32.764.7 for nave and 65.894.8 for co-cultured; p<0.001) (FIG. 14), but decreased the expression of integrin 1 by 2-fold (196.9261.8 for nave and 100.2135.1 for co-cultured; p<0.001). There were almost no differences in the expression level of integrin V3 therebetween (4.111.4 for nave and 4.149.9 for co-cultured).

[0164] The co-cultured cells in inflammation exhibited an increased expression level of integrin 21 among others, compared with nave cells, and integrin 21 was understood to play a critical role in cell adhesion.

Example 7

Functional Validation of Integrin 21 by Treatment with Intedrin 21 Inhibitor

[0165] For the functional validation of integrin 21 in the adhesion of hDMCs, cell viability and adhesion assays of hDMCs were performed with treatment of the selective integrin 21 inhibitor BTT 3033.

[0166] 7-1. Cytotoxicity Assay of BTT 3033

[0167] For cytotoxicity assay of BTT 3033, hDMCs were treated with BTT 3033 in a dose dependent manner and incubated at 37 C. for 90 min. After incubation, cell viability assay was performed.

TABLE-US-00004 TABLE 4 BTT 3033 concentration (nM) Viability (A.U.) 0 (control) 1.000 0.090 16.25 0.896 0.090 32.50 0.844 0.099 65.00 0.899 0.075 130.00 0.800 0.054 260.00 0.854 0.081 520.00 0.827 0.069

[0168] The cytotoxicity of BTT 3033 was found to be less than 20.0% at a concentration from 16.25 to 520.00 nM (FIG. 15, Table 4). Since BTT 3033 has a half maximal effective concentration (EC.sub.50) at 130 nM according to manufacturer's instructions, 130 nM was determined as the therapeutic dose.

[0169] 7-2. Functional Validation of Integrin a21 by Treatment with Integrin 21 Inhibitor

[0170] For an adhesion assay for the functional validation of integrin 21, the co-cultured hDMCs were incubated with 130 nM BTT 3033 at 37 C. for 30 min. After incubation, an adhesion assay was performed as described above.

[0171] The treatment with BTT3033 reduced the adhesion of the co-cultured hDMCs to collagen I by 37.8% (0.430.03 for un-treated and 0.270.04 for BTT 3033-treated; p<0.001) and to collagen IV by 35.7% (0.440.08 for un-treated and 0.280.08 for BTT 3033-treated; p=0.057) (FIG. 16).

[0172] The data shows the reduced adhesion of hDMCs to the ECM components collagen I and IV by treatment with the integrin 21 inhibitor BTT 3033, suggesting that the inhibition of integrin 21 leads to a reduction in the adhesion of hDMCs in inflammation.

Example 8

ELISA Assay for Levels of MMPs, TIMPs and VEGF in hDMCs

[0173] MMP1 mainly interacts with collagens I, II, III, VII, and X, and has an influence on tissue regeneration as well as tissue degradation. MMP3 interacts with collagens IV, V, IX, and X, laminin, and fibronectin, acting as a mediator of inflammation-mediated tissue degradation. TIMP is known to be an endogenous inhibitor of MMPs and a regulator of cell proliferation and apoptosis. In addition, VEGF is a factor responsible for angiogenesis associated with wound healing.

[0174] Levels of Matrix metalloproteinases (MMPs), tissue inhibitors of metalloproteinases (TIMPs), and vascular endothelial growth factor (VEGF) in nave hDMCs and M-co-cultured hDMCs were measured by ELISA.

[0175] Media from nave hDMC cultures, M cultures, and co-cultures of M and hDMCs were assayed. Levels of MMP-1, MMP-3, MMP-9, MMP-2, TIMP-1, TIMP-2, and VEGF were assayed using DuoSet ELISA Development System kits (MMP-1: DY901, MMP-3: DY513, MMP-9: DY911, MMP-2: DY902, TIMP-1: DY970, TIMP-2: DY971, and VEGF: DY293B; R&D Systems).

[0176] Nave hDMCs were measured to be lower in MMP-1 and MMP-9 levels, but higher in TIMP-1 and TIMP-2 levels than M (p<0.01). However, there were no statistical differences between the basal levels of MMP-3, MMP-2, or VEGF therebetween (FIG. 17, Table 5). To investigate changes in MMPs, TIMPs, and VEGF during inflammation, comparison was made of the levels among the co-cultured cells, the nave hDMC, and the M (FIG. 18). Co-culturing of hDMCs with M induced significant increases in MMP-1, MMP-3, and VEGF expression compared with nave hDMCs and M alone (MMP-1: 13.9-fold change, p<0.01; MMP-3: 7.6-fold change, p<0.01; VEGF: 3.8-fold change, p<0.05). In contrast, there were no changes in MMP-2, TIMP-1, and TIMP-2 expression between groups, and the expression of MMP-9 appeared to decrease.

[0177] Taken together, the results show that MMP-1 and MMP-3, together with integrin 21, play a critical role in hDMC adhesion.

[0178] In the co-cultured cells, no changes in TIMP-1 were detected whereas increased levels of MMP-1 and MMP-3 were measured. Such experiment results implicate that the change of MMP is not attributed to TIMP, but driven by the interaction between hDMCs and M.

[0179] Moreover, a wound healing process is understood to progress through the interaction between hDMCs and M when considering the increase level of VEGF.

TABLE-US-00005 TABLE 5 hDMCs Co-cultured Fold (nave) M hDMCs + M hDMCs change MMP-1 (ng/ml) 1.1 0.8 3.8 2.5 4.9 2.3 68.6 13.1 13.9 2.6 MMP-3 (pg/ml) 11.1 9.1 14.1 8.8 25.2 10.0 190.5 45.1 7.6 1.8 MMP-9 (pg/ml) 0 4,933.3 1,887.6 4,933.3 1,887.6 481.9 320.7 0.1 0.1 MMP-2 (pg/ml) 180.5 69.0 141.2 18.2 321.7 67.9 319.5 144.2 1.0 0.4 TIMP-1 (ng/ml) 23.9 2.7 9.3 3.8 33.3 5.7 37.7 3.46 1.1 0.1 TIMP-2 (ng/ml) 9.1 2.1 1.2 0.5 10.2 2.6 7.2 3.3 0.7 0.3 VEGF (pg/ml) 125.8 30.0 182.9 108.2 308.7 136.5 1,163.4 795.3.sup. 3.8 2.6

Example 9

qRT-PCR Assay for Levels of MMPs, TIMPs and VEGF in hDMCs

[0180] RNA was isolated from the nave hDMCs, the M, and the co-cultured hDMCs, using RNeasy Mini Kit (QIAGEN, Valencia, Calif.). Concentration and purity of RNA were determined using Nanodrop 2000 (Thermo Fisher Scientific, Waltham, Mass., USA). The complementary DNA was synthesized from the RNA with the aid of a Maxime RT PreMix Kit (iNtRON Biotechnology, Gyeonggi-do, Korea). The primers for GAPDH, MMP-1, and MMP-3 were used (Table 6).

TABLE-US-00006 TABLE6 SEQ ID Gene Direction Sequence NO: GAPDH sense GTGAACCATGAGAAGTATGACAA 1 antisense CATGAGTCCTTCCACGATAC 2 MMP-1 sense CTGAAGGTGATGAAGCAGCC 3 antisense AGTCCAAGAGAATGGCCGAG 4 MMP-3 sense CTCACAGACCTGACTCGGTT 5 antisense CACGCCTGAAGGAAGAGATG 6

[0181] To determine which cells of hDMCs or M induced such statistical changes, qRT-PCR analysis was performed. Using 2.sup.Ct method, mRNA expression fold change ratios between the individual cell groups and the co-cultured cells were calculated for each of MMP-1 (1.201.76 for M and 4.582.79 for hDMCs) and MMP3 (68.279.28 for M and 1.020.96 for hDMCs) (FIG. 17).

[0182] From the results, it was found that the increased expression of MMP-1 was affected by both hDMCs and M whereas the increased expression of MMP-3 was attributed mainly to M. In addition, the expression of MMP-9 was measured to decrease. Thus, the data imply that the expression of MMP-9 is downregulated in hDMCs, whereby the adhesion of hDMCs is affected.

[0183] Discussion

[0184] hDMC adhesion to ECM is crucial for determining the prognosis after treatment of spinal disease. In this disclosure, hDMC adhesion was examined through experiments.

[0185] In the disclosure, it was found that collagen I and IV are critical components responsible for hDMC adhesion and that pathological conditions related to dura mater inflammation are influenced by increases in integrin subtype a2b1, MMP-1, and MMP3, and decreases in integrin 1 and MMP-9.

[0186] These findings may be helpful for the treatment of diseases related to dura mater adhesion. Particularly, integrin 21 can be a therapeutic target for hDMC adhesion and fibrosis in inflammatory conditions and the inhibition of integrin 21 will lead to a therapeutic effect thereon.