Means and methods for counteracting muscle disorders
RE048468 ยท 2021-03-16
Assignee
Inventors
- Josephus Johannes De Kimpe (Utrecht, NL)
- Gerard Johannes Platenburg (Voorschoten, NL)
- Judith Christina Theodora van Deutekom (Dordrecht, NL)
- Annemieke Aartsma-Rus (Hoofddorp, NL)
- Garrit-Jan Boudewijn Van Ommen (Amsterdam, NL)
Cpc classification
C12N2310/111
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
A61K31/57
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
C12N2310/346
CHEMISTRY; METALLURGY
A61K31/56
HUMAN NECESSITIES
A61K31/57
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
A61K31/58
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K31/56
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
A61K31/573
HUMAN NECESSITIES
A61K31/573
HUMAN NECESSITIES
A61K31/58
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61K31/57
HUMAN NECESSITIES
A61K31/58
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
A61K31/573
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
A61K31/56
HUMAN NECESSITIES
Abstract
The invention provides means and methods for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy and/or Becker Muscular Dystrophy. Therapies using compounds for providing patients with functional muscle proteins are combined with at least one adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or at least one adjunct compound for improving muscle fiber function, integrity and/or survival.
Claims
.[.1. A composition comprising: a first compound that increases the level of a functional dystrophin protein produced in a muscle cell of a Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD) individual, wherein said first compound is an antisense oligonucleotide that induces skipping of exon 51 of human dystrophin pre-mRNA of said individual; and a second compound comprising a steroid; wherein, upon administration to a DMD or BMD patient, the composition increases the ratio of said dystrophin to laminin-2 in muscle tissue of said patient as compared to the ratio of said dystrophin to laminin-2 in muscle tissue of a patient administered with said first compound and not said second compound; and wherein said antisense oligonucleotide is 100% complementary to a portion of exon 51 that is 13 to 50 nucleotides in length and wherein said oligonucleotide comprises a non naturally-occurring modification..].
.[.2. The composition of claim 1, wherein said antisense oligonucleotide is 100% complementary to a portion of exon 51 that is 14 to 25 nucleotides in length..].
.[.3. The composition of claim 1, wherein said antisense oligonucleotide is 100% complementary to a portion of exon 51 that is 20 to 25 nucleotides in length..].
.[.4. The composition of claim 1, wherein said oligonucleotide comprises one or more ribonucleotides, and wherein a said ribonucleotide contains a modification..].
.[.5. The composition of claim 4, wherein said modification is a 2-O-methyl modified ribose..].
.[.6. The composition of claim 1, wherein said modification is selected from the group consisting of at least one of a peptide nucleic acid, a locked nucleic acid, and morpholino phosphorodiamidate..].
.[.7. A method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual, the method comprising administering to a DMD or BMD patient: a first compound that increases the level of a functional dystrophin protein produced in a muscle cell of said individual in said individual, wherein said first compound is an antisense oligonucleotide that induces skipping of exon 51 of dystrophin pre-mRNA of said individual, and a second compound, comprising a steroid; wherein, upon administration to a DMD or BMD patient, the composition increases the ratio of said dystrophin to laminin-2 in muscle tissue of said patient as compared to the ratio of said dystrophin to laminin-2 in muscle tissue of a patient administered with said first compound and not said second compound; and wherein said antisense oligonucleotide is 100% complementary to a portion of exon 51 that is 13 to 50 nucleotides in length and wherein said oligonucleotide comprises a non naturally-occurring modification..].
.[.8. The method of claim 7, wherein said oligonucleotide comprises one or more ribonucleotides, and wherein a said ribonucleotide contains a modification..].
.[.9. The method of claim 8, wherein said modification is selected from the group consisting of a 2-O-methyl modified ribose..].
.[.10. The method of claim 7, wherein said modification is selected from the group consisting of at least one of a peptide nucleic acid, a locked nucleic acid, and morpholino phosphorodiamidate..].
.[.11. A method for increasing the production of a functional dystrophin protein in a cell, said cell comprising pre-mRNA of a dystrophin gene encoding an aberrant dystrophin protein comprising: providing said cell with a first compound for inhibiting inclusion of exon 51 into mRNA produced from splicing of said dystrophin pre-mRNA, wherein said first compound is an antisense oligonucleotide that induces the skipping of exon 51 of the human dystrophin pre-mRNA, and providing said cell with a second compound comprising a steroid, said method further comprising allowing translation of mRNA produced from splicing of said pre-mRNA; wherein, upon administration to a DMD or BMD patient, the composition increases the ratio of said dystrophin to laminin-2 in muscle tissue of said patient as compared to the ratio of said dystrophin to laminin-2 in muscle tissue of a patient administered with said first compound and not said second compound; and wherein said antisense oligonucleotide is 100% complementary to a portion of exon 51 that is 13 to 50 nucleotides in length and wherein said oligonucleotide comprises a non naturally-occurring modification..].
.[.12. A pharmaceutical preparation comprising: said first compound according to claim 1, said second compound according to claim 1, comprising a steroid, and a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient..].
.[.13. A kit comprising: said first compound according to claim 1, and said second compound according to claim 1..].
.[.14. The kit of claim 13, further comprising a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient..].
.[.15. The kit of claim 13, further comprising packaging means thereof..].
.[.16. The composition according to claim 1, wherein the oligonucleotide comprises a phosphorothioate internucleotide linkage, a 2-O-methyl ribose and/or a LNA..].
.[.17. The kit according to claim 13, wherein the oligonucleotide comprises a phosphorothioate internucleotide linkage, a 2-O-methyl ribose and/or a LNA..].
.[.18. A pharmaceutical composition comprising the composition of claim 1 and a pharmaceutically acceptable carrier, adjuvant, diluent, and/or excipient..].
.[.19. The method of claim 7 wherein said steroid is a glucocorticosteroid..].
.[.20. The method of claim 19 wherein said glucocorticosteroid is selected from a group consisting of prednisone, dexamethasone, prednizolone and deflazacort..].
.[.21. The method of claim 20 wherein said prednisone is present at a dosage of 0.5-1.0 mg/kg..].
.[.22. The method of claim 20 wherein said deflazacort is present at a dosage of 0.4-1.4 mg/kg..].
.Iadd.23. A method for alleviating one or more symptoms of Duchenne muscular dystrophy in a human patient, comprising administering to the patient an antisense oligonucleotide that is: (a) 100% complementary to a portion of exon 51 of the human dystrophin pre-mRNA and (b) 30 nucleotides in length, wherein the antisense oligonucleotide comprises the sequence 5-CUC CAA CAU CAA GGA AGA UGG CAU UUC UAG-3 (SEQ ID NO:193), wherein the antisense oligonucleotide is a morpholino phosphorodiamidate, wherein the antisense oligonucleotide is administered intravenously, wherein the antisense oligonucleotide induces skipping of exon 51 of dystrophin pre-mRNA, and wherein the patient is receiving glucocorticosteroid treatment..Iaddend.
.Iadd.24. The method of claim 23, wherein the patient was receiving the glucocorticosteroid treatment prior to the administration of the antisense oligonucleotide..Iaddend.
.Iadd.25. The method of claim 24, wherein the prior glucocorticosteroid treatment was for a period of at least three weeks..Iaddend.
.Iadd.26. The method of claim 23, wherein the glucocorticosteroid is selected from the group consisting of prednisone, dexamethasone, prednisolone, and deflazacort..Iaddend.
.Iadd.27. The method of claim 26, wherein the glucocorticosteroid is prednisone..Iaddend.
.Iadd.28. The method of claim 27, wherein the patient is receiving the prednisolone at a dose of about 0.5 mg/kg/day to about 1.0 mg/kg/day..Iaddend.
.Iadd.29. The method of claim 26, wherein the glucocorticosteroid is deflazacort..Iaddend.
.Iadd.30. The method of claim 29, wherein the patient is receiving the deflazacort at a dose of about 0.4 mg/kg/day to about 1.4 mg/kg/day..Iaddend.
.Iadd.31. The method of claim 23, wherein the method increases the ratio of dystrophin to laminin-2 in muscle tissue of the patient as compared to the ratio of dystrophin to laminin-2 in muscle tissue of a similar patient treated with the antisense oligonucleotide and not the glucocorticosteroid..Iaddend.
.Iadd.32. A method for alleviating one or more symptoms of Duchenne muscular dystrophy in a human patient, comprising administering to the patient an antisense oligonucleotide that is: (a) 100% complementary to a portion of exon 51 of the human dystrophin pre-mRNA and (b) 30 nucleotides in length, wherein the antisense oligonucleotide is a functional equivalent of an oligonucleotide comprising the sequence 5-CUC CAA CAU CAA GGA AGA UGG CAU UUC UAG-3 (SEQ ID NO:193), wherein the antisense oligonucleotide is a morpholino phosphorodiamidate, wherein the antisense oligonucleotide is administered intravenously, wherein the antisense oligonucleotide induces skipping of exon 51 of dystrophin pre-mRNA, and wherein the patient is receiving glucocorticosteroid treatment..Iaddend.
.Iadd.33. A method for alleviating one or more symptoms of Duchenne muscular dystrophy in a human patient, comprising administering to the patient an antisense oligonucleotide that is 100% complementary to the portion of exon 51 of the human dystrophin pre-mRNA to which the sequence 5-CUC CAA CAU CAA GGA AGA UGG CAU UUC UAG-3 (SEQ ID NO:193) is complementary, wherein the antisense oligonucleotide is 30 nucleotides in length, wherein the antisense oligonucleotide is a morpholino phosphorodiamidate, wherein the antisense oligonucleotide is administered intravenously, wherein the antisense oligonucleotide induces skipping of exon 51 of dystrophin pre-mRNA, and wherein the patient is receiving glucocorticosteroid treatment..Iaddend.
.Iadd.34. The method of claim 33, wherein the patient has received the glucocorticosteroid treatment prior to the administration of the antisense oligonucleotide..Iaddend.
.Iadd.35. The method of claim 34, wherein the prior glucocorticosteroid treatment was for a period of at least three weeks..Iaddend.
.Iadd.36. The method of claim 33, wherein the glucocorticosteroid is selected from the group consisting of prednisone, dexamethasone, prednisolone, and deflazacort..Iaddend.
.Iadd.37. The method of claim 36, wherein the glucocorticosteroid is prednisone..Iaddend.
.Iadd.38. The method of claim 37, wherein the patient is receiving the prednisone at a dose of about 0.5 mg/kg/day to about 1.0 mg/kg/day..Iaddend.
.Iadd.39. The method of claim 36, wherein the glucocorticosteroid is deflazacort..Iaddend.
.Iadd.40. The method of claim 39, wherein the patient is receiving the deflazacort at a dose of about 04. Mg/kg/day to about 1.4 mg/kg/day..Iaddend.
.Iadd.41. The method of claim 33, wherein the method increases the ratio of dystrophin to laminin-2 in muscle tissue of the patient as compared to the ratio of dystrophin to laminin-2 in muscle tissue of a similar patient treated with the antisense oligonucleotide and not the glucocorticosteroid..Iaddend.
.Iadd.42. A method for alleviating one or more symptoms of Duchenne muscular dystrophy in a human patient, comprising administering to the patient an antisense oligonucleotide that is 100% complementary to the portion of exon 51 of the human dystrophin pre-mRNA to which the sequence 5-CUC CAA CAU CAA GGA AGA UGG CAU UUC UAG-3 (SEQ ID NO:193) is complementary, wherein the antisense oligonucleotide is 30 nucleotides in length, wherein the antisense oligonucleotide is a morpholino phosphorodiamidate, wherein the antisense oligonucleotide is administered intravenously, wherein the antisense oligonucleotide induces skipping of exon 51 of dystrophin pre-mRNA, wherein the patient is receiving glucocorticosteroid treatment, wherein the glucocorticosteroid is selected from prednisone and deflazacort, and wherein the method increases the ratio of dystrophin to laminin-2 in muscle tissue of the patient as compared to the ratio of dystrophin to laminin-2 in muscle tissue of a similar patient treated with the antisense oligonucleotide and not the glucocorticosteroid..Iaddend.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2) In a patient with Duchenne's muscular dystrophy who has a deletion of exon 50, an out-of-frame transcript is generated in which exon 49 is spliced to exon 51 (A). As a result, a stop codon is generated in exon 51, which prematurely aborts dystrophin synthesis. The sequence-specific binding of the exon-internal antisense oligonucleotide PRO051 interferes with the correct inclusion of exon 51 during splicing so that the exon is actually skipped (B). This restores the open reading frame of the transcript and allows the synthesis of a dystrophin similar to that in patients with Becker's muscular dystrophy (BMD).
(3)
(4) Magnetic resonance images of the lower legs of the four patients (the left leg of Patient 3 and right legs of the other three patients) show the adequate condition of the tibialis anterior muscle (less than 50% fat infiltration and fibrosis) (A). The diagnosis of Duchenne's muscular dystrophy in these patients was confirmed by diaminobenzidine tetrahydrochloride staining of cross sections of biopsy specimens obtained previously from the quadriceps muscle (B). No dystrophin expression was observed, with the exception of one dystrophin-positive, or revertant, fiber in Patient 2 (arrow). Reverse-transcriptase-polymerase chain-reaction (RT-PCR) analysis of the transcript region flanking the patients' mutations and exon 51 confirmed both the individual mutations in nontreated myotubes (NT) and the positive response to PRO051 (i.e., exon 51 skipping) in treated myotubes (T) on the RNA level (C). The efficiencies of exon skipping were 49% for Patient 1, 84% for Patient 2, 58% for Patient 3, and 90% for Patient 4. A cryptic splice site within exon 51 is sometimes activated by PRO051 in cell culture, resulting in an extra aberrant splicing product, as seen in the treated sample from Patient 4. Lane M shows a 100-bp size marker, and lane C RNA from healthy control muscle. Sequence analysis of the RT-PCR fragments from treated and untreated myotubes identified the precise skipping of exon 51 for each patient (D). The new in-frame transcripts led to substantial dystrophin synthesis, as detected by immunofluorescence analysis of treated myotubes with the use of monoclonal antibody NCL-DYS2 (E).
(5) No dystrophin was detected before treatment.
(6)
(7) After treatment with PRO051, reverse-transcriptase-polymerase-chain-reaction (RT-PCR) analysis shows novel, shorter transcript fragments for each patient. Both the size and sequence of these fragments confirm the precise skipping of exon 51. No additional splice variants were observed. At 28 days, still significant in-frame RNA transcripts were detected, suggesting prolonged persistence of PRO051 in muscle. Owing to the small amount of section material, high-sensitivity PCR conditions were used; this process precluded the accurate quantification of skipping efficiencies and the meaningful correlation between levels of RNA and protein. M denotes size marker, and C control.
(8)
(9)
(10)
(11)
(12)
(13)
EXAMPLES
Example 1
(14) In a recent clinical study the local safety, tolerability, and dystrophin-restoring effect of antisense compound PRO051 was assessed. The clinical study was recently published. The content of the publication is reproduced herein under example 1A. In brief, PRO051 is a synthetic, modified RNA molecule with sequence 5-UCA AGG AAG AUG GCA UUU CU-3, and designed to specifically induce exon 51 skipping.sup.59. It carries full-length 2-O-methyl substituted ribose moieties and phosphorothioate internucleotide linkages. Four DMD patients with different specific DMD gene deletions correctable by exon 51 skipping were included. At day 0, a series of safety parameters was assessed. The patient's leg (i.e. tibialis anterior muscle) was fixed with a tailor-made plastic mould and its position was carefully recorded. A topical anesthetic (EMLA) was used to numb the skin Four injections of PRO051 were given along a line of 1.5 cm between two small skin tattoos, using a 2.5 cm electromyographic needle (MyoJect Disposable Hypodermic Needle Electrode, TECA Accessories) to ensure intramuscular delivery. Each injection volume was 200 l, containing 200 g PRO051, dispersed in equal portions at angles of approximately 30 degrees. At day 28, the same series of safety parameters was assessed again. The leg was positioned using the patient's own mould, and a semi-open muscle biopsy was taken between the tattoos under local anesthesia using a forceps with two sharp-edged jaws (Blakesley Conchotoma, DK Instruments). The biopsy was snap-frozen in liquid nitrogen-cooled 2-methylbutane. Patients were treated sequentially. At the time of study, two patients (nr. 1 and 2) were also on corticosteroids (prednisone or deflazacort), one had just stopped steroid treatment (nr. 4) and one patient never used steroids (nr. 3) (see Table 1). This latter patient was also the one who lost ambulance at the youngest age when compared to the other three patients. The biopsy was analysed, for detection of specific exon skipping on RNA level (RT-PCR analysis, not shown) and novel expression of dystrophin on protein level (immunofluorescence and western blot analyses, summarized in Table 1). Assessment of the series of safety parameters (routine plasma and urine parameters for renal and liver function, electrolyte levels, blood cell counts, hemoglobin, aPTT, AP50 and CH50 values) before and after treatment, indicated that the PRO051 compound was locally safe and well tolerated. For immunofluorescence analysis, acetone-fixed cross-sections of the biopsy were incubated for 90 minutes with monoclonal antibodies against the central rod domain (MANDYS106, Dr. G. Morris, UK, 1:60), the C-terminal domain (NCL-DYS2, Novocastra Laboratories Ltd., 1:30) or, as reference, laminin-2 (Chemicon International, Inc, 1:150), followed by Alexa Fluor 488 goat anti-mouse IgG (H+L) (Molecular Probes, Inc, 1:250) antibody for one hour. Sections were mounted with Vectashield Mounting Medium (Vector Laboratories Inc.). For quantitative image analysis the ImageJ software (W. Rasband, NIH, USA; http://rsb.info.nih.gov/ij) was used as described.sup.60,61. Entire cross-sections were subdivided into series of 6-10 adjacent images, depending on section size. To ensure reliable measurements, staining of the sections and recording of all images was performed in one session, using fixed exposure settings, and avoiding pixel saturation. The lower intensity threshold was set at Duchenne muscular dystrophy background, and positive fluorescence was quantified for each section (area percentage), both for dystrophin and laminin-2. Western blot analysis was performed as described.sup.1, using pooled homogenates from sets of four serial 50 m sections throughout the biopsy. For the patients 30 and 60 g total protein was applied and for the control sample 3 g. The blot was incubated overnight with dystrophin monoclonal antibody NCL-DYS1 (Novocastra Laboratories, 1:125), followed by goat anti-mouse IgG-HRP (Santa Cruz Biotechnology, 1:10.000) for one hour Immuno-reactive bands were visualized using the ECL Plus Western Blotting Detection System (GE Healthcare) and Hyperfilm ECL (Amersham, Biosciences). Signal intensities were measured using ImageJ. Novel dystrophin protein expression at the sarcolemma was detected in the majority of muscle fibers in the treated area in all four patients. The fibers in each section were manually counted after staining for laminin-2, a basal lamina protein unaffected by dystrophin deficiency. The individual numbers varied, consistent with the biopsy size and the quality of the patients' muscles. In the largest sections, patient 2 had 726 fibers, of which 620 were dystrophin-positive, while patient 3 had 120 fibers, of which 117 were dystrophin-positive. The dystrophin intensities were typically lower than those in a healthy muscle biopsy. Western blot analysis confirmed the presence of dystrophin in varying amounts. The dystrophin signals were scanned and correlated to the control (per g total protein). The amounts varied from 3% in patient 3 with the most dystrophic muscle, to 12% in patient 2 with the best preserved muscle. Since such comparison based on total protein does not correct for the varying amounts of fibrotic and adipose tissue in Duchenne muscular dystrophy patients, we also quantified the dystrophin fluorescence signal relative to that of the similarly-located laminin-2 in each section, by ImageJ analysis. When this dystrophin/laminin-2 ratio was set at 100% for the control section, the two patients that were co-treated with corticosteroids showed the highest percentages of dystrophin, 32% in patient 1 and 35% in patient 2 (Table 1). The lowest percentage of dystrophin was detected in patient 3, 17%. In patient 4 an intermediate percentage of 25% was observed. These percentages correlated to the relative quality of the target muscle, which was best in patients nr. 1 and 2, and worst in patient nr. 3.
(15) TABLE-US-00001 TABLE 1 Patient 1 Patient 2 Patient 3 Patient 4 Age (yrs) 10 13 13 11 Age at Loss of 9 11 7 10 Ambulation (yrs) Steroid Treatment Yes Yes Never Until January 2006 Ratio Dystrophin/ 32% 35% 17% 25% laminin-alpha2 Conclusion: the effect of the PRO051 antisense compound was more prominent in those patients that were also subjected to corticosteroids.
Example 1A
(16) Reproduced from Van Deutekom J C et al, (2007) Antisense Oligonucleotide PRO051 Restores Local Dystrophin in DMD Patients. N Engl J. Med., 357(26): 2677-86.
(17) Methods
(18) Patients and Study Design
(19) Patients with Duchenne's muscular dystrophy who were between the ages of 8 and 16 years were eligible to participate in the study. All patients had deletions that were correctable by exon-51 skipping and had no evidence of dystrophin on previous diagnostic muscle biopsy. Concurrent glucocorticoid treatment was allowed. Written informed consent was obtained from the patients or their parents, as appropriate. During the prescreening period (up to 60 days), each patient's mutational status and positive exon-skipping response to PRO051 in vitro were confirmed, and the condition of the tibialis anterior muscle was determined by T.sub.1-weighted magnetic resonance imaging (MRI)..sup.62 For patients to be included in the study, fibrotic and adipose tissue could make up no more than 50% of their target muscle.
(20) During the baseline visit, safety measures were assessed. In each patient, the leg that was to be injected was fixed with a tailor-made plastic mold and its position was recorded. A topical eutectic mixture of local anesthetics (EMLA) was used to numb the skin. Four injections of PRO051 were given along a line measuring 1.5 cm running between two small skin tattoos with the use of a 2.5-cm electromyographic needle (MyoJect Disposable Hypodermic Needle Electrode, TECA Accessories) to ensure intramuscular delivery. The volume of each injection was 200 l containing 200 g of PRO051, which was dispersed in equal portions at angles of approximately 30 degrees.
(21) At day 28, safety measures were assessed again. The leg that had been injected was positioned with the use of the patient's own mold, and a semiopen muscle biopsy was performed between the tattoos under local anesthesia with a forceps with two sharp-edged jaws (Blakesley Conchotoma, DK Instruments)..sup.63 The biopsy specimen was snap-frozen in 2-methylbutane cooled in liquid nitrogen.
(22) Patients were treated sequentially from May 2006 through March 2007 and in compliance with Good Clinical Practice guidelines and the provisions of the Declaration of Helsinki. The study was approved by the Dutch Central Committee on Research Involving Human Subjects and by the local institutional review board at Leiden University Medical Center. All authors contributed to the study design, participated in the collection and analysis of the data, had complete and free access to the data, jointly wrote the manuscript, and vouch for the completeness and accuracy of the data and analyses presented.
(23) Description of PRO051
(24) PRO051 is a synthetic, modified RNA molecule with sequence 5-UCAAGGAAGAUGGCAUUUCU-3..sup.12 It carries full-length 2-O-methyl-substituted ribose molecules and phosphorothioate internucleotide linkages. The drug was provided by Prosensa B.V. in vials of 1 mg of freeze-dried material with no excipient. It was dissolved and administered in sterile, unpreserved saline (0.9% sodium chloride). PRO051 was not found to be mutagenic by bacterial Ames testing. In regulatory Good Laboratory Practice safety studies, rats that received a single administration of up to 8 mg per kilogram of body weight intramuscularly and 50 mg per kilogram intravenously showed no adverse effects; monkeys receiving PRO051 for 1 month appeared to tolerate doses up to 16 mg per kilogram per week when the drug was administered by intravenous 1-hour infusion or by subcutaneous injection, without clinically relevant adverse effects.
(25) In Vitro Prescreening
(26) A preexisting primary myoblast culture.sup.1 was used for the prescreening of Patient 4. For the other three patients, fibroblasts were converted into myogenic cells after infection with an adenoviral vector containing the gene for the myogenic transcription factor (MyoD) as described previously..sup.1,64,65 Myotube cultures were transfected with PRO051 (100 nM) and polyethylenimine (2 l per microgram of PRO051), according to the manufacturer's instructions for ExGen500 (MBI Fermentas). RNA was isolated after 48 hours. Reverse transcriptase-polymerase chain reaction (RT-PCR), immunofluorescence, and Western blot analyses were performed as reported previously.sup.1,12 PCR fragments were analyzed with the use of the 2100 Bioanalyzer (Agilent) and isolated for sequencing by the Leiden Genome Technology Center.
(27) Safety Assessment
(28) At baseline and at 2 hours, 1 day, and 28 days after injection, all patients received a full physical examination (including the measurement of vital signs) and underwent electrocardiography. In addition, plasma and urine were obtained to determine renal and liver function, electrolyte levels, complete cell counts, the activated partial-thromboplastin time, and complement activity values in the classical (CH50) and alternative (AP50) routes. The use of concomitant medications was recorded. At baseline and on day 28, the strength of the tibialis anterior muscle was assessed with the use of the Medical Research Council scale.sup.66 to evaluate whether the procedures had affected muscle performance. (On this scale, a score of 0 indicates no movement and a score of 5 indicates normal muscle strength.) Since only a small area of the muscle was treated, clinical benefit in terms of increased muscle strength was not expected. At each visit, adverse events were recorded.
(29) RNA Assessment
(30) Serial sections (50 m) of the frozen muscle-biopsy specimen were homogenized in RNA-Bee solution (Campro Scientific) and MagNA Lyser Green Beads (Roche Diagnostics). Total RNA was isolated and purified according to the manufacturer's instructions. For complementary DNA, synthesis was accomplished with Transcriptor reverse transcriptase (Roche Diagnostics) with the use of 500 ng of RNA in a 20-l reaction at 55 C. for 30 minutes with human exon 53 or 54 specific reverse primers. PCR analyses were performed as described previously..sup.1,12 Products were analyzed on 2% agarose gels and sequenced. In addition, RT-PCR with the use of a primer set for the protein-truncation test.sup.67 was used to rapidly screen for aspecific aberrant splicing events throughout the DMD gene.
(31) Assessment of Protein Level
(32) For immunofluorescence analysis, acetone-fixed sections were incubated for 90 minutes with monoclonal antibodies against the central rod domain (MANDYS106, Dr. G. Morris, United Kingdom) at a dilution of 1:60, the C-terminal domain (NCL-DYS2, Novocastra Laboratories) at a dilution of 1:30, or (as a reference) laminin (Chemicon International), a basal lamina protein that is unaffected by dystrophin deficiency, at a dilution of 1:150, followed by Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody (Molecular Probes) at a dilution of 1:250 for 1 hour. Sections were mounted with Vectashield Mounting Medium (Vector Laboratories). ImageJ software (W. Rasband, National Institutes of Health, http://rsb.info.nih.gov/ij) was used for quantitative image analysis as described previously..sup.60,61 Entire cross sections were subdivided into series of 6 to 10 adjacent images, depending on the size of the section. To ensure reliable measurements, staining of the sections and recording of all images were performed during one session with the use of fixed exposure settings and the avoidance of pixel saturation. The lower-intensity threshold was set at background for Duchenne's muscular dystrophy, and positive fluorescence was quantified for each section (area percentage), both for dystrophin and laminin 2.
(33) Western blot analysis was performed as described previously.sup.1 with the use of pooled homogenates from sets of four serial 50-m sections throughout the biopsy specimen. For each patient, two amounts of total protein30 g and 60 gwere applied, and for the control sample, 3 g. The Western blot was incubated overnight with dystrophin monoclonal antibody NCL-DYS1 (Novocastra Laboratories) at a dilution of 1:125, followed by horseradish-peroxidase-labeled goat antimouse IgG (Santa Cruz Biotechnology) at a dilution of 1:10,000 for 1 hour. Immunoreactive bands were visualized with the use of the ECL Plus Western blotting detection system (GE Healthcare) and Hyperfilm ECL (Amersham Biosciences). Signal intensities were measured with the use of ImageJ software.
(34) Results
(35) Prescreening of Patients
(36) The study was planned to include four to six patients. Six patients were invited to participate, and one declined. The remaining five patients were prescreened. First, the condition of the tibialis anterior muscle was evaluated on MRI. The muscle condition of four patients was deemed to be adequate for the study (
(37) Safety and Adverse Events
(38) All patients had one or more adverse events. However, only one patient reported mild local pain at the injection site, which was considered to be an adverse event related to the study drug. Other events included mild-to-moderate pain after the muscle biopsy. Two patients had blistering under the bandages used for wound closure. In the period between injection and biopsy, two patients reported a few days of flulike symptoms, and one patient had mild diarrhea for 1 day. At baseline, the muscle-strength scores of the treated tibialis anterior muscle in Patients 1, 2, 3, and 4 were 4, 2, 3, and 4, respectively, on the Medical Research Council scale. None of the patients showed changes in the strength of this muscle during the study or significant alterations in standard laboratory measures or increased measures of complement split products or activated partial-thromboplastin time. No local inflammatory or toxic response was detected in the muscle sections of the patients (data not shown). Patient 3 successfully underwent preplanned surgery for scoliosis in the month after the study was completed.
(39) RNA and Protein Level
(40) At day 28, a biopsy of the treated area was performed in each patient. Total muscle RNA was isolated from serial sections throughout the biopsy specimen. In all patients, RT-PCR identified a novel, shorter fragment caused by exon-51 skipping, as confirmed by sequencing (
(41) Western blot analysis confirmed the presence of dystrophin in varying amounts (
(42) Discussion
(43) Our study showed that local intramuscular injection of PRO051, a 2OMePS antisense oligoribonucleotide complementary to a 20-nucleotide sequence within exon 51, induced exon-51 skipping, corrected the reading frame, and thus introduced dystrophin in the muscle in all four patients with Duchenne's muscular dystrophy who received therapy. Dystrophin-positive fibers were found throughout the patients' biopsy specimens, indicating dispersion of the compound in the injected area. Since no delivery-enhancing excipient was used, PRO051 uptake did not seem to be a major potentially limiting factor. We cannot rule out that increased permeability of the dystrophic fiber membrane had a favorable effect. The patients produced levels of dystrophin that were 3 to 12% of the level in healthy control muscle, as shown on Western blot analysis of total protein. Since the presence of fibrosis and fat may lead to some underestimation of dystrophin in total protein extracts, we determined the ratio of dystrophin to laminin 2 in the cross sections, which ranged from 17 to 35, as compared with 100 in control muscle. The dystrophin-restoring effect of PRO051 was limited to the treated area, and no strength improvement of the entire muscle was observed. Future systemic treatment will require repeated administration to increase and maintain dystrophin expression at a higher level and to obtain clinical efficacy.
(44) Because of medical-ethics regulations regarding interventions in minors, we could not obtain a biopsy specimen from the patients' contralateral muscles that had not been injected. However, the patients showed less than 1% of revertant fibers in the original diagnostic biopsy specimens obtained 5 to 9 years before the initiation of the study (Table 2 and
(45) In summary, our study showed that local administration of PRO051 to muscle in four patients with Duchenne' s muscular dystrophy restored dystrophin to levels ranging from 3 to 12% or 17 to 35%, depending on quantification relative to total protein or myofiber content. Consistent with the distinctly localized nature of the treatment, functional improvement was not observed. The consistently poorer result in Patient 3, who had the most advanced disease, suggests the importance of performing clinical trials in patients at a relatively young age, when relatively little muscle tissue has been replaced by fibrotic and adipose tissue. Our findings provide an indication that antisense-mediated exon skipping may be a potential approach to restoring dystrophin synthesis in the muscles of patients with Duchenne's muscular dystrophy.
Example 2
(46) In a pre-clinical study in mdx mice (animal model for DMD) the effect of adjunct compound prednisone on AON-induced exon skipping was assessed.
(47) Mdx mice (C57Bl/10ScSn-mdx/J) were obtained from Charles River Laboratories (The Netherlands). These mice are dystrophin-deficient due to a nonsense mutation in exon 23. AON-induced exon 23 skipping is therapeutic in mdx mice by removing the nonsense mutation and correction of the open reading frame. Two mdx mice per group were injected subcutaneously with: Group 1) physiologic salt (wk 1-8), Group 2) prednisolone (1 mg/kg, wk 1-8), Group 3) mouse-specific antisense oligonucleotide PS49 designed to specifically induce exon 23 skipping (100 mg/kg, wk 4 (5 times), week 5-8 (2 times), Group 4) prednisolone (1 mg/kg, wk 1-8)+PS49 (100 mg/kg, wk 4 (5 times), week 5-8 (2 times). PS49 (5 GGCCAAACCUCGGCUUACCU 3) has a full-length phosphorothioate backbone and 2O-methyl modified ribose molecules.
(48) All mice were sacrificed at 1 week post-last-injection. Different muscles groups, including quadriceps, tibialis anterior, and diaphragm muscles were isolated and frozen in liquid nitrogen-cooled 2-methylbutane. For RT-PCR analysis, the muscle samples were homogenized in the RNA-Bee solution (Campro Scientific, The Netherlands). Total RNA was isolated and purified according to the manufacturer's instructions. For cDNA synthesis with reverse transcriptase (Roche Diagnostics, The Netherlands), 300 ng of RNA was used in a 20 l reaction at 55 C. for 30 min, reverse primed with mouse DMD gene-specific primers. First PCRs were performed with outer primer sets, for 20 cycles of 94 C. (40 sec), 60 C. (40 sec), and 72 C. (60 sec). One l of this reaction (diluted 1:10) was then re-amplified using nested primer combinations in the exons directly flanking exon 23, with 30 cycles of 94 C. (40 sec), 60 C. (40 sec), and 72 C. (60 sec). PCR products were analysed on 2% agarose gels. Skipping efficiencies were determined by quantification of PCR products using the DNA 1000 LabChip Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands). No exon 23 skipping was observed in the muscles from mice treated with physiologic salt or prenisolone only (groups 1 and 2). Levels of exon 23 skipping were detected and per muscle group compared between mice treated with PS49 only (group 3) and mice treated with PS49 and adjunct compound prednisolone (group 4). In the quadriceps (Q), tibialis anterior (TA), and diaphragm (DIA) muscles, exon 23 skipping levels were typically higher in group 4 when compared to group 3 (
Example 3
(49) A., B. Differentiated muscle cell cultures (myotubes) derived from a healthy control individual were transfected with 250 nM PS188 ([5 UCAGCUUCUGUUAGCCACUG 3; SEQ ID NO:10] an AON optimized to specifically skip exon 44) or 250 nM PS221 ([5 AUUCAAUGUUCUGACAACAGUUUGC 3; SEQ ID NO: 60] an AON optimized to specifically skip exon 45) in the presence of 0 to 0.5 mg/ml pentoxifylline, using the transfection reagent polymer UNIFectylin (2.0 l UNIFectylin per g AON in 0.15M NaCl). UNIFectylin interacts electrostatically with nucleic acids, provided that the nucleic acid is negatively charged (such as 2-O-methyl phosphorothioate AONs). Pentoxyfillin (Sigma Aldrich) was dissolved in water. Total RNA was isolated 24 hrs after transfection in RNA-Bee solution (Campro Scientific, The Netherlands) according to the manufacturer's instructions. For cDNA synthesis with reverse transcriptase (Roche Diagnostics, The Netherlands), 500 ng of RNA was used in a 20 l reaction at 55 C. for 30 min, reverse primed with DMD gene-specific primers. First PCRs were performed with outer primer sets, for 20 cycles of 94 C. (40 sec), 60 C. (40 sec), and 72 C. (60 sec). One l of this reaction (diluted 1:10) was then re-amplified using nested primer combinations in the exons directly flanking exon 44 or 45, with 30 cycles of 94 C. (40 sec), 60 C. (40 sec), and 72 C. (60 sec). PCR products were analysed on 2% agarose gels. Skipping efficiencies were determined by quantification of PCR products using the DNA 1000 LabChip Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands).
(50) Both with PS188 and PS221, increasing levels of exon 44 or 45 skipping were obtained with increasing concentrations of the adjunct compound pentoxifylline when compared to those obtained in cells that were not co-treated with pentoxyfilline (see
(51) C.
(52) In a pre-clinical study in mdx mice (animal model for DMD) the effect of adjunct compound pentoxyfilline on AON-induced exon skipping was assessed. Mdx mice (C57Bl/10ScSn-mdx/J) were obtained from Charles River Laboratories (The Netherlands). These mice are dystrophin-deficient due to a nonsense mutation in exon 23. AON-induced exon 23 skipping is therapeutic in mdx mice by removing the nonsense mutation and correction of the open reading frame. Two mdx mice per group were injected subcutaneously with: Group 1) pentoxyfilline (50 mg/kg, wk 1-2), Group 2) mouse-specific antisense oligonucleotide PS49 designed to specifically induce exon 23 skipping (100 mg/kg, wk 2 (2 times), Group 3) pentoxyfilline (50 mg/kg, wk 1-2)+PS49 (100 mg/kg, wk 2 (2 times). PS49 (5 GGCCAAACCUCGGCUUACCU 3) has a full-length phosphorothioate backbone and 2O-methyl modified ribose molecules.
(53) All mice were sacrificed at 1 week post-last-injection. Different muscles groups, including quadriceps, tibialis anterior, triceps and heart muscles were isolated and frozen in liquid nitrogen-cooled 2-methylbutane. For RT-PCR analysis, the muscle samples were homogenized in the RNA-Bee solution (Campro Scientific, The Netherlands). Total RNA was isolated and purified according to the manufacturer's instructions. For cDNA synthesis with reverse transcriptase (Roche Diagnostics, The Netherlands), 300 ng of RNA was used in a 20 l reaction at 55 C. for 30 min, reverse primed with mouse DMD gene-specific primers. First PCRs were performed with outer primer sets, for 20 cycles of 94 C. (40 sec), 60 C. (40 sec), and 72 C. (60 sec). One l of this reaction (diluted 1:10) was then re-amplified using nested primer combinations in the exons directly flanking exon 23, with 30 cycles of 94 C. (40 sec), 60 C. (40 sec), and 72 C. (60 sec). PCR products were analysed on 2% agarose gels. Skipping efficiencies were determined by quantification of PCR products using the DNA 1000 LabChip Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands). No exon 23 skipping was observed in the muscles from mice treated with pentoxyfilline only (groups 1). Levels of exon 23 skipping were detected and per muscle group compared between mice treated with PS49 only (group 2) and mice treated with PS49 and adjunct compound pentoxyfilline (group 3). In the quadriceps (Q), tibialis anterior (TA), triceps (Tri) and heart (HRT) muscles, exon 23 skipping levels were typically higher in group 3 when compared to group 2 (
(54) TABLE-US-00002 TABLE 2 Baseline characteristics of the DMD patients Patient 1 Patient 2 Patient 3 Patient 4 Age (yrs) 10 13 13 11 Deletion Exon 50 Exons Exons Exon 52 48-50 49-50 Age at Loss of 9 11 7 10 Ambulation (yrs) Scoliosis No No Yes Yes Creatine Kinase 5823 2531 717 4711 Levels (U/I).sup.1 Steroid treatment Yes Yes Never Until January 2006 Strength TA 4 2 3 4 muscle (MRC scale) MRI status TA Moderate.sup.2 Moderate.sup.2 Moderate.sup.2 Moderate.sup.2 muscle % Revertant N.D. <1% N.D. fibers .sup.1normal level: <200 U/I .sup.2less than 50% fat infiltration and/or fibrosis [Mercuri et al., 2005)
REFERENCES
(55) 1. Aartsma-Rus A, Janson A A, Kaman W E, et al. Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients. Hum Mol Genet. 2003; 12(8):907-14. 2. Aartsma-Rus A, Janson A A, Kaman W E, et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 2004; 74(1):83-92. 3. Alter J, Lou F, Rabinowitz A, et al. Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology. Nat Med 2006; 12(2):175-7. 4. Goyenvalle A, Vulin A, Fougerousse F, et al. Rescue of dystrophic muscle through U7 snRNA-mediated exon skipping. Science 2004; 306(5702):1796-9. 5. Lu Q L, Mann C J, Lou F, et al. Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse. Nat Med 2003; 6:6. 6. Lu Q L, Rabinowitz A, Chen Y C, et al. Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles. Proc Natl Acad Sci USA 2005; 102(1):198-203. 7. McClorey G, Fall A M, Moulton H M, et al. Induced dystrophin exon skipping in human muscle explants. Neuromuscul Disord 2006; 16(9-10):583-90. 8. McClorey G, Moulton H M, Iversen P L, et al. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther 2006; 13(19):1373-81. 9. Pramono Z A, Takeshima Y, Alimsardjono H, Ishii A, Takeda S, Matsuo M. Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence. Biochem Biophys Res Commun 1996; 226(2):445-9. 10. Takeshima Y, Yagi M, Wada H, et al. Intravenous infusion of an antisense oligonucleotide results in exon skipping in muscle dystrophin mRNA of Duchenne muscular dystrophy. Pediatr Res 2006; 59(5):690-4. 11. van Deutekom J C, Bremmer-Bout M, Janson A A, et al. Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells. Hum Mol Genet. 2001; 10(15):1547-54. 12. Aartsma-Rus A, Bremmer-Bout M, Janson A, den Dunnen J, van Ommen G, van Deutekom J. Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy. Neuromuscul Disord 2002; 12 Suppl:S71-S77. 13. Aartsma-Rus A, De Winter C L, Janson A A, et al. Functional analysis of 114 exon-internal AONs for targeted DMD exon skipping: indication for steric hindrance of SR protein binding sites. Oligonucleotides 2005; 15(4):284-97. 14. Aartsma-Rus A, Janson A A, Heemskerk J A, CL de Winter, G J Van Ommen, J C Van Deutekom. Therapeutic Modulation of DMD Splicing by Blocking Exonic Splicing Enhancer Sites with Antisense Oligonucleotides. Annals of the New York Academy of Sciences 2006; 1082:74-6. 15. Aartsma-Rus A, Kaman W E, Weij R, den Dunnen J T, van Ommen G J, van Deutekom J C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol Ther 2006; 14(3):401-7. 16. Welch E M, Barton E R, Zhuo J, et al. PTC124 targets genetic disorders caused by nonsense mutations. Nature 2007; 447(7140):87-91. 17. Hirawat S, Welch E M, Elfring G L, et al. Safety, tolerability, and pharmacokinetics of PTC124, a nonaminoglycoside nonsense mutation suppressor, following single- and multiple-dose administration to healthy male and female adult volunteers. Journal of clinical pharmacology 2007; 47(4):430-44. 18. Wang B, Li J, Xiao X. Adeno-associated virus vector carrying human minidystrophin genes effectively ameliorates muscular dystrophy in mdx mouse model. Proc Natl Acad Sci USA 2000; 97(25):13714-9. 19. Fabb S A, Wells D J, Serpente P, Dickson G. Adeno-associated virus vector gene transfer and sarcolemmal expression of a 144 kDa micro-dystrophin effectively restores the dystrophin-associated protein complex and inhibits myofibre degeneration in nude/mdx mice. Hum Mol Genet. 2002; 11(7):733-41. 20. Wang Z, Kuhr C S, Allen J M, et al. Sustained AAV-mediated dystrophin expression in a canine model of Duchenne muscular dystrophy with a brief course of immunosuppression. Mol Ther 2007; 15(6):1160-6. 21. Manzur AY, Kuntzer T, Pike M, Swan A. Glucocorticoid corticosteroids for Duchenne muscular dystrophy. Cochrane Database Syst Rev 2004; 2. 22. Duboc D, Meune C, Pierre B, et al. Perindopril preventive treatment on mortality in Duchenne muscular dystrophy: 10 years' follow-up. American heart journal 2007; 154(3):596-602. 23. Cohn R D, van Erp C, Habashi J P, et al. Angiotensin II type 1 receptor blockade attenuates TGF-beta-induced failure of muscle regeneration in multiple myopathic states. Nat Med 2007; 13(2):204-10. 24. Grounds M D, Torrisi J. Anti-TNFalpha (Remicade) therapy protects dystrophic skeletal muscle from necrosis. Faseb J 2004; 18(6):676-82. 25. Hodgetts S, Radley H, Davies M, Grounds M D. Reduced necrosis of dystrophic muscle by depletion of host neutrophils, or blocking TNFalpha function with Etanercept in mdx mice. Neuromuscul Disord 2006; 16(9-10):591-602. 26. Pierno S, Nico B, Burdi R, et al. Role of tumour necrosis factor alpha, but not of cyclo-oxygenase-2-derived eicosanoids, on functional and morphological indices of dystrophic progression in mdx mice: a pharmacological approach. Neuropathology and applied neurobiology 2007; 33(3):344-59. 27. Musaro A, McCullagh K, Paul A, et al. Localized Igf-1 transgene expression sustains hypertrophy and regeneration in senescent skeletal muscle. Nat Genet. 2001; 27(2):195-200. 28. Barton E R, Morris L, Musaro A, Rosenthal N, Sweeney H L. Muscle-specific expression of insulin-like growth factor I counters muscle decline in mdx mice. J Cell Biol 2002; 157(1):137-48. 29. Disatnik M H, Dhawan J, Yu Y, et al. Evidence of oxidative stress in mdx mouse muscle: studies of the pre-necrotic state. J Neurol Sci 1998; 161(1):77-84. 30. Nelson S K, Bose S K, Grunwald G K, Myhill P, McCord J M. The induction of human superoxide dismutase and catalase in vivo: a fundamentally new approach to antioxidant therapy. Free radical biology & medicine 2006; 40(2):341-7. 31. Hart P E, Lodi R, Rajagopalan B, et al. Antioxidant treatment of patients with Friedreich ataxia: four-year follow-up. Archives of neurology 2005; 62(4):621-6. 32. Rolland J F, De Luca A, Burdi R, Andreetta F, Confalonieri P, Conte Camerino D. Overactivity of exercise-sensitive cation channels and their impaired modulation by IGF-1 in mdx native muscle fibers: beneficial effect of pentoxifylline. Neurobiol Dis 2006; 24(3):466-74. 33. Whitehead N P, Streamer M, Lusambili L I, Sachs F, Allen D G. Streptomycin reduces stretch-induced membrane permeability in muscles from mdx mice. Neuromuscul Disord 2006; 16(12):845-54. 34. Badalamente M A, Stracher A. Delay of muscle degeneration and necrosis in mdx mice by calpain inhibition. Muscle Nerve 2000; 23(1):106-11. 35. Burdi R, Didonna M P, Pignol B, et al. First evaluation of the potential effectiveness in muscular dystrophy of a novel chimeric compound, BN 82270, acting as calpain-inhibitor and anti-oxidant. Neuromuscul Disord 2006; 16(4):237-48. 36. Bonuccelli G, Sotgia F, Schubert W, et al. Proteasome inhibitor (MG-132) treatment of mdx mice rescues the expression and membrane localization of dystrophin and dystrophin-associated proteins. Am J Pathol 2003; 163(4):1663-75. 37. Voisin V, Sebrie C, Matecki S, et al. L-arginine improves dystrophic phenotype in mdx mice. Neurobiol Dis 2005; 20(1):123-30. 38. Soret J, Bakkour N, Maire S, et al. Selective modification of alternative splicing by indole derivatives that target serine-arginine-rich protein splicing factors. Proc Natl Acad Sci USA 2005; 102(24):8764-9. 39. Mann C J, Honeyman K, McClorey G, Fletcher S, Wilton S D. Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy. J Gene Med 2002; 4(6):644-54. 40. Graham I R, Hill V J, Manoharan M, Inamati G B, Dickson G. Towards a therapeutic inhibition of dystrophin exon 23 splicing in mdx mouse muscle induced by antisense oligoribonucleotides (splicomers): target sequence optimisation using oligonucleotide arrays. J Gene Med 2004; 6(10):1149-58. 41. Mathews D H, Sabina J, Zuker M, Turner D H. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 1999; 288(5):911-40. 42. Cartegni L, Chew S L, Kramer A R. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet. 2002; 3(4):285-98. 43. Cartegni L, Wang J, Zhu Z, Zhang M Q, Krainer A R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res 2003; 31(13):3568-71. 44. Braasch D A, Corey D R. Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA. Chem Biol 2001; 8(1):1-7. 45. Braasch D A, Corey D R. Novel antisense and peptide nucleic acid strategies for controlling gene expression. Biochemistry 2002; 41(14):4503-10. 46. Elayadi A N, Corey D R. Application of PNA and LNA oligomers to chemotherapy. Curr Opin Investig Drugs 2001; 2(4):558-61. 47. Larsen H J, Bentin T, Nielsen P E. Antisense properties of peptide nucleic acid. Biochim Biophys Acta 1999; 1489 (1):159-66. 48. Summerton J. Morpholino antisense oligomers: the case for an RNase H-independent structural type. Biochim Biophys Acta 1999; 1489(1):141-58. 49. Summerton J, Weller D. Morpholino antisense oligomers: design, preparation, and properties. Antisense Nucleic Acid Drug Dev 1997; 7(3):187-95. 50. Wahlestedt C, Salmi P, Good L, et al. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci USA 2000; 97(10):5633-8. 51. De Angelis F G, Sthandier O, Berarducci B, et al. Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc Natl Acad Sci USA 2002; 99(14):9456-61. 52. Denti M A, Rosa A, D'Antona G, et al. Chimeric adeno-associated virus/antisense U1 small nuclear RNA effectively rescues dystrophin synthesis and muscle function by local treatment of mdx mice. Hum Gene Ther 2006; 17(5):565-74. 53. Gorman L, Suter D, Emerick V, Schumperli D, Kole R. Stable alteration of pre-mRNA splicing patterns by modified U7 small nuclear RNAs. Proc Natl Acad Sci USA 1998; 95(9):4929-34. 54. Suter D, Tomasini R, Reber U, Gorman L, Kole R, Schumperli D. Double-target antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human beta-thalassemic mutations. Hum Mol Genet. 1999; 8(13):2415-23. 55. Wagner K R, Hamed S, Hadley D W, et al. Gentamicin treatment of Duchenne and Becker muscular dystrophy due to nonsense mutations. Ann Neurol 2001; 49(6):706-11. 56. Aartsma-Rus A et al, (2006), Entries in the leiden Duchenne Muscular Dystrophy mutation database: an overview of mutation types and paradoxical cases that confirm the reading-frame rule, Muscle Nerve, 34: 135-144. 57. Hodgetts S., et al, (2006), Neuromuscular Disorders, 16:591-602. 58. Manzur A Y et al, (2008), Glucocorticoid corticosteroids for Duchenne muscular dystrophy (review), Wiley publishers, The Cochrane collaboration. 59. Van Deutekom J C et al, (2007) Antisense Oligonucleotide PRO051 Restores Local Dystrophin in DMD Patients. N Engl J. Med., 357(26): 2677-86. 60. Yuan H, Takeuchi E, Taylor G A, McLaughlin M, Brown D, Salant D J. Nephrin dissociates from actin, and its expression is reduced in early experimental membranous nephropathy. J Am Soc Nephrol 2002; 13:946-56. 61. Koop K, Bakker R C, Eikmans M, et al. Differentiation between chronic rejection and chronic cyclosporine toxity by analysis of renal cortical mRNA. Kindney Int 2004; 66:2038-46. 62. Mercuri E, Bushby K, Ricci e., et al. Muscle MRI findings in patients with limb girdle muscular dystrophy with calpain 3 deficiency (LGMD2A) and early contractures. Neuromuscul Disord 2005; 15:164-71. 63. Dorph C, Nennesmo I, Lundberg I E. Percutaneous conchotome muscle biopsy: a useful diagnostic and assessment tool. J Rheumatol 2001; 28:1591-9. 64. Havenga M J, Lemckert A A, Ophorst O J, et al. Exploiting the natural diversity in adenovirus tropism for therapy and prevention of disease. J Virol 2002; 76:4612-20. 65. Roest P A, van der Tuijn A C, Ginjaar H B, et al. Application of in vitro Myo-differentation of non-muscle cells to enhance gene expression and facilitate analysis of muscle proteins. Neuromuscul Disord 1996; 6:195-202. 66. John J. Grading of muscular power: comparison of MRC and analogue scales by physiotherapists. Int J Rehabil Res 1984; 7:173-81. 67. Roest P A, Roberts R G, van der Tuijn A C, Heikoop J C, van Ommen G J, den Dunnen J T. Protein truncation test (PTT) to rapidly screen the DMD gene for translation terminating mutations. Neuromuscul Disord 1993; 3:391-4. 68. Cullen M J, Walsh J, Roberds S L, Campbell K P. Ultra-structural localization of adhalin, alpha-dystroglycan and merosin in normal and dystrophic muscle. Neuropathol Appl Neurobiol 1996; 22:30-7.