EFFICIENT AND RAPID SPECIFICATION OF SPINAL NEURONAL SUBTYPES FROM HUMAN PLURIPOTENT STEM CELLS
20230416675 · 2023-12-28
Inventors
- Stéphane NEDELEC (Paris, FR)
- Cécile MARTINAT (Corbeil-Essones, FR)
- Vincent MOUILLEAU (Le Poirè-sur-Vie, FR)
- Célia VASLIN (Paris, FR)
Cpc classification
C12N2501/119
CHEMISTRY; METALLURGY
C12N2501/16
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2501/41
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to the targeted engineering of specific cell populations. Motoneurons (MN) subtypes display differential vulnerabilities in diseases and in spinal injuries. Engineered MNs of specific rostro-caudal identity represent an important resource for cell therapy approaches. However, these strategies remain impeded by slow and inefficient targeted differentiations due to the imprecise control over cell fate specification in vitro. The inventors now used an embryoid body-based differentiation of hPSC and showed that the HOX clock expression can be controlled to generate subtypes of spinal MNs. Thus, the present invention relates to an in vitro or an ex vivo method for producing spinal neuronal subtypes comprising exposing axial progenitors to retinoic acid (RA), an agonist of Hedgehog signalling pathway, and optionally a FGFR agonist and/or an activator of the TGF pathway, wherein more and more caudal motor neurons identities are obtained by delayed exposure to RA and/or by exposure to RA in combination with the FGFR agonist and/or the activator of the TGF pathway.
Claims
1-13. (canceled)
14. An in vitro, or an ex vivo method for controlling rostro-caudal identity of human neuron subpopulations comprising culturing axial progenitors in a culture medium comprising retinoic acid (RA), a Hedgehog signalling pathway agonist, and optionally a fibroblast growth factor receptor (FGFR) agonist or a transforming growth factor (TGF)/activin/nodal signalling pathway activator, thereby obtaining spinal motor neuron progenitors, wherein more and more caudal motor neurons identities are obtained by delayed addition of the retinoic acid in the culture medium, or by addition of the retinoic acid in combination with the FGFR agonist or the TGF/activin/nodal signalling pathway activator.
15. The method according to claim 14 further comprising: exposing human pluripotent stem cells (hPSCs) in a culture medium comprising a Wnt signalling pathway activator to obtain the axial progenitors, and exposing the axial progenitors to the RA and the Hedgehog signalling pathway agonist, optionally combined with the FGFR agonist or the TGF/activin/nodal signalling pathway activator in the culture medium to obtain spinal motor neuron progenitors, wherein more and more caudal motor neuron identities are generated either by delaying the exposure of the axial progenitors to the RA with regard to the exposure to the Wnt signalling pathway activator or by exposing the axial progenitors to the RA in combination with an increased concentration of or an increased duration of exposure to the FGFR agonist or the TGF/activin/nodal signalling pathway activator.
16. The method according to claim 14 further comprising: exposing the spinal motor neuron progenitors to a notch pathway inhibitor in the culture medium.
17. The method of claim 15, wherein the human pluripotent stem cells (hPSCs) are exposed to the Wnt signalling pathway activator in combination with a Bone Morphogenetic Protein (BMP) signalling pathway inhibitor, and the TGF/activin/nodal signalling pathway inhibitor.
18. The method of claim 17, wherein: the BMP signalling pathway inhibitor, the TGF/activin/nodal signalling pathway inhibitor, and the Wnt signalling pathway activator are added in the culture medium starting from DO until D3 or D4, the sonic Hedgehog signalling pathway agonist is added to the culture medium starting from D3 to D7 and until D9 or D10, and optionally a notch pathway inhibitor is added between D9 and D14.
19. The method of claim 14, wherein caudal thoracic and lumbar motor neurons are obtained by exposing the axial progenitors to the RA, the FGFR agonist and the TGF/activin/nodal signalling pathway activator.
20. The method of claim 14, wherein the FGFR agonist is added to the culture medium at a concentration of at least 15 ng/ml for a period of time of at least 24 hours and the TGF/activin/nodal signalling pathway activator is added to the culture medium at a concentration of at least 20 ng/ml for a period of time of at least 24 hours.
21. The method of claim 14 wherein the RA is added to the culture medium for a period of 2 to 11 days.
22. The method of claim 14, wherein: brachial motor neurons are obtained by addition to the culture medium of the RA alone between D4 and D9 or by addition to the culture medium of RA between D3 and D9 and the FGFR agonist or the TGF/activin/nodal signalling pathway activator between D3 and D4, respectively, at a concentration of at least 100 ng/ml or at least 20 ng/ml, respectively; anterior thoracic motor neurons are obtained by addition to the culture medium of the RA alone starting from D5 or until D9, or by addition to the culture medium of the RA between D3 and D9 and the FGFR agonist at a concentration of at least 60 ng or the TGF/activin/nodal signalling pathway activator at a concentration of at least 20 ng/ml, respectively, between 24 to 48 hours before addition of the RA to the culture medium, caudal thoracic motor neurons are obtained by addition to the culture medium of the RA between D3 and D9 and the FGFR agonist at a concentration of at least 100 ng/ml and the TGF/activin/nodal signalling pathway activator at a concentration of at least 20 ng/ml between D3 and D4 of; and lumbar motor neurons are obtained by addition to the culture medium of the RA between D5 and D9 and the FGFR agonist at a concentration of at least 100 ng/ml and the TGF/activin/nodal signalling pathway activator at a concentration of at least 20 ng/ml, respectively, between D3 or D4 and D5.
23. The method of claim 14, wherein the FGFR agonist is FGFR2.
24. The method of claim 14, wherein the sonic Hedgehog signalling pathway agonist is Smoothened Agonist (SAG).
25. The method of claim 24 wherein the sonic Hedgehog signalling pathway agonist is SAG at a concentration of at least 300 nM.
26. The method of claim 16, wherein the notch pathway inhibitor is DAPT.
27. The method of claim 26 wherein the notch pathway inhibitor is DAPT at a concentration of at least 5 M.
28. The method of claim 15, wherein the Wnt signalling pathway activator is a Chir-99021 compound or a Wnt3a protein.
29. The method of claim 14, wherein the TGF/activin/nodal signalling pathway activator is GDF11 or GDF8.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0197]
[0198] (A) Schematic summary of data in
[0199]
[0200] (A) Experimental design. (B) 20 most enriched genes in D2 progenitors versus hESC. Progenitors acquired a transcriptomic signature similar to the one of murine axial progenitors. (C) Fold enrichment in D3 progenitors versus hESC of the 20 most enriched neuromesodermal progenitor (NMP) genes defined in (Gouti et al., 2017). (D) Immunostaining for axial progenitor markers on hiPS-derived D2 and D3 progenitors (WTS2 line). Cells co-express the three markers. Scale bars: 40 m. (E) Temporal transcriptional changes in HOX genes coding for HOX regionally expressed in human MNs in vivo. (F) Reactome pathway analysis of the 232 genes upregulated 2-fold (p-value<0.05) between D3 and D2. Y axis: FDR=false discovery rate. X axis=enrichment score calculated for a given Reactome pathway. (G) Temporal evolution of upregulated MAPK target genes and FGF ligands in aging axial progenitors. ETV5 is a transcription factor activated by ERK1/2 MAPK in many other systems. The other genes encode feedback negative regulators of MAPK pathways. All data are shown as meanSD. (H) Schematic representation of the transcriptional and immunostaining analysis of day 2 and 3 progenitors.
[0201]
[0202] (A) Differentiation conditions. PD173074 (FGFR1-3 inhibitor) or PD032590 (MEK1/2 inhibitor) were added at D3 up to D7. (B) Proportion of MNs (ISL1+ cells) in the different conditions (meanSD). (C) Immunostaining for ISL1 (MNs) and HOX transcription factors on cryostat sections of embryoid bodies on day 14 of differentiation. MEK and FGFR inhibitors prevent the specification of HOXC8 and HOXC9 MNs. Instead, HOXA5, HOXC6 MNs are generated. Scale bar: 100 m. (C) Quantification of HOXC6 and HOXC9 MNs on day 14 of differentiation. (D) Real time PCR analysis of HOX mRNAs in progenitors at D3, D4 and D5 of differentiation. MEK and FGFR inhibitors prevent the temporal increase in caudal HOX expression. Data are shown as meanSD; Each circle is an independent experiment. * if P0.05, ** if P0.01 and *** if P0.001.
[0203]
[0204] (A) Differentiation conditions. Extrinsic cues, FGF2, GDF11, or FGF2+GDF11 were added on day 3 of differentiation at various concentrations or for different durations (B) Immunostaining for HOX on cryostat sections of embryoid bodies on day 14 of differentiation. FGF2, GDF11 and FGF2/GDF11 induce more caudal MN subtypes. Scale bar: 100 m. (C, D, E) Proportion of MNs (ISL1+ cells) expressing the indicated markers. The effect of the duration of FGF2 treatment (C), FGF2 concentration (D) and duration of GDF11 or FGF2+GDF11 (E) were monitored. (F) Real time quantitative PCR analysis of the expression of HOX genes regionally expressed in human MNs in vivo. HOX mRNAs were monitored at D4 (24 h post-treatment) and D5 (48 h post-treatment) upon addition of FGF2, GDF11 or a combination of FGF2 (120 ng/ml) together with GDF11 (25 ng/ml). Data is normalized at each time point to the control condition treated with only RA at day 3. Data are shown as meanSD. Each circle is an independent experiment. * if P0.05, ** if P0.01 and *** if P0.001. See also
RESULTS
[0205] Materials and Methods
[0206] Human Embryonic Spinal Cord Histology
[0207] Human fetal embryo of 6.3 weeks of gestation were obtained from pregnant women referred to the Department of Gynecology and Obstetrics at the Antoine Bclre hospital (Clamart, France) for legally induced abortions in the first trimester of pregnancy as previously described (Lambrot et al., 2006). All women provided written informed consent for scientific use of the fetal tissues. None of the abortions were due to fetal abnormality. The fetal age was determined by measuring the length of limbs and feet (Evtouchenko et al., 1996). The project was approved by the local Medical Ethics Committee and by the French Biomedicine Agency (reference number PFS 12-002). Alternatively, Human embryonic spinal cords (n=2) at stage 7.5 weeks of gestation were collected in accordance with the national guidelines of the United States (National Institutes of Health, U.S. Food and Drug Administration) and the State of New York and under Columbia University institutionally approved ethical guidelines relating to anonymous tissue. The material was obtained after elective abortions and was classified on the basis of external morphology according to the Carnegie stages. Gestational age was determined by last menstrual period of the patient or by ultrasound, if the ultrasound estimate differed by 1 week as indicated by the obstetrician. In all cases, the spinal cord was removed as intact as possible before fixation with fresh, cold 4% PFA for 1.5 h on ice washed abundantly with PBS and then cryoprotected overnight in 30% sucrose. Post-fixation, the cord was measured and cut into anatomical sections to accommodate embedding in OCT Compound (Leica) and stored at 80 C. before cutting on a cryostat. Sections (16 m) were cut along the full length of the cord.
[0208] Human Pluripotent Stem Cell Lines
[0209] Human SA001 embryonic stem cell (ESC) line (male, RRID: CVCL_B347) was obtained from Cellectis and used accordingly to the French current legislation (Agency of Biomedicine, authorization number AFSB1530532S). Induced pluripotent stem cell (iPSC) line WTSIi002 (male, RRID: CVCL_AH30, alternative name HPSIO913i-eika_2) was obtained from the European Bank for Pluripotent Stem Cells (EBISC). WTC-mEGFP-Safe harbor locus (AAVS1)-c16 produced by the Allen cell institute was obtained from Coriell (Cat #AICS-0036-006, male, RRID:CVCL_JM19). were obtained from the European Bank for Pluripotent Stem Cells (EBISC). Experiments with iPSCs were approved by relevant ethic committees (declaration DC-2015-2559). All PSC lines were cultured at 37 C. on Matrigel (Corning) in mTSER1 medium (Stem Cell Technologies) and amplified using EDTA (Life Technologies) clump-based passaging. They were tested for potential mycoplasma contamination every other week (MycoAlert Mycoplasma Detection Kit, Lonza, LT07-118). No contamination was detected during the study. PSC were thawed in presence of Y-27632 (10 M, Stemgent or Stem Cell Technologies) and the culture media was changed every day.
[0210] Human Pluripotent Stem Cell Differentiation
[0211] Human PSC embryoid body-based differentiation was performed as previously described (Maury et al., 2015). hPSC were dissociated with cold Accutase (Life Technologies) for 3 to 5 min at 37 C. and resuspended in differentiation medium N2B27 (Advanced DMEM F12, Neurobasal vol:vol (Life Technologies)), supplemented with N2 (Life Technologies), B27 without Vitamin A (Life technologies), penicillin/streptomycin 1%, -Mercaptothanol 0.1% (Life Technologies), with Y-27632 (10 M, Stemgent or Stem Cell Technologies), CHIR-99021 (3 M or 4 M Selleckchem) SB431542 (20 M, Selleckchem) and LDN 193189 (0.1 M, Selleckchem). 210.sup.5 cells ml.sup.1 were seeded in ultra-low attachment 6 well plates (Corning) to form embryoid bodies (EBs). All conditions of differentiation received the same medium at day 2 and at day 3 but SB431542 was removed at day 3. Then, the differentiation proceeded according to the schemas presented above the figures. SAG (Smoothened Agonist, Merck millipore), FGF2 (Recombinant Human FGF basic, Peprotech), RA (Sigma-Aldrich), GDF11 (Recombinant Human/Murine/Rat GDF11, Peprotech), PD0325901 (Selleckchem), PD173074, SCH772984 (Selleckchem), DAPT (Stemgent) were added at indicated time points. For concentrations see Table S2. Media were changed every other day unless specified.
[0212] Embryoid Body Processing for Immunostaining
[0213] EBs were collected, rinsed with PBS then fixed with 4% PFA for 5 min at 4 C. and rinsed with PBS 3 times for 5 min. EBs were cryoprotected with 30% sucrose and embedded in OCT (Leica) prior sectioning with a cryostat. Alternatively, day 2, 3 and 4 progenitors were plated on Matrigel (Corning, diluted according to manufacturer recommendation) coated coverslips and let to adhere between for 30 min prior fixation with 4% PFA for 5 min at 4 C.
[0214] Immunostaining
[0215] All immunostainings were performed as follow: cells or sections were incubated with a saturation solution (PBS/FBS 10%/0.2% Triton) for 10 minutes. Primary antibodies (Table S3) were diluted in staining solution (PBS/2% FBS/0.2% Triton) and incubated overnight at 4 C. in a humidified chamber. Following 4 PBS washes (10 min each), secondary antibodies (Alexa488, Alexa568 and Alexa647, Life Technologies, 1:1,000) were added for 1 h at RT. After 3 PBS washes, DAPI was added on the cells (Invitrogen, 1:3,000) for 5 min. Cells or slices were then mounted in Fluoromount (Sigma Aldrich or Cliniscience).
[0216] Image Acquisition
[0217] Samples were visualized and imaged using either a ZEISS LSM 880 Confocal Laser Scanning Microscope (Carl Zeiss Microscopy) controlled by Zen black software (Zeiss), a confocal microscope TCS SP5 II (Leica) or a DM6000 microscope (Leica) equipped with CoolSNAP EZ CDD camera, controlled by MetaMorph software (MetaMorph Inc). Alternatively, images were acquired using the automated microscope Cell Discoverer 7 (Zeiss), equipped with an Axiocam 506 m camera, with Zen black software (Zeiss).
[0218] Quantitative RT-PCR Analysis
[0219] Total RNA were extracted (RNAeasy Plus Mini Kit, Qiagen) and cDNA synthesized using SuperScript III (Invitrogen). Quantitative real-time PCR was performed using a 7900HT fast real time PCR system (Applied Biosystems) with Sybr Green PCR Master Mix (Applied Biosystems). Alternatively performed using QuantStudio 5 Real-Time PCR System (Thermofisher Scientific) and a mix with qPCR Brilliant II SYBR MM with low ROX (Agilent). Primers are listed in Supplementary Table 3. All expression data were normalized to Cyclophilin A mRNA. All analyses were performed with three technical replicates per plate. Relative expression levels were determined by calculating 2-Ct.
[0220] Transcriptomic Analysis
[0221] hESC were collected post dissociation and prior exposure to differentiation medium. Progenitors were collected on day 2, day 3 and day 4 of differentiation. For each of the 8 samples, total RNA were extracted then reverse transcribed using the Ion AmpliSeq Transcriptome Human Gene Expression kit (Thermofisher Scientific). The cDNA libraries were amplified and barcoded using Ion AmpliSeq Transcriptome Human Gene Expression core panel and Ion Xpress Barcode Adapter (Thermofisher Scientific). The amplicons were quantified using Agilent High Sensitivity DNA kit before the samples were pooled in sets of eight. Emulsion PCR and Enrichment was performed on the Ion OT2 system Instrument using the Ion PI Hi-Q OT2 200 kit (Thermofisher Scientific). Samples were loaded on an Ion PI v3 Chip and sequenced on the Ion Proton System using Ion PI Hi-Q sequencing 200 kit chemistry (200 bp read length; Thermofisher Scientific). The Ion Proton reads (FASTQ files) were imported into the RNA-seq pipeline of Partek Flow software (v6 Partek Inc) using hg19 as a reference genome. The number of reads per sample was ranging from 7.5 million to 12 million reads. To determine genes that are differentially expressed between groups mapped reads were quantified using Partek E/M algorithm normalized by the Total count/sample (the resulting counts represent the gene expression levels on reads/millions for over 20,800 different genes present in the AmpliSeq Human Gene Expression panel). The evaluation of the differential expression between two conditions was performed using the EdgeR package under R. Pathway enrichment analyses were performed on upregulated genes (FC2.0, p-value<0.05) between two time points by interrogating Reactome database. Significant enrichments were calculated using hypergeometrical test and Benjamini-Hochberg correction for multiple comparisons. The enrichment score was calculated as described in (Wang et al., 2017).
[0222] The normalized transcriptomic data are provided in Table S1. Raw data are available upon request.
[0223] Quantification and Statistical Analysis
[0224] All statistics were computed using Graphpad Prism software. One-way analysis of variance (ANOVA) with a Kruskall-Wallis post hoc analysis were performed following normality tests provided by Prism. Number of n, dispersion measures and P-values are indicated in figure legends. In all figures, n are independent differentiations started from independent newly thawed hPSCs vials. For each condition at least 4 independent EBs were imaged in which all the cells were quantified by automated image analysis. The images were exported and saved as TIFF with Fiji if needed (Schindelin et al., 2012). Quantitative analyses on images were performed using the CellProfiler software (Carpenter et al., 2006) (Broad Institute open source at www.cellprofiler.org). DAPI stained nucleus were segmented into primary objects using CellProfiler segmentation pipeline and the nuclear mask was used to define objects on the target channels. The threshold to define positive nuclei for a given target was obtained using EBs' section negative for the target of interest. All images across conditions were then automatically analyzed in batch ensuring unbiased analysis. The analyses of the FOXP1 and SCIP immunostaining intensity were performed combining CellProfiler with the software FCS express 7 (DeNovo Software, Glendale, CA, USA). Nuclei were segmented into primary objects as described above and FOXP1 and SCIP fluorescence intensities were calculated in each primary object. Fluorescence intensity plots for FOXP1 and SCIP were then generated using FCS express 7 software to visualize the intensity levels of the different markers for each individual cells and determine the percentage of cells above a given threshold. Cell profiler pipelines for quantification are available upon request.
[0225] Results
[0226] HOX Expression Profiles and Motor Neuron Subtypes in Human Embryonic Spinal Cord
[0227] The differential expression of HOX transcription factors along the vertebrate spinal cord is a major product of HOX gene regulation. In spinal motor neurons, this Hox code orchestrates the specification of subtype specific features controlling the formation of locomotor circuits (Dasen, 2017; Philippidou and Dasen, 2013). Whether the spinal HOX code and associated MN subtypes is conserved in human remains unknown preventing faithful assessment of HOX regulation and its link with cell rostro-caudal identity during hPSC differentiation. We thus mapped, in human embryos at 6.3 and 7.5 weeks of development, 7 HOX transcription factors that display collinear expression patterns and instruct MN subtype specification in mouse and chick (Philippidou and Dasen, 2013) (
[0228] Overall, HOX transcription factors are regionally expressed along the rostro-caudal axis of the human spinal cord. Within these different HOX domains, distinct MN subtypes, identifiable by combination of transcription factors, are generated at stereotyped positions. This data provided readouts to assess the mechanisms regulating HOX expression in axial progenitors and their impact on cell type specification during hPSC differentiation.
[0229] Aging Axial Progenitors Generate More Caudal Neuronal Subtypes
[0230] We first sought to test whether axial progenitors (i.e. progenitors competent to generate caudal cell types of distinct rostro-caudal identities) could be generated using 3D differentiation of human embryonic stem cells (hESC) by monitoring MN subtype specification. We previously reported sequences of extrinsic cues leading to the targeted generation of spinal MNs from human PSCs through a putative axial progenitor stage (Maury et al., 2015). Exposure of embryoid bodies (EBs) to a Wnt pathway agonist (CHIR99021) and inhibitors of BMP and TGF pathways (SB431542 and LDN193189) generated progenitors that expressed CDX2, a marker of axial progenitors and a regulator of caudal HOX gene induction (Bel-Vialar et al., 2002; Bialecka et al., 2010; Gouti et al., 2014; Maury et al., 2015; Mazzoni et al., 2013; Neijts et al., 2017). Spinal MNs (70% of the cells in average) were generated upon exposure, at day 2 or 4, to Retinoic acid (RA) and an agonist of the sonic hedgehog pathway (SAG) which respectively promotes neurogenesis and guides axial progenitors towards a ventral MN fate (Briscoe and Novitch, 2008; Maury et al., 2015; Ribes et al., 2009). Here, we assessed the rostro-caudal identity of MNs produced in these conditions (
[0231] Overall, Wnt activation combined to TGF-/BMP pathway inhibition converts hPSC into progenitors competent to generate progenies expressing distinct HOX combinations and t found at different rostro-caudal positions in human embryos. Hence, these progenitors qualify as axial progenitors. The duration of the time window between Wnt and RA establishes the final positional identity of the progenies.
[0232] Parallel Induction of Caudal HOX Genes and FGF Target Genes in Aging Axial Progenitors
[0233] Then, we sought to determine the molecular changes occurring over time in aging axial progenitors, prior to RA exposure. We performed a comparative transcriptomic analysis of hESC and hESC-derived axial progenitors on day 2, 3 and 4 of differentiation (
[0234] Then, comparative analysis of the transcriptome of aging progenitors indicated a temporal collinear activation of HOX genes that display regionalized expression patterns in the spinal cord. At D2, the progenitors expressed HOXA5 and low level of HOXC6, which belongs to the 3 half of HOX complexes with anterior borders of expression in the anterior spinal cord (
[0235] To define the pathways activated in parallel with the sequential induction of HOX genes, we performed a pathway analysis on the genes increased more than 2 fold (p<0.05) between D2 and D3. Among the 232 genes, we detected an enrichment for annotations associated with an activation of the Mitogen-activated protein kinases (MAPK) pathways due to a gradual increase in expression of typical MAPK target genes (ETV5, DUSP4, DUSP6, IL17DR or SPRY2) (
[0236] Hence, the sequential collinear expression of HOX genes is paralleled by an increase in expression of FGF ligands and MAPK target genes within axial progenitors. As FGFs promote caudal Hox genes in other systems (Bel-Vialar et al., 2002; Dasen et al., 2003; Liu et al., 2001), we postulated that paracrine or autocrine FGF signaling might be triggering the sequential induction of HOX genes.
[0237] FGF Signaling is Required for HOX Sequential Activation and Caudal MN Specification
[0238] We aimed at testing whether endogenous FGF signaling was necessary for the temporal shift in axial progenitor rostro-caudal potential and HOX gene induction. For that, we blocked FGF signaling in aging progenitors prior RA exposure and tested the impact on caudal HOX gene induction and MN subtype specification. We exposed progenitors from D3 to D7 to i) PD173074, a selective FGFR1/3 antagonist or ii) PD0325901 which inhibits the MAPK kinase MEK1/2 (
[0239] FGF Level Paces the HOX Clock and MN Subtype Specification
[0240] To test whether the level of environmental FGF paces the HOX clock, we exposed early D3 progenitors, to RA/SAG together with FGF2 at different concentrations and for different durations. In all conditions that received FGF2, more caudal MN identities were induced without the need of delaying RA addition (
[0241] To determine whether this caudalizing effect was underlined by an accelerated induction of brachial and thoracic HOX genes we performed real-time PCR analysis 24 h and 48 h post FGF2 treatment. We observed a precocious increase in HOXC8, HOXC9, HOXD9 and HOXC10 expression compared to RA/SAG controls (
[0242] Hence, a precocious increase in FGF signaling accelerates the induction of caudal HOX genes in early axial progenitors resulting in the specification of more caudal cell types within the same differentiation timeline (14 days). These results demonstrate that the levels or duration of FGF signaling dynamically pace the tempo of HOX collinear activation during human axial progenitor differentiation.
[0243] FGF and GDF11 Synergize to Further Accelerate the HOX Clock
[0244] FGF2 accelerated HOX induction to generate MNs up to the mid-thoracic level suggesting that early axial progenitors might not be competent to generate more caudal segments. Alternatively, other extrinsic factors might be required to further accelerate the induction of HOX genes and promote more caudal identities. GDF11 is a member of the TGF family implicated in the control of axial elongation, MN subtype specification and is required for the expression of the most 5 HOX gene starting from the 10 paralogs in vivo and in vitro in late NMP-like cells (Aires et al., 2019; Gaunt et al., 2013; Lippmann et al., 2015; Liu, 2006; Liu et al., 2001; McPherron et al., 1999; Peljto et al., 2010). We exposed D3 early progenitors to a combination of RA and GDF11 (25 ng/ml) for 24 h or 48 h. 24 h GDF11 induced caudal brachial and anterior thoracic MNs (58.7% HOXC8, 41.0% HOXC9); the latest category increasing after 48 h (
[0245] Hence, axial progenitors are competent to produce the different spinal rostro-caudal identities from brachial to lumbar. Changes in parameters of exposure to FGFs and GDF1 1 (concentrations, durations and combinations) dynamically pace the speed at which the HOX clock proceed resulting in the specification of early or later born MN subtypes within the same timeline of differentiation.
[0246] Table S1Transcriptomic Data and List of Markers Defining Axial Progenitors and Other Developmentally Related Cell Types
[0247] The first panel displays the normalized number of reads for each gene for hESC, D2, D3 and D4 replicates. The following panels display the list of genes enriched (FC2.0, p-value<0.05) in the indicated comparison. The last panel displays the list of genes that identify specific cell types (allantois, mesodermal progenitors) and the references used to construct these lists.
TABLE-US-00003 TABLE S2 Growth factors and small molecules. Molecule Concentration Supplier Reference Y-27632 (2HCl) 10 M Stemgent 04-0012-H-10; CAS: 146986-50-7 Y-27632 (2HCl) 10 M Stem Cell 72304; Technologies CAS: 129830-38-2 RA 100 nM Sigma-Aldrich R2625; CAS: 302-79-4 LDN193189 100 nM Stemgent STE04-0074; CAS: 1062368-24-4 SB431542 20 M Stemgent STE04-0010-10; CAS: 301836-41-9 CHIR99021 3 or 4 M Selleckchem S1263; CAS: (CT99021) 252917-06-9 SAG 500 nM Merk 566660; CAS: 364590-63-6 SCH772984 100 nM Selleckchem S7101; CAS: 942183-80-4 PD173074 100 nM Selleckchem S1264; CAS: 219580-11-7 PD0325901 5 M Selleckchem S1036; CAS: 391210-10-9 Recombinant 15-120 ng/ml Peprotech 100-18B, Human FGF accession Number: basic (FGF2) P09038 Recombinant 120 ng/ml Peprotech 100-25; accession Human/Murine Number: P55075 FGF-8b Recombinant 10-50 ng/ml Peprotech 120-11; Accession Human/Murine/ number: O95390 Rat GDF-11 DAPT 10 M Stemgent STE04-0041 CAS: 208255-80-5
TABLE-US-00004 TABLE S3 Antibodies. HOST Target species Dilution References Provider CDX2 Rabbit 1:1000 AB76541 Abcam RRID: AB_1523334 FOXP1 Rabbit 1:32000 AB16645 Abcam RRID: AB_732428 FOXP1 Mouse 1:3000 MAB45341 R&D systems RRID: AB_2107101 HB9 Mouse 1:50 81.5C10 DSHB RRID: AB_2145209 HOXA5 Rabbit 1:1000 ARP31447_P050 Sigma-Aldrich RRID: AB_2046241 HOXA5 Guinea pig 1:1000 Cu570 H. Wichterle HOXC5 Rabbit 1:1000 HPA026794 Sigma-Aldrich RRID: AB_10612118 HOXC6 Rabbit 1:8000 ARP38484_P50 Euromedex RRID: AB_10866814 HOXC8 Mouse 1:10000 BLE920502 Biolegend HOXC9 Guinea pig 1:300 J. Dasen HOXD9 Rabbit 1:1500 SC-8320 Santa-Cruz HOXC10 Rabbit 1:800 HPA053919 Sigma-Aldrich RRID: AB_2682308 HuC/D Rabbit 1:500 A21271 Invitrogen RRID: AB_221448 ISL1 Goat 1:1000 GT15051 Neuromics RRID: AB_2126323 NEUROFILAMENT Chicken 1:500 CH22105 Neuromics RRID: AB_2737102 SCIP Rabbit 1:1000 AB126746 Abcam RRID: AB_11130256 SOX2 Mouse 1:200 AB79351 Abcam RRID: AB_10710406 TBXT/BRACHURY Goat 1:800 AF2085 R&D systems RRID: AB_2200235 Tested antibodies with no staining or unspecific one HOXC8 Mouse sc-517007 Santa Cruz HOXC9 Rabbit ARP35813 (Middle Aviva Sytems region) Biology RRID: AB_938161 HOXC9 Rabbit H2041 n-terminal Sigma-Aldrich region RRID: AB_10603946 HOXC9 Rabbit H1916 Sigma-Aldrich RRID: AB_10604162 HOXC10 Mouse 5G12-10 supernatant DSHB RRID: AB_528286
TABLE-US-00005 TABLES4 RealtimePCRPrimers. PrimerSequences TargetedGene CCCACCGTGTTCTTCGACAT CYCLOA CCAGTGCTCAGAGCACGAAA CYCLOA GGAGATCATAGTTCCGTGAGC HOXA5 GCTGAGATCCATGCCATTGT HOXA5 CCGCCACAGATTTACCCGT HOXC5 AGTCTGGTAGCGCGTGTAAC HOXC5 CCAGGACCAGAAAGCCAGTA HOXC6 GTTAGGTAGCGATTGAAGTGAAA HOXC6 CCTCCGCCAACACTAACAGT HOXC8 CAAGGTCTGATACCGGCTGT HOXC8 ACCTCCTAGCGTCCAGGTTT HOXC9 CGAAGCTACAGGACGGAAA HOXC9 TCGCTGAAGGAGGAGGAGA HOXD9 CAAACACCCACAAAGGAAAAC HOXD9 ACCTCGGATAACGAAGCGAAA HOXC10 TCCAGCGTCTGGTGTTTAGT HOXC10 GAACCTGTGCGAGTGGATG CDX2 GGATGGTGATGTAGCGACTG CDX2 TCTTTGCTTGGGAAATCCG PAX6 CTGCCCGTTCAACATCCTTAG PAX6 GATGCACAACTCGGAGATCA SOX1 GTCCTTCTTGAGCAGCGTCT SOX1
DISCUSSION
[0248] Overall, we report the selective generation of axial progenitors from hPSCs demonstrated by combination of specific markers, detailed transcriptomic analysis and their ability to generate cell types found at distinct rostro-caudal levels. Importantly, we observed line to line differences in the optimal concentration of CHIR necessary to potently induce an axial progenitor state for the subsequent reliable induction of caudal cell types. With efficient access to axial progenitors we then show that changes in the concentration, duration and combination of the caudalizing factors FGFs and GDF1 1 control the speed at which the temporal collinear activation of HOX genes occurs. The pace of the HOX clock is thus dynamically encoded by the parameters of exposure to extrinsic cues. The sequential changes in chromatin structure occurring along HOX complexes during their activation do not appear to act as an intrinsic timer actuated and stopped by extrinsic factors (Bel-Vialar et al., 2002; Del Corral and Storey, 2004; Kimelman and Martin, 2012; Lippmann et al., 2015; Mazzoni et al., 2013; Narendra et al., 2015; Noordermeer et al., 2011; Noordermeer et al., 2014; Soshnikova and Duboule, 2009; Tschopp et al., 2009). Our results might provide a molecular basis for the observation that heterochronic grafting of old axial progenitors to a younger caudal stem zone reverted their HOX profile to the young one (McGrew et al., 2008; Wymeersch et al., 2019). The pacing of the HOX clock by secreted factors might ensure a community effect to synchronize HOX expression between neighboring progenitors which could allow the emergence of expression domains at tissue level (Durston, 2019). Furthermore, FGFs and GDFs also control the maintenance of the stem cell pool and axial elongation (Aires et al., 2019; Boulet and Capecchi, 2012; Jurberg et al., 2013; Mallo et al., 2009; McPherron et al., 1999). A common mechanism to control rostro-caudal extension of the body axis together with Hox gene induction would be a parsimonious way to couple morphogenesis and patterning (Denans et al., 2015; Young et al., 2009). In a bioengineering perspective, HOX clock extrinsic control provides a simple mean to engineer cell types of defined rostro-caudal identities from PSCs. It shortens temporal requirements for the generation of cells born at different time of development during axial elongation. This allows the synchronous engineering with an unprecedented efficiency and precision of human MN subtypes with defined rostro-caudal identities. In particular, we provide the first evidence for the generation of putative hand-controlling MNs (Mendelsohn et al., 2017). MN subtypes display differential vulnerabilities in disease and in spinal injuries. Our results will provide access to a long awaited resource for the modeling of these incurable diseases and more controlled source of cells for putative cell therapy approaches. (Abati et al., 2019; An et al., 2019; Baloh et al., 2018; Nijssen et al., 2017; Ragagnin et al., 2019; Sances et al., 2016; Steinbeck and Studer, 2015; Tung et al., 2019). As HOX play a central role in instructing cell diversification in the three lineages, controlled manipulation of the HOX clock has a great potential for cell engineering besides MN subtypes. Our strategy is likely expandable to other axial stem cell derivatives such as paraxial mesoderm that generate the different muscles of the body with clear applications for the modeling of neuromuscular diseases (Bakooshli et al., 2019; Diaz-Cuadros et al., 2020; Faustino Martins et al., 2020; Frith et al., 2018; Machado et al., 2019; Matsuda et al., 2020; Osaki et al., 2020; Pourqui et al., 2018; Steinbeck et al., 2015; Verrier et al., 2018). More broadly, the temporal generation of distinct types of neurons or glia from the same progenitor domain is a widely used strategy to increase cell diversity in the nervous system (Dias et al., 2014; Kohwi and Doe, 2013; Oberst et al., 2019a; Rossi et al., 2017). Extrinsic cues play important roles in the unfolding of these temporal sequences (Kawaguchi, 2019; Oberst et al., 2019a; Oberst et al., 2019b; Syed et al., 2017; Tiberi et al., 2012). Extrinsic manipulation of the temporality of these lineages should improve the generation of early and late-born cells for both basic research, disease modeling and cell therapy.
REFERENCES
[0249] Abati, E., Bresolin, N., Comi, G. and Corti, S. (2019). Advances, Challenges, and Perspectives in Translational Stem Cell Therapy for Amyotrophic Lateral Sclerosis. Mol. Neurobiol. 56, 6703-6715. [0250] Aires, R., de Lemos, L., Nvoa, A., Jurberg, A. D., Mascrez, B., Duboule, D. and Mallo, M. (2019). Tail Bud Progenitor Activity Relies on a Network Comprising Gdf11, Lin28, and Hox13 Genes. Dev. Cell 48, 383-395.e8. [0251] Amoroso, M. W., Croft, G. F., Williams, D. J., O'Keeffe, S., Carrasco, M. A., Davis, A. R., Roybon, L., Oakley, D. H., Maniatis, T., Henderson, C. E., et al. (2013). Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. J. Neurosci. 33, 574-586. [0252] An, D., Fujiki, R., Iannitelli, D. E., Smerdon, J. W., Maity, S., Rose, M. F., Gelber, A., Wanaselja, E. K., Yagudayeva, I., Lee, J. Y., et al. (2019). Stem cell-derived cranial and spinal motor neurons reveal proteostatic differences between ALS resistant and sensitive motor neurons. Elife 8. [0253] Attardi, A., Fulton, T., Florescu, M., Shah, G., Muresan, L., Lenz, M. O., Lancaster, C., Huisken, J., van Oudenaarden, A. and Steventon, B. (2018). Neuromesodermal progenitors are a conserved source of spinal cord with divergent growth dynamics. Development 145, dev166728. [0254] Bakooshli, M. A., Lippmann, E. S., Mulcahy, B., Iyer, N., Nguyen, C. T., Tung, K., Stewart, B. A., Van Den Dorpel, H., Fuehrmann, T., Shoichet, M., et al. (2019). A 3d culture model of innervated human skeletal muscle enables studies of the adult neuromuscular junction. Elife 8. [0255] Baloh, R. H., Glass, J. D. and Svendsen, C. N. (2018). Stem cell transplantation for amyotrophic lateral sclerosis. Curr. Opin. Neurol. 31, 655-661. [0256] Bel-Vialar, S., Itasaki, N. and Krumlauf, R. (2002). Initiating Hox gene expression: In the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups. Development 129, 5103-5115. [0257] Bell, S. W., Brown, M. J. C. and Hems, T. J. (2017). Refinement of myotome values in the upper limb: Evidence from brachial plexus injuries. Surgeon 15, 1-6. [0258] Bialecka, M., Wilson, V. and Deschamps, J. (2010). Cdx mutant axial progenitor cells are rescued by grafting to a wild type environment. Dev. Biol. 347, 228-234. [0259] Boulet, A. M. and Capecchi, M. R. (2012). Signaling by FGF4 and FGF8 is required for axial elongation of the mouse embryo. Dev. Biol. 371, 235-245. [0260] Briscoe, J. and Novitch, B. G. (2008). Regulatory pathways linking progenitor patterning, cell fates and neurogenesis in the ventral neural tube. Philos. Trans. R. Soc. B Biol. Sci. 363, 57-70. [0261] Cambray, N. and Wilson, V. (2007). Two distinct sources for a population of maturing axial progenitors. Development 134, 2829-2840. [0262] Carpenter, A. E., Jones, T. R., Lamprecht, M. R., Clarke, C., Kang, I. H., Friman, O., Guertin, D. A., Chang, J. H., Lindquist, R. A., Moffat, J., et al. (2006). CellProfiler: Image analysis software for identifying and quantifying cell phenotypes. Genome Biol. [0263] Catela, C., Shin, M. M., Lee, D. H., Liu, J. P. and Dasen, J. S. (2016). Hox Proteins Coordinate Motor Neuron Differentiation and Connectivity Programs through Ret/Gfra Genes. Cell Rep. 14, 1901-1915. [0264] Dasen, J. S. (2017). Master or servant? emerging roles for motor neuron subtypes in the construction and evolution of locomotor circuits. Curr. Opin. Neurobiol. 42, 25-32. [0265] Dasen, J. S., Liu, J. P. and Jessell, T. M. (2003). Motor neuron columnar fate imposed by sequential phases of Hox-c activity. Nature 425, 926-933. [0266] Dasen, J. S., De Camilli, A., Wang, B., Tucker, P. W. and Jessell, T. M. (2008). Hox Repertoires for Motor Neuron Diversity and Connectivity Gated by a Single Accessory Factor, FoxP1. Cell 134, 304-316. [0267] Del Corral, R. D. and Storey, K. G. (2004). Opposing FGF and retinoid pathways: A signalling switch that controls differentiation and patterning onset in the extending vertebrate body axis. BioEssays 26, 857-869. [0268] Denans, N., limura, T. and Pourqui, O. (2015). Hox genes control vertebrate body elongation by collinear Wnt repression. Elife 2015. [0269] Denham, M., Hasegawa, K., Menheniott, T., Rollo, B., Zhang, D., Hough, S., Alshawaf, A., Febbraro, F., Ighaniyan, S., Leung, J., et al. (2015). Multipotent caudal neural progenitors derived from human pluripotent stem cells that give rise to lineages of the central and peripheral nervous system. Stem Cells 33, 1759-1770. [0270] Deschamps, J. and Duboule, D. (2017). Embryonic timing, axial stem cells, chromatin dynamics, and the Hox clock. Genes Dev. 31, 1406-1416. [0271] Dias, J. M., Alekseenko, Z., Applequist, J. M. and Ericson, J. (2014). Tgf signaling regulates temporal neurogenesis and potency of neural stem cells in the CNS. Neuron 84, 927-939. [0272] Diaz-Cuadros, M., Wagner, D. E., Budjan, C., Hubaud, A., Tarazona, O. A., Donelly, S., Michaut, A., Al Tanoury, Z., Yoshioka-Kobayashi, K., Niino, Y., et al. (2020). In vitro characterization of the human segmentation clock. Nature 580, 113-118. [0273] Du, Z.-W., Chen, H., Liu, H., Lu, J., Qian, K., Huang, C.-L., Zhong, X., Fan, F. and Zhang, S.-C. (2015). Generation and expansion of highly pure motor neuron progenitors from human pluripotent stem cells. Nat. Commun. 6, 6626. [0274] Durston, A. J. (2019). Some Questions and Answers About the Role of Hox Temporal Collinearity in Vertebrate Axial Patterning. Front. Cell Dev. Biol. 7. [0275] Duval, N., Vaslin, C., Barata, T. C., Frarma, Y., Contremoulins, V., Baudin, X., Nedelec, S. and Ribes, V. C. (2019). Bmp4 patterns smad activity and generates stereotyped cell fate organization in spinal organoids. Dev. 146, 24-33. [0276] Ebisuya, M. and Briscoe, J. (2018). What does time mean in development? Development 145, dev164368. [0277] Edri, S., Hayward, P., Jawaid, W. and Arias, A. M. (2019). Neuro-mesodermal progenitors (NMPs): A comparative study between pluripotent stem cells and embryo-derived populations. Dev. 146. [0278] Evtouchenko, L., Studer, L., Spencer, C., Dreher, E. and Seiler, R. W. (1996). A mathematical model for the estimation of human embryonic and fetal age. Cell Transplant. 5, 453-464. [0279] Faustino Martins, J. M., Fischer, C., Urzi, A., Vidal, R., Kunz, S., Ruffault, P. L., Kabuss, L., Hube, I., Gazzerro, E., Birchmeier, C., et al. (2020). Self-Organizing 3D Human Trunk Neuromuscular Organoids. Cell Stem Cell 26, 172-186.e6. [0280] Frith, T. J. R., Granata, I., Wind, M., Stout, E., Thompson, O., Neumann, K., Stavish, D., Heath, P. R., Ortmann, D., Hackland, J. O. S., et al. (2018). Human axial progenitors generate trunk neural crest cells in vitro. Elife 7. [0281] Gaunt, S. J. (1991). Expression patterns of mouse hox genes: Clues to an understanding of developmental and evolutionary strategies. BioEssays 13, 505-513. [0282] Gaunt, S. J., George, M. and Paul, Y. L. (2013). Direct activation of a mouse Hoxd11 axial expression enhancer by Gdf1 1/Smad signalling. Dev. Biol. 383, 52-60. [0283] Gouti, M., Tsakiridis, A., Wymeersch, F. J., Huang, Y., Kleinjung, J., Wilson, V. and Briscoe, J. (2014). In vitro generation of neuromesodermal progenitors reveals distinct roles for wnt signalling in the specification of spinal cord and paraxial mesoderm identity. PLoS Biol. 12, e1001937. [0284] Gouti, M., Delile, J., Stamataki, D., Wymeersch, F. J., Huang, Y., Kleinjung, J., Wilson, V. and Briscoe, J. (2017). A Gene Regulatory Network Balances Neural and Mesoderm Specification during Vertebrate Trunk Development. Dev. Cell 41, 243-261.e7. [0285] Henrique, D., Abranches, E., Verrier, L. and Storey, K. G. (2015). Neuromesodermal progenitors and the making of the spinal cord. Dev. 142, 2864-2875. [0286] Izpisda-Belmonte, J. C., Falkenstein, H., Doll, P., Renucci, A. and Duboule, D. (1991). Murine genes related to the Drosophila AbdB homeotic genes are sequentially expressed during development of the posterior part of the body. EMBO J. 10, 2279-2289. [0287] Jung, H., Lacombe, J., Mazzoni, E. O., Liem, K. F., Grinstein, J., Mahony, S., Mukhopadhyay, D., Gifford, D. K., Young, R. A., Anderson, K. V., et al. (2010). Global Control of Motor Neuron Topography Mediated by the Repressive Actions of a Single Hox Gene. Neuron 67, 781-796. [0288] Jurberg, A. D., Aires, R., Varela-Lasheras, I., Nvoa, A. and Mallo, M. (2013). Switching axial progenitors from producing trunk to tail tissues in vertebrate embryos. Dev. Cell 25, 451-462. [0289] Kawaguchi, A. (2019). Temporal patterning of neocortical progenitor cells: How do they know the right time? Neurosci. Res. 138, 3-11. [0290] Kimelman, D. and Martin, B. L. (2012). Anterior-posterior patterning in early development: Three strategies. Wiley Interdiscip. Rev. Dev. Biol. 1, 253-266. [0291] Koch, F., Scholze, M., Wittler, L., Schifferl, D., Sudheer, S., Grote, P., Timmermann, B., Macura, K. and Herrmann, B. G. (2017). Antagonistic Activities of Sox2 and Brachyury Control the Fate Choice of Neuro-Mesodermal Progenitors. Dev. Cell 42, 514-526.e7. [0292] Kohwi, M. and Doe, C. Q. (2013). Temporal fate specification and neural progenitor competence during development. Nat. Rev. Neurosci. 14, 823-838. [0293] Lambrot, R., Coffigny, H., Pairault, C., Donnadieu, A. C., Frydman, R., Habert, R. and Rouiller-Fabre, V. (2006). Use of organ culture to study the human fetal testis development: Effect of retinoic acid. J. Clin. Endocrinol. Metab. 91, 2696-2703. [0294] Li, X. J., Du, Z. W., Zarnowska, E. D., Pankratz, M., Hansen, L. O., Pearce, R. A. and Zhang, S. C. (2005). Specification of motoneurons from human embryonic stem cells. Nat. Biotechnol. 23, 215-221. [0295] Lippmann, E. S., E. williams, C., Ruhl, D. A., Estevez-Silva, M. C., Chapman, E. R., Coon, J. J. and Ashton, R. S. (2015). Deterministic HOX patterning in human pluripotent stem cell-derived neuroectoderm. Stem Cell Reports 4, 632-644. [0296] Liu, J. P. (2006). The function of growth/differentiation factor 11 (Gdf11) in rostrocaudal patterning of the developing spinal cord. Development 133, 2865-2874. [0297] Liu, J. P., Laufer, E. and Jessell, T. M. (2001). Assigning the positional identity of spinal motor neurons: Rostrocaudal patterning of Hox-c expression by FGFs, Gdf11, and retinoids. Neuron 32, 997-1012. [0298] Lunn, J. S., Fishwick, K. J., Halley, P. A. and Storey, K. G. (2007). A spatial and temporal map of FGF/Erk1/2 activity and response repertoires in the early chick embryo. Dev. Biol. 302, 536-552. [0299] Machado, C. B., Kanning, K. C., Kreis, P., Stevenson, D., Crossley, M., Nowak, M., Iacovino, M., Kyba, M., Chambers, D., Blanc, E., et al. (2014). Reconstruction of phrenic neuron identity in embryonic stem cell-derived motor neurons. Dev. 141, 784-794. [0300] Machado, C. B., Pluchon, P., Harley, P., Rigby, M., Sabater, V. G., Stevenson, D. C., Hynes, S., Lowe, A., Burrone, J., Viasnoff, V., et al. (2019). In Vitro Modeling of Nerve-Muscle Connectivity in a Compartmentalized Tissue Culture Device. Adv. Biosyst. [0301] Mallo, M., Vinagre, T. and Carapugo, M. (2009). The road to the vertebral formula. Int. J. Dev. Biol. 53, 1469-1481. [0302] Matsuda, M., Yamanaka, Y., Uemura, M., Osawa, M., Saito, M. K., Nagahashi, A., Nishio, M., Guo, L., Ikegawa, S., Sakurai, S., et al. (2020). Recapitulating the human segmentation clock with pluripotent stem cells. Nature 580, 124-129. [0303] Maury, Y., Cme, J., Piskorowski, R. A., Salah-Mohellibi, N., Chevaleyre, V., Peschanski, M., Martinat, C. and Nedelec, S. (2015). Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nat. Biotechnol. 33, 89-96. [0304] Mazzoni, E. O., Mahony, S., Peljto, M., Patel, T., Thornton, S. R., McCuine, S., Reeder, C., Boyer, L. A., Young, R. A., Gifford, D. K., et al. (2013). Saltatory remodeling of Hox chromatin in response to rostrocaudal patterning signals. Nat. Neurosci. 16, 1191-1198. [0305] McGrew, M. J., Sherman, A., Lillico, S. G., Ellard, F. M., Radcliffe, P. A., Gilhooley, H. J., Mitrophanous, K. A., Cambray, N., Wilson, V. and Sang, H. (2008). Localised axial progenitor cell populations in the avian tail bud are not committed to a posterior Hox identity. Development 135, 2289-2299. [0306] McPherron, A. C., Lawler, A. M. and Lee, S. J. (1999). Regulation of anterior/posterior patterning of the axial skeleton by growth/differentiation factor 11. Nat. Genet. 22, 260-264. [0307] Mendelsohn, A. I., Dasen, J. S. and Jessell, T. M. (2017). Divergent Hox Coding and Evasion of Retinoid Signaling Specifies Motor Neurons Innervating Digit Muscles. Neuron 93, 792-805.e4. [0308] Metzis, V., Steinhauser, S., Pakanavicius, E., Gouti, M., Stamataki, D., Ivanovitch, K., Watson, T., Rayon, T., Mousavy Gharavy, S. N., Lovell-Badge, R., et al. (2018). Nervous System Regionalization Entails Axial Allocation before Neural Differentiation. Cell 175, 1105-1118.e17. [0309] Narendra, V., Rocha, P. P., An, D., Raviram, R., Skok, J. A., Mazzoni, E. O. and Reinberg, D. (2015). CTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation. Science (80-.). 347, 1017-1021. [0310] Neijts, R., Amin, S., van Rooijen, C. and Deschamps, J. (2017). Cdx is crucial for the timing mechanism driving colinear Hox activation and defines a trunk segment in the Hox cluster topology. Dev. Biol. 422, 146-154. [0311] Nijssen, J., Comley, L. H. and Hedlund, E. (2017). Motor neuron vulnerability and resistance in amyotrophic lateral sclerosis. Acta Neuropathol. 133, 863-885. [0312] Noordermeer, D., Leleu, M., Splinter, E., Rougemont, J., De Laat, W. and Duboule, D. (2011). The dynamic architecture of Hox gene clusters. Science (80-.). 334, 222-225. [0313] Noordermeer, D., Leleu, M., Schorderet, P., Joye, E., Chabaud, F. and Duboule, D. (2014). Temporal dynamics and developmental memory of 3D chromatin architecture at Hox gene loci. Elife 2014. [0314] Oberst, P., FiBvre, S., Baumann, N., Concetti, C., Bartolini, G. and Jabaudon, D. (2019a). Temporal plasticity of apical progenitors in the developing mouse neocortex. Nature 573, 370-374. [0315] Oberst, P., Agirman, G. and Jabaudon, D. (2019b). Principles of progenitor temporal patterning in the developing invertebrate and vertebrate nervous system. Curr. Opin. Neurobiol. 56, 185-193. [0316] Ogura, T., Sakaguchi, H., Miyamoto, S. and Takahashi, J. (2018). Three-dimensional induction of dorsal, intermediate and ventral spinal cord tissues from human pluripotent stem cells. Development 145, dev162214. [0317] Olivera-Martinez, I., Harada, H., Halley, P. A. and Storey, K. G. (2012). Loss of FGF-Dependent Mesoderm Identity and Rise of Endogenous Retinoid Signalling Determine Cessation of Body Axis Elongation. PLoS Biol. 10. [0318] Osaki, T., Uzel, S. G. M. and Kamm, R. D. (2020). On-chip 3D neuromuscular model for drug screening and precision medicine in neuromuscular disease. Nat. Protoc. 15, 421-449. [0319] Patani, R., Hollins, A. J., Wishart, T. M., Puddifoot, C. A., Alvarez, S., de Lera, A. R., Wyllie, D. J., Compston, D. A., Pedersen, R. A., Gillingwater, T. H., Hardingham, G. E., Allen, N. D., & Chandran, S. (2011). Retinoid-independent motor neurogenesis from human embryonic stem cells reveals a medial columnar ground state. Nature communications, 2, 214. https://doi.org/10.1038/ncomms1216 [0320] Peljto, M., Dasen, J. S., Mazzoni, E. O., Jessell, T. M. and Wichterle, H. (2010). Functional diversity of ESC-derived motor neuron subtypes revealed through intraspinal transplantation. Cell Stem Cell 7, 355-366. [0321] Philippidou, P. and Dasen, J. S. (2013). Hox Genes: Choreographers in Neural Development, Architects of Circuit Organization. Neuron 80, 12-34. [0322] Philippidou, P., Walsh, C. M., Aubin, J., Jeannotte, L. and Dasen, J. S. (2012). Sustained Hox5 gene activity is required for respiratory motor neuron development. Nat. Neurosci. 15, 1636-1644. [0323] Pourqui, O., Al Tanoury, Z. and Chal, J. (2018). The Long Road to Making Muscle In Vitro. In Current Topics in Developmental Biology, pp. 123-142. [0324] Ragagnin, A. M. G., Shadfar, S., Vidal, M., Jamali, M. S. and Atkin, J. D. (2019). Motor neuron susceptibility in ALS/FTD. Front. Neurosci. 13. [0325] Ribes, V., Le Roux, I., Rhinn, M., Schuhbaur, B. and Dolle, P. (2009). Early mouse caudal development relies on crosstalk between retinoic acid, Shh and Fgf signalling pathways. Development 136, 665-676. [0326] Rossi, A. M., Fernandes, V. M. and Desplan, C. (2017). Timing temporal transitions during brain development. Curr. Opin. Neurobiol. 42, 84-92. [0327] Rousso, D. L., Gaber, Z. B., Wellik, D., Morrisey, E. E. and Novitch, B. G. (2008). Coordinated Actions of the Forkhead Protein Foxpl and Hox Proteins in the Columnar Organization of Spinal Motor Neurons. Neuron 59, 226-240. [0328] Routal, R. V. and Pal, G. P. (1999). A study of motoneuron groups and motor columns of the human spinal cord. J. Anat. 195, 211-224. [0329] Sances, S., Bruijn, L. I., Chandran, S., Eggan, K., Ho, R., Klim, J. R., Livesey, M. R., Lowry, E., Macklis, J. D., Rushton, D., et al. (2016). Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nat. Neurosci. 19, 542-553. [0330] Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: An open-source platform for biological-image analysis. Nat. Methods 9, 676-682. [0331] Soshnikova, N. and Duboule, D. (2009). Epigenetic temporal control of mouse hox genes in vivo. Science (80-.). 324, 1321-1323. [0332] Steinbeck, J. A. and Studer, L. (2015). Moving stem cells to the clinic: Potential and limitations for brain repair. Neuron 86, 187-206. [0333] Steinbeck, J. A., Choi, S. J., Mrejeru, A., Ganat, Y., Deisseroth, K., Sulzer, D., Mosharov, E. V. and Studer, L. (2015). Optogenetics enables functional analysis of human embryonic stem cell-derived grafts in a Parkinson's disease model. Nat. Biotechnol. 33, 204-209. [0334] Syed, M. H., Mark, B. and Doe, C. Q. (2017). Playing Well with Others: Extrinsic Cues Regulate Neural Progenitor Temporal Identity to Generate Neuronal Diversity. Trends Genet. 33, 933-942. [0335] Tiberi, L., Vanderhaeghen, P. and van den Ameele, J. (2012). Cortical neurogenesis and morphogens: Diversity of cues, sources and functions. Curr. Opin. Cell Biol. 24, 269-276. [0336] Tschopp, P., Tarchini, B., Spitz, F., Zakany, J. and Duboule, D. (2009). Uncoupling time and space in the collinear regulation of Hox genes. PLoS Genet. 5. [0337] Tung, Y. T., Peng, K. C., Chen, Y. C., Yen, Y. P., Chang, M., Thams, S. and Chen, J. A. (2019). Mir-17-92 Confers Motor Neuron Subtype Differential Resistance to ALS-Associated Degeneration. Cell Stem Cell 25, 193-209.e7. [0338] Tzouanacou, E., Wegener, A., Wymeersch, F. J., Wilson, V. and Nicolas, J. F. (2009). Redefining the Progression of Lineage Segregations during Mammalian Embryogenesis by Clonal Analysis. Dev. Cell 17, 365-376. [0339] Verrier, L., Davidson, L., Gierlinki, M., Dady, A. and Storey, K. G. (2018). Neural differentiation, selection and transcriptomic profiling of human neuromesodermal progenitor-like cells in vitro. Dev. 145, dev166215. [0340] Wang, J., Vasaikar, S., Shi, Z., Greer, M. and Zhang, B. (2017). WebGestalt 2017: A more comprehensive, powerful, flexible and interactive gene set enrichment analysis toolkit. Nucleic Acids Res. 45, W130-W137. [0341] Wymeersch, F. J., Huang, Y., Blin, G., Cambray, N., Wilkie, R., Wong, F. C. K. and Wilson, V. (2016). Position-dependent plasticity of distinct progenitor types in the primitive streak. Elife 5. [0342] Wymeersch, F. J., Skylaki, S., Huang, Y., Watson, J. A., Economou, C., Marek-Johnston, C., Tomlinson, S. R. and Wilson, V. (2019). Transcriptionally dynamic progenitor populations organised around a stable niche drive axial patterning. Dev. 146, dev168161. [0343] Young, T., Rowland, J. E., van de Ven, C., Bialecka, M., Novoa, A., Carapuco, M., van Nes, J., de Graaff, W., Duluc, I., Freund, J. N., et al. (2009). Cdx and Hox Genes Differentially Regulate Posterior Axial Growth in Mammalian Embryos. Dev. Cell.