VACCINATION AGAINST DIABETES, OBESITY AND COMPLICATIONS THEREOF

20210069313 · 2021-03-11

    Inventors

    Cpc classification

    International classification

    Abstract

    Vaccines for preventing or treating diabetes, obesity and complications thereof are provided. The vaccines comprise at least one active agent such as attenuated Porphyromonas gingivalis, inactivated Porphyromonas gingivalis, a subunit of Porphyromonas gingivalis, a recombinant or isolated immunogenic polypeptide or peptide from Porphyromonas gingivalis or a cDNA from Porphyromonas gingivalis.

    Claims

    1. A method for preventing or treating diabetes, obesity and/or complications thereof in a subject in need thereof, comprising administering a prophylactically or therapeutically effective amount of a vaccine composition comprising at least one prophylactically or therapeutically active agent selected from the group consisting of attenuated Porphyromonas gingivalis, inactivated Porphyromonas gingivalis, a subunit of Porphyromonas gingivalis, a recombinant or isolated immunogenic polypeptide or peptide from Porphyromonas gingivalis or a cDNA from Porphyromonas gingivalis.

    2. The method according to claim 1, wherein said vaccine composition further comprises: at least one additional prophylactically or therapeutically active agent selected from the group consisting of live attenuated Fusobacterium nucleatum, killed or inactivated Fusobacterium nucleatum, a subunit of Fusobacterium nucleatum, a recombinant or isolated immunogenic polypeptide or peptide from Fusobacterium nucleatum or a cDNA from Fusobacterium nucleatum, and/or at least one additional prophylactically or therapeutically active agent selected from the group consisting of live attenuated Prevotella intermedia, killed or inactivated Prevotella intermedia, a subunit of Prevotella intermedia, a recombinant or isolated immunogenic polypeptide or peptide from Prevotella intermedia or a cDNA from Prevotella intermedia.

    3. The method according to claim 1, wherein said prophylactically or therapeutically active agent is attenuated or inactivated Porphyromonas gingivalis.

    4. The method according to claim 1, wherein said composition does not include an adjuvant.

    5. The method according to claim 1, wherein the subject is at risk of metabolic disease.

    6. The method according to claim 1, wherein the subject suffers from obesity.

    7. The method according to claim 1, wherein the complications include insulinemia and/or high fasting blood glucose.

    8. The method according to claim 1, wherein said subject has a high fat diet.

    9. The method according to claim 1, wherein the diabetes is type 2 diabetes.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0091] FIGS. 1-5. Oral colonization with Pg, Fn and Pi induces periodontitis associated with local and systemic immune disorders.

    [0092] FIG. 1 A) Mice were colonized with Porphyromonas gingivalis (Pg), Fusobacterium nucleatum (Fn) and Prevotella intermedia (Pi) or by vehicle solution for one month and then randomized in four groups: NC (normal chow, n=6), NC-Co (normal chow colonized, n=6), HFD (high-fat diet, n=7) and HFD-Co (High-fat diet colonized, n=10);

    [0093] FIG. 1 B) Alveolar Bone loss (in mm) for each group;

    [0094] FIG. 1 C) TNF-, PAI-1, ILI-, and IL-6 expression in periodontal tissue. NC: white bar; NC-Co: grey bar; HFD: black bar, and HFD-Co: checkerboard bar.

    [0095] FIG. 2) Histological examination for hemi-mandibles stained with hematolin/eosin, F4/80, CD3 and CD45 antibodies: cells count is shown for each group. NC: white_bar; NC-Co: grey bar; HFD: black bar, and HFD-Co: checkerboard bar.

    [0096] FIG. 3A) Number of immune cell-types explored at 3 months in cervical lymph-nodes of each group.

    [0097] FIG. 3B) Relative abundance of immune cell-types explored at 3 months in cervical lymph-nodes of each group. NC: white bar; NC-Co: grey bar; HFD: black bar, and HFD-Co: checkerboard bar.

    [0098] FIG. 4A) Number of immune cell-types explored at 3 months in spleen of each group.

    [0099] FIG. 4B) Relative abundance of immune cell-types explored at 3 months in spleen of each group. NC: white bar; NC-Co: grey bar; HFD: black bar, and HFD-Co: checkerboard bar.

    [0100] FIG. 5) Relative abundance of immune cell-types explored at 3 months in blood of each group. NC: white bar; NC-Co: grey bar; HFD: black bar, and HFD-Co: checkerboard bar. Data (meanSEM) and One-way ANOVA followed by Tukey's test used for *P<0.05 and ****P<0.0001 when compared to HFD, .sup.P<0.05; .sup.P<0.001 .sup.P<0.0001 when compared to NC and .sup.$P<0.05 when compared to NC-Co.

    [0101] FIGS. 6-8. Periodontitis enhances HFD-induced metabolic disorders in mice. FIG. 6A) Glycaemic profiles (mg/dL) during an Intraperitoneal Glucose-Tolerance Test (IpGTT NC (normal chow, white bar, n=6), NC-Co (normal chow colonized, grey bar, n=6), HFD (high-fat diet, black bar n=7) and HFD-Co (High-fat diet colonized, checkerboard_bar, n=10) and glycaemic indexes as inset; for each group during 1 month.

    [0102] FIG. 6B) Ratio fat/lean for each group during 1 month.

    [0103] FIG. 6C) Glycaemic profiles (mg/dL) during an Intraperitoneal Glucose-Tolerance Test (IpGTT NC (normal chow, white bar, n=6), NC-Co (normal chow colonized, grey bar, n=6), HFD (high-fat diet, black bar n=7) and HFD-Co (High-fat diet colonized, checkerboard_bar, n=10) and glycaemic indexes as inset; for each group during 2 months.

    [0104] FIG. 6D) Ratio fat/lean for each group during 2 months.

    [0105] FIG. 6E) Glycaemic profiles (mg/dL) during an Intraperitoneal Glucose-Tolerance Test (IpGTT NC (normal chow, white bar, n=6), NC-Co (normal chow colonized, grey bar, n=6), HFD (high-fat diet, black bar n=7) and HFD-Co (High-fat diet colonized, checkerboard bar, n=10) and glycaemic indexes as inset; for each group during 3 months.

    [0106] FIG. 6F) Ratio fat/lean for each group during 3 months.

    [0107] FIG. 7) Insulin-sensitivity evaluated by the euglycaemic-hyperinsulinemic clamp technique.

    [0108] FIG. 8) Correlation between Glucose Infusion Rate (GIR) and ABL (alveolar bone loss). Data are meanSEM. Significant results when: *P<0.05; **P<0.01 and ***P<0.001 when compared to HFD, .sup.P<0.05 and .sup.P<0.001 when compared to NC and .sup.$P<0.05 when compared to NC-Co as determined by Two-Way ANOVA with Bonferroni's post-test for FIG. A, C and E and one-way ANOVA followed by Tukey's post-test for FIG. 6B, D, F, and FIG. 7.

    [0109] FIG. 9. Immune cells transfer from cervical lymph-nodes from periodontitis mice reduce colonization-induced glucose-intolerance.

    [0110] FIG. 9A) Immune cells from cervical lymph-nodes from donor mice with or without periodontitis were transferred to recipient mice. Then, each group was colonized by Pg, Fn and Pi in periodontal tissue for four weeks.

    [0111] FIG. 9B) Intra-peritoneal glucose-tolerance tests were performed in recipient mice after transfer (not shown) and after colonization.

    [0112] FIG. 9C) Glycaemic index. PTC+NC-Co: Periodontitis transfer+Colonization; HTC+NC-Co: Healthy transfer+Colonization; PCT+NC: Periodontitis transfer without colonization; HTC+NC: Healthy transfer without colonization.

    [0113] Data are meanSEM. Significant results when: ***P<0.001 when compared to HTC+NC as determined by one-way ANOVA followed by Tukey's test (C) and Two-Way ANOVA with Bonferroni's post-test (B).

    [0114] FIG. 10. Pre-treatment with inactivated Porphyromonas gingivalis prevents periodontitis-aggravated glucose-intolerance in HFD-fed mice.

    [0115] FIG. 10A) Mice were injected by 10.sup.6 CFU of inactivated Porphyromonas gingivalis or inactivated Fusobacterium nucleatum or inactivated Prevotella intermedia or a mix of all inactivated bacteria or vehicle solution. 1 month later, mice were colonized by Pg, Fn, Pi and or by vehicle solution for one month and then randomized in 7 groups: NC-vehicles (vehicle+normal chow, n=4), HFD-vehicles (vehicle+HFD, n=4), HFD-Co (vehicle+HFD+colonization, n=4), HFD-Co+I B mix (inactivated mix bacteria+colonization+HFD, n=4), HFD-Co+I Pg (inactivated Porphyromonas gingivalis+colonization+HFD, n=4), HFD-Co+I Fn (inactivated Fusobacterium nucleatum+colonization+HFD, n=4) and HFD-Co+I Pi (inactivated Prevotella intermedia+colonization+HFD, n=4).

    [0116] FIG. 10B-E) Intraperitoneal Glucose-Tolerance Test (IpGTT) was assessed for each group after 3 months of HFD.

    [0117] FIG. 10F) Glycaemic index was assessed for each group after 3 months of HFD. NC-vehicles: white bar, HFD-vehicles: black bar, HFD-Co: checkerboard bar, HFD-Co+I B mix: vertical striped bar, HFD-Co+I Pg: diagonal striped bar, HFD-Co+I Fn: horizontal striped bar, HFD-Co+I Pi: grey pointed bar.

    [0118] FIG. 10G) Measurement of Immunoglobulin G antibodies specific to LPS of Porphyromonas gingivalis in blood. NC-vehicles: white bar, HFD-vehicles: black bar, HFD-Co: checkerboard bar, HFD-Co+I B mix: vertical striped bar, HFD-Co+I Pg: diagonal striped bar, HFD-Co+I Fn: horizontal striped bar, HFD-Co+I Pi: grey pointed bar.

    [0119] FIG. 10H) Alveolar Bone loss was explored after experimental procedures for each group. NC-vehicles: white bar, HFD-vehicles: black bar, HFD-Co: checkerboard bar, HFD-Co+I B mix: vertical striped bar, HFD-Co+I Pg: diagonal striped bar, HFD-Co+I Fn: horizontal striped bar, HFD-Co+I Pi: grey pointed bar.

    [0120] Data are meanSEM. Significant results when: **P<0.01, ***P<0.001 and ****P<0.0001 when compared to HFD-vehicles, .sup.P<0.05 and .sup.P<0.0001 when compared to NC-vehicles and .sup.#P<0.05 and .sup.###P<0.0001 when compared to HFD-Co as determined by Two-Way ANOVA with Bonferroni's post-test for B, C, D and E and one-way ANOVA followed by Tukey's post-test for F and G.

    [0121] FIG. 11. Pre-treatment with inactivated Porphyromonas gingivalis induced production of antibodies against Porphyromonas gingivalis FIG. 11 A) Mice were injected by 10.sup.6 CFU of inactivated Porphyromonas gingivalis or inactivated Fusobacterium nucleatum or inactivated Prevotella intermedia or a mix of all inactivated bacteria or vehicle solution. 1 month later, mice were colonized by Pg, Fn, Pi and or by vehicle solution for one month and then randomized in 7 groups: Sham (vehicle+normal chow, n=4), HFD (vehicle+HFD, n=4), HFD-Co (vehicle+HFD+colonization, n=4), HFD-Co+I B mix (inactivated mix bacteria+colonization+HFD, n=4), HFD-Co+I Pg (inactivated Porphyromonas gingivalis+colonization+HFD, n=4), HFD-Co+I Fn (inactivated Fusobacterium nucleatum+colonization+HFD, n=4) and HFD-Co+inactivated Pi (inactivated Prevotella intermedia+colonization+HFD, n=4).

    [0122] FIG. 11 B-E) Intraperitoneal Glucose-Tolerance Test (IpGTT) was assessed for each group after 1 month of HFD.

    [0123] FIG. 11 F) Glycaemic index was assessed for each group after 1 month of HFD. NC-vehicles: white bar, HFD-vehicles: black bar, HFD-Co: checkerboard bar, HFD-Co+I B mix: vertical striped bar, HFD-Co+I Pg: diagonal striped bar, HFD-Co+I Fn: grey pointed bar, HFD-Co+I Pi: horizontal striped bar.

    [0124] FIG. 11 G) Measurement of Immunoglobulin G antibodies specific to LPS of Porphyromonas gingivalis in blood. NC-vehicles: white bar, HFD-vehicles: black bar, HFD-Co: checkerboard bar, HFD-Co+I B mix: vertical striped bar, HFD-Co+I Pg: diagonal striped bar, HFD-Co+I Fn: grey pointed bar, HFD-Co+I Pi: horizontal striped bar. Data are meanSEM. Significant results when: **P<0.01, ***P<0.001 and ****P<0.0001 when compared to HFD-vehicles, .sup.P<0.05 and .sup.P<0.0001 when compared to NC-vehicles and .sup.#P<0.05 and .sup.###P<0.0001 when compared to HFD-Co as determined by Two-Way ANOVA with Bonferroni's post-test for B, C, D and E and one-way ANOVA followed by Tukey's post-test for F and G.

    [0125] FIG. 12. Scheme presenting the experimental procedure for the study of Example 4.

    [0126] FIGS. 13A and B. A, intraperitoneal glucose test tolerance; and B, glycemic index from the test.

    [0127] FIG. 14. Fasted insulinemia.

    EXAMPLES

    Example 1: Design of a Mouse Model of Periodontitis

    [0128] This example describes the production of a mouse model of periodontitis used by the inventors to design a vaccine for prevention of diabetes and obesity.

    Material and Methods

    [0129] Animals and experimental procedures. C57BI/6J wild-type (WT) (Charles River, L'Arbresle, France) female mice were group-housed (six mice per cage) in a specific pathogen-free controlled environment (inverted 12-hr daylight cycle, light off at 10:00 a.m.). Five week-old mice were randomized in 2 groups: group one was colonized (Co) and group two served as control. For group one, 1 ml of a mix of 10.sup.9 CFU of each periodonto-pathogen such as Porphyromonas gingivalis (Pg) ATCC 33277, Fusobacterium nucleatum (Fn) and Prevotella intermedia (Pi) in 2% carboxymethylcellulose was applied at the surface of the mandibular molar teeth, four times a week, during one month. Control mice received the vehicle only. Each group was divided in two subgroups and fed with either a normal chow (NC, energy content: 12% fat, 28% protein, and 60% carbohydrate; A04, Villemoisson-sur-Orge, France) or a diabetogenic, high-fat carbohydrate-free diet (HFD; energy content: 72% fat (corn oil and lard), 28% protein and less than 1% carbohydrate; SAFE, Augy, France) for 3 months. The groups were labelled as following: NC+vehicle (NC), NC+colonization (NC-Co), high-fat diet (HFD) and HFD+colonization (HFD-Co). All animal experimental procedures were approved by the local ethical committee of Rangueil University Hospital (Toulouse, France).

    [0130] Quantification of mandibular alveolar bone resorption. Hemi-mandibles were scanned using a high-resolution CT (Viva CT40; Scanco Medical, Bassersdorf, Switzerland). Data were acquired at 45 keV, with a 10.Math. isotropic voxel size. Six linear measurements were obtained from each molar by using a stereomicroscope with an onscreen computer-aided measurement package. The alveolar bone loss (mm) was measured from the cemento-enamel junction (CEJ) to the alveolar bone crest (ABC) for each molar. Three-dimensional reconstructions were generated from a set of 400 slices.

    [0131] Real-Time quantitative PCR (qPCR) analysis for periodontal tissue. Total RNA from periodontal tissue was extracted using the TriPure reagent (Roche, Basel, Switzerland). cDNA was synthesized using a reverse transcriptase (Applied Biosystems, Fost City, USA) from 1 9 of total RNA as described in Blasco-Baque et al. (2012) PLoS One 7:e48220. The primers (Eurogentec, San Diego, USA) used were (5 to 3): tumor necrosis factor- (TNF-), forward TGGGACAGTGACCTGGACTGT (SEQ ID NO: 1); reverse TCGGAAAGCCCATTTGAGT (SEQ ID NO: 2); Interleukin 1 (IL-I) forward TCGCTCAGGGTCACAAGAAA (SEQ ID NO: 3); reverse CATCAGAGGCAAGGAGGAAAAC (SEQ ID NO: 4); plasminogen activator inhibitor-1 (PAI-1) forward ACAGCCTTTGTCATCTCAGCC (SEQ ID NO: 5); reverse CCGAACCACAAAGAGAAAGGA (SEQ ID NO: 6) and interleukin (IL-6) forward ACAAGTCGGAGGCTTAATTACACAT (SEQ ID NO: 7); reverse TTGCCATTGCACAACTCTTTTC (SEQ ID NO: 8). The concentration of each mRNA was normalized for RNA loading against the ribosomal protein L1 9 (RPL 19) (forward GAAGGTCAAAGGGAATGTGTTCA (SEQ ID NO: 9); reverse CCTTGTCTGCCTTCAGCTTGT (SEQ ID NO: 10)) as an internal standard and the data were analysed according to the 2-.sup.AACT method, as described in Serino et al. (2011) PLoS One 6:e21 184.

    [0132] Intraperitoneal glucose-tolerance test (IPGTT) and in vivo glucose infusion rate. Six-hour fasted mice were injected with glucose into the peritoneal cavity (1 g/kg). Blood glucose was measured with a glucometer (Roche Diagnostics, Meylan, France) on 2 I of blood collected from the tip of the tail vein at 30, 0, 30, 60 and 90 min after the glucose injection. To assess insulin-sensitivity, a catheter was indwelled into the femoral vein as described in Cani et al. (2007) Diabetes 56:1761-1 772. After full recovery from the surgery and 6 hours of fasting, the whole body glucose utilization rate was evaluated in euglycemic/hyperinsulinemic conditions, as described in Cani et al. (2007) Diabetes 56:1 761-1772.

    [0133] Histological analyses. Hemi-Mandibles were excised, fixed in 4% paraformaldehyde for 48 hours and embedded in paraffin. Hemi-mandibles samples were cut with a microtome in the transverse direction following the main axis of tooth from coronal to apical. Then, sections (4 m thickness), were stained with hematoxylin/eosin. Immunohistological analyses were performed using primary antibodies against F4/80 (AbD Serotec, Colmar, France), CD3 (Spring Bioscience, Pleasanton USA) and CD45R (Bio-Rad Laboratoires, Manes-La-Coquette, France), and revealed by R.T.U. (Ready-to-Use) Vectastin Elite (Vector Laboratories, Burlingame, USA) and for diaminobenzidine (DAB) by ImmPACT DAB Substrate (Vector Laboratories, Burlingame, USA), to quantify the infiltration of immune cells. Slides were scanned with panoramic digital scanner 250 with Z-Stack function and the objective 40 (3DH ISTECH). The cells subpopulations counting was done with the Panoramic Viewer software (3DH ISTECH) and was carried into the Lamina propria gingivae and periodontal ligament on average surface 127000 m.sup.2 on each tissue section Five microscopic fields of 0.02 m.sup.2 were counted on each slide by two independent naive investigators.

    [0134] Surface staining and antibodies treatment of immune cells from cervical lymph-nodes, spleen and blood. Mononuclear cell suspensions were incubated for 15 min with anti-CD16/32 to block Fc receptors and then with antibodies, anti-CD4 APC (RMA4-5, eBioscience), CD8 V450 (53.6.7, BD Bioscience), anti-CD1 1 b APC-eFluor780 (M1/70, eBioscience), CD45 V500 (30F1 1, BD Bioscience), anti-CD19 FITC (1 D3, BD Bioscience) anti-TCR PerCP-Cy5.5 (H57, eBioscience) for 30 min on ice. LIV&DEAD Fixable Cell Stain Kit (Life technologies) was used to remove dead cells. All data were acquired using a digital flow cytometer (LSR II Fortessa, Becton Dickinson), and analyzed with FlowJo software (Tree Star).

    [0135] Plasma biochemical assays. 50 l of blood were sampled from the retro-orbital sinus in awake condition in six-hour-fasted mice. For insulin, the plasma was separated and frozen at 80 C. 10 l of plasma were used to determine insulin concentration with an Elisa kit (Mercodia, Uppsala, Sweden) following the manufacturer's instructions. Plasma cytokines concentration was determined by the MILLIPLEX MAP system (Luminex, Austin 12212 Technology Blvd. Austin, Tex. 78727 United States/Merck Millipore Headquarters 290 Concord Road Billerica, Mass. 01821).

    [0136] Statistical analysis. Results are presented as mean valuesSEM. One-way ANOVA followed by Tukey's post-test was used to assess inter-groups differences, except for the IPGTT, where two-way ANOVA followed by Bonferroni's post-test was applied. *P<0.05; **P<0.01; ***P<0.001 and ****P<0.0001 when compared to HFD, P<0.05; P<0.001 P<0.0001 when compared to NC and $P<0.05 when compared to NC-Co defined statistical significance. Statistical analyses were performed using Graph Pad Prism version 5.00 for Windows Vista (GraphPad Software, San Diego, Calif.).

    Results

    [0137] Porphyromonas gingivalis (Pg), Fusobacterium nucleatum (Fn) and Prevotella intermedia (Pi), periodontal pathogens, are drivers for the development of periodontitis in mice. Here, the inventors generated a unique mouse model. First, periodontitis was induced by colonizing five-week-old wild-type C57B16/J female mice with all three pathogens; then, mice were fed with a normal chow (NC) or a diabetogenic/not obesogenic high-fat diet (HFD) (FIG. 1A).

    [0138] The inventors validated this model by showing periodontal pathogens-induced mandibular alveolar bone loss, a feature of periodontitis, on NC. Moreover, this parameter was worsened on HFD (FIG. 1B). Then, the inventors studied the periodontal tissue looking for a putative inflammatory status. As shown in FIG. 1C, NC-fed colonized mice displayed a significant increased gene expression for all the analysed cytokines. Moreover, the pro-inflammatory effect due to TNF-a and PAI-1 was increased by HFD (FIG. 1C). Subsequently, given this evidence, the inventors analysed histological sections of hemi-mandibles. They showed by hematoxylin/eosin staining that cells infiltrated the periodontal tissue (FIG. 2) after the colonization with the periodontal pathogens under normal chow. In addition, they characterized the cell-types by immunostaining and showed that an increased macrophages (cells F4/80+), lymphocytes T (cells CD3+) and lymphocytes B (cells CD45+) number in the same experimental conditions. In response to the HFD treatment, the number of cells increased when compared to NC-fed mice. Eventually, in colonized HFD-fed mice the number of immune cells even further increased over that of NC, NC-Co, and HFD mice, showing the impact of the dietary treatment and of the colonization on the inflammatory process in periodontal tissue (FIG. 2).

    [0139] Next, to identify whether periodontitis and local inflammation may be associated with an impaired immune system, the inventors quantified local (cervical lymph-node) and systemic (spleen) adaptive and innate immune system cells. HFD-feeding increased the number of cells in both cervical lymph-node and spleen when compared to NC-fed mice. Interestingly, periodontitis blunted this increase only in HFD-fed mice (FIGS. 3A and 4A).

    [0140] In the latter, this variation was due to a strong reduction in the frequency of innate CD1 1 b+ cells (gating on CD3CD19CD11 CCD11 b+) in cervical lymph-nodes and spleen, whereas periodontitis increased the frequency of T and B lymphocytes (CD4+, CD8+ and CD19+) during HFD only (FIGS. 3B and 4B).

    [0141] To further explore the systemic effect of periodontitis, the inventors analysed immune cells in blood, where the above reported modifications were confirmed for all cell types and especially for dendritic cells (CD11 b+CD11 c+) and Innate CD11 b+CD11 c(FIG. 5). By contrast, periodontitis had no significant impact on any cell type whatever the tissue under normal chow (FIGS. 3-5). Indeed, the periodontal colonization increased the number of antibodies anti-PG on NC whereas the HFD treatment reduced IgG serum levels and antibodies anti-PG in colonized mice only (Table 1). Conversely, HFD increased IgG serum levels independently of colonization at both 2 and 3 months of treatment (Table 1). Moreover, the periodontitis increased blood IL-6 on HFD and decreased blood IFN-gamma concentrations on HFD and NC at 3 months (Table 1).

    TABLE-US-00001 TABLE 1 NC NC-Co HFD HFD-Co Param. 1 m 2 m 3 m 1 m 2 m 3 m 1 m 2 m 3 m 1 m 2 m 3 m Insul. 465 440 483 32 472 18 462 518 636 736 784 671 41# 732 836 17 11 33 18 35 57 109 62# 105#text missing or illegible when filed Lept. 741 583 760 940 626 384 626 20203 2347 2209 1177 3474 505 376 385 263 503 153 589 451 254 636#text missing or illegible when filed 418#text missing or illegible when filed 421#text missing or illegible when filed IgG 1411 1199 2836 1468 1360 2231 1690 3199 5933 991 2211 2362 82 73 857 91 388 561 522 1230 947 98text missing or illegible when filed 384text missing or illegible when filed 514text missing or illegible when filed IFN- 36 25 230 255 13 8 7 5 14 7 55 45 176 80 70 30 4 2text missing or illegible when filed 7 3text missing or illegible when filed 23 106 420 30text missing or illegible when filed IL-6 4 1 8 2 9 4 19 8 21 8 5 2 1 4 1 4 1 16 6text missing or illegible when filed 16 22 4text missing or illegible when filed 10 5text missing or illegible when filed IP10 73 17 108 138 25 100 33 87 13 95 0 81 18 93 12 100 19 96 15 110 18 126 7 17 RANTES 22 7 25 10 22 8 16 1 13 4 9 2 14 5 21 4 15 3 17 4 21 4 15 3 MIG 22 6 28 5 46 22 24 4 23 5 33 12 25 11 32 9 30 8 20 3 30 9 27 6 -PG 1.45 1.54 1.49 3.89 3.76 3.56 1.19 1.12 1.92 1.79 1.17 1.31 0.24 0.24 0.14 2.44 2.63 1.82 0.11 0.25 1.70 0.45# 0.27# 0.29# N = 6 per group: Data as mean SEM P < 0.05 when compared to HFD, P < 0.05 when compared to NC and #P < 0.05 when compared to NC-Co Param.: parameters 1 m: 1 month 2 m: 2 months 3 m: 3 months Insul: Insulinemia (pg/ml) Lept: Leptinemia (pg/ml) IgG (g/ml) IFN- (pg/ml) IL-6 (pg/ml) IP10 (pg/ml) RANTES (pg/ml) MIG (pg/ml) -PG: antibodies anti-PG (EI) text missing or illegible when filed indicates data missing or illegible when filed

    [0142] To demonstrate that periodontal pathogen-induced periodontitis may represent an aggravating risk factor for diet-induced metabolic diseases, the inventors characterized glucose metabolism in response to the nutritional stress. The data obtained show that periodontitis aggravated the HFD-induced glucose-intolerance by the first and up to the third month of treatment (FIGS. 6A, C, E). These data were associated with a progressive and significant increase in the fat/lean mass ratio (FIGS. 6B, D, F). Furthermore, according to the time course, periodontitis increased plasma leptin and insulin concentrations on HFD at 3 months (Table 1). Insulin-resistance (indexed by the glucose-infusion rate (GIR)), as assessed by the euglycemic/hyperinsulinemic clamp technique, was induced by the periodontitis in HFD-fed mice only (FIG. 7). Importantly, alveolar bone loss was strongly and significantly correlated (R.sup.2=0.52; P<0.0001) with insulin-resistance (FIG. 8).

    [0143] Altogether, these data show that periodontitis aggravates HFD-induced glucose-intolerance and insulin-resistance.

    Example 2: The Transfer of Cervical Lymph-Node Cells from Mice Models of Periodontitis to Naive Recipients Guards Against Periodontitis-Aggravated Metabolic Disease

    Materials and Methods

    [0144] Animals and experimental procedures. See example 1.

    [0145] Immunotherapy. Cervical lymph nodes were harvested both from mice colonized with bacteria mixture as described in Example 1, or not colonized. Cervical lymph node cells (10.sup.7 total) were injected into the peritoneal cavity from mice with periodontitis (PTC) or without (HTC) and intraperitoneal glucose-tolerance test (IPGTT) was assessed after transfer and after colonization by periodontal pathogens.

    [0146] Intraperitoneal glucose-tolerance test (IPGTT) and in vivo glucose infusion rate. See example 1.

    [0147] Statistical analysis. See example 1.

    Results

    [0148] To demonstrate that the adaptive immune system was triggered by the change in periodontal microbial ecology and was a causal mechanism responsible for the deleterious impact of the periodontal pathogens on metabolic disease, the inventors first transferred the cervical lymph-node cells from mice with or without periodontitis to healthy recipient mice (FIG. 9A). In such conditions the glucose-tolerance was similar in both groups of recipient mice, suggesting that another confounding factor was required to trigger the metabolic disease. Hence, the inventors challenged the recipient mice with the periodontal pathogens 6 weeks after the cell transfer (FIG. 9A) and demonstrated that the glucose-tolerance was improved in mice which received the immune cells from the infected mouse when compared to those which received immune cells from a non-infected mouse (FIG. 9B,C). Body weight gain was not significantly affected. The transfer of immune cells by itself, without colonizing the recipient mice, is not sufficient to impact on glucose tolerance (FIG. 9B,C). However glucose metabolism could be impacted when the immune cells were specifically adapted to the periodontal pathogens. This suggests that both nutritional stress and periodontitis are required factors to trigger metabolic phenotypes.

    Example 3: A Treatment with Inactivated Porphyromonas gingivalis Prior to the Periodontal Infection Induces Specific Antibodies Against Porphyromonas gingivalis and Protects the Mouse from Periodontitis-Induced Dysmetabolism

    Materials and Methods

    [0149] Animals and experimental procedures. See example 1.

    [0150] Immunization. An injection of 10.sup.6 CFU of Porphyromonas gingivalis, Fusobacterium nucleatum or Prevotella intermedia or the mix of the three bacteria, inactivated by oxygen-exposition during 48 hours, was given in the footpad muscle. Control mice were injected with saline. Then, periodontitis was induced (as described in Example 1) one month after the immunization in 3 months HFD-fed mice.

    [0151] Intraperitoneal glucose-tolerance test (IPGTT) and in vivo glucose infusion rate. See example 1.

    [0152] Anti-Porphyromonas gingivalis antibodies measurement. Immunoglobulin G antibodies specific to LPS of P. gingivalis were measured using a homemade ELISA. The wells of 96-well flat-bottom microtiter plates were coated in triplicates with LPS of P. gingivalis. After washing and blocking the plates, serum samples were added to individual wells and specific mouse IgG antibodies were detected with an alkaline phosphatase-conjugated anti-mouse immunoglobulin. The absorbance was read at 405 nm using an ELISA plate reader. The results were expressed as an ELISA index (EI), which was the mean OD 405 of a given serum sample divided by the mean OD 405 of the calibrator (reference serum) (Hitchon et al. (2010) J. Rheumatology 37: 1105-1112).

    [0153] Statistical analysis. See example 1.

    Results

    [0154] In a second set of experiments, to further validate the role of the adaptive immune system on the control of glucose-tolerance, the inventors immunized the lymphocytes to the periodontal pathogens by treating mice with different sets of inactivated periodontal pathogens (FIG. 10A). The intramuscular treatment with the three inactivated periodontal pathogens prevented the above reported aggravating effects of periodontitis on HFD-induced glucose-intolerance at 1 month (FIGS. 11 A-F), 2 months and 3 months (FIGS. 10B-F). Importantly, this preventive effect was due to Porphyromonas gingivalis since the treatment of the mice with this unique bacteria was sufficient to protect against periodontitis-induced metabolic diseases. Moreover, the specific treatment by Porphyromonas gingivalis prevented the decreased of antibodies anti-Pg observed on HFD after periodontal colonization at 1 and 3 months (FIGS. 11 G and 10G). At 3 months of HFD, the treatment by PG protected against the periodontal colonization-induced alveolar bone loss in periodontal tissue (FIG. 10H).

    Example 4

    [0155] This example provides experimental results confirming that a vaccine composition comprising attenuated P. gingivalis enables treating diabetes in patients. The mouse model used which comprises administering (feeding) a diabetogenic high-fat carbohydrate-free diet is an accepted model for diabetes.

    Materials and Methods

    [0156] The scheme presented in FIG. 12 shows the procedure used in the experiments.

    Immunization

    [0157] After 3 months of a high fat diet (FWD), an injection of 10.sup.6 CFU of Porphyromonas gingivalis (Pg), or a mix of the three bacteria Porphyromonas gingivalis (Pg), Fusobacterium nucleatum (Fn) and Prevotella intermedia (Pi), inactivated by oxygen-exposition over 48 hours, was given in the 10 footpad muscle. Control mice were injected with saline. Then, mice were fed again over 2 months to monitor diabetic parameters and insulinemia, in particular using the intra-peritoneal glucose-tolerance test (IPGTT) and the in vivo glucose infusion rate.

    Results

    [0158] Intramuscular treatment with the three inactivated periodontal pathogens or with only inactivated Pg decreased glucose intolerance (FIGS. 13A and B) and insulinemia (FIG. 14) in mice in which diabetes had been induced by the high fat diet.