Yeast strains co-expressing exogenous glucoamylases, the method for obtaining said yeast strains and the use thereof to produce bioethanol

Abstract

The present application relates to improved Saccharomyces cerevisiae yeast strains that co-express a gene encoding a glucoamylase of fungal origin and a gene encoding the glucoamylase of Saccharomyces cerevisiae var. diastaticus. The present invention also relates to a method for obtaining these yeast strains involving a) genetically modifying a Saccharomyces cerevisiae yeast to co-express a gene encoding a glucoamylase of fungal origin and a gene encoding the glucoamylase of Saccharomyces cerevisiae var. diastaticus; b) culturing and fermenting the strain obtained in step a) on a dextrin medium; c) selecting the strains having fermentation kinetics at least equal to or greater than those obtained with the strain deposited at the CNCM [French National Collection of Microorganism Cultures] under number I 4999 under the same conditions. The yeast strains according to the invention are of particular interest in producing bioethanol.

Claims

1. A Saccharomyces cerevisiae yeast strain, wherein said yeast strain co-expresses: a gene encoding a glucoamylase of fungal origin selected from the group consisting of a glucoamylase of Aspergillus niger and a glucoamylase of Saccharomycopsis fibulifera; and a gene encoding the glucoamylase of Saccharomyces cerevisiae var. diastaticus, wherein the gene encoding the glucoamylase of Aspergillus niger comprises the nucleic acid sequence set forth in SEQ ID NO: 1, the gene encoding the glucoamylase of Saccharomycopsis fibulifera comprises the nucleic acid sequence set forth in SEQ ID NO: 17, and the gene encoding the glucoamylase of Saccharomyces cerevisiae var. diastaticus comprises the nucleic acid sequence set forth in SEQ ID NO: 3, wherein said Saccharomyces cerevisiae yeast strain comprises: between 2 and 10 copies of the gene encoding the glucoamylase of fungal origin; and between 2 and 10 copies of the gene encoding the glucoamylase of Saccharomyces cerevisiae var. diastaticus, and wherein said Saccharomyces cerevisiae yeast strain hydrolyzes liquefied starch extracted from a biomass while at the same time ferments the sugars resulting from hydrolyzed liquefied starch.

2. The Saccharomyces cerevisae yeast strain of claim 1, wherein the gene encoding the glucoamylase of Saccharomyces cerevisiae var. diastaticus encodes a protein comprising the amino acid sequence of SEQ ID NO: 4.

3. The Saccharomyces cerevisiae yeast strain of claim 1, wherein the gene encoding the glucoamylase of Aspergillus niger comprises the nucleic acid sequence set forth in SEQ ID NO: 1.

4. The Saccharomyces cerevisiae yeast strain of claim 3, wherein gene encoding the glucoamylase of Aspergillus niger comprises the amino acid sequence of SEQ ID NO: 2.

5. The Saccharomyces cerevisiae yeast strain of claim 1, wherein the gene encoding the glucoamylase of fungal origin and the gene encoding the glucoamylase of Saccharomyces cerevisiae var. diastaticus are integrated into the genome of said yeast.

6. The Saccharomyces cerevisiae yeast strain of claim 1, wherein said Saccharomyces cerevisiae yeast strain is selected from the strain deposited, on Aug. 6, 2015, at the CNCM [French National Collection of Microorganism Cultures] under I-5005, the strain deposited, on Jul. 9, 2015, at the CNCM under number I-4997, the strain deposited, on Aug. 11, 2016, at the CNCM under number I-5119, the strain deposited, on Aug. 11, 2016, at the CNCM under number I-5120, the strain deposited, on Aug. 11, 2016, at the CNCM under I5121 and the strain deposited, on Aug. 11, 2016, at the CNCM under number I-5122.

7. A Saccharomyces cerevisiae yeast strain comprising the nucleic acid sequence of SEQ ID NO: 1 encoding a glucoamylase of Aspergillus niger and the nucleic acid sequence of SEQ ID NO: 3 encoding a glucoamylase of Saccharomyces cerevisiae var. diastaticus, wherein said Saccharomyces cerevisiae yeast strain hydrolyzes liquefied starch extracted from a biomass while at the same time ferments the sugars resulting from hydrolyzed liquefied starch.

8. A method for obtaining a Saccharomyces cerevisiae yeast strain, said method comprising steps of: a) genetically modifying a Saccharomyces cerevisiae yeast to co-express a gene encoding a glucoamylase of fungal origin selected from the group consisting of a glucoamylase of Aspergillus niger and a glucoamylase of Saccharomycopsis fibulifera; and a gene encoding the glucoamylase of Saccharomyces cerevisiae var. diastaticus, wherein the gene encoding the glucoamylase of Aspergillus niger comprises the nucleic acid sequence set forth in SEQ ID NO: 1, the gene encoding the glucoamylase of Saccharomycopsis fibulifera comprises the nucleic acid sequence set forth in SEQ ID NO: 17, and the gene encoding the glucoamylase of Saccharomyces cerevisiae var. diastaticus comprises the nucleic acid sequence set forth in SEQ ID NO: 3, wherein said Saccharomyces cerevisiae yeast strain comprises between 2 and 10 copies of the gene encoding the glucoamylase of fungal origin; and between 2 and 10 copies of the gene encoding the glucoamylase of Saccharomyces cerevisiae var. diastaticus, and wherein said Saccharomyces cerevisiae yeast strain hydrolyzes liquefied starch extracted from a biomass while at the same time ferments the sugars resulting from hydrolyzed liquefied starch; b) culturing and fermenting the Saccharomyces cerevisiae yeast strain obtained in step a) on a dextrin medium; c) selecting the Saccharomyces cerevisiae yeast strains having fermentation kinetics at least equal to or greater than the fermentation kinetics, under the same conditions, with the Saccharomyces cerevisiae yeast strain deposited, on Jul. 9, 2015, at the CNCM under number I-4999.

9. A process for producing bioethanol from a biomass comprising the steps: a) prehydrolyzing and liquefying starch of the biomass to obtain liquefied starch; b) contacting the liquefied starch of step a) with the Saccharomyces cerevisiae yeast strain of claim 1; c) hydrolyzing and fermenting the liquefied starch with said Saccharomyces cerevisiae yeast to produce the bioethanol; and d) extracting the bioethanol produced in step c).

10. The process of claim 9, wherein said process further comprises adding exogenous glucoamylase enzymes after step b) and/or during step c).

Description

BRIEF DESCRIPTION OF THE FIGURES

DEPOSITS

(1) The Deposits with INSTITUT PASTEUR COLLECTION NATIONALE DE CULTURES DE MICROORGANISMES (CNCM), under deposit accession numbers I-5005, deposited Aug. 6, 2015, I-4997, deposited Jul. 9, 2015, I-5119, deposited Aug. 11, 2016, I-5120, deposited Aug. 11, 2016, I-5121, deposited Aug. 11, 2016, and I-5122, deposited Aug. 11, 2016, were made and accepted pursuant to the terms of the Budapest Treaty. Upon issuance of a patent, all restrictions upon the deposit will be removed, and the deposit is intended to meet the requirements of 37 CFR 1.801-1.809. The deposit will be irrevocably and without restriction or condition released to the public upon the issuance of a patent and for the enforceable life of the patent. The deposit will be maintained in the depository for a period of 30 years, or 5 years after the last request, or for the effective life of the patent, whichever is longer, and will be replaced if necessary during that period.

(2) FIG. 1A-B shows two examples of overexpression and cloning vectors pANG and pSDG for the glucoamylases. This vector is an integrative cloning vector used for gene expression in yeast. pADH1: ADH1 promoter of S. cerevisiae; tCYC1: CYC1 terminator of S. cerevisiae; Kan-MX: geneticin-resistance marker; AmpR: ampicillin-resistance marker. BUD5-A and BUD5-B: the recombinogenic regions for the integration at the BUD5 locus.

(3) FIG. 2 describes the cloning strategy for the insertion of 4 expression modules and one selection module at the HO locus.

(4) FIG. 3 describes the strategy and the various steps for obtaining the I-5005 strain (A).

(5) FIG. 4 shows an example of a result of screening 88 ER-GAND clones on a YEG/starch medium. After incubation for 48 h, the hydrolysis of the starch appears as clear halos around the yeast colonies secreting functional glucoamylases. The yeasts 1 to 6 on the 12th column are control strains which allow comparison of the size and intensity of the halos.

(6) FIG. 5 shows the screening carried out with the ER-GAND series 8000 clones by fermentation on dextrin medium. Three fermentation times (20 h, 31 h and 54 h) are presented. The arrows indicate the 15 ER-GAND-series 8000 clones selected.

(7) FIG. 6 represents a fermentation on dextrin medium of the best 30 ER-GAND clones screened and also of 4 control strains (ER, I-4998; I-4899 and I-4999). The fermentation is carried out at 32 C. and is monitored by weight loss (g/kg) for 74 h.

(8) FIG. 7 represents a fermentation on industrial corn medium of the best 5 ER-GAND series 7000 clones screened and also of 3 control strains (I-4998; I-4899 and I-4999). The fermentation is carried out at 32 C. and is monitored by weight loss (g/kg) for 70 h.

(9) FIG. 8 describes the strategy and the various steps for obtaining the I-5119 (A) and I-5210 (B) strains.

(10) FIG. 9 describes the strategy and the various steps for obtaining the ER-SDG-4c and ER-SDG-8c control strains.

(11) FIG. 10 describes the strategy and the various steps for obtaining the ER-ANG-8c strain.

(12) FIG. 11 represents a fermentation on dextrin medium of the best 3 ER-GAND-12000 clones screened and also of 6 control strains (I-4071, I-4899, I-4997, I-4998, ER-ANG-8c, and ER-SDG-4c). The fermentation is carried out at 32 C. and is monitored by weight loss (g/kg) for 70 h.

(13) FIG. 12 represents a fermentation on dextrin medium of the best 3 ER-GAND-48000 clones screened and also of 4 control strains (I-4071, I-4899, I-4997 and ER-SDG-8c). The fermentation is carried out at 32 C. and is monitored by weight loss (g/kg) for 70 h.

(14) FIG. 13 represents an example of an overexpression and cloning vector pSFG for the glucoamylases. This vector is an integrative cloning vector used for gene expression in yeast. pADH1: ADH1 promoter of S. cerevisiae; tCYC1: CYC1 terminator of S. cerevisiae; Kan-MX: geneticin-resistance marker; AmpR: ampicillin-resistance marker. BUD5-A and BUD5-B: the recombinogenic regions for the integration at the BUD5 locus.

(15) FIG. 14 describes the strategy and the various steps for obtaining the I-5121 (A) and I-5122 (B) strains.

(16) FIG. 15 represents a fermentation on dextrin medium of the best 4 ER-GFD-8000 clones screened and also of 3 control strains (I-4071, I-4999 and ER-SDG-4c). The fermentation is carried out at 32 C. and is monitored by weight loss (g/kg) for 70 h.

(17) FIG. 16 represents a fermentation on dextrin medium of the best 4 ER-GFD-48000 clones screened and also of 5 control strains (I-4071, I-4999, ER-SDG-4c, ER-SDG-8c and ER-GFD-8044). The fermentation is carried out at 32 C. and is monitored by weight loss (g/kg) for 70 h.

(18) FIG. 17 represents a fermentation on industrial corn medium of the best ER-GAND clones screened and also of 4 control strains (I4899, I-4997, ER-SDG-4c and ER-SDG-8c). The fermentation is carried out at 32 C. and is monitored by weight loss (g/kg) for 70 h.

(19) FIG. 18 represents a fermentation on industrial corn medium of the best ER-GFD series 8000 clone screened and also of 3 control strains (I-4999, ER-SDG-4c and ER-SDG-8c). The fermentation is carried out at 32 C. and is monitored by weight loss (g/kg) for 70 h.

EXAMPLES

Example 1

Integration of 4 Copies of the Gene Encoding the Glucoamylase of Aspergillus Niger and of at Least 3 Copies of the Gene Encoding the Glucoamylase of Saccharomyces Cerevisiae Var. Diastaticus in a Saccharomyces Cerevisiae Yeast Strain

(20) The copies of the genes of the glucoamylase of Aspergillus niger GLAA (SEQ ID No.: 1) and of the glucoamylase of S. cerevisiae var. diastaticus STA1 (SEQ ID No.: 3) were synthesized with codon usage bias for Saccharomyces cerevisiae.

(21) The DNA sequences used were cloned into a standard vector comprising: the integration targets the chosen promoters/terminators, for example pADH1/tCYC1 the resistance markers which may subsequently be removed.

(22) In the present example, the pANG plasmid (applicant's internal name) was used to express the GLAA glucoamylase of Aspergillus niger (cf. FIG. 1). Likewise, the plasmid pSDG (applicant's internal name) was prepared in order to express the STA1 glucoamylase of S. cerevisiae var. diastaticus.

(23) The principle of the cloning of 4 copies of GLAA or of at least 3 copies of STA1 can be explained in detail in the following way: an expression module comprising the pADH1 promoter, the ORF of the glucoamylases and the tCYC1 terminator was amplified with 3 or 4 different oligonucleotide pairs. Each module obtained after PCR amplification has these 3 elements in common. A selection module comprising a strong promoter/terminator, and a gene of which the expression confers, on the yeasts which contain it, a characteristic which makes it possible to select them. It is for example an antibiotic-resistance gene or a gene which allows the yeast to grow on a particular medium. Since the antibiotic-marker-resistance module is flanked by LoxP sites, it will be possible to remove it, a posteriori, through the action of the Cre recombinase.

(24) ORF means Open Reading Frame.

(25) The primers used for the integration of the 4 copies of the GLAA gene and of the selection module at the HO locus are the following:

(26) TABLE-US-00001 1f-GibsonAMG: (SEQIDNo.:5) TCTGATGGCTAACGGTGAAATTAAAGACATCGCAAACGTCACGGCTAACT TGAAGCTTCGTACGCTGCAGG A1-GibsonAMG: (SEQIDNo.:6) TCACTGTACGGTGAGAACGTAGATGGTGTGCGCATAGGCCACTAGTGGAT CT A2-GibsonAMG: (SEQIDNo.:7) CACACCATCTACGTTCTCACCGTACAGTGAGCATAACCGCTAGAGTACTT B1-GibsonAMG: (SEQIDNo.:8) TTACGTAGACTGAGTAGCAACGGTTGAGGACAGCTTGCAAATTAAAGCCT B2-GibsonAMG: (SEQIDNo.:9) TCCTCAACCGTTGCTACTCAGTCTACGTAAGCATAACCGCTAGAGTACTT C1-GibsonAMG: (SEQIDNo.:10) TCAGTAGCACAGAGAAGTGTAGGAGTGTAGCAGCTTGCAAATTAAAGCCT C2-GibsonAMG: (SEQIDNo.:11) CTACACTCCTACACTTCTCTGTGCTACTGAGCATAACCGCTAGAGTACTT D1-GibsonAMG: (SEQIDNo.:12) TTAGGATACATGCAGTAGACGAGGTAAGCACAGCTTGCAAATTAAAGCCT D2-GibsonAMG: (SEQIDNo.:13) TGCTTACCTCGTCTACTGCATGTATCCTAAGCATAACCGCTAGAGTACTT 2r-GibsonAMG: (SEQIDNo.:14) ACATACTTGCAATTTATACAGTGATGACCGCTGAATTTGTATCTTCCATA CAGCTTGCAAATTAAAGCCT.

(27) The primers used for the integration of at least 3 copies of the STA1 gene and of the selection module at the GRE3 locus are the following:

(28) TABLE-US-00002 MCI-pADH1-GRE3-f: (SEQIDNo.:15) TAAGGGATATAGAAGCAAATAGTTGTCAGTGCAATCCTTCAAGACGATTG GCATAACCGCTAGAGTACTT A1-tCYC1-r: (SEQIDNo.:21) TCACTGTACGGTGAGAACGTAGATGGTGTGCAGCTTGCAAATTAAAGCCT A2-GibsonAMG: (SEQIDNo.:7) CACACCATCTACGTTCTCACCGTACAGTGAGCATAACCGCTAGAGTACTT B1-GibsonAMG: (SEQIDNo.:8) TTACGTAGACTGAGTAGCAACGGTTGAGGACAGCTTGCAAATTAAAGCCT B2-GibsonAMG: (SEQIDNo.:9) TCCTCAACCGTTGCTACTCAGTCTACGTAAGCATAACCGCTAGAGTACTT C1-GibsonAMG: (SEQIDNo.:10) TCAGTAGCACAGAGAAGTGTAGGAGTGTAGCAGCTTGCAAATTAAAGCCT C2-GibsonAMG: (SEQIDNo.:11) CTACACTCCTACACTTCTCTGTGCTACTGAGCATAACCGCTAGAGTACTT D1-GibsonAMG: (SEQIDNo.:12) TTAGGATACATGCAGTAGACGAGGTAAGCACAGCTTGCAAATTAAAGCCT D2-GibsonAMG: (SEQIDNo.:13) TGCTTACCTCGTCTACTGCATGTATCCTAAGCATAACCGCTAGAGTACTT MCI-tCYC1-GRE3-r: (SEQIDNo.:16) CACATATACAGCATCGGAATGAGGGAAATTTGTTCATATCGTCGTTGAGT CAGCTTGCAAATTAAAGCCT.

(29) Table 1 mentions the oligonucleocide pairs used in the selection and expression modules.

(30) TABLE-US-00003 TABLE 1 Primer pairs used for the cloning of 4 copies of GLAA and for example 3 and 4 copies of STA1 Expression module primer Selection Expression module primer pairs pairs for the cloning of 4 module for the cloning of 4 copies of copies of GLAA and 3 copies primer pairs GLAA and 4 copies of STA1 of STA1 Primers 1f-Gibson A2-Gibson AMG + B1-Gibson A2-Gibson AMG + B1-Gibson for AMG + A1- AMG AMG cloning Gibson AMG B2-Gibson AMG + C1-Gibson B2-Gibson AMG + C1-Gibson the ANG AMG AMG gene C2-Gibson AMG + D1-Gibson C2-Gibson AMG + D1-Gibson AMG AMG D2-Gibson AMG + 2r-Gibson D2-Gibson AMG + 2r-Gibson AMG AMG Primers MCI-pADH1- A2-Gibson AMG + B1-Gibson A2-Gibson AMG + B1-Gibson for GRE3-f + AMG AMG cloning A1-tCYC1-r B2-Gibson AMG + C1-Gibson B2-Gibson AMG + C1-Gibson the SDG AMG AMG gene C2-Gibson AMG + D1-Gibson C2-Gibson AMG + MCI- AMG tCYC1-GRE3-r D2-Gibson AMG + MCI-tCYC1- GRE3-r

(31) ANG gene means GLAA gene of the glucoamylase of Aspergillus niger.

(32) SDG gene means STA1 gene of the glucoamylase of Saccharomyces cerevisiae var. diastaticus.

(33) Each amplified module has recombinogenic sequences (A1, B1, C1 and D1) on either side of its promoter and of its terminator. These sequences are introduced by the floating tails of the PCR primers and will make it possible for the modules to align and to recombine specifically by homology between these recombinogenic sequences (FIG. 2).

(34) The strategy employed consists in simultaneously integrating several glucoamylase gene expression modules into an S. cerevisiae strain in a single step at a given locus, using as a basis the natural capacity of the yeast to perform homologous recombination in vivo.

(35) Depending on the combinations of PCR products prepared, at least three glucoamylase expression modules and one selection module can be transformed into the S. cerevisiae strain.

(36) The selection of the clones having correctly integrated the expression cassettes is carried out firstly on the basis of the presence of the selection module in the integration cassette (MCI).

(37) The presence of homologous sequences at a given locus, for example the HO locus, at the 5 and 3 ends of the multi-integrative expression cassette allows the simultaneous integration of the expression modules and of the selection module by homologous recombination at this given locus.

(38) The use of various selectable markers and of their recycling and also the integration at various loci allows the sequential and repeated integration of several multi-integrative cassettes.

(39) For example, FIG. 3 shows the various steps for obtaining the I-5005 strain as explained below. 1-integration of 4 expression modules for the glucoamylase of A. niger, hereinafter GLAA, and of the G418 selection module (geneticin-resistance gene/KanMX marker) at the HO locus then making it possible to obtain the ER-ANG-G418 strain; 2-removal of the selection module through the action of the Cre recombinase enabling the selection of the strain deposited, on Oct. 15, 2014, at the CNCM under number I-4899; 3-integration of a second cassette composed of several expression modules for the glucoamylase of S. cerevisiae var. diastaticus, hereinafter STA1, at the GRE3 locus.

(40) The strains jointly expressing the glucoamylases of A. niger (GLAA) and of S. cerevisiae var. diastaticus (STA1) were called ER-GAND. According to this construction model, it is thus possible to construct yeasts that have integrated at least 4 copies of the GLAA glucoamylase gene and at least 3 copies of the STA1 glucoamylase gene.

(41) For the ER-GAND yeasts, two series of clones were generated. The 7000 series (ER-GAND-7200 to ER-GAND-7376) corresponds to the integration of 4 copies of the GLAA glucoamylase gene (of A. niger) and 3 copies of the STA1 glucoamylase gene (of S. cerevisiae var. diastaticus). With regard to the 8000 series (ER-GAND-8000 to ER-GAND-8159), at least 4 copies of the GLAA glucoamylase gene (of A. niger) and 4 copies of the STA1 glucoamylase gene (of S. cerevisiae var. diastaticus) were cloned. The 8159 clone corresponds to the I-4997 strain.

(42) The yeast strains used are recalled below in table 2, along with their characteristics.

(43) TABLE-US-00004 TABLE 2 Summary of the names/numbers of strains and of the number of copies of glucoamylase genes integrated ANG GA of GA of GA - SDG SFG Strain name CNCM Copies Copies Copies ER I-4071 0 0 0 ER-ANG-G418 nd 4 0 0 ER-GA-36 I-4899 4 0 0 ER-SFG-4c I-4999 0 0 4 ER-SDG-3c I-4998 0 3 0 (nd: not deposted)

Example 2

Screening of the Strains

(44) Three phenotypic screenings were carried out in order to select the best fifteen clones most effective for the intended application. a) Phenotypic Screening with Iodine

(45) The hydrolysis of the soluble starch by the yeast transformants is tested on a YEG/starch agar medium (1% glucose, 0.5% yeast extract, 1% soluble starch). The yeast cells are deposited on the YEG/starch agar and incubated for 2 days at 30 C. The dishes are then stained with iodine vapor in order to visualize the hydrolysis halos present around the yeast colonies.

(46) This screening with iodine vapor makes it possible to select the clones secreting at least one enzyme capable of hydrolyzing the starch. These positive clones can be visualized in particular by hydrolysis halos, the size of which is proportional to the enzymatic activity. FIG. 4 shows an example of screening 88 ER-GAND clones on YEG/starch medium after iodine staining. Table 3 presents the results obtained after iodine staining.

(47) TABLE-US-00005 TABLE 3 Results of the screening with iodine for the 2 ER-GAND series Number Hydrolysis of Growth No phenotype ER-GAND clones on hydrolysis weaker than strains screened YEG phenotype the control Series 7000 176 173 (98%) 1 (<1%) 0 (0%) Series 8000 176 176 (100%) 5 (3%) 1 (<1%)

(48) Out of 176 clones screened for each series, less than 3% of the clones tested do not appear to be capable of hydrolyzing the starch under the culture conditions of the example. It should be noted that the host strain used in this strategy already had several glucoamylase genes in its genome, thus a hydrolysis halo is present for this strain. These negative clones therefore appear to have lost their glucoamylase genes. b) Phenotypic Screening by Fermentation in a Medium of 0.5 g

(49) The phenotypic screening on a dextrin medium under fermentation conditions makes it possible to eliminate the ER-GAND clones that cannot ferment or that ferment more slowly than the I-4899 strain. For this, visual monitoring of the biomass during the fermentation is carried out twice a day for 3 days. By comparing the rate of appearance of the biomass pellet with respect to the I-4999 and I-4998 control strains, the most promising strains can then be selected.

(50) The ER-SDG-1c strain mentioned in the controls of FIG. 5 is an Ethanol Red strain expressing a copy of the glucoamylase gene of S. cerevisiae var. diastaticus (STA1).

(51) The GO-ANG-4c strain mentioned in the controls of FIG. 5 is a GenOne+ strain deposited, on Jul. 25, 2013, at the CNCM under number I-4791 expressing four copies of the glucoamylase gene of A. niger (GLAA).

(52) The fermentation medium used, in the dextrin medium, is a synthetic medium containing starch dextrins (220 g/kg), yeast extract (5 g/kg), urea (2 g/kg), KH.sub.2PO.sub.4 (1 g/kg) and also minerals and vitamins. The strains which ferment the most quickly are strains capable of secreting a considerable amount of glucoamylase, therefore making it possible to release glucose by hydrolysis of the dextrin molecules. The glucose thus released is then metabolized by the S. cerevisiae yeast in order to product ethanol.

(53) FIG. 5 illustrates an example of fermentation in plates for the 88 ER-GAND clones. The biomass pellets correspond to a fermentation of 31 h on dextrin medium. The clones indicated by an arrow show a larger biomass pellet than for the I-4899 strain. These are the clones that were selected to be tested in a fermentation on 100 g of dextrin medium.

(54) For each ER-GAND series, fifteen clones were selected and will be tested in a fermentation on 100 g of dextrin medium.

(55) c) Phenotypic screening by fermentation in a medium of 100 g

(56) A fermentation on 100 g of selective synthetic dextrin medium (corn dextrin 220 g/kg, yeast extract 5 g/kg, urea 2 g/kg, KH.sub.2PO.sub.4 1 g/kg and also minerals and vitamins) is carried out at 32 C. The dextrins are starch hydrolysates which make it possible to mimic the real medium.

(57) The S. cerevisiae strains modified according to the invention were pre-propagated on a YPG (Yeast extract, Peptone, Glucose) medium for 24 h at 30 C. The initial pH of the fermentation medium was adjusted to 5.0 without regulation. The fermentation medium was then inoculated at a level of 0.125 g equivalent dry matter per kilogram of medium. No exogenous hydrolysis enzyme is added to the fermentation medium. Monitoring by weight loss was carried out for 72 hours and is shown in FIG. 6.

(58) In this type of fermentation medium (dextrin), little glucose is free at t0 (approximately ten or so grams). Since the ER strain does not have an enzyme that can hydrolyze the dextrins, it consumes only the available glucose and therefore a low weight loss is measured (approximately 5 g/kg).

(59) On the basis of the weight loss monitoring results presented in FIG. 6, out of 30 clones tested, 3 groups can be established according to their kinetic behaviors in fermentation: Group A: 4 clones have a kinetics profile identical to the I-4899 mother yeast strain. Group B: 2 clones exhibit a kinetics profile similar to the I-4999 reference strain. Group C: the fermentation kinetics performance of 24 clones is better than that of the I-4999 strain (target performance).

(60) Among the strains of group C, the best 5 clones of each series (series 7000 and 8000) were selected to be tested on an industrial medium under real biofuel production conditions.

Example 3

Evaluation of the Production of Enzymatic Activity of the Strains

(61) The 5 ER-GAND clones with 4 copies of GLAA and 3 copies of STA1 (series 7000) previously selected were evaluated at 32 C. on the E140723-11 industrial medium and compared with the I-4998, I-4999 and I-4899 control strains. They were the following clones: 7215, 7250, 7271, 7296, 7302. The 7302 clone corresponds to the I-5005 strain.

(62) The strain (deposited, on Jul. 9, 2015, at the CNCM under number I-4998) expressing the STA1 activity derived from S. cerevisiae var. diastaticus made it possible to obtain rapid but incomplete dextrin hydrolysis kinetics, whereas the strain (I-4899) expressing the GLAA activity derived from A. niger made it possible to obtain a dextrin hydrolysis which was satisfactory but had kinetics that were not as good as I-4998.

(63) The strains were pre-propagated on a medium/water mixture (70%/30%) for 7 h 30 at 32 C. The propagation medium was then transferred to the fermentation medium at a level of 2.5%/97.5%. The fermentation was carried out at 32 C. The initial pH of the propagation and fermentation media was adjusted to 5.0 without regulation. Urea was added in propagation (1500 ppm) and in fermentation (1000 ppm). A dose of 0.06 ml/kg of Spirizyme Ultra (Novozyme) commercial GA glucoamylase solids was added in propagation but not in fermentation.

(64) The weight loss of the fermentation reactors was measured over time from t=0 to t=71 h.

(65) The results of weight losses obtained during the alcoholic fermentation are presented in FIG. 7.

(66) FIG. 7 shows that the new strains make it possible to obtain a dextrin hydrolysis that is both as fast as the I-4998 strain and as complete as the I-4899 strain, but that they are also faster than the I-4999 strain. It can be concluded from this that the production of glucoamylase of Saccharomyces cerevisiae var. diastaticus has a stimulating effect on the hydrolytic activity of the Aspergillus niger glucoamylase. These strains merely exhibit a combination of the characteristics of the fungal glucoamylase of Aspergillus niger and of the glucoamylase of Saccharomyces cerevisiae var. diastaticus (that is to say with a kinetics profile which would be between that of the glucoamylase of Aspergillus niger and that of the glucoamylase of Saccharomyces cerevisiae var. diastaticus), but exhibit an improved kinetics profile with an acceleration of the kinetics. There therefore appears to be a synergistic effect between the glucoamylase of fungal origin and that of Saccharomyces cerevisiae var. diastaticus.

(67) The composition of the fermentation samples is measured by high performance liquid chromatography (HPLC) on an Aminex HPX 87H column (Biorad) with a 5 mM H2SO4 solution as eluent.

(68) The HPLCs carried out at the end of fermentation do not show any major defect for any of the strains in question (table 4). They indeed recall the incapacity of the STA1 enzyme to totally hydrolyze dextrins, contrary to the SFG and GLAA enzymes.

(69) TABLE-US-00006 TABLE 4 Concentrations after 71 H of fermentation (g/kg) Total Free Free Acetic sugars glucose sugars Glycerol acid Ethanol (g/kg) (g/kg) (g/kg) (g/kg) (g/kg) (g/kg) T0 232.6 9.4 11.7 1.3 0.7 2.0 ER-GAND-7215 11.3 0.2 1.3 8.2 0.3 120.7 ER-GAND-7250 9.9 0.1 1.3 8.1 0.2 122.2 ER-GAND-7271 12.6 0.2 1.3 8.1 0.2 121.5 ER-GAND-7296 10.7 0.2 1.3 8.4 0.2 121.3 I-5005 10.9 0.1 1.2 8.4 0.2 122.1 I-4998 37.3 0.8 1.8 6.7 0.0 108.7 I-4999 11.7 0.2 1.1 8.8 0.2 120.1 I-4899 12.1 0.3 1.6 8.4 0.3 119.1

Example 4

Integration of 4 Additional Copies of a Gene Encoding a Glucoamylase in a Saccharomyces Cerevisiae Yeast Strain Possessing at Least 4 Copies of the Gene Encoding the Glucoamylase of Aspergillus Niger and at Least 4 Copies of the Gene Encoding the Glucoamylase of Saccharomyces Cerevisiae Var. Diastaticus

(70) Using the ER-GAND-8159 clone (CNCM I-4997), additional copies of the gene of a glucoamylase were integrated into the BUD5 locus in order to increase the number of copies of the gene of one of the two glucoamylases.

(71) In the present example, the sequences used for this integration correspond to the genes of the glucoamylase of Aspergillus niger GLAA (SEQ ID No.: 1) and of the glucoamylase of S. cerevisiae var. diastaticus STA1 (SEQ ID No.: 3) previously described.

(72) The general principle of the cloning is the same as that described in example 1, only the integration locus varies.

(73) The principle of the cloning of 4 additional copies of GLAA or of 4 additional copies of STA1 can be described in detail in the following way: an expression module comprising the pADH1 promoter, the ORF of the glucoamylases and the tCYC1 terminator was amplified with 4 different oligonucleotide pairs. Each module obtained after PCR amplification has these 3 elements in common. A selection module comprising a strong promoter/terminator, and a gene of which the expression confers, on the yeasts which contain it, a characteristic which makes it possible to select them. It is for example an antibiotic-resistance gene or a gene which allows the yeast to grow on a particular medium. Since the antibiotic-marker-resistance module is flanked by LoxP sites, it will be possible to remove it, a posteriori, through the action of the Cre recombinase.

(74) Saccharomyces cerevisiae yeast strains expressing exclusively either the glucoamylase of A. niger or the glucoamylase of S. cerevisiae var. diastaticus were also obtained according to the same cloning strategy. These S. cerevisiae yeast strains can then contain 4 or 8 copies of the gene of the same glucoamylase in one locus or both loci.

(75) The primers used for the integration of the various copies of the GLAA gene or of the STA1 gene and of the selection module are the following:

(76) TABLE-US-00007 MCI-pADH1-BUD5-f: (SEQIDNo.:19) CGCTCCAGAATTAGCGGACCTCTTGAGCGGTGAGCCTCTGGCAAAGAAGA GCATAACCGCTAGAGTACTT MCI-pTEF-BUD51: (SEQIDNo.:20) CGCTCCAGAATTAGCGGACCTCTTGAGCGGTGAGCCTCTGGCAAAGAAGA TGAAGCTTCGTACGCTGCAGG MCI-pADH1-GRE3-f: (SEQIDNo.:15) TAAGGGATATAGAAGCAAATAGTTGTCAGTGCAATCCTTCAAGACGATTG GCATAACCGCTAGAGTACTT A1-tCYC1-r: (SEQIDNo.:21) TCACTGTACGGTGAGAACGTAGATGGTGTGCAGCTTGCAAATTAAAGCCT A2-GibsonAMG: (SEQIDNo.:7) CACACCATCTACGTTCTCACCGTACAGTGAGCATAACCGCTAGAGTACTT B1-GibsonAMG: (SEQIDNo.:8) TTACGTAGACTGAGTAGCAACGGTTGAGGACAGCTTGCAAATTAAAGCCT B2-GibsonAMG: (SEQIDNo.:9) TCCTCAACCGTTGCTACTCAGTCTACGTAAGCATAACCGCTAGAGTACTT C1-GibsonAMG: (SEQIDNo.:10) TCAGTAGCACAGAGAAGTGTAGGAGTGTAGCAGCTTGCAAATTAAAGCCT C2-GibsonAMG: (SEQIDNo.:11) CTACACTCCTACACTTCTCTGTGCTACTGAGCATAACCGCTAGAGTACTT D1-GibsonAMG: (SEQIDNo.:12) TTAGGATACATGCAGTAGACGAGGTAAGCACAGCTTGCAAATTAAAGCCT D2-GibsonAMG: (SEQIDNo.:13) TGCTTACCTCGTCTACTGCATGTATCCTAAGCATAACCGCTAGAGTACTT MCI-tCYC1-BUD5-r: (SEQIDNo.:22) CTCAAGAACGTAGGACGATAACTGGTTGGAAAGCGTAAACACGGAGTCAA CAGCTTGCAAATTAAAGCCT MCI-tCYC1-GRE3-r: (SEQIDNo.:16) CACATATACAGCATCGGAATGAGGGAAATTTGTTCATATCGTCGTTGAGT CAGCTTGCAAATTAAAGCCT.

(77) Table 5 mentions the oligonucleotide pairs used in the selection and expression modules, and also the host yeast strain for the various constructions

(78) TABLE-US-00008 TABLE 5 Primer pairs used for the cloning of 4 copies of GLAA and for example 4 copies of STA1 in the BUD5 locus Constructions 1 2 3 4 5 Host S. ER-GAND-8159 ER-GAND- ER-GA-36 Ethanol Red ER-SDG-4c cerevisiae I-4997 81591-4997 1-4899 1-4071 strains Integration BUD5 GER3 BUDS locus Selection MCI-pADH1-BUD5-f MCI-pADH1-GRE3- MCI-pTEF- module A1-tCYC1-r f BUD5-f A1-tCYC1-r A1-tCYC1-r Module 1 A2-Gibson AMG BI -Gibson AMG Module 2 B2-Gibson AMG Cl-Gibson AMG Module 3 C2-Gibson AMG Dl-Gibson AMG Module 4 D2-Gibson AMG D2-Gibson AMG D2-Gibson AMG MCI-tCYC1-BUD5-r MCI-tCYC1-GRE3-r MCI-tCYC1- BUD5-r Name of S. ER-GAND- ER-GAND- ER-ANG-8c ER-SDG-4c ER-SDG-8c cerevisiae 12020 48038 strains (I-5119) (I-5120) obtained

(79) The strategy is strictly similar to that employed in example 1 for the simultaneous integration of several glucoamylase gene expression modules in an S. cerevisiae strain in a single step at a given locus, using, as a basis, the natural capacity of the yeast to perform homologous recombination in vivo.

(80) The strains jointly expressing the glucoamylases of A. niger (GLAA) and of S. cerevisiae var. diastaticus (STA1) were called ER-GAND plus the number of the clone. Two series of clones were generated. The 12000 series (ER-GAND-12001 to 12023) corresponds to the integration of 8 copies of the GLAA glucoamylase gene (of A. niger) and 4 copies of the STA1 glucoamylase gene (of S. cerevisiae var. diastaticus) and the 48000 series (ER-GAND-480001 to 480088) corresponds to the integration of 4 copies of the GLAA glucoamylase gene (of A. niger) and of 8 copies of the STA1 glucoamylase gene (of S. cerevisiae var. diastaticus).

(81) The strains expressing exclusively the glucoamylase of A. niger (GLAA) were called ER-ANG-z-c where z corresponds to the copy number of the GLAA gene introduced into the host strain. The strains expressing exclusively the S. cerevisiae var. diastaticus glucoamylase (STA1) were called ER-SDG-y-c where y corresponds to the copy number of the STA1 gene introduced into the host strain.

(82) For example, FIGS. 8 to 10 show the various steps for obtaining the ER-GAND-12000, ER-GAND-48000, ER-ANG-8c, ER-SDG-4c and ER-SDG-8c strains constructed in this example.

(83) The yeast strains used are recalled below in table 6 along with their characteristics.

(84) TABLE-US-00009 TABLE 6 Summary of the strain names/numbers and of the number of copies of glucoamylase genes integrated GA-ANG GA of SDG Strain name CNCM Copies Copies ER I-4071 0 0 ER-GA-36 I-4899 4 0 ER-SDG-4c nd 0 4 ER-SDG-8c nd 0 8 ER-ANG-8c nd 8 4 ER-GAND-12020 I-5119 8 4 ER-GAND-48035 I-5120 4 8 (nd: not deposited)

Example 5

Screening of the Strains

(85) Three phenotypic screenings were carried out in order to select the best clones that are the most effective for the intended application.

(86) a) Phenotypic Screening with Iodine

(87) The phenotypic screening with iodine was carried out in a manner identical to example 2a). Table 7 presents the results obtained after iodine staining.

(88) TABLE-US-00010 TABLE 7 Results of the screening with iodine for the 5 series of cloning carried out. The weaker hydrolysis phenotype corresponds to a halo around the clone that is smaller than that of the host S.cerevisiae strain Number of S.cerevisiae clones Growth on No hydrolysis Weaker hydrolysis strains screened YEG phenotype phenotype* ER-ANG-8c 88 0 0 0 ER-SDG-4c 132 0 3 (2%) ER-SDG-8c 9 0 0 0 ER-GAND 23 0 0 1 (4%) 12000 series ER-GAND 88 0 0 0 48000 series

(89) Out of all the 5 series of screening carried out, only the series for ER-SDG-4c provides any clones that do not have starch hydrolysis activity under the culture conditions of the example. It should be noted that this is the only series where the cloning was carried out in the Ethanol Red host strain which does not possess a glucoamylase gene. These negative clones therefore appear not to have integrated at least one glucoamylase gene.

(90) b) Phenotypic Screening by Fermentation in a Medium of 0.5 g

(91) The phenotypic screening on a dextrin medium under fermentation conditions makes it possible to eliminate the clones obtained in the various series which cannot ferment or which ferment more slowly than the corresponding host strain. For this, visual monitoring of the biomass during the fermentation is carried out twice a day for 2 days. By comparing the rate of appearance of the biomass pellet with respect to the I-4997 control strain, the most promising strains can then be selected.

(92) The fermentation medium used, which is the dextrin medium, is a synthetic medium containing starch dextrins (220 g/kg), yeast extract (5 g/kg), urea (2 g/kg), KH.sub.2PO.sub.4 (1 g/kg) and also minerals and vitamins. The strains which ferment the most quickly are strains capable of secreting a large amount of glucoamylase therefore making it possible to release glucose by hydrolysis of the dextrin molecules. The glucose thus released is then metabolized by the S. cerevisiae yeast in order to produce ethanol.

(93) For each cloning series, between two and four clones were selected and are tested on a larger scale in a fermentation on 100 g of dextrin medium.

(94) c) Phenotypic Screening by Fermentation in a Medium of 100 g

(95) As for example 2c), a fermentation on 100 g of selective synthetic dextrin medium (corn dextrin 220 g/kg, yeast extract 5 g/kg, urea 2 g/kg, KH.sub.2PO.sub.4 1 g/kg and also minerals and vitamins) is carried out at 32 C. The dextrins are starch hydrolysates which make it possible to mimic the real medium.

(96) The S. cerevisiae strains modified according to the invention were pre-propagated on a YPG (Yeast extract, Peptone, Glucose) medium for 24 h at 30 C. The initial pH of the fermentation medium was adjusted to 5.0 without regulation. The fermentation medium was then inoculated at a level of 0.125 g equivalent dry matter per kilogram of medium. No exogenous hydrolysis enzyme is added to the fermentation medium. Weight loss monitorings were carried out for 72 hours and are shown in FIG. 11, for the ER-GAND-12000 series, and FIG. 12 for the ER-GAND-48000 series.

(97) In this type of fermentation medium (dextrin), little glucose is free at t0 (approximately ten or so grams). Since the ER strain does not have any enzyme that can hydrolyze dextrins, it consumes only the available glucose and a low weight loss is therefore measured (approximately 5 g/kg) from 14 h up to the end of the fermentation.

(98) On the basis of the weight loss monitoring results presented in FIGS. 11 and 12, the 3 clones tested for each series exhibit weight-loss kinetics that are virtually identical and therefore appear to be equivalent in terms of fermentation performance on a dextrin medium.

(99) The increase in the copy number of the STA1 or sGLAA gene (from 4 to 8 copies) in an S. cerevisiae strain also makes it possible to gain in kinetic performance, in particular for the fermentation rate during the first 30 hours (FIG. 11).

(100) The addition, likewise, of either 4 copies of the sGLAA gene (FIG. 11) or of 4 copies of the STA1 gene (FIG. 12) in the ER-GAND-8159 strain (I-4997) allows an improvement in the fermentation kinetics on dextrin medium and thus makes it possible to combine the performance levels of the glucoamylases of S. cerevisiae var. diastaticus and of A. niger.

Example 6

Integration of 4 or 8 Copies of the Gene Encoding the Glucoamylase of Saccharomyces Cerevisiae Var. Diastaticus into a Saccharomyces Cerevisiae Yeast Strain Containing 4 Copies of the Gene Encoding the Glucoamylase of Saccharomycopsis Fibuligera

(101) The copies of the genes of the glucoamylase of S. cerevisiae var. diastaticus STA1 (SEQ ID No.: 3) and of the glucoamylase of Saccharomycopsis fibuligera GLU0111 (SEQ ID No.: 17) were synthesized with codon usage bias for Saccharomyces cerevisiae.

(102) The DNA sequences used were cloned into a standard vector comprising: the integration targets the chosen promoters/terminators, for example pADH1/tCYC1 the resistance markers which may be subsequently removed.

(103) In the present example, the pSFG plasmid (applicant's internal name) was used to express the GLU0111 glucoamylase of Saccharomycopsis fibuligera (cf. FIG. 13). Likewise, the pSDG plasmid (applicant's internal name) is prepared in order to express the STA1 glucoamylase of S. cerevisiae var. diastaticus.

(104) The principle of the cloning of 4 copies of GLU0111 or of 4 or 8 copies of STA1 can be described in detail in the following way: an expression module comprising the pADH1 promoter, the ORF of the glucoamylases and the tCYC1 terminator was amplified with 3 or 4 different oligonucleotide pairs. Each module obtained after PCR amplification has these 3 elements in common. A selection module comprising a strong promoter/terminator, and a gene of which the expression confers, on the yeasts which contain it, a characteristic which makes it possible to select them. It is for example an antibiotic-resistance gene or a gene which allows the yeast to grow on a particular medium. Since the antibiotic-marker-resistance module is flanked by LoxP sites, it will be possible to remove it, a posteriori, through the action of the Cre recombinase.

(105) The primers used for the integration of the various copies of the GLAA gene or of the STA1 gene and of the selection module are the following:

(106) TABLE-US-00011 1f-GibsonAMG: (SEQIDNo.:5) TCTGATGGCTAACGGTGAAATTAAAGACATCGCAAACGTCACGGCTAACT TGAAGCTTCGTACGCTGCAGG MCI-pTEF-BUD5-f (SEQIDNo.:20) CGCTCCAGAATTAGCGGACCTCTTGAGCGGTGAGCCTCTGGCAAAGAAGA TGAAGCTTCGTACGCTGCAGG MCI-pADH1-GRE3-f (SEQIDNo.:15) TAAGGGATATAGAAGCAAATAGTTGTCAGTGCAATCCTTCAAGACGATTG GCATAACCGCTAGAGTACTT A1-GibsonAMG: (SEQIDNo.:6) TCACTGTACGGTGAGAACGTAGATGGTGTGCGCATAGGCCACTAGTGGAT CT A1-tCYC1-r: (SEQIDNo.:21) TCACTGTACGGTGAGAACGTAGATGGTGTGCAGCTTGCAAATTAAAGCCT A2-GibsonAMG: (SEQIDNo.:7) CACACCATCTACGTTCTCACCGTACAGTGAGCATAACCGCTAGAGTACTT B1-GibsonAMG: (SEQIDNo.:8) TTACGTAGACTGAGTAGCAACGGTTGAGGACAGCTTGCAAATTAAAGCCT B2-GibsonAMG: (SEQIDNo.:9) TCCTCAACCGTTGCTACTCAGTCTACGTAAGCATAACCGCTAGAGTACTT C1-GibsonAMG: (SEQIDNo.:10) TCAGTAGCACAGAGAAGTGTAGGAGTGTAGCAGCTTGCAAATTAAAGCCT C2-GibsonAMG: (SEQIDNo.:11) CTACACTCCTACACTTCTCTGTGCTACTGAGCATAACCGCTAGAGTACTT D1-GibsonAMG: (SEQIDNo.:12) TTAGGATACATGCAGTAGACGAGGTAAGCACAGCTTGCAAATTAAAGCCT D2-GibsonAMG: (SEQIDNo.:13) TGCTTACCTCGTCTACTGCATGTATCCTAAGCATAACCGCTAGAGTACTT MCI-tCYC1-BUD5-r: (SEQIDNo.:22) CTCAAGAACGTAGGACGATAACTGGTTGGAAAGCGTAAACACGGAGTCAA CAGCTTGCAAATTAAAGCCT MCI-tCYCl-GRE3-r: (SEQIDNo.:16) CACATATACAGCATCGGAATGAGGGAAATTTGTTCATATCGTCGTTGAGT CAGCTTGCAAATTAAAGCCT 2r-GibsonAMG: (SEQIDNo.:14) ACATACTTGCAATTTATACAGTGATGACCGCTGAATTTGTATCTTCCATA CAGCTTGCAAATTAAAGCCT.

(107) TABLE-US-00012 TABLE 8 Primer pairs used for the cloning of 4 copies of GLU0111 and for example 4 or 8 copies of STA1 Constructions 1 2 3 Host S. cerevisiae Ethanol Red ER-SFG ER-GFD-8044 strains I-4071 I-4999 (I-5121) Integration locus HO GRE3 BUD5 Selection module 1f-Gibson MCI-pADH1- MCI-pTEF- AMG GRE3-f BUD5-f A1-Gibson A1-Gibson A1-Gibson AMG AMG AMG Module 1 A2-Gibson AMG B1-Gibson AMG Module 2 B2-Gibson AMG C1-Gibson AMG Module 3 C2-Gibson AMG D1-Gibson AMG Module 4 D2-Gibson D2-Gibson D2-Gibson AMG AMG AMG 2r-Gibson MCI-tCYC1- MCI-tCYC1- AMG GRE3-r BUD5 Name of the ER-SFG ER-GFD-8044 ER-GFD-48015 S. cerevisiae strains (I-4999) (I-5121) (I-5122) obtained

(108) SFG gene means GLU0111 gene of the glucoamylase of Saccharomycopsis fibuligera.

(109) The strategy is strictly similar to that employed in example 1 for the simultaneous integration of several glucoamylase gene expression modules into an S. cerevisiae strain in a single step at a given locus, using as a basis the natural capacity of the yeast to perform homologous recombination in vivo.

(110) For example, FIG. 14 shows the various steps for obtaining the I-5122 strain as explained below: 1integration of 4 S. fibuligera glucoamylase expression modules, hereinafter GLU0111, and of the G418 selection module (geneticin-resistance gene/KanMX marker) at the HO locus, therefore making it possible to obtain the ER-SFG strain; 2integration of a second cassette composed of 4 S. cerevisiae var. diastaticus glucoamylase expression modules, hereinafter STA1, at the GRE3 locus; 3integration of a third cassette composed of 4 S. cerevisiae var. diastaticus glucoamylase expression modules, hereinafter STA1, at the BUD5 locus.

(111) The strains jointly expressing the glucoamylases of S. fibuligera (GLU0111) and of S. cerevisiae var. diastaticus (STA1) were called ER-GFD. According to this construction model, it is thus possible to construct yeasts that have integrated 4 copies of the GLU0111 glucoamylase gene and at least 4 copies of the STA1 glucoamylase gene.

(112) For the ER-GFD yeasts, two series of clones were generated. The 8000 series (ER-GFD-8001 to ER-GFD-8045) corresponds to the integration of 4 copies of the GLU0111 glucoamylase gene (from S. fibuligera) and 4 copies of the STA1 glucoamylase gene (from S. cerevisiae var. diastaticus). With regard to the 48000 series (ER-GFD-48001 to ER-GFD-48015), 4 copies of the GLU0111 glucoamylase gene (from S. fibuligera) and 8 copies of the STA1 glucoamylase gene (from S. cerevisiae var. diastaticus) were cloned. The ER-GFD-8044 and ER-GFD-48015 clones correspond to the I-5121 and I-5122 strains, respectively.

(113) The Yeast strains used are recalled below in table 9 alone with their characteristics.

(114) TABLE-US-00013 TABLE 9 Summary of the strain names/numbers and of the number of copies of glucoamylase genes integrated GA of GA of SDG SFG Strain name CNCM Copies Copies ER I-4071 0 0 ER-SFG-4c I-4999 0 4 ER-GFD-8044 I-5121 4 4 ER-GFD-48015 I-5122 8 4

Example 7

Screening of the Strains

(115) Three phenotypic screenings were carried out in order to select the best clones that are the most effective for the intended application.

(116) a) Phenotypic Screening with Iodine

(117) The phenotypic screening with iodine was carried out in a manner identical to example 2a).

(118) Table 10 presents the results obtained after staining with iodine.

(119) TABLE-US-00014 TABLE 10 Results of the screening with iodine for the 2 series of cloning carried out. The weaker hydrolysis phenotype corresponds to a halo around the clone that is smaller than that of the host S. cerevisiae strain Number of S.cerevisiae clones Growth on No hydrolysis Weaker hydrolysis strains screened YEG phenotype phenotype* ER-GFD 45 0 0 1 (2%) series 8000 ER-GFD 15 0 0 0 series 48000

(120) Out of all of the clones screened for each series, less than 2% of the clones tested do not appear to be capable of hydrolyzing the starch under the culture conditions of the example. It should be noted that the host strain used in this strategy already possessed several glucoamylase genes in its genome, thus a hydrolysis halo is present for each strain. These negative clones therefore appear to have lost their glucoamylase genes.

(121) b) Phenotypic Screening by Fermentation in a Medium of 0.5 g

(122) The phenotypic screening on a dextrin medium under fermentation conditions makes it possible to eliminate the clones obtained in the various series which cannot ferment or which ferment more slowly than the corresponding host strain. For this, visual monitoring of the biomass during the fermentation is carried out twice a day for 2 days. By comparing the rate of appearance of the biomass pellet with respect to the I-4999 strain, the most promising strains can then be selected.

(123) The fermentation medium used, which is the dextrin medium, is a synthetic medium containing starch dextrins (220 g/kg), yeast extract (5 g/kg), urea (2 g/kg), KH.sub.2PO.sub.4 (1 g/kg) and also minerals and vitamins. The strains which ferment the most quickly are strains capable of secreting a large amount of glucoamylase, therefore making it possible to release glucose by hydrolysis of the dextrin molecules. The glucose thus released is then metabolized by the S. cerevisiae yeast in order to produce ethanol.

(124) For each cloning series, between two and four clones were selected and are tested on a larger scale in a fermentation on 100 g of dextrin medium.

(125) c) Phenotypic Screening by Fermentation in a Medium of 100 g

(126) As for examples 2c) and 5c), a fermentation on 100 g of selective synthetic dextrin medium (corn dextrin 220 g/kg, yeast extract 5 g/kg, urea 2 g/kg, KH.sub.2PO.sub.41 g/kg and also minerals and vitamins) is carried out at 32 C. The dextrins are starch hydrolysates which make it possible to mimic the real medium.

(127) The S. cerevisiae strains modified according to the invention were pre-propagated on a YPG (Yeast extract, Peptone, Glucose) medium for 24 h at 30 C. The initial pH of the fermentation medium was adjusted to 5.0 without regulation. The fermentation medium was then inoculated at a level of 0.125 g equivalent dry matter per kilogram of medium. No exogenous hydrolysis enzyme is added to the fermentation medium. Weight loss monitorings were carried out for 72 hours and are shown in FIG. 15, for the ER-GFD-8000 series, and FIG. 16 for the ER-GFD-48000 series.

(128) In this type of fermentation medium (dextrin), little glucose is free at t0 (approximately ten or so grams). Since the ER strain has no enzyme that can hydrolyze dextrins, it consumes only the available glucose and therefore a low weight loss is measured (approximately 5 g/kg) from 14 h up to the end of the fermentation.

(129) On the basis of the weight-loss monitoring results presented in FIGS. 15 and 16, the clones tested for each series exhibit weight-loss kinetics that are virtually identical and therefore appear to be equivalent in terms of fermentation performance on a dextrin medium.

Example 8

Evaluation of the Production of Enzymatic Activity of the Strains

(130) The clones previously selected were evaluated at 32 C. on the E140723-11 industrial medium and compared with the I-4998, I-4999, I-4899, I-4997, ER-SDG-4c and ER-SDG-8c control strains. They are the following clones: ER-GAND-12020, ER-GAND 48084, ER-GFD-8044 and ER-GFD-48015.

(131) The strain (deposited, on Jul. 9, 2015, at the CNCM under number I-4998) expressing the STA1 activity derived from S. cerevisiae var. diastaticus made it possible to obtain rapid but incomplete dextrin hydrolysis kinetics, whereas the strain (I-4899) expressing the GLAA activity derived from A. niger made it possible to obtain a dextrin hydrolysis which was satisfactory but had kinetics that were not as good as I-4998.

(132) The strains were pre-propagated on a rich medium overnight at 32 C. The fermentation was carried out at 32 C. The initial pH of the fermentation medium was adjusted to 5.0 without regulation. Urea was added in fermentation (600 ppm). The fermentation medium was then inoculated at a level of 0.5 g equivalent dry matter per kilogram of medium.

(133) The weight loss of the fermentation reactors was measured over time from t=0 to t=66 h.

(134) The results of weight losses obtained during the alcoholic fermentation are presented in FIGS. 17 and 18.

(135) For the ER-GAND series (I-5119 and I-5120), FIG. 17 shows that the new strains make it possible to obtain dextrin hydrolysis that is both as fast as the ER-SDG-4c and ER-SDG-8c strains and as complete as the I-4899 strain, but they are as fast as the I-4997 strain. It can be concluded from this that the production of glucoamylase of Saccharomyces cerevisiae var. diastaticus still has a stimulating effect on the hydrolytic activity of the Aspergillus niger glucoamylase.

(136) For the ER-GFD series (I-5121 and I-5122), FIG. 18 shows that the new strains make it possible to obtain dextrin hydrolysis that is both as fast as the I-ER-SDG4c strain and as complete as the I-4999 strain, but that they are also much faster than the I-4999 strain. It can be concluded from this that the production of glucoamylase of Saccharomyces cerevisiae var. diastaticus has a stimulating effect on the hydrolytic activity of the Saccharomycopsis fibuligera glucoamylase. These strains do nothing but exhibit a combination of the characteristics of the fungal glucoamylase of Saccharomycopsis fibuligera and of the glucoamylase of Saccharomyces cerevisiae var. diastaticus (that is to say with a kinetics profile which is between that of the glucoamylase of Saccharomycopsis fibuligera and that of the glucoamylase of Saccharomyces cerevisiae var. diastaticus), but exhibit an improved kinetics profile with an acceleration of the kinetics. There therefore appears to be a synergistic effect between the glucoamylase of fungal origin and that of Saccharomyces cerevisiae var. diastaticus.