M13 MUTANT FOR INCREASING PRODUCTION OF DNA

20210040455 ยท 2021-02-11

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a gene including an M13 p5 expressing cassette, which includes a promoter, a ribosome binding site (RBS) and a protein 5 (p5) coding region, wherein at least one base of sequences between the RBS and the p5 coding region is mutated. Using this gene may increase production of single-stranded DNA.

Claims

1. A gene comprising: an M13 p5 expressing cassette which includes a promoter, a ribosome binding site (RBS) and a protein 5 (p5) coding region, wherein at least one of sequences between the RBS and the p5 coding region is mutated.

2. The gene according to claim 1, wherein the sequence between the RBS and the p5 coding region is substituted by any one sequence selected from the group consisting of SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, and SEQ ID NO. 9.

3. The gene according to claim 1, wherein the RBS sequence is represented by SEQ ID NO. 3, and the p5 coding region is represented by SEQ ID NO. 4.

4. The gene according to claim 1, wherein the p5 expressing cassette includes a sequence represented by any one sequence selected from the group consisting of SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 13.

5. An M13 bacteriophage comprising the gene according to claim 1.

6. A host cell comprising the gene according to claim 1.

7. A host cell infected with the M13 bacteriophage according to claim 5.

8. The host cell according to claim 6, wherein the host cell expresses F cilia.

9. The host cell according to claim 7, wherein the host cell expresses F cilia.

10. A method for increasing production of DNA, comprising: mutating at least one base of sequences between a ribosome binding site (RBS) and a protein 5 (p5) coding region in an M13 p5 expressing cassette which includes a promoter in M13 bacteriophage, the RBS and the p5 coding region; and infecting a host cell with the mutant M13 bacteriophage.

11. The method according to claim 10, wherein the sequence between the RBS and the p5 coding region is substituted by any one sequence selected from the group consisting of SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, and SEQ ID NO. 9.

12. The method according to claim 10, wherein the RBS sequence is represented by SEQ ID NO. 3, and the p5 coding region is represented by SEQ ID NO. 4.

13. The method according to claim 10, wherein the p5 expressing cassette includes a sequence represented by any one sequence selected from the group consisting of SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, and SEQ ID NO. 13.

14. The method according to claim 10, wherein the host cell expresses F cilia.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0026] The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:

[0027] FIG. 1 is a graph illustrating a ratio of production of bacteriophage by DNA sequence mutation to native (wild type) one according to one embodiment of the present invention;

[0028] FIG. 2 is a graph illustrating production of bacteriophage to native one in the mutated spacer sequence-introduced XL1blue strain according to one embodiment of the present invention: 18k-0, 18k-5, 18k-7, 18k-10 and 18k-62 in this order from the left side;

[0029] FIG. 3 is a graph illustrating production of single-stranded DNA to native one in the mutated spacer sequence-introduced XL1blue strain according to one embodiment of the present invention: 18k-0, 18k-5, 18k-7, 18k-10 and 18k-62 in this order from the left side;

[0030] FIG. 4 is a graph illustrating production of single-stranded DNA to native one in the mutated spacer sequence-introduced Jude1 DH10B F strain according to one embodiment of the present invention: 18k-0, 18k-5, 18k-7, 18k-10 and 18k-62 in this order from the left side;

[0031] FIG. 5 illustrates DNA sequence of p5 protein expressing cassette in the native M13M13mp18k (18k-0) according to one embodiment of the present invention;

[0032] FIG. 6 illustrates DNA sequence of p5 protein expressing cassette in M13M13mp18k mutant (18k-5) having a spacer sequence mutated into CTGAC according to one embodiment of the present invention;

[0033] FIG. 7 illustrates DNA sequence of p5 protein expressing cassette in M13M13mp18k mutant (18k-7) having a spacer sequence mutated into TCGTA according to one embodiment of the present invention;

[0034] FIG. 8 illustrates DNA sequence of p5 protein expressing cassette in M13M13mp18k mutant (18k-10) having a spacer sequence mutated into TCTTC according to one embodiment of the present invention;

[0035] FIG. 9 illustrates DNA sequence of p5 protein expressing cassette in M13M13mp18k mutant (18k-62) having a spacer sequence mutated into GAGGT according to one embodiment of the present invention;

[0036] FIGS. 10(a), 10(b) and 10(c) illustrate the full-length DNA sequence of the native M13M13mp18k according to one embodiment of the present invention; and

[0037] FIG. 11 illustrates a spacer sequence, and a spacer mutant sequence of the native M13mp18k (18k-0) according to one embodiment of the present invention.

DETAILED DESCRIPTION OF THE INVENTION

[0038] Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings. However, some embodiment of the present invention, but not limited thereto, are illustrated. In fact, these invention may be practically embodied in various formed and should not be construed to limit the present invention to the embodiments proposed in the present disclosure. Singular forms used in the specification and appended claims may also include plural forms unless otherwise specifically indicated.

[0039] M13 phage is a fibrous phage infecting E. coli through F cilia. When the M13 phage enters E. coli having F cilia, M13 DNA is replicated by itself using an enzyme such as DNA polymerase, RNA polymerase and ligase in a host cell. This process is known to rolling circle replication.

[0040] The rolling circle replication includes three stages. That is, stage 1 includes infection and formation of replication form (RF). When an M13 template (+) strand enters a cytoplasm, a complementary () strand corresponding to the (+) strand is formed. Thereafter, DNA gyrase of E. coli forms super-coiled double-stranded M13 DNA (RF). In stage 2, the phage protein, p2, cuts off the (+) strand of RF. 3 hydroxyl group acts as a primer of DNA polymerase and synthesizes (+) strand using a fresh () strand as a template. After forming a complete (+) strand, p2 cuts off the (+) strand and divides the (+) strands. As such, a single RF DNA and a single (+) strand may be formed. In this stage, a protein 5 (p5) acts as a regulator. When a concentration of p5 is high, the process may go on stage 3. If the concentration of p5 is low, stage 2 may be repeated. Lastly, stage 3 is a releasing step. When the concentration of p5 is sufficiently high, thousands of p5s are bound to the single (+) strand prepared in stage 2 to form (+) strand-p5 dimer. The dimer acts as a releasing signal and may be released by a transporter including phage proteins, p1, p4 and p11. When the dimer passes through the transporter, p5 is removed and several replicated p3, p6, p7, p8 and p9 are combined with (+) single-stranded DNA to form a phage capsid.

[0041] Supposing that a replication rate is constant, the single-stranded DNA (ssDNA) is increased by Fibonacci series in stage 2 while being increased arithmetically in stage 3:

[0042] DNA Increase Series in Stage 2

[00001] 1 5 .Math. ( ( 1 + 5 2 ) n - ( 1 - 5 2 ) n )

[0043] DNA Increase Series in Stage 3

[00002] 1 5 .Math. ( ( 1 + 5 2 ) n - ( 1 - 5 2 ) n ) * x

[0044] In the above equations, n is the number of repeating the circle, and x is the number of (+) stranded DNA prepared in stage 2.

[0045] In order to amplify the production of single-stranded DNAs, the present invention has been developed on the basis of an assumption that it is preferable to maintain stage 2 for a long period of time. In the rolling circle replication, p5 concentration becomes a turning point. If p5 is rapidly accumulated, the process may quickly go on stage 3. On the other hand, if p5 is slowly accumulated, the process may be slowly advanced to stage 3 to thus produce many more single-stranded DNAs.

[0046] The present inventors have intended to control accumulation of p5 during translation, and for this purpose, conducted mutation of a ribosome binding site (RBS), a spacer sequence and N-terminal sequence to regulate p5 expression level. As used herein, the term spacer sequence refers to a base sequence between the RBS and an initiating codon. The present inventors have expected p5 expression levels of total 71 genes on the upstream of the initiating codon among the p5 expressing cassettes, and based on this expectation, prepared four (4) expressing cassettes. Phage production and DNA production were determined to be increased when the spacer sequence is mutated, thereby the present invention has been completed on the basis of the determination.

[0047] The native spacer sequence consists of five (5) nucleic acids (TCACA, SEQ ID NO. 5) and may be mutated according to any method well known in the related art. For instance, position designating mutation or random mutation may be used, and the random mutation may include methods such as error-prone PCR, rolling circle error-prone PCR, use of mutation-deriving strain, use of constitutive mutation-deriving strain, insert mutation production, use of ethyl methane sulfonate, use of nitrous acid, DNA shuffling, production of dNTP-mutant, or the like, but it is not limited thereto.

[0048] The spacer sequence may have one, two, three, four or five mutated nucleotides and, when 2 to 4 nucleotides are mutated, the mutated sequence may include continuous nucleotide, partially discontinuous nucleotide or entirely discontinuous nucleotide. For instance, such mutated spacer sequence may include GTCTT, TATTA, CTCTA, TGGAT, CTGAC, CATTC, TCGTA, GTTCT, GCATT, TCTTC, CGGT, CGGC, TATTT, GCAGT, TATTT, ACACA, GATTG, AAGTC, CGTAA, CTGGC, ATGGA, CAGGC, CGGGC, TTGTA, TCGTT, CCAAC, TGTAT, GAGTA, AGTAT, TTGTC, GTTTA, CCGGC, ATCGA, GTTGT, TTTTA, TGTCT, TTTAA, GTGTC, AAGGA, AAGTA, TGCTA, ATGGT, CGTTA, GTGAA, GAAAT, AGGTT, GTGTA, GACTC, ATTCG, TAATT, CATGA, TCTTA, TATTT, GCTAA, GTTTT, ATGCT, CAGTT, TACTA, AGCCA, CCCTC, CACTA, GAGGT, AACAA, TTAGG, GAGTT, CGATC, CACAG, TTTTG, TTTGA, CGGTA or GATTT, preferably, C, TCGTA, TCTTC, TTGTA, CCAAC, TGTAT, GAGTA, AGTAT, TTGTC, GTTTA, ATCGA, GTTGT, TTTTA, TGTCT, TTTAA, GTGTC, AAGGA, AAGTA, TGCTA, ATGGT, CGTTA, GTGAA, GAAAT, AGGTT, GTGTA, GACTC, ATTCG, TAATT, CATGA, GCTAA, GTTTT, ATGCT, CAGTT, TACTA, AGCCA, CCCTC, CACTA, GAGGT, GAGTT, CGATC, CACAG, TTTTG, TTTGA, CGGTA or GATTT, and more preferably, CTGAC, TCGTA, TCTTC or GAGGT.

[0049] As used herein, the term regulatory region refers to a nucleic acid sequence to regulate expression of nucleic acid. The regulatory region may include a sequence (homologous region) inherently liable to expression of specific nucleic acid, and may also include sequences with different origins (heterologous region) responsible for expression of different proteins and further synthetic proteins. Specifically, these sequences may be sequences of prokaryotes, eukaryotes or viral genes which promote or inhibit transcription of genes in specific or non-specific manner and inducible or non-inducible manner, or sequences derived from the same. The regulatory region may include an origin of replication, a RNA splice site, a promoter, an enhancer, a transcription terminating sequence and/or a secretion signal to induce to a secretion route of a target cell of polypeptide.

[0050] As used herein, the term promoter and promoter sequence are interchangeably used, and refer to a coding sequence or a DNA sequence able to regulate expression of functional RNA. In general, the coding sequence is positioned at 3 of the promoter sequence. The promoter is entirely derived from natural gene, consists of different components derived from different promoters discovered in nature, or may include synthetic DNA fragments. The different promoters may induce expression of genes in different tissues or cytoplasm, genes under different development steps, or genes responding to different environmental or physiological conditions. In most cases, an exact or definite boundary of the regulatory sequence is not distinguished, and therefore, it is recognized that DNA fragments with different lengths may have the same promoter activity.

[0051] Generally, a transcription initiating site is operably linked to the downstream of a promoter sequence, and extends toward the upstream (5 direction), thus to include a minimum number of base or elements required for initiating transcription in a detectable level more than the background. Within the promoter sequence, not only a protein binding domain (consensus sequence) responsible for the binding of RNA polymerase but also a transcription initiating site (for example, simply defined by a mapping process using nuclease S1) would be found.

[0052] As used herein, the term upstream refers to a nucleotide sequence positioned at 5 of the above mentioned nucleic acid sequence. Specifically, the upstream nucleotide sequence relates to a coding sequence or a sequence positioned at 5 of the transcription initiating site. For instance, the promoter is mostly positioned at upstream of an initiating codon. As used herein, the term downstream refers to a nucleotide sequence positioned at 3 of the above mentioned nucleic acid sequence.

[0053] As used herein, the term operably linked means association of nucleic acid sequences in a single nucleic acid fragment so that a function there of is influenced by another one. That is, this means a functional combination between a nucleic acid expression regulatory sequence (e.g., promoter, signal sequence or array at a binding position of transcription regulatory factor) and another nucleic acid sequence. Thereby, the regulatory sequence may regulate transcription and/or interpretation (or decoding) of the latter (i.e., another nucleic acid sequence). For instance, when the promoter can influence upon expression of the coding sequence (that is, the coding sequence under controlled transcription by the promoter), the promoter may be operably linked to the coding sequence. The coding sequence may be operably linked to the regulatory sequence by sense or antisense orientation.

[0054] As used herein, the term ribosome binding site (RBS) refers to a nucleotide sequence present on the upstream of the initiating codon in mRNA transcript to which a ribosome is bound during protein translation. This may include internal ribosome entry sites (IRES) found from mRNA of virus infecting prokaryotic or eukaryotic organisms, however, RBS generally means a bacteria sequence.

[0055] M13 bacteriophage is a virus capable of infecting E. coli, generally consists of thin and flexible annular tube type single-stranded DNAs surrounded by about 2700 skin proteins P8 (pVIII), has a flexible tube form, and further includes additional skin proteins p3, p6, p7 and p9. The infection is initiated as p3 receptor reaches at the terminal of F cilia. Phage proteins present in cytoplasm are p2, p10 and p5, wherein several thousands of p5 may bind to a newly synthesized single-stranded DNA to prevent formation of FR DNA. P5-DNA structure has a length of about 800 nm and a diameter of about 8 nm.

[0056] As used herein, the term coding region refers to a part of nucleic acid consisting of codon translated as an amino acid. Stop codon (TAG, TGA or TAA) may be considered as a part of the coding region even though not being translated as amino acid, however, any flanking sequence, for example, a promoter, a ribosome binding site, a transcription terminator, etc. is not regarded as a part of the coding region. Any nucleic acid or nucleic acid fragment may encode a single polypeptide or fragments, derivative or variants thereof or, otherwise, encode one or more polypeptides. For example, a single nucleic acid may encode two or more polypeptides. Further, the nucleic acid may include a regulatory element such as the promoter, the ribosome binding site or the transcription terminator, or may encode a heterologous coding region fused in a protein coding region, for example, specified element or motif such as secretive signal peptide or hetero-functional domain.

[0057] As used herein, the term cassette, expressing cassette and gene expressing cassette refer to a DNA fragment that can be inserted into nucleic acid or polynucleotide at a specific restriction enzyme site or by homologous recombination. This DNA fragment may include polynucleotide encoding desired polypeptide, and the cassette and restriction enzyme site may be designed to ensure insertion of a cassette into an appropriate reading frame suitable for transcription and translation. A transfection cassette includes polynucleotide encoding the desired polypeptide, and refers to a specific vector having an element other than polynucleotide to facilitate transfection of a specific host cell. The cassette, expressing cassette, gene expressing cassette and transfection cassette may further include an element for regulating expression of polynucleotide encoding the desired polypeptide in the host. Such elements may include a promoter, an enhancer, a reaction factor, a terminator sequence, a polyadenylation sequence, etc., but it is not limited thereto.

[0058] As used herein, the term gene refers to polynucleotide including nucleotide that encodes a functional molecule such as a functional molecule (e.g., bioactive RNA species) to be generated only by transcription or a functional molecule (e.g., polypeptide) to be generated by transcription and translation. The term gene may include cDNA and genomic DNA nucleic acid. The gene may optionally refer to a nucleic acid fragment that includes a regulatory sequence (5-decoding sequence) prior to an encoded region and a regulatory sequence (3-decoding sequence) following the same, and expresses specific RNA, protein or polypeptide. The native gene refers to a gene having self-regulatory sequence discovered in nature. A chimeric gene refers to any gene other than native gene, which includes a regulatory or coding sequence not found in nature together. Therefore, the chimeric gene may include regulatory and coding sequences derived from other sources or, otherwise, regulatory and coding sequences that are arranged in different manners from those found in nature, even though being derived from the same source. An endogenous gene refers to a native gene present in the original site within a genome of an organism. A foreign gene or heterologous gene refers to a gene generally not found in a host organism, but transferred to the host organism by gene delivery. The foreign gene may include the native gene inserted into non-native organism or the chimeric gene. A transgene or transfer gene is a gene introduced into a cell during gene delivery.

[0059] As used herein, the term mutation may mean substitution, deletion, addition or replacement of one or a plurality of nucleic acids.

[0060] As used herein, the term expression refers to biological production of a product encoded by a coding sequence. In most cases, DNA sequence including the coding sequence is under transcription to form a messenger-RNA (mRNA). Then, the messenger-RNA is translated to form a polypeptide product having biological activity associated with the same. Further, the expression process may include additional processing of the RNA transcription product (for example, splicing to remove intron) and/or post-translation processing of the polypeptide product.

[0061] As used herein, the term host cell may include prokaryote (e.g., bacteria) and eukaryote (e.g., fungi, yeast, animal, insect, plant), and may be any desirable cell for DNA production. It is preferable to be a cell having F cilia. Appropriate prokaryotic host cell may be E. coli having F cilia, and may include DH5, XL1blue or Jude1 DH10B, but it is not limited thereto.

[0062] As used herein, the term primer refers to oligonucleotide which is hybridized with a target nucleic acid to form a double-stranded nucleic acid region that can act as an initiating point for DNA synthesis under desirable conditions. Such primers may be used in polymerase chain reaction or for DNA sequence analysis.

[0063] Hereinafter, a method of the present invention will be described in detail.

[0064] In M13 p5 expressing cassette including a promoter, a ribosome binding site (RBS) and a protein 5 (p5) coding region in M13 bacteriophage, at least one base, at least two continuous or non-continuous bases, at least three continuous or non-continuous bases, at least four continuous or non-continuous bases or five bases among the sequence between the RBS and the p5 coding region are under mutation, a host cell is infected with the mutated M13 bacteriophage, followed by culturing the host cell, thereby increasing DNA production.

[0065] The culturing may be performed using an appropriate culture medium under suitable culture conditions well known in the related art. The culture medium and culture conditions may be altered by those skilled in the art. For instance, the culture medium may be a liquid medium, but it is not limited thereto. The culturing method may include, for example, batch culture, continuous culture, fed-batch culture or a combination thereof, but it is not limited thereto.

[0066] The culture medium needs suitable conditions for specific strains, which may be desirably altered by those skilled in the art. The culture medium may include diverse carbon sources, nitrogen sources and trace elements. The carbon source possibly used in the culture medium may include, but it is not limited to: e.g., sugar or carbohydrate such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose; e.g., oil and fat such as soybean oil, sunflower oil, castor oil, coconut oil, etc.; e.g., fatty acid such as palmitic acid, stearic acid and linoleic acid; alcohol such as glycol and ethanol; and organic acid such as acetic acid, which may be used alone or in combination of two or more thereof. The nitrogen source possibly used in the culture medium may include, but it is not limited to: e.g., organic substances such as peptone, yeast extract, meat extract, molt extract, corn steep liquor, beans powder and urea; and non-organic substances such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, which may be used alone or in combination of two or more thereof. A potassium source possibly used in the culture medium may include, but it is not limited to, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and sodium-containing salts corresponding to the same. According to some embodiments, the culture medium may include a metal salt necessary to growth such as magnesium sulfate or iron sulfate, etc., but it is not limited thereto. According to some embodiments, in addition to the above components, essential amino acids and vitamins may be further included. According to some embodiments, the culture medium may further include an appropriate precursor. The culture medium or individual components may be added to a culture solution in any suitable manner, for example, in a batch or continuous manner, but it is not limited thereto.

[0067] In some embodiments, pH of the culture may be properly adjusted to match to a selected microorganism by adding a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid or sulfuric acid to the culture in a suitable manner during incubation. In some embodiments, a defoaming agent such as fatty acid polyglycol ester may be used to inhibit foaming in the culture during incubation. In order to maintain the culture in an aerobic condition, oxygen or oxygen-containing gas (e.g., air) may be fed to the culture. For instance, a temperature of the culture may be maintained in a range of about 20 to 45 C. Further, in some embodiments, the temperature may be maintained in a range of about 25 to 40 C. For instance, the incubation may be conducted for about 8 to 160 hours, for example, until it reaches a desired amount of DNA.

[0068] Hereinafter, the present invention will be concretely described by following examples.

Example 1. p5 Expressing Cassette Mutant and Expectation of Expression Level by the Same

[0069] p5 expressing cassette includes a promoter, a RBS and p5 coding sequence, wherein there are several base sequences between the RBS and the p5 coding sequence. In the present invention, such several sequences are named as a spacer.

[0070] The present inventors have introduced M13mp18 vector purchased from New England Biolabs into E. coli XL1blue by heat shocking to produce double-stranded DNAs (dsDNA) and purified the same by Exprep Plasmid SV (GeneAll, Korea). Then, a kanamycin resistant gene KanR as a molecule marker was introduced into the produced dsDNA, which was named as M13mp18k (SEQ ID NO. 18).

[0071] Using UTR designer (https://sbi.postech.ac.kr/utr designer/), a promoter region and a ribosome binding site (RBS) were confirmed, thereby identifying the spacer sequence between the RBS sequence and the p5 coding region. Therefore, DNA sequence of a native p5 expressing cassette including the promoter, RBS, spacer and p5 coding region was represented by SEQ ID No. 1.

[0072] In order to randomly mutate the spacer sequence, M13mp18k vector was divided into two fragments, and then, the first fragment and the second fragment were subjected to PCR at annealing temperatures of 58 and 59 C., respectively, wherein PCR for the first fragment was conducted using M13mp18pV TCACA random mut. 1F (ttaaaatcgcataaggtaatNNNNNATGATTAAAGTTGAAATTAAACCATC, SEQ ID NO. 14) and M13mp18pV TCACA random mut. 1R (attttgacgcTCAATCGTCTGAAATGGATTATTTAC, SEQ ID NO. 15) as primers, while PCR for the second fragment was conducted using M13mp18pV TCACA random mut. 2F (agacgattgaGCGTCAAAATGTAGGTATTTC, SEQ ID NO. 16) and M13mp18pV TCACA random mut. 2R (ATTACCTTATGCGATTTTAAGAAC, SEQ ID NO. 17) as primers, followed by conjugating both of these fragments, thereby preparing 71 types of mutant candidates (18k-1 to 18k-71, see FIG. 11) that may decrease p5 protein expression.

[0073] Each of the prepared mutants was introduced into E. coli XL1blue strain and inoculated on 5 ml of LB medium in a 15 ml conical tube for incubation. Production of M13 phage was measured and illustrated as a ratio of production to that of a product obtained by culturing native M13 under the same conditions (FIG. 1).

[0074] Among those mutants, with regard to the mutant having a relative phage production of 1 or more compared to the native M13, the phage was produced on 25 ml M9 2 medium in a 250 ml flask and a relative phage production to the native M13 was determined. 18k-5, 18k-7, 18k-10 and 18k-62 mutants showing consistent results were selected.

TABLE-US-00001 TABLE1 Phage Spacersequence 18k-0(WT)(SEQIDNO.1) TCACA(SEQIDNO.5) 18k-5(SEQIDNO.10) CTGAC(SEQIDNO.6) 18k-7(SEQIDNO.11) TCGTA(SEQIDNO.7) 18k-10(SEQIDNO.12) TCTTC(SEQIDNO.8) 18k-62(SEQIDNO.13) GAGGT(SEQIDNO.9)

[0075] By inputting promoter-RBS-spacer-p5 coding sequences of the selected mutants in UTR designer (https://sbi.postech.ac.kr/utr designer/), RBS binding intensity was estimated whereby an expression level of p5 protein was expected from the estimated results (Table 2).

TABLE-US-00002 TABLE 2 Spacer sequence Estimated p5 expression level 18k-0 314958.9 18k-5 102908.7 18k-7 453043.1 18k-10 251821.9 18k-62 87012.5

Example 2. Measurement of Single-Stranded DNA Production

[0076] 18k-5, 18k-7, 18k-10 and 18k-62 phages obtained in Example 1, which were expected to reduce p5 expression level, were used to infect a host cell expressing F cilia, that is, XL1blue endA1 gyrA96 (nal.sup.R) thi-1 recA1 relA1 lac glnV44 F [::Tn10 proAB.sup.+lacI.sup.q(lacZ)M15] hsdR17(r.sub.K.sup.m.sub.X.sup.+) strain, followed by incubation in 25 ml of culture medium (2XM9(Na.sub.2HPO.sub.4 12 g/L, KH.sub.2PO.sub.4 6 g/L, NaCl 1 g/L, NH.sub.4Cl 2 g/L)+citrate 1.7 g/L+thiamine 25 mg/L) for 27 hours. Herein, the native phage 18k-0 was used as a control group. The phage was collected by PEG precipitation, and after measuring an absorbance at 230 to 400 nm, a concentration was determined by the following equation.


(A269A320)(610.sup.16)/number of bases/virion=PFU/ml

[0077] The measured results were indicated as a ratio of phage production when each phage mutant was inoculated to phage production when 18k-0 was inoculated (Table 3, FIG. 2).

TABLE-US-00003 TABLE 3 Phage Relative production of phage 18k-0 (WT) 1 18k-5 2.432817 18k-7 2.376569 18k-10 2.270974 18k-62 2.129119

[0078] Further, a concentration of single-stranded DNAs was determined by the following equation after measuring absorbance at 260 nm using a nano-spectrometer.


A260*33=ssDNA concentration (ng/ul)

[0079] The determined results are shown in Table 4 below and FIG. 3.

TABLE-US-00004 TABLE 4 ssDNA concentration Relative ssDNA Phage (260/280) production 18k-0 (WT) 380 1 18k-5 1330 3.5 18k-7 790 2.07895 18k-10 920 2.42105 18k-62 1138 2.99474

Example 3. Measurement of p5 Production

[0080] The 18k-0, 18k-5, 18k-7, 18k-10 and 18k-62 phages, respectively, were used to infect a host cell expressing F cilia, that is, Jude1 DH10B F [proAB lacI.sup.Q lacZ AM15 Tn10(Tet.sup.R)] strain, followed by incubation in 25 ml of culture medium (2XM9(Na.sub.2HPO.sub.4 12 g/L, KH.sub.2PO.sub.4 6 g/L, NaCl 1 g/L, NH.sub.4Cl 2 g/L)+citrate 1.7 g/L+thiamine 25 mg/L+leucine 40 mg/L) for 27 hours. The native phage 18k-0 was used as a control group. Production of the phage was measured in the same manner as described in Example 2, and the measured results were indicated as a relative amount to 18k-0 (Table 5, FIG. 4).

TABLE-US-00005 TABLE 5 Phage Relative production of phage 18k-0 1 18k-5 1.114822 18k-7 1.212842 18k-10 1.207001 18k-62 1.36875

TABLE-US-00006 [Sequence Listing] Sequence number Description 1 Native p5 protein expressing cassette sequence 2 Promoter sequence of native p5 protein expressing cassette 3 RBS sequence of native p5 protein expressing cassette 4 p5 coding region sequence of native p5 protein expressing cassette 5 Spacer sequence of 18k-0 6 Spacer sequence of 18k-5 7 Spacer sequence of 18k-7 8 Spacer sequence of 18k-10 9 Spacer sequence of 18k-62 10 p5 protein expressing cassette sequence of 18-5 11 p5 protein expressing cassette sequence of 18k-7 12 p5 protein expressing cassette sequence of 18k-10 13 p5 protein expressing cassette sequence of 18k-62 14 M13mp18pV TCACA random mut. 1F sequence 15 M13mp18pV TCACA random mut. 1R sequence 16 M13mp18pV TCACA random mut. 2F sequence 17 M13mp18pV TCACA random mut. 2R sequence 18 M13mp18k full length sequence

[0081] For the purpose of establishing claims, the appended claims should not be interpreted in a narrow range more than the meanings of a terminology itself used therein, whereby illustrative embodiments in the specification should not be directly considered as the claims. Accordingly, it should be understood that the present invention has been described by means of illustrative embodiments, which substantially do not limit the claims. Therefore, the scope of the present invention is only restricted by the appended claims. All published documents, patents, patent applications and journal articles are introduced herein, the entire contents of which are incorporated by reference.