SIDE CHAIN MODIFIED PEPTOIDS USEFUL AS STRUCTURE-STABILIZING COATINGS FOR BIOMATERIALS
20210070886 ยท 2021-03-11
Inventors
- Shih-Ting Wang (Mastic, NY, US)
- Oleg Gang (Setauket, NY, US)
- Ronald N. Zuckermann (El Cerrito, CA)
- Carolyn R. Bertozzi (Menlo Park, CA, US)
Cpc classification
A61K47/62
HUMAN NECESSITIES
B82Y5/00
PERFORMING OPERATIONS; TRANSPORTING
A61K47/549
HUMAN NECESSITIES
A61K47/42
HUMAN NECESSITIES
C07K17/06
CHEMISTRY; METALLURGY
A61K47/6855
HUMAN NECESSITIES
A61K47/6929
HUMAN NECESSITIES
A61K47/6923
HUMAN NECESSITIES
International classification
C07K17/06
CHEMISTRY; METALLURGY
A61K47/69
HUMAN NECESSITIES
Abstract
The current invention pertains compositions and methods to generate compositions providing stability to biomolecules, including providing physiologically stable and functional DNA origami-based drug/gene delivery carriers by surface coating with the oligo-ethylene glycol conjugated peptoids of Formulas (I), (II), and (III).
Claims
1. A composition for stabilizing a biomaterial, said composition comprising a compound of Formula (I)
T.sub.1-[A.sub.m-E.sub.n].sub.b1-[G.sub.p-J.sub.q].sub.b2-[L.sub.r-M.sub.s].sub.b3-[Q.sub.t-U.sub.u].sub.b4-T.sub.2(I) wherein A is ##STR00088## E is ##STR00089## G is ##STR00090## J is ##STR00091## L is ##STR00092## M is ##STR00093## Q is ##STR00094## U is ##STR00095## m, n, p, q, r, s, t, and u are independently 0, 1, 2, 3, 4, or 5; b1, b2, b3, and b4 are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, R.sub.8 are independently H, OH, (C.sub.1-C.sub.8)alkyl, (C.sub.2-C.sub.6)alkenyl, (C.sub.2-C.sub.6)alkynyl, (C.sub.1-C.sub.8)alkoxy, (C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkyl, (C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkyl, ((CH.sub.2).sub.1-8O).sub.1-14CH.sub.3, ((CH.sub.2).sub.1-8O).sub.1-14-alkyl, (C.sub.1-C.sub.8)alkylene-C(O)OH, (C.sub.1-C.sub.8)alkylene-SO.sub.1-3H.sub.1-2, (C.sub.1-C.sub.8)alkylene-PO.sub.1-3H.sub.1-2, (C.sub.1-C.sub.8)alkylene-SO.sub.2NH.sub.2, (C.sub.1-C.sub.8)alkoxy, (C.sub.1-C.sub.6)alkylene-(NH)NR.sub.10R.sub.11, (C.sub.1-C.sub.8)alkylene-NR.sub.12R.sub.13, (C.sub.1-C.sub.8)alkylene-C(O)NR.sub.14R.sub.15, or (C.sub.1-C.sub.6)alkylene-R.sub.16, where alkyl, alkenyl, alkynyl, alkylene, and alkoxy are optionally substituted with one or more substituent each independently selected from (C.sub.1-C.sub.3)alkyl, oxo, NH.sub.2, COOH, halogen, hydroxyl, methoxy, ethoxy, N.sub.3, biotinyl, sulfhydryl, cyano, hydrazido, carbodiimide, succinimide, or maleimide; T.sub.1 is ##STR00096## or H; T.sub.2 is ##STR00097## H, OH, or NH.sub.2; T.sub.1.1, T.sub.1.2, T.sub.1.3, T.sub.2.1, and T.sub.2.2 are independently R.sub.1, R.sub.8, (C.sub.1-C.sub.6)alkylene(NR.sub.17R.sub.18), NR.sub.14R.sub.15, (C.sub.1-C.sub.6)alkylene-C(O)R.sub.16, C(O)(C.sub.1-C.sub.6)alkyl, C(O)NR.sub.17R.sub.18, SO.sub.2, OH, SH, COOH, (C.sub.1-C.sub.6)alkylene-N3, (C.sub.2-C.sub.6)alkynyl, or alkyl, alkenyl, alkynyl, alkylene, or alkoxy that is substituted with at least one of biotinyl, sulfhydryl, cyano, hydrazido, carbodiimide, halo, succinimide, and maleimide; R.sub.16 is partially or fully saturated (C.sub.3-C.sub.8)carbocyclic, phenyl, 4- to 8-membered heterocycle containing 1 to 4 heteroatoms each independently selected from O, S, or N, 5- to 7-membered heteroaryl containing 1 to 3 heteroatoms each independently selected from O, N, or S, where R.sub.16 is optionally substituted with one or more substituents each independently selected from (C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkyl-NH.sub.2, (C.sub.1-C.sub.3)alkoxy, halogen, hydroxyl, C(O)NH.sub.2, COOH, or CN; and R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, R.sub.16, R.sub.17, and R.sub.18 are each independently H, (C.sub.1-C.sub.6)alkyl, (C.sub.2-C.sub.6)alkenyl, (C.sub.2-C.sub.6)alkynyl, or halo-substituted (C.sub.1-C.sub.6)alkyl; wherein R.sub.1-R.sub.8, each defines a submonomer, and wherein Formula (I) defines a peptoid.
2. The composition according to claim 1, wherein R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are independently (CH.sub.2)C.sub.2alkyne, ((CH.sub.2).sub.2O)CH.sub.3, ((CH.sub.2).sub.2O).sub.3CH.sub.3, or (CH.sub.2).sub.2NH.sub.2.
3. The composition according to of claim 1, wherein at least one of R.sub.1-R.sub.4 comprise a positively charged group; and R.sub.5-R.sub.8 do not comprise a positively charged group.
4. The composition according to claim 1, wherein R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, and R.sub.8 are independently selected from the group consisting of (CH.sub.2).sub.2NH.sub.2, (CH.sub.2).sub.3NH.sub.2, (CH.sub.2).sub.4NH.sub.2, (CH.sub.2).sub.5NH.sub.2, (CH.sub.2).sub.6NH.sub.2, (CH.sub.2).sub.7NH.sub.2, (CH.sub.2).sub.8NH.sub.2, (CH.sub.2)C.sub.2alkyne, ((CH.sub.2).sub.2O)CH.sub.3, ((CH.sub.2).sub.2O).sub.3CH.sub.3, and (C.sub.1-C.sub.6)alkylene-N.sub.3.
5. A composition for stabilizing a biomaterial, said composition comprising a compound of Formula (II)
T.sub.1-[X.sub.b1Y.sub.b2Z.sub.b3].sub.n-T.sub.2(II) wherein X is ##STR00098## Y is ##STR00099## Z is ##STR00100## T.sub.1 is ##STR00101## or H; and T.sub.2 is ##STR00102## H, OH, or NH.sub.2; wherein, n is 1, 2, 3, 4, or 5; b1, b2, and b3 are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, and 20; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, are independently H, OH, (C.sub.1-C.sub.8)alkyl, (C.sub.2-C.sub.6)alkenyl, (C.sub.2-C.sub.6)alkynyl, (C.sub.1-C.sub.8)alkoxy, (C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkyl, (C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkyl, ((CH.sub.2).sub.1-8O).sub.1-14CH.sub.3, ((CH.sub.2).sub.1-8O).sub.1-14-alkyl, (C.sub.1-C.sub.8)alkylene-C(O)OH, (C.sub.1-C.sub.8)alkylene-SO.sub.1-3H.sub.1-2, (C.sub.1-C.sub.8)alkylene-PO.sub.1-3H.sub.1-2, (C.sub.1-C.sub.8)alkylene-SO.sub.2NH.sub.2, (C.sub.1-C.sub.8)alkoxy, (C.sub.1-C.sub.6)alkylene-(NH)NR.sub.10R.sub.11, (C.sub.1-C.sub.8)alkylene-NR.sub.12R.sub.13, (C.sub.1-C.sub.8)alkylene-C(O)NR.sub.14R.sub.15, or (C.sub.1-C.sub.6)alkylene-R.sub.16, where alkyl, alkenyl, alkynyl, alkylene, and alkoxy are optionally substituted with one or more substituent each independently selected from (C.sub.1-C.sub.3)alkyl, oxo, NH.sub.2, COOH, halogen, hydroxyl, methoxy, ethoxy, N.sub.3, biotinyl, sulfhydryl, cyano, hydrazido, carbodiimide, succinimide, or maleimide; R.sub.16 is partially or fully saturated (C.sub.3-C.sub.8)carbocyclic, phenyl, 4- to 8-membered heterocycle containing 1 to 4 heteroatoms each independently selected from O, S, or N, 5- to 7-membered heteroaryl containing 1 to 3 heteroatoms each independently selected from O, N, or S, where R.sub.16 is optionally substituted with one or more substituents each independently selected from (C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkyl-NH.sub.2, (C.sub.1-C.sub.3)alkoxy, halogen, hydroxyl, C(O)NH.sub.2, COOH, or CN; T.sub.1.1, T.sub.1.2, T.sub.1.3, T.sub.2.1, and T.sub.2.2 are independently R.sub.1, R.sub.6, (C.sub.1-C.sub.6)alkylene(NR.sub.17R.sub.18), NR.sub.14R.sub.15, (C.sub.1-C.sub.6)alkylene-C(O)R.sub.16, C(O)(C.sub.1-C.sub.6)alkyl, C(O)NR.sub.17R.sub.18, SO.sub.2, OH, SH, COOH, (C.sub.1-C.sub.6)alkyl azide, (C.sub.2-C.sub.6)alkynyl, or alkyl, alkenyl, alkynyl, alkylene, or alkoxy that is substituted with at least one of biotinyl, sulfhydryl, cyano, hydrazido, carbodiimide, halo, succinimide, and maleimide; and R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, R.sub.16, R.sub.17, and R.sub.18 are each independently H, (C.sub.1-C.sub.6)alkyl, (C.sub.2-C.sub.6)alkenyl, (C.sub.2-C.sub.6)alkynyl, or halo-substituted (C.sub.1-C.sub.6)alkyl; wherein R.sub.1-R.sub.6, each defines a submonomer, and wherein Formula (II) defines a peptoid.
6. A composition for stabilizing a biomaterial, said composition comprising a compound of Formula (III): ##STR00103## wherein r is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 50, 100, or 200; T.sub.1 is ##STR00104## or H; and T.sub.2 is ##STR00105## H, OH, or NH.sub.2; wherein T.sub.1.1, T.sub.1.2, T.sub.1.3, T.sub.2.1, and T.sub.2.2 are independently (CH.sub.2)NH.sub.2, ((CH.sub.2).sub.2O).sub.3CH.sub.3, (C.sub.1-C.sub.6)alkylene(NR.sub.17R.sub.18), NR.sub.14R.sub.15, (C.sub.1-C.sub.6)alkylene-C(O)R.sub.16, C(O)(C.sub.1-C.sub.6)alkyl, C(O)NR.sub.17R.sub.18, SO.sub.2, OH, SH, COOH, (C.sub.1-C.sub.6)alkylene-azide, (C.sub.2-C.sub.6)alkynyl, or alkyl, alkenyl, alkynyl, alkylene, or alkoxy that is substituted with at least one of biotinyl, sulfhydryl, cyano, hydrazido, carbodiimide, halo, succinimide, and maleimide; and R.sub.14, R.sub.15, R.sub.16, R.sub.17, and R.sub.18 are each independently H, (C.sub.1-C.sub.6)alkyl, (C.sub.2-C.sub.6)alkenyl, (C.sub.2-C.sub.6)alkynyl, or halo-substituted (C.sub.1-C.sub.6)alkyl; wherein formula (III) defines a peptoid.
7. The composition according to claim 1, wherein Formula (I) comprises: ##STR00106## ##STR00107## ##STR00108## ##STR00109##
8. The composition according to claim 1, wherein the compound of Formula (I), is conjugated to an antibody, imaging reagent, biomaterial, biomolecule, glycan, polymer, or a peptoid.
9. A drug delivery carrier comprising a pre-defined nucleic acid nanostructure and a compound of Formula (I), (II), or (III).
10. A stabilized complex comprising: a pre-defined nucleic acid nanostructure; a compound of Formula (I), (II), or (III); and a drug molecule or protein.
11. The stabilized complex according to claim 10, wherein an antibody is conjugated to the compound of Formula (I), (II), or (III).
12. A method of stabilizing a pre-defined nucleic acid nanostructure, said method comprising: (i) complexing a pre-defined nucleic acid nanostructure with a composition comprising a compound of Formula (I), (II), or (III).
13. The method according to claim 12, wherein complexing comprises: (i) contacting pre-defined nucleic acid nanostructure composition with a compound of Formula (I), (II), or (III).
14. The method according to claim 12 wherein the pre-defined nucleic acid nanostructure is coated with a compound according to any of Formulas (I), (II), or (III), wherein one terminal end of Formula (I), (II), or (III) is conjugated to the pre-defined nucleic acid structure and one terminal end of Formula (I), (II), or (III) is conjugated to a nucleic acid, protein, a different pre-defined nucleic acid nanostructure, a small molecule therapeutic, or a protein therapeutic.
15. A stabilized nanoparticle complex comprising: a nanoparticle; and a compound according to Formula (I), (II), or (III).
16. The stabilized nanoparticle according to claim 15, wherein the nanoparticle comprises silver or gold.
17. The stabilized nanoparticle according to claim 15, wherein the compound according to Formula (I), (II), or (III) comprises: ##STR00110##
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
DETAILED DESCRIPTION
[0077] The present invention relates to compositions and methods for the stabilization of biomaterials.
[0078] As used herein, compositions of the present invention for stabilization of biomaterials are referred to as peptoids. In other words, the peptoids of the present invention can also be referred to as a series of N-substituted glycines. Peptoids according to the present invention are exemplified by Formulas (I), (II), and (III) described herein.
[0079] In one embodiment, the composition of the invention includes a compound of Formula (I).
T.sub.1-[A.sub.m-E.sub.n].sub.b1-[G.sub.p-J.sub.q].sub.b2-[L.sub.r-M.sub.s].sub.b3-[Q.sub.t-U.sub.u].sub.b4-T.sub.2(I)
wherein
A is
[0080] ##STR00019##
E is
[0081] ##STR00020##
G is
[0082] ##STR00021##
J is
[0083] ##STR00022##
L is
[0084] ##STR00023##
M is
[0085] ##STR00024##
Q is
[0086] ##STR00025##
U is
[0087] ##STR00026##
wherein m, n, p, q, r, s, t, and u are independently 0, 1, 2, 3, 4, or 5;
b1, b2, b3, and b4 are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20;
R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7, R.sub.8 are independently H, OH, (C.sub.1-C.sub.8)alkyl, (C.sub.2-C.sub.6)alkenyl, (C.sub.2-C.sub.6)alkynyl, (C.sub.1-C.sub.8)alkoxy, (C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkyl, (C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkyl, ((CH.sub.2).sub.1-8O).sub.1-14CH.sub.3, ((CH.sub.2).sub.1-8O).sub.1-14-alkyl, (C.sub.1-C.sub.8)alkylene-C(O)OH, (C.sub.1-C.sub.8)alkylene-SO.sub.1-3H.sub.1-2, (C.sub.1-C.sub.8)alkylene-PO.sub.1-3H.sub.1-2, (C.sub.1-C.sub.8)alkylene-SO.sub.2NH.sub.2, (C.sub.1-C.sub.8)alkoxy, (C.sub.1-C.sub.6)alkylene-(NH)NR.sub.10R.sub.11, (C.sub.1-C.sub.8)alkylene-NR.sub.12R.sub.13, (C.sub.1-C.sub.8)alkylene-C(O)NR.sub.14R.sub.15, or (C.sub.1-C.sub.6)alkylene-R.sub.16, where alkyl, alkenyl, alkynyl, alkylene, and alkoxy are optionally substituted with one or more substituent each independently selected from (C.sub.1-C.sub.3)alkyl, oxo, NH.sub.2, COOH, halogen, hydroxyl, methoxy, ethoxy, N3, biotinyl, sulfhydryl, cyano, hydrazido, carbodiimide, succinimide, or maleimide;
T.SUB.1 .is
[0088] ##STR00027##
or H;
T.SUB.2 .is
[0089] ##STR00028##
H, OH, or NH.SUB.2.;
[0090] T.sub.1.1, T.sub.1.2, T.sub.1.3, T.sub.2.1, and T.sub.2.2 are independently R.sub.1, R.sub.8, (C.sub.1-C.sub.6)alkylene(NR.sub.17R.sub.18), NR.sub.14R.sub.15, (C.sub.1-C.sub.6)alkylene-C(O)R.sub.16, C(O)(C.sub.1-C.sub.6)alkyl, C(O)NR.sub.17R.sub.18, SO.sub.2, OH, SH, COOH, (C.sub.1-C.sub.6)alkylene N.sub.3, (C.sub.2-C.sub.6)alkynyl, or alkyl, alkenyl, alkynyl, alkylene, or alkoxy that is substituted with at least one of biotinyl, sulfhydryl, cyano, hydrazido, carbodiimide, halo, succinimide, and maleimide;
wherein R1-R8, each defines a submonomer,
R.sub.16 is partially or fully saturated (C.sub.3-C.sub.8)carbocyclic, phenyl, 4- to 8-membered heterocycle containing 1 to 4 heteroatoms each independently selected from O, S, or N, 5- to 7-membered heteroaryl containing 1 to 3 heteroatoms each independently selected from O, N, or S, where R.sub.16 is optionally substituted with one or more substituents each independently selected from (C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkyl-NH.sub.2, (C.sub.1-C.sub.3)alkoxy, halogen, hydroxyl, C(O)NH.sub.2, COOH, or CN; and
R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, R.sub.16, R.sub.17, and R.sub.18 are each independently H, (C.sub.1-C.sub.6)alkyl, (C.sub.2-C.sub.6)alkenyl, (C.sub.2-C.sub.6)alkynyl, or halo-substituted (C.sub.1-C.sub.6)alkyl;
wherein Formula (I) defines a peptoid, and
wherein T.sub.1 and T.sub.2 define terminal groups.
[0091] For purposes of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa.
[0092] As used herein, the term alkyl refers to a fully saturated branched or unbranched hydrocarbon moieties having up to 12 carbon atoms. Unless otherwise provided, alkyl refers to hydrocarbon moieties having 1 to 12 carbon atoms, 1 to 8 carbon atoms, 1 to 6 carbon atoms (i.e., (C.sub.1-C.sub.6)alkyl), or 1 to 3 carbon atoms (i.e., (C.sub.1-C.sub.3)alkyl). Representative examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, neopentyl, 3,3-dimethylpropyl, hexyl, 2-methylpentyl, and the like.
[0093] As used herein, alkylene or alkylenyl refers to a branched or unbranched alkyl (as defined herein) chain having two free radicals available for bonding. Alkylene refers to divalent alkyl group as defined herein above having 1 to 12 carbon atoms. Unless otherwise provided, alkylene refers to moieties having 1 to 12 carbon atoms, 1 to 8 carbon atoms, 1 to 6 carbon atoms, or 1 to 3 carbon atoms. For example, methylene or methylenyl (e.g, CH.sub.2), ethylene or ethylenyl (e.g, CH.sub.2CH.sub.2 or CH(CH.sub.3)), propylene or propylenyl (e.g., CH.sub.2CH.sub.2CH.sub.2, CH(CH.sub.3)CH.sub.2, CH.sub.2CH(CH.sub.3), or C(CH.sub.3).sub.2. Representative examples of alkylene further include, but are not limited to (CH.sub.2CH.sub.2CH.sub.2CH.sub.2, CH(CH.sub.3)CH.sub.2CH.sub.2, CH.sub.2CH(CH.sub.3)CH.sub.2, C(CH.sub.3)(CH.sub.3)CH.sub.2), and the like.
[0094] As used herein, the term alkenyl refers to a monovalent group derived from a hydrocarbon having at least one carbon-carbon double bond. The term C.sub.2-C.sub.6-alkenyl refers to a monovalent group derived from a hydrocarbon having two to six carbon atoms and comprising at least one carbon-carbon double bond. The alkenyl group can be unbranched or branched. Representative examples of alkenyl include vinyl, 1-propenyl, 2-propenyl, 1-methyl-1-propenyl, 1-methyl-2-propenyl, 2-methyl-1-propenyl, 2-methyl-2-propenyl, 1-butenyl, 2-butenyl, 3-butenyl, and so on.
[0095] As used herein, the term alkynyl refers to a monovalent group derived from a hydrocarbon having at least one carbon-carbon triple bond. The term (C.sub.2-C.sub.6)alkynyl refers to a monovalent group derived from a hydrocarbon having 2 to 6 carbon atoms and comprising at least one carbon-carbon triple bond. The alkynyl group can be unbranched or branched. Representative examples include ethynyl, propynyl, butyn-1-yl, butyn-2-yl, and so on.
[0096] As used herein, the term alkoxy refers to O-alkyl, wherein alkyl is as defined herein. Representative examples of alkoxy include, but are not limited to, methoxy, ethoxy, propoxy, 2-propoxy, butoxy, tert-butoxy, pentyloxy, hexyloxy, cyclopropyloxy-, cyclohexyloxy- and the like. In some embodiments, alkoxy groups may have about 1 to 8 carbon atoms. Typically, alkoxy groups have about 1 to 6 carbons, and more preferably about 1 to 3 carbons.
[0097] As used herein, the term partially or fully saturated carbocyclic (also referred to as partially or fully saturated cycloalkyl) refers to nonaromatic rings that are either partially or fully hydrogenated and may exist as a single ring of 3 to 8 members or bicyclic ring of 9 to 14 members. Unless specified otherwise, the carbocyclic ring is generally a 3- to 8-membered ring. In another embodiment, the carbocyclic ring is a 3- to 6-membered ring. For example, partially or fully saturated carbocyclic rings (or cycloalkyl) include groups such as cyclopropyl, cyclopropenyl, cyclobutyl, cyclobutenyl, cyclopentyl, cyclpentenyl, cyclopentadienyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, norbornyl, norbornenyl, and the like. The term cycloalkylene refers to cycloalkyl as defined herein having two free radicals available for bonding.
[0098] As used herein, the term heteroaryl refers to a 5- to 14-membered monocyclic- or bicyclic- or tricyclic-aromatic ring system, having 1 to 8 heteroatoms selected from N, O, or S. Typically, the heteroaryl is a 5- to 10-membered ring system (e.g., 5- to 7-membered monocycle or an 8- to 10-membered bicycle). A 5-7 membered monocyclic ring system preferably contains 1 to 3 heteroatoms each independently selected from O, N, or S. Typical heteroaryl groups include 2- or 3-thienyl, 2- or 3-furyl, 2- or 3-pyrrssolyl, 2-, 4-, or 5-imidazolyl, 3-, 4-, or 5-pyrazolyl, 2-, 4-, or 5-thiazolyl, 3-, 4-, or 5-isothiazolyl, 2-, 4-, or 5-oxazolyl, 3-, 4-, or 5-isoxazolyl, 3- or 5-1,2,4-triazolyl, 4- or 5-1,2, 3-triazolyl, tetrazolyl, 2-, 3-, or 4-pyridyl, 3- or 4-pyridazinyl, 3-, 4-, or 5-pyrazinyl, 2-pyrazinyl, and 2-, 4-, or 5-pyrimidinyl. As used herein, the term heteroarylene refers to heteroaryl as defined herein having two free radicals available for bonding.
[0099] As used herein, the term halogen or halo refers to fluoro, chloro, bromo, and iodo. It is to be understood that the terminology oxo or C(O) refers to a CO group, whether it be ketone, aldehyde or acid or acid derivative. Similarly, S(O) refers to a SO group.
Submonomers
[0100] As used herein, the term submonomer refers to a substituent that is covalently bonded to the amino group of the peptoid backbone of Formulas (I), (II), and (III). More specifically, in the case of Formula (I), submonomer refers to R.sub.1-R.sub.8 (individually or collectively); in the case of Formula (II), submonomer refers to R.sub.1-R.sub.6 (individually or collectively); and in the case of Formula (III), submonomer refers to the groups bound to the amino group of the peptoid backbone (individually or collectively). More specifically, submonomers of Formula (III) include (CH.sub.2).sub.2NH.sub.2, and (CH.sub.2).sub.2O(CH.sub.2).sub.2O(CH.sub.2).sub.2OCH.sub.3.
[0101] In general, each of the submonomer moiety has a molecular weight of 1 to 250 daltons or 1 to 500 daltons. The submonomers can be positively charged, negatively charged, or neutrally charged. Submonomers may include functional groups that add functionality to the peptoid.
[0102] In some embodiments, the N-substitutions can include guanidoalkyl, alkylphenyl, indolylalkyl, alkoxyphenyl, hydroxyphenylalkyl, and halophenylalkyl and without limitation to (S, R)--methylbenzyl, benzyl, phenethyl, naphthylmethyl, methoxyethyl, (S)--methylnaphthylmethyl, N-pyrrolidinopropyl, furfurylmethyl, cyclohexylmethyl, 3,4,5-trimethoxybenzyl, phenylpropyl, 6-galactosyl, 3-indolylethyl, p-methoxyphenylethyl, p-chlorophenylethyl, or p-hydroxyphenylethyl groups.
[0103] The submonomers may be protected by tert-butyloxycarbonyl (Boc), fluorenylmethoxycarbonyl (Fmoc), or allyloxycarbonyl (Aloc) and cleaved after the peptoid synthesis.
Positively-Charged Submonomers
[0104] In some embodiments, the positively charged submonomers are aminoalkyl groups having about 1-20 carbon atoms. The N-substitutions can include guanidoalkyl, alkylphenyl, halophenylalkyl, indolylalkyl, alkoxyphenyl, hydroxyphenylalkyl and without limitation to (S, R)--methylbenzyl, benzyl, phenethyl, naphthylmethyl, methoxyethyl, (S)--methylnaphthylmethyl, N-pyrrolidinopropyl, furfurylmethyl, cyclohexylmethyl, 3,4,5-trimethoxybenzyl, phenylpropyl, 6-galactosyl, 3-indolylethyl, p-methoxyphenylethyl, p-chlorophenylethyl, or p-hydroxyphenylethyl groups. The cationic side chains can include the following: aminoethyl, aminopropyl, aminohexyl, 1,4-butadiamine (lysine mimic), (S)-1-methylethylenediamine, trimethylaminoethyl, quanidinoethyl, or quanidinopropyl.
[0105] The positively charged submonomers can include functional groups discussed herein.
[0106] Examples of positively charged submonomers are shown in Table 1.
TABLE-US-00001 TABLE 1 Positively-charged submonomers
[0107] Wherein n is an integer between 1 and 100. Wherein X represents the amino group of the peptoid backbone.
Negatively-Charged Submonomers
[0108] In some embodiments, negatively charged submonomers are carboxyalkyl groups having 1-20 carbon atoms. The anionic side chain can include carboxyl, carbonyl, sulfonic acid, sulfonamide, phosphate, and phosphonic acid-based submonomers. Similar to the positively charged submonomers, the N-substituted side chains can include functional groups discussed herein.
[0109] The negatively charged submonomers can include functional groups discussed herein.
[0110] Examples of negatively-charged submonomers are shown in Table 2.
TABLE-US-00002 TABLE 2 Negative submonomers
[0111] Wherein n is an integer between 1 and 100. Wherein X represents the amino group of the peptoid backbone.
Neutrally-Charged Oligo-Ethylene Glycol Motifs:
[0112] The term oligo as in oligo-ethylene glycol includes without limitation to polymers, copolymers, and interpolymers of any length. In addition, the oligomers may consist of a single repeating monomer, two alternating monomer units, and two or more monomer units randomly or purposely spaced relative to each other. The oligo-ethylene glycol comprises at least 1 ethylene glycol unit (i.e., submonomer: methoxyethylamine) moiety, typically at least 2 repeating units (i.e., submonomer: 2-(2-methoxyethoxy)ethanamine) and preferably at least 3 repeating units (i.e., submonomer: 2-(2-(2-methoxyethoxy)ethoxy)ethanamine).
[0113] The water-soluble motifs can also be substituted with oligomers or polymers composed of -methylbenzylamine which typically comprise 2 to 13 repeating units. Examples can be found in works by Kirshenbaum (44), Zuckermann (45), Barron (46) and their co-workers. Carboxyamide, taurine- and phosphonate-based submonomers may also be used (47-49).
[0114] Examples of neutrally-charged submonomers are shown in Table 3.
TABLE-US-00003 TABLE 3 Neutral submonomers
[0115] Wherein n is an integer between 1 and 100. Wherein X represents the amino group of the peptoid backbone.
Neutrally Charged Functional Submonomers:
[0116] The functional groups exhibit no net positive or negative charge. Functional groups include any group that allows for chemical conjugatison (or strong binding) to a chemical compound, imaging reagents, biomolecules, ligands, polymers, or glycans discussed above on the surfaces of DNA origami and nanoformulation carriers. Examples of a functional group includes alkyne, azide, sulfhydryl, maleimide biotinyl, cyano, hydrazido, carbodiimide, halo, succinimide, and maleimide.
[0117] Examples of functional submonomers are shown in Table 4.
TABLE-US-00004 TABLE 4 Functional submonomers
[0118] Wherein n is an integer between 1 and 100. Wherein X represents the amino group of the peptoid backbone.
[0119] In one embodiment, the composition of the invention includes a compound of Formula (II).
T.sub.1-[X.sub.b1Y.sub.b2Z.sub.b3].sub.n-T.sub.2(II)
wherein
X is
[0120] ##STR00080##
Y is
[0121] ##STR00081##
Z is
[0122] ##STR00082##
T.SUB.1 .is
[0123] ##STR00083##
or H; and
T.SUB.2 .is
[0124] ##STR00084##
H, OH, or NH.SUB.2.;
[0125] wherein,
n is 1, 2, 3, 4, or 5;
b1, b2, and b3 are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20;
T.sub.1.1, T.sub.1.2, T.sub.1.3, T.sub.2.1, and T.sub.2.2 are independently R.sub.1, R.sub.6, (C.sub.1-C.sub.6)alkylene(NR.sub.17R.sub.18), NR.sub.14R.sub.15, (C.sub.1-C.sub.6)alkylene-C(O)R.sub.16, C(O)(C.sub.1-C.sub.6)alkyl, C(O)NR.sub.17R.sub.18, SO.sub.2, OH, SH, COOH, (C.sub.1-C.sub.6)alkylene-N.sub.3, (C.sub.2-C.sub.6)alkynyl, or alkyl, alkenyl, alkynyl, alkylene, or alkoxy that is substituted with at least one of biotinyl, sulfhydryl, cyano, hydrazido, carbodiimide, halo, succinimide, and maleimide;
R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, R.sub.6, are independently H, OH, (C.sub.1-C.sub.8)alkyl, (C.sub.2-C.sub.6)alkenyl, (C.sub.2-C.sub.6)alkynyl, (C.sub.1-C.sub.8)alkoxy, (C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkyl, (C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkylene-O(C.sub.1-C.sub.6)alkyl, ((CH.sub.2).sub.1-8O).sub.1-14CH.sub.3, ((CH.sub.2).sub.1-8O).sub.1-14-alkyl, (C.sub.1-C.sub.8)alkylene-C(O)OH, (C.sub.1-C.sub.8)alkylene-SO.sub.1-3H.sub.1-2, (C.sub.1-C.sub.8)alkylene-PO.sub.1-3H.sub.1-2, (C.sub.1-C.sub.8)alkylene-SO.sub.2NH.sub.2, (C.sub.1-C.sub.8)alkoxy, (C.sub.1-C.sub.6)alkylene-(NH)NR.sub.10R.sub.11, (C.sub.1-C.sub.8)alkylene-NR.sub.12R.sub.13, (C.sub.1-C.sub.8)alkylene-C(O)NR.sub.14R.sub.15, or (C.sub.1-C.sub.6)alkylene-R.sub.16, where alkyl, alkenyl, alkynyl, alkylene, and alkoxy are optionally substituted with one or more substituent each independently selected from (C.sub.1-C.sub.3)alkyl, oxo, NH.sub.2, COOH, halogen, hydroxyl, methoxy, ethoxy, N3, biotinyl, sulfhydryl, cyano, hydrazido, carbodiimide, succinimide, or maleimide;
R.sub.16 is partially or fully saturated (C.sub.3-C.sub.8)carbocyclic, phenyl, 4- to 8-membered heterocycle containing 1 to 4 heteroatoms each independently selected from O, S, or N, 5- to 7-membered heteroaryl containing 1 to 3 heteroatoms each independently selected from O, N, or S, where R.sub.16 is optionally substituted with one or more substituents each independently selected from (C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkyl-NH.sub.2, (C.sub.1-C.sub.3)alkoxy, halogen, hydroxyl, C(O)NH.sub.2, COOH, or CN; and
R10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, R.sub.16, R.sub.17, and R.sub.18 are each independently H, (C.sub.1-C.sub.6)alkyl, (C.sub.2-C.sub.6)alkenyl, (C.sub.2-C.sub.6)alkynyl, or halo-substituted (C.sub.1-C.sub.5)alkyl;
wherein R.sub.1-R.sub.6, each defines a submonomer,
wherein Formula (II) defines a peptoid, and
wherein T.sub.1 and T.sub.2 define terminal groups.
[0126] In some embodiments, the peptoid of Formula (I) or Formula (II) may include alternating submonomers across a portion of the peptoid sequence, or across the entirety of the peptoid sequence, excluding the terminal groups. For example, the peptoid may include submonomers that alternate between any combination of positive submonomers, negative submonomers, and neutral submonomers.
[0127] In one embodiment, the peptoid may include submonomers that alternate between positive submonomers and neutral submonomers. In one embodiment, the peptoid may include submonomers that alternate between negative submonomers and neutral submonomers. In one embodiment, the peptoid may include submonomers that alternate between positive submonomers and negative submonomers. In one embodiment, the peptoid may include submonomers that alternate between two types of negative submonomers, two types of positive submonomers, or two types of neutral submonomers.
[0128] In some embodiments, the peptoid sequence may include semi-alternating submonomers. For example, the peptoid sequence may alternate between one pair of submonomers for one portion of the peptoid sequence, and alternate between a second pair of submonomers for another portion of the peptoid sequence.
[0129] As used herein, the term repeat unit or repeating unit corresponds to the smallest constitutional unit, the repetition of which constitutes a regular macromolecule (or oligomer molecule or block).
[0130] By way of example, with reference to Formula (I), [A.sub.m, -E.sub.n] defines a repeat unit having two monomers; with reference to Formula (II), [X.sub.b1Y.sub.b2Z.sub.b3] defines a repeat unit, having three monomers.
[0131] By way of further example, in the case of peptoid PE1, the repeat unit is (CH.sub.2).sub.2NH.sub.2 and ((CH.sub.2).sub.2O).sub.3CH.sub.3. By way of further example, in the case of peptoid PE3, the repeat unit is (CH.sub.2).sub.2NH.sub.2, ((CH.sub.2).sub.2O).sub.3CH.sub.3, (CH.sub.2).sub.2OCH.sub.3, and ((CH.sub.2).sub.2O).sub.3CH.sub.3, wherein one monomer is repeated in this repeat unit. In some embodiments, the repeating unit may contain a sequence of four unique submonomers.
[0132] In one embodiment, the peptoid sequence may have alternating groups of submonomers, wherein each repeating unit includes a unique sequence of 2, 3, 4, 5, or 6 submonomers. By way of example, see peptoid PE3 of
[0133] In some embodiments, the peptoids of the present invention may have the charged submonomers distributed across the length of the peptoid. For example, the charged submonomers may be sporadically, evenly, or periodically distributed across the length of the peptoid. This type of peptoid structure is herein referred to as a brush structure.
[0134] In some embodiments, the peptoids of the present invention may have an uneven distribution of charged submonomers across the length of the peptoid. In some embodiments, positively-charged submonomers, negatively-charged submonomers, or neutrally-charged submonomers are clustered at the N-terminus, at the C-terminus, or internally, resulting in uneven charge distribution across the length of the peptoid. Such peptoids are referred to as having a block structure. In one aspect of this embodiment, positively-charged submonomers are clustered at the N-terminus. For example, in the case of a peptoid of Formula (I), submonomers R.sub.1-R.sub.4 include at least one positive submonomer and no more than four positive submonomers, and submonomers R.sub.5-R.sub.8 include no positive submonomers, or less submonomers than submonomers R.sub.1-R.sub.4. In another aspect of this embodiment, negatively-charged submonomers are clustered at the C-terminus.
[0135] Examples of peptoids having a brush structure and block structure are shown in
[0136] In some embodiments, the peptoids described herein may have a net positive charge. Such peptoids can interact with nucleic acid to facilitate their binding thereto.
[0137] In some embodiments, out of the total submonomers present in a peptoid of the invention, and described herein, 0-80%, 20-80%, 20-50%, 20-40%, 20-30%, 30-60%, 30-50%, or 30-40% of the submonomers are positively charged.
[0138] In some embodiments, out of the total submonomers present in a peptoid of the invention, and described herein, 0-80%, 20-80%, 20-50%, 20-40%, 20-30%, 30-60%, 30-50%, or 30-40% of the submonomers are negatively charged.
[0139] In some embodiments, out of the total submonomers present in a peptoid of the invention, and described herein, less than 20%, less than 25%, less than 30%, less than 25% of the submonomers are neutrally charged.
[0140] In some embodiments, the ratio of positive:neutral, negative:neutral, or positive:negative submonomers is 0.001:1, 0.01:1, 0.1:1, 0.5:1; 1:1, 1:3, 1:5, 1:10, or a range in between.
[0141] In some embodiments, the ratio of neutral submonomers to charged submonomers is approximately 1:1. In some embodiments, the ratio of neutral submonomers to charged submonomers is approximately 2-5:1.
[0142] In some embodiments, out of the total submonomers present in a peptoid of the invention, 20-80%, 30-80%, or 40-80% of the total submonomer content includes oligo-ethylene glycol.
[0143] In a preferred embodiment, N-substituted glycine, L-amino acid, D-amino acid and analogue thereof (e.g., aliphatic guanidines) are preferred to be incorporated as the charged motifs that facilitate peptoid interactions with the surfaces of drug/gene carriers. More specific to peptoid-DNA origami interactions, the positively charged submonomers are not limited to functional groups, including the amino, guanidino, hydrazido, and amidino groups. These functional groups can be aromatic or aliphatic and may include enantiomers (e.g., L-amino acid and D-amino acid).
[0144] The peptoid sequences can be chemically conjugated with polyalkylene glycol, in particular, polyethylene glycol is preferred and typically has a molecular weight from 2 to 50 kDa. The peptoid sequences can also be chemically conjugated to mono-, di-, or polysaccharide. This may include chitosan, alginate, heparin, hyaluronic acid, chondroitin sulfate, cyclodextrin, pectin, amylose, dextran and analog thereof. Finally, the peptoid designs also permit crosslinking between the polymers, for example, through disulfide bond at the terminating group or side chains.
[0145] The amount of neutrally charged functional groups in a peptoid sequence 12 repeating units can be less than 30% in order to ensure peptoid-DNA binding by the positively charged moieties and DNA origami stabilization by the oligo-ethylene glycol moieties. In some embodiments, a peptoid sequence having 12 repeating units the amount of neutrally charged functional groups is less than 35%. In some embodiments, a peptoid sequence having 12 repeating units the amount of neutrally charged functional groups is less than 25%.
[0146] In one embodiment, the composition of the invention includes a compound of Formula (III).
##STR00085##
wherein r is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 50, 100, or 200;
T.SUB.1 .is
[0147] ##STR00086##
or H; and
T.SUB.2 .is
[0148] ##STR00087##
H, OH, or NH.SUB.2.;
[0149] wherein
T.sub.1.1, T.sub.1.2, T.sub.1.3, T.sub.2.1, and T.sub.2.2 are independently (CH.sub.2)NH.sub.2, ((CH.sub.2).sub.2O).sub.3CH.sub.3, (C.sub.1-C.sub.6)alkylene(NR.sub.17R.sub.18), NR.sub.14R.sub.15, (C.sub.1-C.sub.6)alkylene-C(O)R.sub.16, C(O)(C.sub.1-C.sub.6)alkyl, C(O)NR.sub.17R.sub.18, SO.sub.2, OH, SH, COOH, (C.sub.1-C.sub.6)alkylene-N.sub.3, (C.sub.2-C.sub.6)alkynyl, or alkyl, alkenyl, alkynyl, alkylene, or alkoxy that is substituted with at least one of biotinyl, sulfhydryl, cyano, hydrazido, carbodiimide, halo, succinimide, and maleimide; and
R.sub.14, R.sub.15, R.sub.16, R.sub.17, and R.sub.18 are each independently H, (C.sub.1-C.sub.6)alkyl, (C.sub.2-C.sub.6)alkenyl, (C.sub.2-C.sub.6)alkynyl, or halo-substituted (C.sub.1-C.sub.6)alkyl;
wherein formula (III) defines a peptoid, and
wherein T.sub.1 and T.sub.2 define terminal groups.
[0150] As used herein, and with reference to Formulas (I), (II), and (III), T.sub.1 defines the N-terminus and T.sub.2 defines the C-terminus.
[0151] In some embodiments, the peptoid includes 1, 2, 3, 4, or more functional groups. The functional groups may be located exclusively at a single terminus, both termini, internal to the peptoid sequence, or combinations thereof.
[0152] The peptoid sequences of the present disclosure can be up to 200 monomer units in length. Typically, the length of the peptoid sequence is at least 2 monomers; at least 3 monomers; more usually 4 monomers, more usually 6-12 monomers and preferably 24-48 monomers. In addition, the typical repeating units of peptoid sequences comprise 2 monomers including 1 positively-charged and 1 neutrally-charged monomer, 3 monomers including 1 positively-charged and 2 neutrally-charged monomers, and 4 monomers including 2 positive-charged and 2 neutrally-charged monomers. As used herein, a monomer means one N-substituted glycine unit. By way of example, referencing Formula (I), A.sub.m, E.sub.n, G.sub.p, J.sub.q, L.sub.r, M.sub.s, Q.sub.t, and U.sub.u each define a monomer.
[0153] In some embodiments, the present invention includes a peptoid according to Formula (I), (II), and (III), wherein a peptoid is conjugated to a chemical compound, imaging reagent, targeting ligand, protein, peptide, aptamer, peptide nucleic acid, dendrimer, oligomer, polymer, antibody, antibody fragment, another peptoid, a biomaterial as disclosed herein, or combinations thereof. Examples of suitable chemical compounds for conjugation include hormones, steroids, estrogens, androgens, thyroid hormone, vitamins, or folic acid.
[0154] The conjugation may be by way of a functional group, as described herein and commonly known in the art.
[0155] Peptoid synthesis follows the solid-phase peptoid synthesis which is well known in the art, see, e.g., reference nos. 25, 26; where the designed functionality is incorporated during synthesis, enabling controlled peptoid components and architectures.
[0156] The peptoids disclosed herein can be prepared by solid-phase synthesis and polymerization methods. The solid-phase synthesis includes methods developed by 1) Merrifield (36), which involves coupling amino acid units (commonly protected by Fmoc) to the growing chain anchored on a resin; and 2) the submonomer method developed by Zuckermann (26), which builds peptoid sequences using acylation and nucleophilic displacement with bromoacetic acid and secondary amines. In the polymerization method, peptoids with high molecular weights can be synthesized through ring-opening polymerizations of N-substituted N-carboxyanhydride monomers (37-40) or N-thiocarboxyanhydrides (41-43).
[0157] Regardless of type of peptoid monomers, the full-length peptoids described herein may be produced by the same general procedure which includes repeating a two-step or three step cycle wherein a new monomer unit is added in each cycle until a desired length is obtained.
[0158] With regards to Formulas (I), (II), and (III) as described herein. When the specific number denoting a chemical group is the integer 0 (zero), a bond is intended to link the adjacent groups onto which the said group is substituted. For example, (G1)(G2).sub.0(G3) is equivalent to G1-G3. Wherein G1 and G3 are adjacent to the subject chemical group G1 (wherein 0 is the specific number denoting the chemical group).
Stabilized Biomaterials
[0159] In some embodiments, the present invention provides a stabilized biomaterial and methods for generating the same.
Biomaterials
[0160] As used herein, biomaterials include materials useful for biomedical applications. Examples of biomaterials include nucleic acid (DNA and RNA) based nano-structures; lipid based nanostructures; and nanoparticles.
[0161] The nucleic acid based nano-structure may be a pre-defined nucleic acid nanostructure. An example of a pre-defined nucleic acid nanostructure includes pre-defined DNA nanostructure. The terms DNA origami and pre-defined DNA nanostructure are used interchangeably herein.
[0162] As used herein, pre-defined nucleic acid nanostructure includes a polynucleotide molecule that has been rationally designed to self-assemble into a pre-defined shape or structure.
[0163] The pre-defined nucleic acid nanostructure in accordance with the present disclosure has a size of 1 to 2000 nm, 1 to 1000 nm, 1 to 900 nm, 1 to 800 nm, 1 to 700 nm, 1 to 600 nm, 1 to 500 nm, 1 to 400 nm, 1 to 300 nm, 1 to 200 nm, 1 to 100 nm, or 1 to 50 nm. The size of the pre-defined nucleic acid nanostructure is determined by the longest length of the structure.
[0164] As used herein, self-assemble refers to the ability of a single-strand of nucleic acid to anneal to itself or another single-strand of nucleic acid, in a sequence-specific manner, in a predicted and non-arbitrary manner, and without external physical control.
[0165] In some embodiments, the nucleic acid based nanostructure is double stranded DNA.
[0166] In some embodiments, the pre-defined nucleic acid nanostructure is an octahedral-shaped DNA structure having a size of approximately 60 nm. (29, 30)
[0167] In some embodiments, the pre-defined nucleic acid nanostructure is a lattice-based DNA structure that includes a template DNA and staple DNAs with defined shapes and sizes.
[0168] In some embodiments, the pre-defined nucleic acid nanostructure is a large-scale DNA structure formed by self-assembly of several smaller pre-defined DNA nanostructures.
[0169] The term lipid as used herein refers to any suitable material resulting in a single to multi-layered structures such that a hydrophobic portion of the lipid material orients toward the inner lipid layer while a hydrophilic portion orients toward the aqueous phase. An example of a single layer lipid structure includes micelle. Lipids include highly hydrophobic compounds such as triglycerides, phospholipids, glycolipids, and sterols such as cholesterol and amphipathic lipids. An example of a lipid-based structure includes liposomes.
[0170] As used herein, the terms liposome and liposomes refer to a spherical structure having at least one lipid bilayer. A liposome can be used for the administration of therapeutic agents. A liposome can comprise a combination of one or more phospholipids, an optional lipid that is not a phospholipid, such as sterols, glycolipids, amphipathic lipids, pegylated lipids, or a combination thereof. As used herein, a liposome may have a diameter of about 20 nm to about 3,000 nm. In one embodiment, the diameter of the liposomes is about 75 nm to about 600 nm. In certain embodiments, the liposomes can have diameters precisely falling within 110 nm and 125 nm.
[0171] In one embodiment, the invention includes stabilized nanoparticles. The nanoparticles are metallic (e.g., monometallic, bimetallic, or polymetallic), and may be inorganic or organic. In some embodiments, the nanoparticles comprise gold, silver, copper, iron oxide, titanium nanoparticles, or alloys thereof, ceramics, carbon, or silica nano- or microparticles. In particular embodiments the nanoparticles are gold or silver nanoparticles.
[0172] In some embodiments, the present invention includes a composition having a compound of Formula (I), Formula (II), or Formula (III) and a biomaterial, wherein the compound of Formula (I), Formula (II), or Formula (III) is complexed with a biomaterial. In some embodiments, the complex further includes a small molecule therapeutic or protein. Such a complex defines a drug carrier complex according to the present disclosure.
[0173] In embodiments wherein the biomaterial is a nucleic acid, the complex between the peptoid of Formula (I), Formula (II), or Formula (III) and the biomaterial can be characterized as having a molar ratio of peptoid amines to nucleic acid phosphates (N/P).
[0174] The following values for N/P be combined in any manner to create a range with a minima and maxima for ratio necessary for a stable complex between the peptoid and nucleic acid biomaterial: 0.001, 0.01, 0.1, 0.125, 0.25, 0.5, 1, 2, 3, 4, 5, 8, and 10. As an example, the N/P may be between 0.001 and 3, 0.001 and 2, 0.01 and 2, or 0.1 and 2.
[0175] In some embodiments, the N/P is less than 4, less than 3, less than 2, or less than 1.
[0176] In some embodiments, the biomaterial is a pre-defined nucleic acid nanostructure and the complex with a peptoid of the present invention includes a N/P of less than 3 or less than 2.
[0177] In an embodiment of the invention, the peptoid sequences comprise 1 to 100 (or any range in between) of the repeating dimers, trimers or tetramers. Optionally, the designs are not limited to peptoid sequences that contain only the positively-, negatively- or neutrally charged monomers, excluding the terminal groups for specific purposes.
[0178] As used herein, the submonomers and peptoids are referenced as having a charge. The net charges are also determined by the solution pH, in which the physiologically relevant pH is at least 4 and is no more than 8.5.
Method of Stabilizing
[0179] In some embodiments, the present invention includes a method of stabilizing a biomaterial, said method includes complexing with the biomaterial with a composition including a compound of Formula (I), (II), or (III), as described herein.
[0180] As used herein, complexing means forming a complex of two or more components. As used herein, complex refers to a combination of two or more components having intramolecular or intermolecular covalent or noncovalent interactions. The complexed components are said to be stabilized. As used herein, stabilized means that the component that is stabilized has improved properties as compared to properties of the non-stabilized or non-complexed component. By way of example, and as described herein, a biomaterial is stabilized if it has increased nuclease resistance. By way of further example, a stabilized pre-defined DNA nanostructure has increased structural integrity in environments with low salt or low monovalent or bivalent ions.
[0181] In one embodiment, complexing includes (i) contacting the biomaterial with a composition with a compound of Formula (I), (II), or (III). The contacting conditions include with compound of Formula (I), (II), or (III) for between 0.5 and 20, 10 and 20, 8 and 12, or 0.5 and 4 hours; and at a temperature of between 1 C. and 4 C., 20 C. and 40 C., or 2 C. and 10 C.
[0182] In one embodiment, the method includes a method of stabilizing a pre-defined nucleic acid nanostructure. In some aspects of this embodiment, the contacting and complexing include a ratio of Formula (I), (II), or (III) amines to nucleic acid phosphates is less than 20, less than 15, less than 10, less than 8, less than 5, or less than 2. In some aspects of this embodiment, the contacting includes a ratio of Formula (I), (II), or (III) amines to nucleic acid phosphates of the pre-defined nucleic acid nanostructure is between 3 and 0.01, 3 and 0.1, or 2 and 0.2.
[0183] Formation of the origami nanostructures can include and without limitation to basically negatively charged polynucleotide or nucleic acid, which refers to DNA, RNA, peptide nucleic acids and their analogues thereof. In addition, the nucleic acids may be single-stranded, double-stranded or combination of the two types of molecules.
[0184] Throughout this specification, quantities are defined by ranges having a lower boundary and upper boundary, and by lower or upper boundaries. Each lower boundary can be combined with each upper boundary to define a range. Two lower boundary values can be combined to define a range, and two upper boundary values can be combined to define a range. The lower and upper boundaries should each be taken as a separate element.
Examples
Materials
[0185] All single-stranded DNA (ssDNA) sequences were purchased from Integrated DNA Technologies and the M13mp18 ssDNA scaffold was purchased from Bayou Biolabs. 2-(2-(2-methoxyethoxy)ethoxy)ethanamine was purchased from Aurum Pharmatech. Rink Amide resin, 2-methoxyethylamine, propargylamine, magnesium chloride (MgCl.sub.2), copper (II) sulphate (CuSO.sub.4), aminoguanidine hydrochloride, DNase I, doxorubicin, agarose (medium EEO), bovine serum albumin, trypsin and phosphate buffer saline (PBS) were purchased from Sigma Aldrich.
Method
[0186] Preparation of octahedra-shaped DNA origamis (OCs). OCs were folded by mixing 20 nM of M13mp18 scaffold DNA and 100 nM of each staple oligonucleotides in TAE (1) buffer containing 12.5 mM MgCl.sub.2. The mixed solution was then cooled from 90 C. to room temperature over 20 hours to obtain the target OC structure. After synthesis, OCs were purified using the Amicon 100 k centrifugal filter units (Millipore Sigma) and centrifuged at 400 g and at 4 C. The purification process was repeated 6 times by adding fresh TAE (1) buffer containing 12.5 mM MgCl.sub.2 in each cycle.
OC Sequence
[0187]
TABLE-US-00005 OC-staple-1 (SEQIDNO:2) TCAAAGCGAACCAGACCGTTTTATATAGTC OC-staple-2 (SEQIDNO:3) GCTTTGAGGACTAAAGAGCAACGGGGAGTT OC-staple-3 (SEQIDNO:4) GTAAATCGTCGCTATTGAATAACTCAAGAA OC-staple-4 (SEQIDNO:5) AAGCCTTAAATCAAGACTTGCGGAGCAAAT OC-staple-5 (SEQIDNO:6) ATTTTAAGAACTGGCTTGAATTATCAGTGA OC-staple-6 (SEQIDNO:7) GTTAAAATTCGCATTATAAACGTAAACTAG OC-staple-7 (SEQIDNO:8) AGCACCATTACCATTACAGCAAATGACGGA OC-staple-8 (SEQIDNO:9) ATTGCGTAGATTTTCAAAACAGATTGTTTG OC-staple-9 (SEQIDNO:10) TAACCTGTTTAGCTATTTTCGCATTCATTC OC-staple-10 (SEQIDNO:11) GTCAGAGGGTAATTGAGAACACCAAAATAG OC-staple-11 (SEQIDNO:12) CTCCAGCCAGCTTTCCCCTCAGGACGTTGG OC-staple-12 (SEQIDNO:13) GTCCACTATTAAAGAACCAGTTTTGGTTCC OC-staple-13 (SEQIDNO:14) TAAAGGTGGCAACATAGTAGAAAATAATAA OC-staple-14 (SEQIDNO:15) GATAAGTCCTGAACAACTGTTTAAAGAGAA OC-staple-15 (SEQIDNO:16) GGTAATAGTAAAATGTAAGTTTTACACTAT OC-staple-16 (SEQIDNO:17) TCAGAACCGCCACCCTCTCAGAGTATTAGC OC-staple-17 (SEQIDNO:18) AAGGGAACCGAACTGAGCAGACGGTATCAT OC-staple-18 (SEQIDNO:19) GTAAAGATTCAAAAGGCCTGAGTTGACCCT OC-staple-19 (SEQIDNO:20) AGGCGTTAAATAAGAAGACCGTGTCGCAAG OC-staple-20 (SEQIDNO:21) CAGGTCGACTCTAGAGCAAGCTTCAAGGCG OC-staple-21 (SEQIDNO:22) CAGAGCCACCACCCTCTCAGAACTCGAGAG OC-staple-22 (SEQIDNO:23) TTCACGTTGAAAATCTTGCGAATGGGATTT OC-staple-23 (SEQIDNO:24) AAGTTTTAACGGGGTCGGAGTGTAGAATGG OC-staple-24 (SEQIDNO:25) TTGCGTATTGGGCGCCCGCGGGGTGCGCTC OC-staple-25 (SEQIDNO:26) GTCACCAGAGCCATGGTGAATTATCACCAATCAGAAAAGCCT OC-staple-26 (SEQIDNO:27) GGACAGAGTTACTTTGTCGAAATCCGCGTGTATCACCGTACG OC-staple-27 (SEQIDNO:28) CAACATGATTTACGAGCATGGAATAAGTAAGACGACAATAAA OC-staple-28 (SEQIDNO:29) AACCAGACGCTACGTTAATAAAACGAACATACCACATTCAGG OC-staple-29 (SEQIDNO:30) TGACCTACTAGAAAAAGCCCCAGGCAAAGCAATTTCATCTTC OC-staple-30 (SEQIDNO:31) TGCCGGAAGGGGACTCGTAACCGTGCATTATATTTTAGTTCT OC-staple-31 (SEQIDNO:32) AGAACCCCAAATCACCATCTGCGGAATCGAATAAAAATTTTT OC-staple-32 (SEQIDNO:33) GCTCCATTGTGTACCGTAACACTGAGTTAGTTAGCGTAACCT OC-staple-33 (SEQIDNO:34) AGTACCGAATAGGAACCCAAACGGTGTAACCTCAGGAGGTTT OC-staple-34 (SEQIDNO:35) CAGTTTGAATGTTTAGTATCATATGCGTAGAATCGCCATAGC OC-staple-35 (SEQIDNO:36) AAGATTGTTTTTTAACCAAGAAACCATCGACCCAAAAACAGG OC-staple-36 (SEQIDNO:37) TCAGAGCGCCACCACATAATCAAAATCAGAACGAGTAGTATG OC-staple-37 (SEQIDNO:38) GATGGTTGGGAAGAAAAATCCACCAGAAATAATTGGGCTTGA OC-staple-38 (SEQIDNO:39) CTCCTTAACGTAGAAACCAATCAATAATTCATCGAGAACAGA OC-staple-39 (SEQIDNO:40) AGACACCTTACGCAGAACTGGCATGATTTTCTGTCCAGACAA OC-staple-40 (SEQIDNO:41) GCCAGCTAGGCGATAGCTTAGATTAAGACCTTTTTAACCTGT OC-staple-41 (SEQIDNO:42) CCGACTTATTAGGAACGCCATCAAAAATGAGTAACAACCCCA OC-staple-42 (SEQIDNO:43) GTCCAATAGCGAGAACCAGACGACGATATTCAACGCAAGGGA OC-staple-43 (SEQIDNO:44) CCAAAATACAATATGATATTCAACCGTTAGGCTATCAGGTAA OC-staple-44 (SEQIDNO:45) AACAGTACTTGAAAACATATGAGACGGGTCTTTTTTAATGGA OC-staple-45 (SEQIDNO:46) TTTCACCGCATTAAAGTCGGGAAACCTGATTTGAATTACCCA OC-staple-46 (SEQIDNO:47) GAGAATAGAGCCTTACCGTCTATCAAATGGAGCGGAATTAGA OC-staple-47 (SEQIDNO:48) ATAATTAAATTTAAAAAACTTTTTCAAACTTTTAACAACGCC OC-staple-48 (SEQIDNO:49) GCACCCAGCGTTTTTTATCCGGTATTCTAGGCGAATTATTCA OC-staple-49 (SEQIDNO:50) GGAAGCGCCCACAAACAGTTAATGCCCCGACTCCTCAAGATA OC-staple-50 (SEQIDNO:51) GTTTGCCTATTCACAGGCAGGTCAGACGCCACCACACCACCC OC-staple-51 (SEQIDNO:52) CGCGAGCTTAGTTTTTCCCAATTCTGCGCAAGTGTAAAGCCT OC-staple-52 (SEQIDNO:53) AGAAGCAACCAAGCCAAAAGAATACACTAATGCCAAAACTCC OC-staple-53 (SEQIDNO:54) ATTAAGTATAAAGCGGCAAGGCAAAGAAACTAATAGGGTACC OC-staple-54 (SEQIDNO:55) CAGTGCCTACATGGGAATTTACCGTTCCACAAGTAAGCAGAT OC-staple-55 (SEQIDNO:56) ATAAGGCGCCAAAAGTTGAGATTTAGGATAACGGACCAGTCA OC-staple-56 (SEQIDNO:57) TGCTAAACAGATGAAGAAACCACCAGAATTTAAAAAAAGGCT OC-staple-57 (SEQIDNO:58) CAGCCTTGGTTTTGTATTAAGAGGCTGACTGCCTATATCAGA OC-staple-58 (SEQIDNO:59) CGGAATAATTCAACCCAGCGCCAAAGACTTATTTTAACGCAA OC-staple-59 (SEQIDNO:60) CGCCTGAATTACCCTAATCTTGACAAGACAGACCATGAAAGA OC-staple-60 (SEQIDNO:61) ACGCGAGGCTACAACAGTACCTTTTACAAATCGCGCAGAGAA OC-staple-61 (SEQIDNO:62) CAGCGAACATTAAAAGAGAGTACCTTTACTGAATATAATGAA OC-staple-62 (SEQIDNO:63) GGACGTTTAATTTCGACGAGAAACACCACCACTAATGCAGAT OC-staple-63 (SEQIDNO:64) AAAGCGCCAAAGTTTATCTTACCGAAGCCCAATAATGAGTAA OC-staple-64 (SEQIDNO:65) GAGCTCGTTGTAAACGCCAGGGTTTTCCAAAGCAATAAAGCC OC-staple-65 (SEQIDNO:66) AATTATTGTTTTCATGCCTTTAGCGTCAGATAGCACGGAAAC OC-staple-66 (SEQIDNO:67) AAGTTTCAGACAGCCGGGATCGTCACCCTTCTGTAGCTCAAC OC-staple-67 (SEQIDNO:68) ACAAAGAAATTTAGGTAGGGCTTAATTGTATACAACGGAATC OC-staple-68 (SEQIDNO:69) AACAAAAATAACTAGGTCTGAGAGACTACGCTGAGTTTCCCT OC-staple-69 (SEQIDNO:70) CATAACCTAAATCAACAGTTCAGAAAACGTCATAAGGATAGC OC-staple-70 (SEQIDNO:71) CACGACGAATTCGTGTGGCATCAATTCTTTAGCAAAATTACG OC-staple-71 (SEQIDNO:72) CCTACCAACAGTAATTTTATCCTGAATCAAACAGCCATATGA OC-staple-72 (SEQIDNO:73) GATTATAAAGAAACGCCAGTTACAAAATTTACCAACGTCAGA OC-staple-73 (SEQIDNO:74) AGTAGATTGAAAAGAATCATGGTCATAGCCGGAAGCATAAGT OC-staple-74 (SEQIDNO:75) TAGAATCCATAAATCATTTAACAATTTCTCCCGGCTTAGGTT OC-staple-75 (SEQIDNO:76) AAAGGCCAAATATGTTAGAGCTTAATTGATTGCTCCATGAGG OC-staple-76 (SEQIDNO:77) CCAAAAGGAAAGGACAACAGTTTCAGCGAATCATCATATTCC OC-staple-77 (SEQIDNO:78) GAAATCGATAACCGGATACCGATAGTTGTATCAGCTCCAACG OC-staple-78 (SEQIDNO:79) TGAATATTATCAAAATAATGGAAGGGTTAATATTTATCCCAA OC-staple-79 (SEQIDNO:80) GAGGAAGCAGGATTCGGGTAAAATACGTAAAACACCCCCCAG OC-staple-80 (SEQIDNO:81) GGTTGATTTTCCAGCAGACAGCCCTCATTCGTCACGGGATAG OC-staple-81 (SEQIDNO:82) CAAGCCCCCACCCTTAGCCCGGAATAGGACGATCTAAAGTTT OC-staple-82 (SEQIDNO:83) TGTAGATATTACGCGGCGATCGGTGCGGGCGCCATCTTCTGG OC-staple-83 (SEQIDNO:84) CATCCTATTCAGCTAAAAGGTAAAGTAAAAAGCAAGCCGTTT OC-staple-84 (SEQIDNO:85) CAGCTCATATAAGCGTACCCCGGTTGATGTGTCGGATTCTCC OC-staple-85 (SEQIDNO:86) CATGTCACAAACGGCATTAAATGTGAGCAATTCGCGTTAAAT OC-staple-86 (SEQIDNO:87) AGCGTCACGTATAAGAATTGAGTTAAGCCCTTTTTAAGAAAG OC-staple-87 (SEQIDNO:88) TATAAAGCATCGTAACCAAGTACCGCACCGGCTGTAATATCC OC-staple-88 (SEQIDNO:89) ATAGCCCGCGAAAATAATTGTATCGGTTCGCCGACAATGAGT OC-staple-89 (SEQIDNO:90) AGACAGTTCATATAGGAGAAGCCTTTATAACATTGCCTGAGA OC-staple-90 (SEQIDNO:91) AACAGGTCCCGAAATTGCATCAAAAAGATCTTTGATCATCAG OC-staple-91 (SEQIDNO:92) ACTGCCCTTGCCCCGTTGCAGCAAGCGGCAACAGCTTTTTCT OC-staple-92 (SEQIDNO:93) TCAAAGGGAGATAGCCCTTATAAATCAAGACAACAACCATCG OC-staple-93 (SEQIDNO:94) GTAATACGCAAACATGAGAGATCTACAACTAGCTGAGGCCGG OC-staple-94 (SEQIDNO:95) GAGATAACATTAGAAGAATAACATAAAAAGGAAGGATTAGGA OC-staple-95 (SEQIDNO:96) CAGATATTACCTGAATACCAAGTTACAATCGGGAGCTATTTT OC-staple-96 (SEQIDNO:97) CATATAACTAATGAACACAACATACGAGCTGTTTCTTTGGGG OC-staple-97 (SEQIDNO:98) ATGTTTTGCTTTTGATCGGAACGAGGGTACTTTTTCTTTTGATAAGAGGT CATT OC-staple-98 (SEQIDNO:99) GGGGTGCCAGTTGAGACCATTAGATACAATTTTCACTGTGTGAAATTGTT ATCC OC-staple-99 (SEQIDNO:100) CTTCGCTGGGCGCAGACGACAGTATCGGGGCACCGTCGCCATTCAGGCTG CGCA OC-staple-100 (SEQIDNO:101) TCAGAGCTGGGTAAACGACGGCCAGTGCGATCCCCGTAGTAGCATTAACA TCCA OC-staple-101 (SEQIDNO:102) TTAGCGGTACAGAGCGGGAGAATTAACTGCGCTAATTTCGGAACCTATTA TTCT OC-staple-102 (SEQIDNO:103) GATATTCTAAATTGAGCCGGAACGAGGCCCAACTTGGCGCATAGGCTGGC TGAC OC-staple-103 (SEQIDNO:104) TGTCGTCATAAGTACAGAACCGCCACCCATTTTCACAGTACAAACTACAA CGCC OC-staple-104 (SEQIDNO:105) CGATTATAAGCGGAGACTTCAAATATCGCGGAAGCCTACGAAGGCACCAA CCTA OC-staple-105 (SEQIDNO:106) AACATGTACGCGAGTGGTTTGAAATACCTAAACACATTCTTACCAGTATA AAGC OC-staple-106 (SEQIDNO:107) GTCTGGATTTTGCGTTTTAAATGCAATGGTGAGAAATAAATTAATGCCGG AGAG OC-staple-107 (SEQIDNO:108) GCCTTGAATCTTTTCCGGAACCGCCTCCCAGAGCCCAGAGCCGCCGCCAG CATT OC-staple-108 (SEQIDNO:109) CGCTGGTGCTTTCCTGAATCGGCCAACGAGGGTGGTGATTGCCCTTCACC GCCT OC-staple-109 (SEQIDNO:110) TGATTATCAACTTTACAACTAAAGGAATCCAAAAAGTTTGAGTAACATTA TCAT OC-staple-110 (SEQIDNO:111) ACATAACTTGCCCTAACTTTAATCATTGCATTATAACAACATTATTACAG GTAG 0C-staple-111 (SEQIDNO:112) GTAGCGCCATTAAATTGGGAATTAGAGCGCAAGGCGCACCGTAATCAGTA GCGA OC-staple-112 (SEQIDNO:113) TTATTTTTACCGACAATGCAGAACGCGCGAAAAATCTTTCCTTATCATTC CAAG OC-staple-113 (SEQIDNO:114) TTTCAATAGAAGGCAGCGAACCTCCCGATTAGTTGAAACAATAACGGATT CGCC OC-staple-114 (SEQIDNO:115) GGGCGACCCCAAAAGTATGTTAGCAAACTAAAAGAGTCACAATCAATAGA AAAT OC-staple-115 (SEQIDNO:116) AGCCGAAAGTCTCTCTTTTGATGATACAAGTGCCTTAAGAGCAAGAAACA ATGA OC-staple-116 (SEQIDNO:117) GTGGGAAATCATATAAATATTTAAATTGAATTTTTGTCTGGCCTTCCTGT AGCC OC-staple-117 (SEQIDNO:118) CCCACGCGCAAAATGGTTGAGTGTTGTTCGTGGACTTGCTTTCGAGGTGA ATTT OC-staple-118 (SEQIDNO:119) ATGACCACTCGTTTGGCTTTTGCAAAAGTTAGACTATATTCATTGAATCC CCCT OC-staple-119 (SEQIDNO:120) TCCAAATCTTCTGAATTATTTGCACGTAGGTTTAACGCTAACGAGCGTCT TTCC OC-staple-120 (SEQIDNO:121) GGGTTATTTAATTACAATATATGTGAGTAATTAATAAGAGTCAATAGTGA ATTT Note: ToencapsulateAuNPsandBSAinsidetheOCs,add (SEQIDNO:122) ATCCATCACTTCATACTCTACGTTGTTGTTinfrontofthe red-markedsequences.
M13mp18 scaffold DNA sequence.
TABLE-US-00006 >FOUNDATION_ssDNA_7249 (SEQIDNO:123) TGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGT GGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCT TTTGATTTATAAGGGATTTTGCCGATTTCGGAACCACCATCAAACAGGATT TTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGG GCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAA AAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCG ATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGT GAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCT TTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAA CAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGT ACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGC CGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAA TCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGC CCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCG CTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTG CGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCA CGGTTACGATGCGCCCATCTACACCAACGTGACCTATCCCATTACGGTCAA TCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATT TAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGA TGGCGTTCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAATGCG AATTTTAACAAAATATTAACGTTTACAATTTAAATATTTGCTTATACAATC TTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGTACATATGATTGAC ATGCTAGTTTTACGATTACCGTTCATCGATTCTCTTGTTTGCTCCAGACTC TCAGGCAATGACCTGATAGCCTTTGTAGATCTCTCAAAAATAGCTACCCTC TCCGGCATTAATTTATCAGCTAGAACGGTTGAATATCATATTGATGGTGAT TTGACTGTCTCCGGCCTTTCTCACCCTTTTGAATCTTTACCTACACATTAC TCAGGCATTGCATTTAAAATATATGAGGGTTCTAAAAATTTTTATCCTTGC GTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTT GGTACAACCGATTTAGCTTTATGCTCTGAGGCTTTATTGCTTAATTTTGCT AATTCTTTGCCTTGCCTGTATGATTTATTGGATGTTAATGCTACTACTATT AGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCCAAATGAAAATATAGCT AAACAGGTTATTGACCATTTGCGAAATGTATCTAATGGTCAAACTAAATCT ACTCGTTCGCAGAATTGGGAATCAACTGTTATATGGAATGAAACTTCCAGA CACCGTACTTTAGTTGCATATTTAAAACATGTTGAGCTACAGCATTATATT CAGCAATTAAGCTCTAAGCCATCCGCAAAAATGACCTCTTATCAAAAGGAG CAATTAAAGGTACTCTCTAATCCTGACCTGTTGGAGTTTGCTTCCGGTCTG GTTCGCTTTGAAGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTT CCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAGTCAG GGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTT AAAGCATTTGAGGGGGATTCAATGAATATTTATGACGATTCCGCAGTATTG GACGCTATCCAGTCTAAACATTTTACTATTACCCCCTCTGGCAAAACTTCT TTTGCAAAAGCCTCTCGCTATTTTGGTTTTTATCGTCGTCTGGTAAACGAG GGTTATGATAGTGTTGCTCTTACTATGCCTCGTAATTCCTTTTGGCGTTAT GTATCTGCATTAGTTGAATGTGGTATTCCTAAATCTCAACTGATGAATCTT TCTACCTGTAATAATGTTGTTCCGTTAGTTCGTTTTATTAACGTAGATTTT TCTTCCCAACGTCCTGACTGGTATAATGAGCCAGTTCTTAAAATCGCATAA GGTAATTCACAATGATTAAAGTTGAAATTAAACCATCTCAAGCCCAATTTA CTACTCGTTCTGGTGTTTCTCGTCAGGGCAAGCCTTATTCACTGAATGAGC AGCTTTGTTACGTTGATTTGGGTAATGAATATCCGGTTCTTGTCAAGATTA CTCTTGATGAAGGTCAGCCAGCCTATGCGCCTGGTCTGTACACCGTTCATC TGTCCTCTTTCAAAGTTGGTCAGTTCGGTTCCCTTATGATTGACCGTCTGC GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATT TATCAGGCGATGATACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATA ATCGCTGGGGGTCAAAGATGAGTGTTTTAGTGTATTCTTTTGCCTCTTTCG TTTTAGGTTGGTGCCTTCGTAGTGGCATTACGTATTTTACCCGTTTAATGG AAACTTCCTCATGAAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGC TACCCTCGTTCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAA AGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGC GTGGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTT TAAGAAATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTC CTTTTGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCG CAATTCCTTTAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAA GTTGTTTAGCAAAATCCCATACAGAAAATTCATTTACTAACGTCTGGAAAG ACGACAAAACTTTAGATCGTTACGCTAACTATGAGGGCTGTCTGTGGAATG CTACAGGCGTTGTAGTTTGTACTGGTGACGAAACTCAGTGTTACGGTACAT GGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGAGG GTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTCCTG AGTACGGTGATACACCTATTCCGGGCTATACTTATATCAACCCTCTCGACG GCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCTTCTC TTGAGGAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATAGGTTCC GAAATAGGCAGGGGGCATTAACTGTTTATACGGGCACTGTTACTCAAGGCA CTGACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATCAAAAGCCA TGTATGACGCTTACTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCTG GCTTTAATGAGGATTTATTTGTTTGTGAATATCAAGGCCAATCGTCTGACC TGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTG GCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCT CTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTGATTTTGATTATG AAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAA ACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATTCTGTCGCTACTGATT ACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATG GTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAG TCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTAC CTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGGCGCTGGTA AACCATATGAATTTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTG TCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCTACGT TTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGG TATTCCGTTATTATTGCGTTTCCTCGGTTTCCTTCTGGTAACTTTGTTCGG CTATCTGCTTACTTTTCTTAAAAAGGGCTTCGGTAAGATAGCTATTGCTAT TTCATTGTTTCTTGCTCTTATTATTGGGCTTAACTCAATTCTTGTGGGTTA TCTCTCTGATATTAGCGCTCAATTACCCTCTGACTTTGTTCAGGGTGTTCA GTTAATTCTCCCGTCTAATGCGCTTCCCTGTTTTTATGTTATTCTCTCTGT AAAGGCTGCTATTTTCATTTTTGACGTTAAACAAAAAATCGTTTCTTATTT GGATTGGGATAAATAATATGGCTGTTTATTTTGTAACTGGCAAATTAGGCT CTGGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTG GGTGCAAAATAGCAACTAATCTTGATTTAAGGCTTCAAAACCTCCCGCAAG TCGGGAGGTTCGCTAAAACGCCTCGCGTTCTTAGAATACCGGATAAGCCTT CTATATCTGATTTGCTTGCTATTGGGCGCGGTAATGATTCCTACGATGAAA ATAAAAACGGCTTGCTTGTTCTCGATGAGTGCGGTACTTGGTTTAATACCC GTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACATG CTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTG TTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTTGTTTATTGTCGTC GTCTGGACAGAATTACTTTACCTTTTGTCGGTACTTTATATTCTCTTATTA CTGGCTCGAAAATGCCTCTGCCTAAATTACATGTTGGCGTTGTTAAATATG GCGATTCTCAATTAAGCCCTACTGTTGAGCGTTGGCTTTATACTGGTAAGA ATTTGTATAACGCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATT CCGGTGTTTATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTCA AACCATTAAATTTAGGTCAGAAGATGAAATTAACTAAAATATATTTGAAAA AGTTTTCTCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTTACAT ATAGTTATATAACCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGA CCTATGATTTTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTAA GCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACG ATTTACAGAAGCAAGGTTATTCACTCACATATATTGATTTATGTACTGTTT CCATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTTGTT TTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAAT AATTCGCCTCTGCGCGATTTTGTAACTTGGTATTCAAAGCAATCAGGCGAA TCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCATCT GACGTTAAACCTGAAAATCTACGCAATTTCTTTATTTCTGTTTTACGTGCA AATAATTTTGATATGGTAGGTTCTAACCCTTCCATTATTCAGAAGTATAAT CCAAACAATCAGGATTATATTGATGAATTGCCATCATCTGATAATCAGGAA TATGATGATAATTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAAAATGAT AATGTTACTCAAACTTTTAAAATTAATAACGTTCGGGCAAAGGATTTAATA CGAGTTGTCGAATTGTTTGTAAAGTCTAATACTTCTAAATCCTCAAATGTA TTATCTATTGACGGCTCTAATCTATTAGTTGTTAGTGCTCCTAAAGATATT TTAGATAACCTTCCTCAATTCCTTTCAACTGTTGATTTGCCAACTGACCAG ATATTGATTGAGGGTTTGATATTTGAGGTTCAGCAAGGTGATGCTTTAGAT TTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGTTGCAGGCGGTGTTAAT ACTGACCGCCTCACCTCTGTTTTATCTTCTGCTGGTGGTTCGTTCGGTATT TTTAATGGCGATGTTTTAGGGCTATCAGTTCGCGCATTAAAGACTAATAGC CATTCAAAAATATTGTCTGTGCCACGTATTCTTACGCTTTCAGGTCAGAAG GGTTCTATCTCTGTTGGCCAGAATGTCCCTTTTATTACTGGTCGTGTGACT GGTGAATCTGCCAATGTAAATAATCCATTTCAGACGATTGAGCGTCAAAAT GTAGGTATTTCCATGAGCGTTTTTCCTGTTGCAATGGCTGGCGGTAATATT GTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCA AGTGATGTTATTACTAATCAAAGAAGTATTGCTACAACGGTTAATTTGCGT GATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAAAACACTTCT CAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTG TTTAGCTCCCGCTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTCGTC AAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGT GGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGC TCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCG TCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACG GCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCC ATCGCCC
Peptoid Synthesis and Purification.
[0188] Peptoids were synthesized by solid phase peptoid synthesis on the Symphony X (Gyros Protein Technologies) and the synthesis procedure followed the method previously described (1). All solvents and reagents were purchased from commercial sources and used without further purification. Briefly, 200 mg of Rink amide polystyrene resin (0.61 mmol/g, Novabiochem) was swelled in DMF and the Fmoc group was deprotected in 20% (v/v) 4-methylpiperidine/DMF prior to the submonomer cycle. The acylation step was performed on the amino resin by the addition of 1.0 mL of 0.8 M bromoacetic acid and 1.0 mL of 0.8 M N,N-diisopropylcarbodiimide in DMF and agitated with N2 for 20 min. Displacement of the bromide with the submonomers was performed by adding 1 M solution of the primary amine in N-methyl-2-pyrrolidone followed by agitation for 30 min. The peptoids were cleaved from the resin by the addition of trifluoroacetic acid/triisopropylsilane/deionized water (95:2.5:2.5, v/v/v) solution for 2 h, followed by evaporation using the Biotage V10 Evapoator and precipitation with an excess of cold diethyl ether. The crude peptoids were re-dispersed in deionized water followed by lyophilization. Finally, the peptoids were purified by reverse-phase high-performance liquid chromatography (HPLC, Shimadzu) using a linear gradient of 5-95% acetonitrile in water with 0.1% TFA. The Phenomenex C18 Gemini NX column was 15021.2 mm and had a 5 m pore size and 100 particle size.
[0189] Preparation of peptoid-coated OCs. The synthesized peptoids were dissolved in deionized water at a concentration of 10 mM and stored at 4 C. For all experiments, peptoids at different concentrations based on the target ratios between the free peptoid amine and DNA phosphate (N/P) were mixed with OCs (5-45 nM) and incubated overnight (12 h) at 4 C. in TAE (1) buffer.
[0190] The buffer is TAE (1) buffer composed of 40 mM tris base, 20 mM acetic acid and 1 mM of ethylenediaminetetraacetic acid (EDTA) sodium salt dihydrate, and containing 12.5 mM magnesium chloride.
[0191] Negative-stained TEM imaging. The peptoid-coated OC structures were typically confirmed using negative-stained TEM imaging. In brief, 5 L of the peptoid-coated OC (5-10 nM) solution was dropped on a carbon film for 1-3 min and the residual liquid was removed with a piece of filter paper. After that, the grid was washed with 5 L of deionized water followed by staining with 5 L of 2 wt % uranyl acetate for 15 sec. The excess liquid was removed with filter papers. TEM imaging was performed on a JEOL 1400 TEM with an acceleration voltage of 120 kV.
[0192] Agarose Gel Electrophoresis (AGE).
[0193] In a typical experiment, agarose (0.8 wt %) was prepared in TBE (1) buffer containing 12.5 mM MgCl.sub.2 and 1SYBR Gold dye. OCs (4.3 nM, 40 L) were mixed with 1 BlueJuice gel loading buffer (Thermo Fisher Scientific) prior to loading into the gel. The gel electrophoresis was performed at 60 V on ice to prevent heating damage.
[0194] SYBR Green I (SG) fluorescence assay of OCs. OCs (1 nM) were mixed with peptoids in PBS (1) buffer at an N/P of 0.125 and incubated overnight at room temperature. Prior to measuring fluorescence, 0.8SG was added to the peptoid-coated OC solutions for 2 h at room temperature. The fluorescence signal was recorded from 37 C. to 85 C. at a step of 0.03 C./sec by LightCycler 480 (Roche).
SYBR Green I (SG) Fluorescence of Duplex DNA (dsDNA).
[0195] A15-bp dsDNA was designed with a sequence of 5-ATTACCGTATAGCAT-3 (SEQ ID NO: 124) with a complementary sequence of 5-ATGCTATACGGTAAT-3 (SEQ ID NO: 125). The dsDNA (500 M) was formed in PBS (1) buffer and cooled from 70 C. to room temperature over 11 h. Next, the dsDNA (100 nM) solution was mixed with different peptoid solutions at varied concentrations in PBS overnight at room temperature. Prior to measuring fluorescence, SG (1) was added to the dsDNA/peptoid mixtures for 2 h at room temperature. The fluorescence signal was recorded from 37 C. to 85 C. at a step of 0.03 C./sec by LightCycler 480. The concentrations of only peptoids in solution were the same as those in the N/P of 8, which were 3.43 M for PE1, PE3, PE4, PE5, and 1.85 M for PE2, respectively.
[0196] Molecular dynamics (MD) simulation of peptoid-DNA interactions.
[0197] All-atom MD simulations were performed to investigate the mechanisms of interactions and binding of brush-type PE1 and block-type PE4 peptoids with DNA in explicit solvent. The 15-bp dsDNA (5-ATT ACC GTA TAG CAT-3) (SEQ ID NO: 126) structure was generated using the nab program available through AMBER18 (2). The peptoids were build using the Dassault Systemes BIOVIA Materials Studio package (3), and their atomic charges were calculated with B3LYP/6-31G* level of theory using the RESP procedure (4) and Gaussian16 (5). The force field parameters for the peptoids, except the atomic charges, were generated using antechamber (6) and gaff (7). The ParmBSC1 force field (8) was employed to model the dsDNA. The molecular structures of the dsDNA, PE1 and PE4 peptoids are shown in
[0198] All simulations were performed using the GROMACS simulations package (9). Particle mesh Ewald (PME) (10) electrostatic summation was truncated at 11 , while a force-switched cut-off starting at 9 and ending at 10 was used for the Lennard-Jones non-bonded interactions. Cubic interpolation was used with 10 Fourier spacing and an Ewald tolerance of 10.sup.6. The MD simulations were performed in the NPT (isothermal-isobaric) ensemble. The temperature of the system was coupled at 300 K using the Nos-Hoover thermostat (11) and pressure was maintained at 1 bar using the Parinello-Rahman barostat (12). An integration time-step of 2 fs was applied with all hydrogen bond lengths constrained using the LINCS algorithm (13). Each system was energy minimized using the steepest descent approach with a convergence criteria of 500 kJ mol.sup.1 nm.sup.1 to remove any steric clashes. Following the energy minimization, a 200 ps of MD simulation was performed with position restraints applied to the solute to allow the solvent to equilibrate. Initial unrestrained MD simulations were performed on the dsDNA for 50 ns to equilibrate its structure. A peptoid was then added to the simulation box sufficiently apart to prevent any initial interactions with the dsDNA. To further emulate spontaneous DNA-peptoid binding and explore wider conformational space four different starting arrangements were simulated, where the peptoid was positioned at 0, 90, 180, and 270 relative to the dsDNA. A 100 ns unrestrained MD was conducted for each peptoid arrangement where the peptoid was allowed to spontaneously adsorb onto the DNA from solution. The simulation trajectories from all four starting arrangements per dsDNA/peptoid complex were concatenated for further analysis. A total of 800 ns of simulation data was collected.
[0199] The different modes of interaction between the peptoids and dsDNA were investigated using contact analysis. The total time each peptoid was in contact with the dsDNA was determined, and these frames were extracted for further analysis. A contact was defined when any peptoid atom was within 4 of any DNA atom. The number of positively charged (Nae) residues and ethylene glycol (Nte) chains interacting with DNA and their contact stabilities was calculated. The preference of binding to specific structural features of DNA was also determined by calculating the total time each peptoid was interacting exclusively with the major or minor groove, or with both simultaneously (atomic definition for the DNA grooves is provided in the caption of Table S1). The average contact area between each peptoid and DNA was also determined. The average solvent accessible surface area of each peptoid while bound to dsDNA was calculated using a probe radius of 1.4 (water) and Lennard-Jones hard-shell radii for each atom to define the surface of the peptoid. The elongation or compactness of the peptoid was estimated by measuring the average distance between the outermost nitrogen atoms of the peptoid backbone. Visualization of the trajectories and analysis was performed using the VMD software (14).
TABLE-US-00007 TABLE S1 Peptoid-DNA interaction characterization and properties. Properties PE1 PE4 .sup.a Persistent Contact (%) 98.2% 98.7% .sup.bMinor/Major groove interactions .sup.cMinor Groove Contacts (%) 28.5% 241.0% .sup.dMajor Groove Contacts (%) 6.1% 39.6% Major and Minor Groove Contacts (%) 48.8% 18.5% .sup.bNte/Nae residue interaction time Nte Contact (%) 98.01% 70.39% Nte (1 residue) 12.55% 30.45% Nte (2 residues) 74.75% 24.94% Nte (3 residues) 31.79% 11.82% Nte (4 residues) 20.19% 2.90% Nte (5 residues) 8.07% 0.28% Nte (6 residues) 0.67% 0.00% Nae Contact Time (%) 98.08% 99.90% Nae (1 residue) 14.79% 0.66% Nae (2 residues) 25.53% 3.87% Nae (3 residues) 31.53% 12.74% Nae (4 residues) 19.87% 28.43% Nae (5 residues) 6.45% 35.86% Nae (6 residues) 0.41% 18.33% Average contact area (nm.sup.2) 2.88 1.11 2.54 1.05 Peptoid solvent accessible surface area 18.82 1.47 17.81 1.64 (nm.sup.2) Average separation distance of outermost 2.33 0.6 2.20 0.6 nitrogens d.sub.N2-N19 (nm)
[0200] Magnesium depletion assays.
[0201] Bare OCs and peptoid-coated OCs were diluted in TAE (1) buffer, PBS (1) buffer, Roswell Park Memorial Institute 1640 medium (RPMI, Thermo Fisher Scientific) and the Dulbecco's Modified Eagle Medium (DMEM, Gibco) such that the final concentrations of origami and MgCl.sub.2 were 4.3 nM and 1.25 mM, respectively. The samples were incubated at 4 C. (TAE and PBS) or 37 C. (RPMI and DMEM) for 24 h and characterized by AGE and negative-stained TEM imaging. In all figures of AGE analyses, label + represents the final MgCl.sub.2 concentration of 12.5 mM; label represents depleted Mg.sup.2+ and the final MgCl.sub.2 concentration was 1.25 mM. To prepare samples for TEM imaging, OCs were extracted from the agarose gels using the Freeze 'N Squeeze DNA Gel Extraction Spin Columns (Bio Rad) and centrifuged at 1000 rcf for 3 min at room temperature.
[0202] Dynamic light scattering (DLS). In
[0203] Nuclease degradation assays.
[0204] Bare OCs (4.3 nM) and peptoid-coated OCs (4.3 nM, N/P: 0.5) were mixed with different concentrations of deoxyribonuclease I (DN) in TAE (1) buffer containing 12.5 mM MgCl.sub.2. The samples were incubated at 37 C. for 30 min at 650 rpm on a thermal cycler (Eppendorf) and characterized using AGE and negative-stained TEM imaging.
Encapsulation of 10 nm gold nanoparticles (Au NPs) in OCs.
[0205] (1) Peptide Synthesis.
[0206] Solid-phase peptide synthesis was performed to synthesize the azido peptide (CALDDK(N3)) for Au NP functionalization. Briefly, Rink Amide resins and the protected amino acids were added to the growing peptide chain with the activating reagent 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU). Following addition of the submonomers, the Fmoc group was removed under 20% piperidine in DMF deprotection conditions. The peptides were cleaved by trifluoroacetic acid/triisopropylsilane/deionized water (95:2.5:2.5, v/v/v). The crude peptide was precipitated by cold ether several times and lyophilized. The as-synthesized peptides were purified by reverse-phase high-performance liquid chromatography (HPLC, Shimadzu). The Phenomenex C18 Gemini NX column was 15021.2 mm and had a 5 m pore size and 100 particle size.
[0207] (2) Au NP Functionalization.
[0208] First, 990 L of 10 nm Au NPs (9.5 nM, BBI solutions) were mixed with 10 L of peptide CALDDK(N3) (pep, 1 mM) overnight at room temperature (12 h). The solution was washed 3 times with 10 mM phosphate buffer (pH 7.4) by centrifugation at 10,000 rcf and at 4 C. Next, DBCO-modified single-stranded DNA (ssDNA, 5-TATGAAGTGATGGATGAT/3DBCO/)) (SEQ ID NO: 1) was added to the Au NP-pep solution at concentration ratio of 300:1 in 10 mM phosphate buffer (pH 7.4) and incubated at least 4 h at room temperature. A final concentration of 100 mM of NaCl was added to the Au NP-solution and left incubating overnight. The solution was washed 3 times with 10 mM phosphate (pH 7.4) containing 100 mM NaCl by centrifugation at 10,000 rcf and at 4 C. UV-vis spectroscopy (Lambda 25, PerkinElmer) was used to calculate the final Au NP-pep-ssDNA concentration.
[0209] (3) Au NP-pep-ssDNA Encapsulation in OCs.
[0210] OCs (40 nM) were mixed with the Au NP-pep-ssDNA (48 nM) and cooled from 50 C. to room temperature over a time course of 40 h.
[0211] Doxorubicin (Dox) release from bare OCs and peptoid-coated OCs. OCs (10 nM) were incubated with doxorubicin (Dox, 0.1 mM) at room temperature for 24 h and purified 3 times with TAE (1) buffer containing 12.5 mM MgCl.sub.2 using a 100 kDa filter and centrifuged at 400 rcf and at 15 C. OCs were concentrated to 50 nM in the final centrifugation. PE2-coated OCs were prepared by mixing PE2 (27.7 M) with Dox-loaded OCs (50 nM) overnight (12 h) at room temperature. Dox-loaded bare and PE2-coated OCs were diluted in PBS (1) at pH 7 or 5.5 and incubated at 37 C. for 48 h, followed by centrifugation with 50 kDa filters at 1000 rcf for 30 min at room temperature, of which the supernatant solution was collected. Fluorescence spectra were measured in a 384 well plate (Corning) using the Spark microplate reader (Tecan). The ex and em were 485 nm and 515-800 nm, respectively with a step size of 2 nm.
Encapsulation of fluorescein-modified bovine serum albumin (BSA) in OCs.
[0212] First, NHS-fluorescein (240 M) and NHS-PEG-azide (60 M) was mixed with BSA (10 M) in PBS (1) buffer for 3 h at room temperature. The solution was purified 8 times with PBS using a 50 kDa filter and centrifuged at 3000 rcf and at 4 C. Next, the DBCO-modified single-stranded DNA (ssHy, 5-TATGAAGTGATGGATGAT/3DBCO/, 250 M) (SEQ ID NO: 1) was mixed with the BSA solution (10 M) overnight (12 h) at 4 C. The solution was purified 8 times with PBS using a 50 kDa filter and centrifuged at 3000 rcf at 4 C. Finally, the surface-modified BSA (200 nM) was added to the OCs (40 nM) and the solution was cooled down from 45 C. to room temperature over a time course of 60 h. The solution was purified 2 times with TAE (1) buffer containing 12.5 mM MgCl.sub.2 using a 100 kDa filter and centrifuged at 400 rcf and at 4 C.
Fluorescence Assay for Tryptic Digestion of BSA.
[0213] (1) The fluorescein-modified BSA (80 nM) solution without OCs was incubated at 37 C. in the presence or absence of trypsin (50 nM) overnight 12 h prior to fluorescence measurement. Fluorescence spectra were measured with excitation and emission wavelengths of 490 nm and 510-750 nm, respectively and a step size of 2 nm. (2) The fluorescein-modified BSA encapsulated OCs (20 nM) were incubated at 37 C. in the presence or absence of trypsin (50 nM) in a 384 well plate. The fluorescence kinetics were measured at .sub.ex and .sub.em of 490 nm and 525 nm, respectively and time interval of 3 min. Fluorescence spectra were measured after 15 h at excitation and emission wavelengths of 490 nm and 510-800 nm, respectively and a step size of 2 nm. TAE (1) buffer containing 12.5 mM MgCl.sub.2 was used for both experiments.
Surface conjugation of peptoid-protected OCs with azide fluor 488.
[0214] Alkyne-modified peptoids (PE8 and PE9, 20 M) were mixed with azide fluor 488 (60 M), 0.1 mM CuSO.sub.4, 0.5 mM THPTA, 5 mM aminoguanidine and 5 mM sodium ascorbate in 100 mM sodium phosphate buffer (pH=7.4) for 2 h at room temperature. The peptoid-fluorophore (PE8-FL and PE9-FL) conjugates were dialyzed against deionized water with 0.2 mM EDTA for 12 h at room temperature using a 3,500 Da membrane, followed by dialysis against deionized water for 24 h at room temperature.
[0215] Synthesis of Trastuzumab-azide.
[0216] Trastuzumab expressed with two heavy chain C-terminal formylglycine residues (SMARTag antibody CT) was a gift from David Rabuka (Catalent) (15). A small molecule azide linker with a hydrazino moiety was synthesized in 9 steps as described previously (16, 17). The trastuzumab-aldehyde was reacted with the azide via the hydrazino-iso-Pictet Spengler ligation as described previously (17). Briefly, trastuzumab with C-terminal heavy-chain formylglycine residues was buffer exchanged via PD-10 column (GE Life Sciences, 17085101) into 50 mM sodium citrate (Millipore Sigma C8532). To trastuzumab fGly (182.7 nmol, 2.19 mL, 1 equiv.) in sodium citrate buffer was added the azide molecule (4 mol, 135 L, 21.9 equiv.) freshly dissolved in DMSO in a falcon tube. The falcon tube was closed after flushing with argon gas, and the reaction was mixed 250 rpm in the dark at 37 C. for 22 h. Following this, the reaction was buffer exchanged via PD-10 desalting columns into PBS (Corning, 21-040-CM), with 90% recovery.
[0217] Trastuzumab-azide was analyzed by mass spectrometry to confirm the azide addition, with no detected unmodified trastuzumab-azide remaining. Trastuzumab-azide (20 L in PBS was treated with 0.75 L PNGaseF (NEB, P0704S) at 37 C. overnight in an eppendorf tube. After 16 h, the DTT was added (30 mM, 0.6 L from frozen stock solution in water) (Thermo Fisher Scientific, 15508013), and the antibody was heated at 65 C. for 5 min using a Thermomixer. Antibody was placed on ice and analyzed in the same day at the SUMS facility at Stanford University by ESI-LC/MS on an Agilent 1260 HPLC and Bruker MicroTOF-Q II time-of-flight mass spectrometer. A Waters BioResolve RP mAb Polyphenyl 450 2.7 m 1002.1 mm column was maintained at 50 C. Five microliters of reduced, de-glycosylated antibody conjugate were injected at a flow rate of 0.3 mL/min at 95% solvent A (0.05% trifluoroacetic acid in water) and 5% solvent B (0.1% formic acid in acetonitrile). This was held for 1.5 min, then ramped to 35% B at 2 min, 46% B at 10 min, and 95% B at 11 min, which was held for 1 min. Data was collected in full scan MS mode with a mass range of 400-4000 Da and Collision RF setting equal to 800 V.
Surface conjugation of peptoid-protected OCs with Trastuzumab.
[0218] Alkyne-modified peptoids (PE8 and PE9, 30 M) were mixed with azide-modified Trastuzumab (10 M), 0.1 mM CuSO.sub.4, 0.5 mM THPTA, 5 mM aminoguanidine and 5 mM sodium ascorbate in 100 mM sodium phosphate buffer (pH=7.4) for 2 h at room temperature. The peptoid-Trastuzumab (PE8-Tz and PE9-Tz) conjugates were dialyzed against PBS (1) buffer with 0.2 mM EDTA for 12 h at 4 C. using a 100-500 Da membrane for 2 times, followed by dialysis against PBS (1) buffer for 24 h at 4 C.
Results and Discussion
[0219] Two types of polycationic peptoids were designed to protect DNA origamis by multivalent peptoid-DNA interactions and compact surface coating (
[0220] These polycationic peptoids are proposed to electrostatically bind to the anionic phosphate backbone of the DNA and compensate charge repulsions between DNA strands. In addition, incorporation of neutral oligo-Nte is expected to prevent aggregation of the DNA origami structures. The anti-fouling oligo-Nte can also prevent adsorption of biomolecules in physiological environments (51, 52) and enzymatic degradation of DNA origamis triggered by protease and nuclease.
[0221] In this disclosure, the interactions between a duplex DNA and peptoids were first studied by comprehensive spectroscopic approach and molecular dynamics simulations. The enhanced stability of 3D octahedra-shaped DNA origamis (OCs) was then investigated by surface coating with peptoids in physiological solutions, including the depletion of magnesium ions, the presence of nuclease and the addition of cell culture media. The effect of different peptoid structures on OC protection was discussed. Next, the functionality of peptoid-stabilized OCs was explored, where controlled release of anti-cancer drug and tryptic digestion of proteins encapsulated in OC nanostructures were examined. Finally, alkyne modified peptoids were used to conjugate functional biomolecules and present them on the surface of peptoid-coated OCs.
[0222] The effect of the two types (i.e., brush and block) of peptoids on stabilizing duplex DNA (dsDNA) was investigated by real-time SYBR Green I (SG) fluorescence assay. SG is known to have a stronger affinity toward dsDNA than to single-stranded DNA (ssDNA) due to the favored intercalation between base pairs and increased stability of the SG/dsDNA complex. The enhanced SG fluorescence in complex with dsDNA is due to the dampening of its intra-molecular motions (53, 54). Here, a 15-base pair dsDNA with a melting temperature (Tm) of 44 C. was designed to study dsDNA stability in the presence of peptoids at varied molar ratios of peptoid amines to phosphate groups of the DNA (i.e., N/P). As shown in
[0223] Polycationic polymers and lipids often cause DNA to form polyplexes which can significantly quench the DNA-binding fluorophores (55). Here, the oligo-Nte motifs are expected to inhibit DNA condensation and polyplex formation. Indeed, the fluorescence of SG intercalated inside the dsDNA remained unchanged after the addition of PE2 at room temperature (25 C.) (
[0224] Explicit solvent molecular dynamics (MD) simulations were performed to investigate the binding mechanisms of brush-type PE1 and block-type PE4 with dsDNA in solution (
[0225] PE1 and PE4 exhibited distinct differences in the binding mechanisms to dsDNA. PE1 demonstrated persistent interactions (98% of the total contact time) with DNA via both the Nae and Nte motifs, where at least 58% (Nae) and 61% (Nte) of the time, 3 or more residues were in close contact with the dsDNA. In addition, the brush arrangement facilitated PE1 to spread across the DNA backbone where it interacted with both major and minor grooves concurrently (48.8% of the total contact time), while a preferred binding toward the minor groove (28.5%) exclusively over the major groove (6.1%) of the dsDNA was also observed.
[0226] In contrast, the PE4-dsDNA interactions dominated binding through the Nae moieties (100% of the total contact time), where 4 or more Nae residues were in close contact with the dsDNA for more than 85% of the time. Meanwhile, the Nte moieties exhibited significantly less persistent interactions with DNA, where only the closest two Nte residues were involved in binding for 55% of the total contact time. In addition, the block arrangement facilitated the Nte end of PE4 to be solvent exposed, and therefore PE4 was observed to embed in either the major (39.6%) or minor (24%) grooves of the dsDNA, while simultaneous interactions with both major and minor grooves (18.5%) were less favored. As expected, PE1 formed a larger contact area with dsDNA (2.881.11 nm.sup.2) compared to PE4 (2.541.05 nm.sup.2), whereas PE4 had lower average solvent accessible surface area than PE1 due to a more compact structure overall while bound to DNA (PE1: 18.821.47 nm.sup.2 and PE4: 17.811.64 nm.sup.2) (Table S). Interestingly, MD simulations showed the PE1 structure to be more flexible and dynamic while interacting with the dsDNA compared to PE4, which was frequently restrained due to the embedding of the Nae end within the DNA grooves (demonstrated by the larger occupancy volume areas adopted by PE4 compared to PE1 in
[0227] Without wishing to be bound by theory, it is believed that water plays an important role in the binding phenomena of the architecturally different peptoids with dsDNA. The structuring of water surrounding the pristine dsDNA in respective to the dsDNA/peptoid complex was investigated through radial distribution functions (RDFs).
[0228] The polycationic peptoids were then applied to protect OCs, which possessed six DNA bundles at each edge that confers rigidity of the 3D nanostructure (
[0229] Mg.sup.2+ is known to play the central role for the integrity of DNA origami nanostructures by stabilizing DNA base-pairing (28). Here, a Mg.sup.2+ depleted condition was generated by diluting the bare OCs and peptoid-coated OCs (OC/peptoid) so that the final concentration of magnesium chloride (MgCl2) in solution was 1.25 mM (
[0230] Dynamic light scattering (DLS) and in situ small angle X-ray scattering (SAXS) were used to analyze the overall average size and structure of bare OCs and OC/PE2 in solution, respectively. Here, ethylenediaminetetraacetic acid (EDTA), a strong metal ion chelating reagent, was used to remove Mg.sup.2+ from the solution, where TEM images showed that the extent of damaged OCs increased with the concentration of EDTA (
[0231] When bare OCs and OC/peptoid were dispersed in phosphate buffered saline (PBS) at low Mg.sup.2+ content, all OC/peptoid exhibited more stable structures compared to those observed in TAE buffer (
[0232] Next, the stability of OC/peptoid against enzymatic degradation was investigated in solution containing deoxyribonuclease I (DN). As shown in AGE, bare OCs could be degraded by DN at a concentration as low as 2.5 g/mL, where the increased electrophoretic mobility indicated dissociation of staple strands from the OCs (
[0233] Since PE2 exhibited the best protection of OC structures, the stability of OC/PE2 in cell media was investigated, including the Dulbecco's Modified Eagle Medium (DMEM) (
[0234] It was demonstrated that surface coating of OCs with PE2 provides protease resistance to proteins encapsulated in the OC structures. Here, bovine serum albumin (BSA) was modified with fluorescein and encapsulated in the bare OCs and OC/PE2 via DNA hybridization (see Method). The fluorescence signal was self-quenched due to multiple fluorescein labeled on a single BSA (60). Fluorescence recovery was attained in the presence of trypsin, which catalyzed hydrolysis of BSA preferentially at sites of lysine and arginine (61), and subsequently released the fluorescein-conjugated fragments (
[0235] Peptoid-protected OCs can be modified with different biological moieties by incorporating reactive groups into the peptoid sequences. Toward this end, two clickable peptoids (brush and block types, PE8 and PE9) were synthesized (
SEQUENCE LISTING
[0236] A Sequence Listing conforming to the rules of WIPO Standard ST.25 is hereby incorporated by reference. The Sequence Listing has been filed as an electronic document via EFS-Web in ASCII format. The electronic document, created on Sep. 25, 2020, is entitled SEQ-369-304_ST25.txt, and is 37,860 bytes in size.
REFERENCES
[0237] 1. Seeman N C (2003) DNA in a material world. Nature 421:427. [0238] 2. Lin C, Liu Y, Yan H (2009) Designer DNA Nanoarchitectures. Biochemistry 48:1663-1674. [0239] 3. Pinheiro A V, Han D, Shih W M, Yan H (2011) Challenges and opportunities for structural DNA nanotechnology. Nat Nanotechnol 6:763-772. [0240] 4. Rothemund PWK (2006) Folding DNA to create nanoscale shapes and patterns. Nature 440:297. [0241] 5. Mirkin C A, Letsinger R L, Mucic R C, Storhoff J J (1996) A DNA-based method for rationally assembling nanoparticles into macroscopic materials. Nature 382:607-609. [0242] 6. Niemeyer C M, Burger W, Peplies J (1998) Covalent DNA-Streptavidin Conjugates as Building Blocks for Novel Biometallic Nanostructures. Angew Chemie Int Ed 37:2265-2268. [0243] 7. Keren K, et al. (2002) Sequence-Specific Molecular Lithography on Single DNA Molecules. Science (80-) 297:72 LP-75. [0244] 8. Ford W E, Harnack O, Yasuda A, Wessels J M (2001) Platinated DNA as Precursors to Templated Chains of Metal Nanoparticles. Adv Mater 13:1793-1797. [0245] 9. Alivisatos A P, et al. (1996) Organization of nanocrystal molecules using DNA. Nature 382:609-611. [0246] 10. Nykypanchuk D, Maye M M, van der Lelie D, Gang O (2008) DNA-guided crystallization of colloidal nanoparticles. Nature 451:549. [0247] 11. Zhang Y, Lu F, Yager K G, van der Lelie D, Gang O (2013) A general strategy for the DNA-mediated self-assembly of functional nanoparticles into heterogeneous systems. Nat Nanotechnol 8:865. [0248] 12. Chandrasekaran A R, Levchenko O (2016) DNA Nanocages. Chem Mater 28:5569-5581. [0249] 13. Schneider A-K, Niemeyer C M (2018) DNA Surface Technology: From Gene Sensors to Integrated Systems for Life and Materials Sciences. Angew Chemie Int Ed 57:16959-16967. [0250] 14. Zhu B, Wang L, Li J, Fan C (2017) Precisely Tailored DNA Nanostructures and their Theranostic Applications. Chem Rec 17:1213-1230. [0251] 15. Zhang Y, et al. (2018) Programmable and Multifunctional DNA-Based Materials for Biomedical Applications. Adv Mater 30:1703658. [0252] 16. Fu J, Liu M, Liu Y, Yan H (2012) Spatially-Interactive Biomolecular Networks Organized by Nucleic Acid Nanostructures. Acc Chem Res 45:1215-1226. [0253] 17. Li J, Fan C, Pei H, Shi J, Huang Q (2013) Smart Drug Delivery Nanocarriers with Self-Assembled DNA Nanostructures. Adv Mater 25:4386-4396. [0254] 18. Amir Y, et al. (2014) Universal computing by DNA origami robots in a living animal. Nat 20 Nanotechnol 9:353. [0255] 19. Douglas S M, Bachelet I, Church G M (2012) A Logic-Gated Nanorobot for Targeted Transport of Molecular Payloads. Science (80-) 335:831 LP-834. [0256] 20. Bujold K E, Hsu JCC, Sleiman H F (2016) Optimized DNA Nanosuitcases for Encapsulation and Conditional Release of siRNA. J Am Chem Soc 138:14030-14038. [0257] 21. Schller V J, et al. (2011) Cellular Immunostimulation by CpG-Sequence-Coated DNA Origami Structures. ACS Nano 5:9696-9702. [0258] 22. Grossi G, Dalgaard Ebbesen Jepsen M, Kjems J, Andersen E S (2017) Control of enzyme reactions by a reconfigurable DNA nanovault. Nat Commun 8:992. [0259] 23. Ora A, et al. (2016) Cellular delivery of enzyme-loaded DNA origami. Chem Commun 52:14161-14164. [0260] 24. Jiang Q, et al. (2012) DNA Origami as a Carrier for Circumvention of Drug Resistance. J Am Chem Soc 134:13396-13403. [0261] 25. Zhang Q, et al. (2014) DNA Origami as an In Vivo Drug Delivery Vehicle for Cancer Therapy. ACS Nano 8:6633-6643. [0262] 26. Sun W, et al. (2014) Cocoon-Like Self-Degradable DNA Nanoclew for Anticancer Drug Delivery. J Am Chem Soc 136:14722-14725. [0263] 27. Douglas S M, et al. (2009) Self-assembly of DNA into nanoscale three-dimensional shapes. Nature 459:414. [0264] 28. Hahn J, Wickham S F J, Shih W M, Perrault S D (2014) Addressing the Instability of DNA Nanostructures in Tissue Culture. ACS Nano 8:8765-8775. [0265] 29. Kielar C, et al. (2018) On the Stability of DNA Origami Nanostructures in Low-Magnesium Buffers. Angew Chemie Int Ed 57:9470-9474. [0266] 30. Kim H, Surwade S P, Powell A, O'Donnell C, Liu H (2014) Stability of DNA Origami Nanostructure under Diverse Chemical Environments. Chem Mater 26:5265-5273. [0267] 31. Benson E, et al. (2018) Effects of Design Choices on the Stiffness of Wireframe DNA Origami Structures. ACS Nano 12:9291-9299. [0268] 32. Benson E, et al. (2015) DNA rendering of polyhedral meshes at the nanoscale. Nature 523:441. [0269] 33. Veneziano R, et al. (2016) Designer nanoscale DNA assemblies programmed from the top down. Science (80-) 352:1534 LP-1534. [0270] 34. Gerling T, Kube M, Kick B, Dietz H (2018) Sequence-programmable covalent bonding of designed DNA assemblies. Sci Adv 4:eaau1157. [0271] 35. Cassinelli V, et al. (2015) One-Step Formation of Chain-Armor-Stabilized DNA Nanostructures. Angew Chemie Int Ed 54:7795-7798. 21 [0272] 36. Ponnuswamy N, et al. (2017) Oligolysine-based coating protects DNA nanostructures from low-salt denaturation and nuclease degradation. Nat Commun 8:15654. [0273] 37. Kiviaho J K, et al. (2016) Cationic polymers for DNA origami coatingexamining their binding efficiency and tuning the enzymatic reaction rates. Nanoscale 8:11674-11680. [0274] 38. Agarwal N P, Matthies M, Gur F N, Osada K, Schmidt T L (2017) Block Copolymer Micellization as a Protection Strategy for DNA Origami. Angew Chemie Int Ed 56:5460-5464. [0275] 39. Mikkil J, et al. (2014) Virus-Encapsulated DNA Origami Nanostructures for Cellular Delivery. Nano Lett 14:2196-2200. [0276] 40. Auvinen H, et al. (2017) Protein Coating of DNA Nanostructures for Enhanced Stability and Immunocompatibility. Adv Healthc Mater 6:1700692. [0277] 41. Sun J, Zuckermann R N (2013) Peptoid Polymers: A Highly Designable Bioinspired Material. ACS Nano 7:4715-4732. [0278] 42. Figliozzi G M, Goldsmith R, Ng S C, Banville S C, Zuckermann RNBT-M in E (1996) [25] Synthesis of N-substituted glycine peptoid libraries. Combinatorial Chemistry (Academic Press), pp 437-447. [0279] 43. Webster A M, Cobb S L (2018) Recent Advances in the Synthesis of Peptoid Macrocycles. ChemA Eur J 24:7560-7573. [0280] 44. Miller S M, et al. (1994) Proteolytic studies of homologous peptide and N-substituted glycine peptoid oligomers. Bioorg Med Chem Lett 4:2657-2662. [0281] 45. Wender P A, et al. (2000) The design, synthesis, and evaluation of molecules that enable or enhance cellular uptake: Peptoid molecular transporters. Proc Natl Acad Sci 97:13003-13008. [0282] 46. Rothbard J B, et al. (2002) Arginine-Rich Molecular Transporters for Drug Delivery: Role of Backbone Spacing in Cellular Uptake. J Med Chem 45:3612-3618. [0283] 47. Schrder T, et al. (2008) Peptoidic Amino- and Guanidinium-Carrier Systems: Targeted Drug Delivery into the Cell Cytosol or the Nucleus. J Med Chem 51:376-379. [0284] 48. Murphy J E, et al. (1998) A combinatorial approach to the discovery of efficient cationic peptoid reagents for gene delivery. Proc Natl Acad Sci 95:1517-1522. [0285] 49. Tian Y, et al. (2015) Prescribed nanoparticle cluster architectures and low-dimensional arrays built using octahedral DNA origami frames. Nat Nanotechnol 10:637. [0286] 50. Tian Y, et al. (2016) Lattice engineering through nanoparticle-DNA frameworks. Nat Mater 15:654. [0287] 51. Statz A R, Meagher R J, Barron A E, Messersmith P B (2005) New Peptidomimetic Polymers for Antifouling Surfaces. J Am Chem Soc 127:7972-7973. [0288] 52. Xuan S, et al. (2017) Synthesis and Characterization of Well-Defined PEGylated Polypeptoids as Protein-Resistant Polymers. Biomacromolecules 18:951-964. [0289] 53. Dragan, A. I.; Pavlovic, R.; McGivney, J. B.; Casas-Finet, J. R.; Bishop E. S.; Strouse, R. J.; Schenerman M A. GCD (2012) SYBR Green I: Fluorescence Properties and Interaction with DNA. J Fluoresc 22:1189-1199. [0290] 54. Zipper H, Brunner H, Bernhagen J, Vitzthum F (2004) Investigations on DNA intercalation and surface binding by SYBR Green I, its structure determination and methodological implications. Nucleic Acids Res 32:e103-e103. [0291] 55. Krishnamoorthy G, Duportail G, M61y Y (2002) Structure and Dynamics of Condensed DNA Probed by 1,1-(4,4,8,8-Tetramethyl-4,8-diazaundecamethylene)bis[4-[[3-methylbenz-1,3-oxazol-2-yl]methylidine]-1,4-dihydroquinolinium] Tetraiodide Fluorescence. Biochemistry 41:15277-15287. [0292] 56. Guarnieri F, Mezei M (1996) Simulated Annealing of Chemical Potential: A General Procedure for Locating Bound Waters. Application to the Study of the Differential Hydration Propensities of the Major and Minor Grooves of DNA. J Am Chem Soc 118:8493-8494. [0293] 57. Spink C H, Chaires J B (1999) Effects of Hydration, Ion Release, and Excluded Volume on the Melting of Triplex and Duplex DNA. Biochemistry 38:496-508. [0294] 58. Tateishi-Karimta H, Sugimoto N (2014) Control of stability and structure of nucleic acids using cosolutes. Methods 67:151-158. [0295] 59. Miyoshi D, Karimata H, Sugimoto N (2006) Hydration Regulates Thermodynamics of G-Quadruplex Formation under Molecular Crowding Conditions. J Am Chem Soc 128:7957-7963. [0296] 60. Munkholm C, Parkinson D R, Walt D R (1990) Intramolecular fluorescence self-quenching of fluoresceinamine. J Am Chem Soc 112:2608-2612. [0297] 61. Hu L, et al. (2012) Highly sensitive fluorescent detection of trypsin based on BSA-stabilized gold nanoclusters. Biosens Bioelectron 32:297-299. [0298] 62. Xiao H, Woods E C, Vukojicic P, Bertozzi C R (2016) Precision glycocalyx editing as a strategy for cancer immunotherapy. Proc Nat Acad Sci 113:10304 LP-10309. [0299] 63. Gray, Melissa A.; Stanczak Michal A.; Xiao Han; Pijnenborg, Johan F. A.; Malaker, Stacy A.; Tanzo, Julia T.; Ahn, Green; Weidenbacher, Payton A.; Woods, Elliot C.; Laubli H, Bertozzi C R (2019) Targeted desialylation overcomes glyco-immune checkpoints and potentiates the anticancer immune response in vivo. https://doi.org/026434/chemrxiv8l87146.v1.
[0300] Thus while there have been described what are presently believed to be preferred embodiments of the invention, those skilled in the art will realize that changes and modifications may be made thereto without departing from the spirit of the invention, and it is intended to claim all such changes and modifications as fall within the true scope of the invention.