GUANINE-RICH OLIGONUCLEOTIDES
20230416296 ยท 2023-12-28
Inventors
- Frank HENNECKE (Dietlikon, CH)
- Matthias KINZLER (Richterswil, CH)
- Philippe SAUDAN (Pfungen, CH)
- Jennifer ERICKSON (North Providence, RI, US)
- Isabelle LACAN (Norwood, MA, US)
- Chi LAN LE (Andover, MA, US)
Cpc classification
C40B50/14
CHEMISTRY; METALLURGY
C07D273/00
CHEMISTRY; METALLURGY
International classification
C40B50/14
CHEMISTRY; METALLURGY
C07D273/00
CHEMISTRY; METALLURGY
Abstract
This invention relates to methods for oligonucleotide synthesis, specifically the synthesis of oligonucleotides that contain a high content of guanine monomers. In more detail, the invention relates to a method for coupling a nucleoside phosphor amidite during the synthesis of an oligonucleotide to a universal support, to a first nucleoside, or to an extending oligonucleotide.
Claims
1. A method for coupling a nucleoside phosphoramidite during the synthesis of an oligonucleotide to a universal support, to a first nucleoside, or to an extending oligonucleotide, wherein said oligonucleotide comprises a region of 3 or more consecutive guanine monomers, and wherein said method comprising the steps of: (i) generating a coupling solution, wherein said coupling solution comprises: (a) said nucleoside phosphoramidite; (b) an activating reagent; and (c) one or more solvents, wherein one of said one or more solvents is N,N-dimethylformamide (DMF); and (ii) contacting said coupling solution with said universal support, with said first nucleoside, or with said extending oligonucleotide.
2. The method of claim 1, and wherein the volume of said DMF is equal to or higher than 25%, preferably equal to or higher than 33%, further preferably equal to or higher than 50%, of the total volume of said one or more solvents.
3. The method of claim 1, wherein said one or more solvents comprises, preferably consists of, DMF and acetonitrile, and wherein the ratio (v/v) of said DMF to acetonitrile is between 1:3 and 3:1.
4. The method of claim 1, wherein said one or more solvents consists of DMF and acetonitrile, and wherein the ratio (v/v) of said DMF to acetonitrile is 1:1.
5. The method of claim 1, wherein said one or more solvents consists of exactly one solvent, wherein said exactly one solvent is DMF.
6. The method of claim 1, wherein said activating reagent is selected from: (a) 4,5-dicyanoimidazole (DCI); (b) 5-ethylthio-1H-tetrazole (ETT); (c) 5-benzylthio-1H-tetrazole (BTT); or (d) 5-(3,5-bis-trifluoromethyl)phenyl-1H-tetrazole (Activator 42).
7. The method of claim 1, wherein said coupling solution comprises, preferably consists of: (a) said nucleoside phosphoramidite; (b) said activating reagent, wherein said activating reagent is 5-ethylthio-1H-tetrazole (ETT) (c) exactly one solvent, and wherein said exactly one solvent is DMF.
8. The method of a claim 1, wherein said first nucleoside and/or said extending oligonucleotide is immobilized on a support.
9. The method of claim 1, wherein said support is a polystyrene support, wherein said polystyrene support is cross-linked by divinylbenzene.
10. The method of claim 1, wherein said support further comprises a linker, wherein said linker is represented by the formula I ##STR00002## and wherein X represents said support, wherein preferably X represents said polystyrene support cross-linked by divinylbenzene.
11. The method of claim 1, wherein said oligonucleotide comprises at least 30% guanine monomers.
12. The method of claim 1, wherein said oligonucleotide comprises a first region of 3 or more consecutive guanine monomers and a second region of 3 or more consecutive guanine monomers, and wherein said first region is located at the 3-terminus of said oligonucleotide and wherein said second region is located at the 5-terminus of said oligonucleotide.
13. The method of claim 1, wherein said oligonucleotide comprises a nucleotide sequence selected from the group consisting of: TABLE-US-00004 (a) (SEQIDNO:3) GGGGACGATCGTCGGGGGG; (b) (SEQIDNO:4) GGGGGACGATCGTCGGGGGG; (c) (SEQIDNO:5) GGGGGGACGATCGTCGGGGGG; (d) (SEQIDNO:6) GGGGGGGACGATCGTCGGGGGG; (e) (SEQIDNO:7) GGGGGGGGACGATCGTCGGGGGGG; (f) (SEQIDNO:8) GGGGGGGGGACGATCGTCGGGGGGGG; (g) (SEQIDNO:9) GGGGGGGGGGACGATCGTCGGGGGGGGG; (h) (SEQIDNO:1) GGGGGGGGGGGACGATCGTCGGGGGGGGGG; and (i) (SEQIDNO:10) GGGGGGCGACGACGATCGTCGTCGGGGGGG.
14. The method of claim 1, wherein said oligonucleotide consists of SEQ ID NO:1.
15. A method for producing an oligonucleotide, said method comprising (i) coupling a nucleoside phosphoramidite to a first nucleoside; wherein said coupling comprises the method of claim 1; (ii) generating an extending oligonucleotide by oxidizing the product of step (i); (iii) coupling a nucleoside phosphoramidite to the product of step (ii) after deprotection; wherein said coupling comprises the method of claim 1; (iv) generating an extending oligonucleotide by oxidizing the product of step (iii); and (v) repeating steps (iii) and (iv) until said extending oligonucleotide comprises the sequence of said oligonucleotide.
Description
DETAILED DESCRIPTION OF THE INVENTION
[0018] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0019] Oligonucleotide. As used herein, the term oligonucleotide refers to a nucleic acid sequence comprising 2 or more nucleotides, preferably 6 to 200 nucleotides, further preferably 10 to 100, and again more preferably 20 to about 100 nucleotides, again more preferably 20 to 50, and again further preferably 20 to 40 nucleotides. Very preferably, oligonucleotides comprise about 30 nucleotides, more preferably oligonucleotides comprise exactly 30 nucleotides, and most preferably oligonucleotides consist of exactly 30 nucleotides. Further preferred oligonucleotides consist of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. Oligonucleotides are polyribonucleotides or polydeoxribonucleotides and are preferably selected from (a) unmodified RNA or DNA, and (b) modified RNA or DNA. The modification may comprise the backbone or nucleotide analogues which are known to the person skilled in the art. Preferred nucleotide modifications/analogs are phosphorothioates or alkylphosphorothioates modifications. Besides unmodified oligonucleotides consisting exclusively of phosphodiester bound nucleotides, phosphothioated nucleotides are protected against degradation in a cell or an organism and are therefore preferred nucleotide modifications. Further encompassed are oligonucleotides comprising phosphodiester bound nucleotides and phosphothioated nucleotides. The term oligonucleotide as used herein typically and preferably refers to a single stranded deoxyribonucleotide. Typically, an oligonucleotide comprises a region of 3 or more consecutive guanine monomers. Preferably, an oligonucleotide comprises a first region of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive guanine monomers, wherein preferred hereby said first region is located at the 3-terminus of said oligonucleotide. In a further preferred embodiment said oligonucleotide comprises a second region of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive guanine monomers, wherein preferably said second region is located at the 5-terminus of said oligonucleotide. Preferably, an oligonucleotide comprises at least 30% guanine monomers. A further preferred oligonucleotide comprises at least one poly G stretch as defined below. More preferred oligonucleotides comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 of said poly G stretches. Very preferred oligonucleotides comprise exactly two poly G stretches, wherein preferably one of said two poly G stretches is located at the 5 end or at the 3 end of said oligonucleotide. Even more preferred oligonucleotides comprise exactly two poly G stretches, wherein one of said two poly G stretches is located at the 5 end of said oligonucleotide and one of said two poly G stretches is located at the 3 end of said oligonucleotide. Very preferred oligonucleotides are unmethylated CpG containing oligonucleotides comprising at least one, preferably one, two, three or four CpG motifs. Still more preferred oligonucleotides comprise a palindromic sequence, wherein preferably said palindromic sequence comprises least one, preferably one, two, three or four CpG motifs. Still more preferred oligonucleotides comprise a palindromic sequence, wherein preferably said palindromic sequence comprises, or preferably consists of the sequence GACGATCGTC (SEQ ID NO:2). Still more preferred oligonucleotides comprise a palindromic sequence, wherein said palindromic sequence is flanked at its 5 end by a poly G stretch and wherein said palindromic sequence is flanked at its 3 end by a poly G stretch, wherein preferably said palindromic sequence is GACGATCGTC (SEQ ID NO:2). Very preferred oligonucleotides comprise a palindromic sequence, wherein said palindromic sequence is flanked at its 5 end by at least 3 to 10, preferably by 4 to 10 guanosine entities and wherein said palindromic sequence is flanked at its 3 end at least 3 to 10, preferably by 4 to 10, guanosine entities, wherein preferably said palindromic sequence is GACGATCGTC (SEQ ID NO:2).
[0020] Poly G stretch: The term poly G stretch, as used herein, refers to a segment of an oligonucleotide, wherein said segment consists of at least 3 consecutive guanosine residues. Preferred poly G stretches consist of 3 to 25, preferably of 4 to 20, more preferably of 4 to 15 and most preferably of 4 to 10 consecutive guanosine entities. Further preferred poly G stretches consist of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive guanosine entities.
[0021] CpG motif: As used herein, the term CpG motif refers to an oligodesoxynucleotide containing at least one unmethylated cytosine, guanine dinucleotide and wherein preferably said CG dinucleotide is phosphodiester bound.
[0022] Unmethylated CpG-containing oligonucleotide: As used herein, the term unmethylated CpG-containing oligonucleotide or CpG refers to an oligonucleotide, preferably to an oligodesoxynucleotide, containing at least one CpG motif. Preferably, CpG relates to a single stranded oligodesoxynucleotide containing an unmethylated cytosine followed 3 by a guanosine, wherein said unmethylated cytosine and said guanosine are linked by a phosphate bond, wherein preferably said phosphate bound is a phosphodiester bound or a phosphothioate bound, and wherein further preferably said phosphate bond is a phosphodiester bound.
[0023] In a first aspect, the present invention provides for a method for coupling a nucleoside phosphoramidite during the synthesis of an oligonucleotide to a universal support, to a first nucleoside, or to an extending oligonucleotide, wherein said oligonucleotide comprises a region of 3 or more consecutive guanine monomers, and wherein said method comprising the steps of (i) generating a coupling solution, wherein said coupling solution comprises: (a) said nucleoside phosphoramidite; (b) an activating reagent; and (c) one or more solvents, wherein one of said one or more solvents is N,N-dimethylformamide (DMF); and (ii) contacting said coupling solution with said universal support, with said first nucleoside, or with said extending oligonucleotide.
[0024] In a preferred embodiment, the volume of said DMF is equal to or higher than 25%, preferably equal to or higher than 33% of the total volume of said one or more solvents. In another preferred embodiment, the volume of said DMF is equal to or higher than 50% of the total volume of said one or more solvents.
[0025] In another preferred embodiment, said one or more solvents further comprises acetonitrile, wherein the volume of said acetonitrile is lower than or at most equal to 75%, preferably lower than or at most equal to 67%, and further preferably lower than or at most equal to 50%, of the total volume of said one or more solvents.
[0026] In another preferred embodiment, said one or more solvents comprises, preferably consists of, DMF and acetonitrile, and wherein the ratio (v/v) of said DMF to acetonitrile is between 1:3 and 3:1. In another preferred embodiment, said one or more solvents consists of DMF and acetonitrile, and wherein the ratio (v/v) of said DMF to acetonitrile is 1:1.
[0027] In another preferred embodiment, the volume of said DMF is equal to or higher than 67%, preferably equal to or higher than 75%, further preferably equal to or higher than 90%, of the total volume of said one or more solvents.
[0028] In a very preferred embodiment, said one or more solvents consists of exactly one solvent, wherein said exactly one solvent is DMF. Thus, in a very preferred embodiment, said coupling solution comprises exactly one solvent, and wherein said exactly one solvent is DMF. Preferably, said DMF has a purity of at least 98%, preferably of at least 99%, again more preferably of at least 99.5%, and again more preferably of at least 99.8%.
[0029] Suitable activators are known to the person skilled in the art and are described, by way of example, in U.S. Pat. Nos. 6,031,092 and 6,476,216, each of which is incorporated herein by reference. In a preferred embodiment, said activating reagent is selected from (a) 4,5-dicyanoimidazole (DCI); (b) 5-ethylthio-1H-tetrazole (ETT); (c) 5-benzylthio-1H-tetrazole (BTT); or (d) bis-trifluoromethyl)phenyl-1H-tetrazole (Activator 42). In another preferred embodiment, said activating reagent is selected from (a) 5-ethylthio-1H-tetrazole (ETT); (b) 5-benzylthio-1H-tetrazole (BTT); or (c) 5-(3,5-bis-trifluoromethyl)phenyl-1H-tetrazole (Activator 42), and wherein preferably said activating reagent is 5-ethylthio-1H-tetrazole (ETT). In another preferred embodiment, said activating reagent is 4,5-dicyanoimidazole (DCI) or 5-ethylthio-1H-tetrazole (ETT). In a very preferred embodiment said activating reagent is 5-ethylthio-1H-tetrazole (ETT). In again a very preferred embodiment, said coupling solution comprises, preferably consists of, (a) said nucleoside phosphoramidite; (b) said activating reagent, wherein said activating reagent is 5-ethylthio-1H-tetrazole (ETT); and (c) exactly one solvent, and wherein said exactly one solvent is DMF. In another preferred embodiment, the concentration of said activating reagent in said coupling solution is 0.05 to 0.90 M, and wherein preferably the concentration of said activating reagent in said coupling solution is 0.40 to 0.80 M.
[0030] In a further preferred embodiment, the concentration of said nucleoside phosphoramidite in said coupling solution is at least 0.03 M, and wherein preferably the concentration of said nucleoside phosphoramidite in said coupling solution is 0.03 to 0.60 M, and wherein further preferably the concentration of said nucleoside phosphoramidite in said coupling solution is 0.03 to 0.30 M.
[0031] In a further preferred embodiment, said first nucleoside and/or said extending oligonucleotide is immobilized on a support, wherein preferably said support is selected from (a) polymeric support, preferably polystyrene support; and (b) silica support, preferably a controlled pore glass (CPG) support. In a further preferred embodiment, said first nucleoside and/or said extending oligonucleotide is immobilized on a support, wherein preferably said support is selected from (a) polystyrene support; and (b) silica support, preferably a controlled pore glass (CPG) support. Some polymeric bead supports are disclosed in the following patents: U.S. Pat. Nos. 6,016,895; 6,043,353; 6,300,486; 8,541,599; and 8,153,725 B2; each of which is incorporated herein in its entirety.
[0032] In a very preferred embodiment, said support is a polystyrene support. In a further very preferred embodiment, said support is a polystyrene support, wherein said polystyrene support is cross-linked by divinylbenzene, wherein preferably said polystyrene support is characterized by functional hydroxyl groups; and wherein further preferably said polystyrene support comprises an average particle size of about 80-90 m. Said supports are known to the person skilled in the art. One of these preferred supports for the present invention are NittoPhase HL Solid Supports by Nitto Denko Corporation. These have been used for the examples provided in the present invention.
[0033] Such supports are generally used in the art and typically and preferably further comprises a linker, typically and preferably a succinate-linker or a linker comprising a succinate moiety. Thus, in a preferred embodiment of the present invention, said support further comprises a linker, wherein preferably said linker comprises a succinate moiety.
[0034] In a very preferred embodiment, the support further comprises a linker, wherein the linker is represented by the following formula I
##STR00001## [0035] and wherein X represents said support, wherein preferably X represents said polystyrene support cross-linked by divinylbenzene.
[0036] In a very preferred embodiment, said support further comprises a linker, wherein said support is a polystyrene support, wherein said polystyrene support is cross-linked by divinylbenzene, and wherein said linker is represented by the formula I, wherein X represents said polystyrene support cross-linked by divinylbenzene. Said very preferred support with said linker allows a preferred loading capacity of 200-400 mol/g. Further very preferred are said support with said linker as used in the example section (NPHL250), wherein said support with linker allows a loading capacity of 250 mol/g. These very preferred support-linker combinations are commercially available from Kinovate Life Sciences, Inc., Oceanside, CA 92058 and named UnyLinker loaded NittoPhase HL & NittoPhase Solid Supports.
[0037] Various linkers for oligomer solid phase synthesis have been described and are known by the person skilled in the art. Preferred linkers and support-linker combinations for the present invention are disclosed in WO 2005/049621 which is incorporated herein in its entirety by reference. Furthermore, the synthesis of these linkers and support/linker combinations are also described in WO 2005/049621.
[0038] The synthesis primers known by the person skilled in the art may typically comprise besides the support-linker combinations a suitable nucleoside depending on the sequence of the oligonucleotide to be actually synthesized. These synthesis primers are typically prepared by covalently linking said suitable nucleoside to said support through said linker. Numerous of said synthesis primers can even be commercially purchased.
[0039] In a preferred embodiment, said oligonucleotide comprises at least one poly G stretch. In another preferred embodiment, said oligonucleotide comprises at least 30% guanine monomers. In a further preferred embodiment, said oligonucleotide comprises at least 40% guanine monomers. In another preferred embodiment, said oligonucleotide comprises at least 50% guanine monomers.
[0040] In a further preferred embodiment the oligonucleotide contains a first region of 3 or more consecutive guanine monomers. In a further preferred embodiment the oligonucleotide contains a first region of 4 or more consecutive guanine monomers. In a further preferred embodiment the oligonucleotide contains a first region of 5 or more consecutive guanine monomers. In another preferred embodiment, said oligonucleotide comprises a first region of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive guanine monomers. Preferably, said first region is located at the 3-terminus of said oligonucleotide.
[0041] In a further preferred embodiment the oligonucleotide contains a second region of 3 or more consecutive guanine monomers. In a further preferred embodiment the oligonucleotide contains a second region of 4 or more consecutive guanine monomers. In a further preferred embodiment the oligonucleotide contains a second region of 5 or more consecutive guanine monomers. In another preferred embodiment, said oligonucleotide comprises a second region of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive guanine monomers. Preferably, said second region is located at the 5-terminus of said oligonucleotide.
[0042] In another preferred embodiment, said oligonucleotide comprises a first region of 3 or more consecutive guanine monomers and a second region of 3 or more consecutive guanine monomers, and wherein said first region is located at the 3-terminus of said oligonucleotide and wherein said second region is located at the 5-terminus of said oligonucleotide.
[0043] In another preferred embodiment, said oligonucleotide comprises a first region of 4 or more consecutive guanine monomers and a second region of 4 or more consecutive guanine monomers, and wherein said first region is located at the 3-terminus of said oligonucleotide and wherein said second region is located at the 5-terminus of said oligonucleotide.
[0044] In a further preferred embodiment said oligonucleotide comprises 10 to 50, preferably 20 to 40, and most preferably 30 nucleotide monomers.
[0045] In a further preferred embodiment said oligonucleotide comprises a palindromic sequence, wherein preferably said palindromic sequence is GACGATCGTC (SEQ ID NO:2). In another preferred embodiment, said palindromic sequence is flanked at its 5-terminus by at least 4 and at most 20, preferably at most 10, guanosine entities. In another preferred embodiment, said palindromic sequence is flanked at its 3-terminus by at least 4 and at most 20, preferably at most guanosine entities.
[0046] In a further preferred embodiment said oligonucleotide comprises or preferably consists of a nucleotide sequence selected from the group consisting of: (a) GGGGACGATC GTCGGGGGG (SEQ ID NO:3); (b) GGGGGACGAT CGTCGGGGGG (SEQ ID NO:4); (c) GGGGGGACGATCGTCGGGGGG (SEQ ID NO:5); (d) GGGGGGGACG ATCGTCGGGG GG (SEQ ID NO:6); (e) GGGGGGGGAC GATCGTCGGG GGGG (SEQ ID NO:7); (f) GGGGGGGGGA CGATCGTCGG GGGGGG (SEQ ID NO:8); (g) GGGGGGGGGG ACGATCGTCG GGGGGGGG (SEQ ID NO:9); (h) GGGGGGGGGG GACGATCGTC GGGGGGGGGG (SEQ ID NO:1); and (i) GGGGGGCG ACGACGAT CGTCGTCG GGGGGG (SEQ ID NO:10). In a very preferred embodiment, said oligonucleotide comprises or preferably consists of SEQ ID NO:1. In a further preferred embodiment the oligonucleotide is SEQ ID NO:10.
[0047] In a further preferred embodiment, said oligonucleotide is a deoxynucleotide, and wherein preferably said deoxynucleotide consists exclusively of phosphodiester bound monomers. More preferably, said oligonucleotide comprises or preferably consists of SEQ ID NO:1 and said oligonucleotide is a deoxynucleotide, and wherein said deoxynucleotide consists exclusively of phosphodiester bound monomers.
[0048] In a further aspect, the invention relates to a method for producing an oligonucleotide, said method comprising any one of the methods described herein for coupling a nucleoside phosphoramidite during the synthesis of an oligonucleotide to an universal support, to a first nucleoside, or to an extending oligonucleotide.
[0049] In a further aspect, the invention relates to a method for producing an oligonucleotide, said method comprising (i) coupling a nucleoside phosphoramidite to a first nucleoside; wherein said coupling comprises any one of the methods described herein for coupling a nucleoside phosphoramidite during the synthesis of an oligonucleotide to a first nucleoside; (ii) generating an extending oligonucleotide by oxidizing the product of step (i); (iii) coupling a nucleoside phosphoramidite to the product of step (ii), typically and preferably after deprotection; wherein said coupling comprises any one of the methods described herein for coupling a nucleoside phosphoramidite during the synthesis of an oligonucleotide to an extending oligonucleotide; (iv) generating an extending oligonucleotide by oxidizing the product of step (iii); and (v) repeating steps (iii) and (iv) until said extending oligonucleotide comprises the sequence of said oligonucleotide.
[0050] In a preferred embodiment said method further comprises the step of purifying said oligonucleotide under denaturing conditions, wherein preferably said denaturing conditions are characterized by a pH of 10 to 14, preferably by a pH of 10 to 13, more preferably by a pH of about 12, most preferably by a pH of 12.
[0051] In a further preferred embodiment said method further comprises the step of purifying said oligonucleotide at a pH of 10 to 14, preferably at a pH of 10 to 13, more preferably at a pH of about 12, most preferably at a pH of 12.
[0052] In a further preferred embodiment, said purification is performed by anion-exchange chromatography, wherein preferably said anion-exchange chromatography is performed using an anion-exchange matrix functionalized with quaternary amine groups, wherein further preferably said anion-exchange matrix is composed of a material selected from polystyrene, polystyrene/divinyl benzene or polymethacrylate, and wherein still further preferably said material is polystyrene/divinyl benzene.
[0053] In a further preferred embodiment said oligonucleotide is produced in a molar yield with respect to said first nucleoside of at least 15%, preferably of at least 20%, again preferably of at least 25%. Still more preferably of at least 30%.
[0054] In a further preferred embodiment the purity of said oligonucleotide is at least 75%, preferably at least 80%, more preferably at least 85%, still more preferably at least 90%, and most preferably at least 95%.
[0055] The inventive methods disclosed herein are well suited for the large scale synthesis of oligonucleotides, in particular of G-rich oligonucleotides, such as, for example, poly-G flanked unmethylated CpG containing oligonucleotides. Such compounds are, in particular, used in pharmaceutical applications.
[0056] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0057] The use of the terms a and an and the and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0058] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.
EXAMPLES
[0059] The following examples further illustrate the invention but should not be construed as in any way limiting its scope.
[0060] The following abbreviations have particularly been used throughout this Example section and the entire specification: [0061] ACN Acetonitrile [0062] CNET Cyanoethyl protecting group [0063] CV Column volume(s) [0064] DCA Dichloroacetic acid [0065] DCI Dicyanoimidazole [0066] DEA Diethylamine [0067] DMF Dimethylformamide [0068] eq equivalents [0069] ETT 3-Ethylthio-1H-tetrazole [0070] FLP Full length product [0071] HPLC High pressure liquid chromatography [0072] NMI N-methylimidazole [0073] NPHL 250 Nittophase high loaded unylinker 250 [0074] OD Optical density [0075] TBA Tert-Butylamine [0076] UV Ultraviolet
[0077] Dimethylformamide (DMF) was purchased from Acros Organics (part of Thermo Fisher Scientific) and had a purity of 99.8%. Nittophase high loaded unylinker 250 (NPHL 250) was purchased from Kinovate Life Sciences, Inc., Oceanside, CA.
Example 1
[0078] This example describes the synthesis of oligonucleotide G10 (SEQ ID NO:1) in the presence of various solvents and co-solvent combinations. It demonstrates the superiority of the solvent mixture ACN/DMF and pure DMF over ACN/sulfolane in terms of purity of full-length product. It further demonstrates the superiority of pure DMF over ACN/DMF in terms of total oligonucleotide yield.
[0079] Synthesis in ACN/Sulfolane with DCI as Activator
[0080] This example describes a 1.51 mmol trityl-off synthesis of oligonucleotide G10 (SEQ ID NO:1) on an kta 100 OligoPilot using Nittophase High Loaded Unylinker 250 (NPHL 250) as solid synthesis support. 57.7 ml of the synthesis support, swollen in ACN/sulfolane (1:1 v/v) (support density: 0.109 g/ml) were filled into the synthesis column (column diameter 3.5 cm, column height 6 cm), and after a pre-synthesis wash with ACN (64.1 ml/min, 2 CV) the following synthesis cycle was used: (1) detritylation with DCA in toluene (first cycle: 10% DCA in toluene, 32.9 ml/min; subsequent cycles: 3% DCA in toluene, 64.1 ml/min; 2 CV) followed by ACN wash (2 CV at 32.1 ml/min and 2 CV at 64.1 ml/min); (2) conditioning with ACN/sulfolane (1:1 v/v; 32.9 ml/min, 1.5 CV); (3) coupling (activator: 0.7 M DCI in ACN/sulfolane (1:1 v/v); deoxynucleoside phosphoramidite (2.0 eq/support): 0.2 M in ACN/sulfolane (1:1 v/v); charge volume: 30.2 ml (15.1 ml amidite+15.1 ml activator), charge flow rate: 53.1 ml/min; push volume: 8 ml, push flow rate: 53.1 ml/min; recycle time: 10 min, recycle flow rate: 48.1 ml/min) followed by ACN wash (1 CV, 64.1 ml/min); (4) pre-oxidation capping with 0.2 CV Cap A (NMI/pyridine/ACN, 2:3:5 v/v/v)/ACN (1:1 v/v) followed by 0.75 CV of 1:1 (v/v) Cap A/Cap B (Isobutyric anhydride/ACN 1:1 v/v), contact time 2.5 min, charge/push flow rate: 17.3 ml/min, push volume: 1.1 ml, wash volume: 1 CV, wash flow rate: 64.1 ml/min; (5) pre-oxidation push with 0.5 CV Cap A (34.8 ml/min); (6) oxidation with 50 mM 12 (3 eq) in pyridine/water (9:1 v/v), charge volume: 90.6 ml, contact time: 2.6 min, charge/push flow rate: 34.8 ml/min, oxidation push volume: 1.1 CV, followed by ACN wash (1 CV, 64.1 ml/min); (7) pre-capping conditioning with 1.5 CV ACN/sulfolane (1:1 v/v, 32.9 ml/min); (8) capping with 0.2 CV Cap A/ACN (1:1 v/v) followed by 0.75 CV of 1:1 (v/v) Cap A/Cap B, contact time 2.5 min, charge/push flow rate: 17.3 ml/min, push volume: 1.1 CV, wash volume: 1 CV, wash flow rate: 64.1 ml/min. After a final column wash with 2 CV ACN (64.1 ml/min) and the final detritylation, the CNET protecting group was removed from the phosphodiester linkage with 20% DEA in ACN (5 CV, contact time 10 min, followed by a wash with 4 CV ACN (96.2 ml/min)). Cleavage and deprotection was achieved by treatment with not less than 4 CV of 28-30% ammonia at 50 C. for not less than 24 hours in a bottle on a shaker table followed by repeated washing steps of 1 CV water each until a UV reading of less than 40 OD/ml is reached.
[0081] The OD was determined by absorption measurement at 260 nm. The oligonucleotide yield (OD/mol) is given in Table 1.
[0082] Anion exchange analysis for determination of the crude oligonucleotide purity was performed on a Waters Alliance HPLC system on a Dionex DNAPac PA200 4250 mm column at 30 C. The samples are diluted to 6.25 OD/ml in HPLC buffer A (20 mM NaOH), 20 l of which were injected onto the column and separated at a flow rate of 1 ml/min using a gradient from 25 to 40% HPLC buffer B (20 mM NaOH, 1.5 M NaCl, 40% Methanol) during 5 min followed by a gradient from 40 to 55% buffer B during 35 min. The % full length product is given in Table 1.
[0083] Synthesis in ACN/DMF with DCI as Activator
[0084] This example describes a 1.51 mmol trityl-off synthesis of SEQ ID NO:1 on an kta 100 OligoPilot using Nittophase High Loaded Unylinker 250 (NPHL 250) as solid synthesis support. 57.7 ml of the synthesis support, swollen in ACN/DMF (1:1 v/v) (support density: 0.109 g/ml) were filled into the synthesis column (column diameter 3.5 cm, column height 6 cm), and after a pre-synthesis wash with ACN (64.1 ml/min, 2 CV) the following synthesis cycle was used: (1) detritylation with DCA in toluene (first cycle: 10% DCA in toluene, 32.9 ml/min; subsequent cycles: 3% DCA in toluene, 64.1 ml/min; 2 CV) followed by ACN wash (2 CV at 32.1 ml/min and 2 CV at 64.1 ml/min); (2) conditioning with ACN/DMF (1:1 v/v; 32.9 ml/min, 1.5 CV); (3) coupling (activator: 0.7 M DCI in ACN/DMF (1:1 v/v); deoxynucleoside phosphoramidite (2.0 eq/support): 0.2 M in ACN/DMF (1:1 v/v); charge volume: 30.2 ml (15.1 ml amidite+15.1 ml activator), charge flow rate: 53.1 ml/min; push volume: 8 ml, push flow rate: 53.1 ml/min; recycle time: 10 min, recycle flow rate: 48.1 ml/min) followed by ACN wash (1 CV, 64.1 ml/min); (4) pre-oxidation capping with 0.2 CV Cap A (NMI/pyridine/ACN, 2:3:5 v/v/v)/ACN (1:1 v/v) followed by 0.75 CV of 1:1 (v/v) Cap A/Cap B (Isobutyric anhydride/ACN 1:1 v/v), contact time 2.5 min, charge/push flow rate: 17.3 ml/min, push volume: 1.1 ml, wash volume: 1 CV, wash flow rate: 64.1 ml/min; (5) pre-oxidation push with 0.5 CV Cap A (34.8 ml/min); (6) oxidation with 50 mM 12 (3 eq) in pyridine/water (9:1 v/v), charge volume: 90.6 ml, contact time: 2.6 min, charge/push flow rate: 34.8 ml/min, oxidation push volume: 1.1 CV, followed by ACN wash (1 CV, 64.1 ml/min); (7) pre-capping conditioning with 1.5 CV ACN/DMF (1:1 v/v, 32.9 ml/min); (8) capping with 0.2 CV Cap A/ACN (1:1 v/v) followed by 0.75 CV of 1:1 (v/v) Cap A/Cap B, contact time 2.5 min, charge/push flow rate: 17.3 ml/min, push volume: 1.1 CV, wash volume: 1 CV, wash flow rate: 64.1 ml/min. After a final column wash with 2 CV ACN (64.1 ml/min) and the final detritylation, the CNET protecting group was removed from the phosphodiester linkage with 20% DEA in ACN (5 CV, contact time not less than 45 min, followed by a wash with 4 CV ACN (96.2 ml/min)). Cleavage and deprotection was achieved by on-column recirculation with not less than 4 CV of 28-30% ammonia at 50 C. followed by repeated washing steps of 1 CV water each until a UV reading of less than 40 OD/ml is reached.
[0085] The OD was determined by absorption measurement at 260 nm. The oligonucleotide yield (OD/mol) is given in Table 1.
[0086] Anion exchange analysis for determination of the crude oligonucleotide purity was performed on a Waters Alliance HPLC system on a Dionex DNAPac PA200 4250 mm column at 30 C. The samples are diluted to 6.25 OD/ml in HPLC buffer A (20 mM NaOH), 20 l of which were injected onto the column and separated at a flow rate of 1 ml/min using a gradient from 25 to 40% HPLC buffer B (20 mM NaOH, 1.5 M NaCl, 40% Methanol) during 5 min followed by a gradient from 40 to 55% buffer B during 35 min. The % full length product is given in Table 1.
[0087] Synthesis in DMF with DCI as Activator
[0088] This example describes a 1.51 mmol trityl-off synthesis of SEQ ID NO:1 on an kta 100 OligoPilot using Nittophase High Loaded Unylinker 250 (NPHL 250) as solid synthesis support. 57.7 ml of the synthesis support, swollen in DMF (support density: 0.109 g/ml) were filled into the synthesis column (column diameter 3.5 cm, column height 6 cm), and after a pre-synthesis wash with ACN (64.1 ml/min, 2 CV) the following synthesis cycle was used: (1) detritylation with DCA in toluene (first cycle: 10% DCA in toluene, 32.9 ml/min; subsequent cycles: 3% DCA in toluene, 64.1 ml/min; 2 CV) followed by ACN wash (2 CV at 32.1 ml/min and 2 CV at 64.1 ml/min); (2) conditioning with DMF (32.9 ml/min, 1.5 CV); (3) coupling (activator: 0.7 M DCI in DMF; deoxynucleoside phosphoramidite (2.0 eq/support): 0.2 M in DMF; charge volume: 30.2 ml (15.1 ml amidite+15.1 ml activator), charge flow rate: 53.1 ml/min; push volume: 8 ml, push flow rate: 53.1 ml/min; recycle time: 10 min, recycle flow rate: 48.1 ml/min) followed by ACN wash (1 CV, 64.1 ml/min); (4) pre-oxidation capping with 0.2 CV Cap A (NMI/pyridine/ACN, 2:3:5 v/v/v)/ACN (1:1 v/v) followed by 0.75 CV of 1:1 (v/v) Cap A/Cap B (Isobutyric anhydride/ACN 1:1 v/v), contact time 2.5 min, charge/push flow rate: 17.3 ml/min, push volume: 1.1 ml, wash volume: 1 CV, wash flow rate: 64.1 ml/min; (5) pre-oxidation push with 0.5 CV Cap A (34.8 ml/min); (6) oxidation with 50 mM 12 (3 eq) in pyridine/water (9:1 v/v), charge volume: 90.6 ml, contact time: 2.6 min, charge/push flow rate: 34.8 ml/min, oxidation push volume: 1.1 CV, followed by ACN wash (1 CV, 64.1 ml/min); (7) pre-capping conditioning with 1.5 CV DMF (32.9 ml/min); (8) capping with 0.2 CV Cap A/ACN (1:1 v/v) followed by 0.75 CV of 1:1 (v/v) Cap A/Cap B, contact time 2.5 min, charge/push flow rate: 17.3 ml/min, push volume: 1.1 CV, wash volume: 1 CV, wash flow rate: 64.1 ml/min. After a final column wash with 2 CV ACN (64.1 ml/min) and the final detritylation, the CNET protecting group was removed from the phosphodiester linkage with 20% TBA in ACN (5 CV, contact time not less than 45 min, followed by a wash with 4 CV ACN (96.2 ml/min)). Cleavage and deprotection was achieved by on-column recirculation with not less than 4 CV of 28-30% ammonia at 50 C. followed by repeated washing steps of 1 CV water each until a UV reading of less than 40 OD/ml is reached.
[0089] The OD was determined by absorption measurement at 260 nm. The oligonucleotide yield (OD/mol) is given in Table 1.
[0090] Anion exchange analysis for determination of the crude oligonucleotide purity was performed on a Waters Alliance HPLC system on a Dionex DNAPac PA200 4250 mm column at 30 C. The samples are diluted to 6.25 OD/ml in HPLC buffer A (20 mM NaOH), 20 l of which were injected onto the column and separated at a flow rate of 1 ml/min using a gradient from 25 to 40% HPLC buffer B (20 mM NaOH, 1.5 M NaCl, 40% Methanol) during 5 min followed by a gradient from 40 to 55% buffer B during 35 min. The % full length product is given in Table 1.
[0091] The data demonstrate that the purity of FLP in the crude synthesis is highest with DMF as co-solvent (57.9%) and with pure DMF as solvent (56.3%). Moreover, the total yield is highest with pure DMF as solvent (181 OD/mol). Moreover, impurities and synthesis failures such as G101n and G10+1n, i.e. compounds comprising one or more G residues less or compounds comprising one or more G residues in addition to the targeted FLP, are strongly reduced when using DMF instead of ACN/sulfolane. The latter is in particular true for G10+1n which, in turn, is very beneficial due to the difficulty of separating the G10+1n compounds from the FLP.
TABLE-US-00001 TABLE 1 Yield Content Content Oligo FLP 1n FLP + 1n [OD/ Purity FLP relative relative Solvent Activator mol] [% of oligo] to FLP [%] to FLP [%] ACN/Sulfolane DCI 166 54.0 6.46 5.37 ACN/DMF DCI 145 57.9 6.08 3.45 DMF DCI 181 56.3 5.75 0.62
Example 2
[0092] This example describes the synthesis of SEQ ID NO:1 in the presence of pure DMF using ETT as activator. It demonstrates the superiority of ETT over DCI in terms of oligonucleotide yield and purity of full-length product.
[0093] Synthesis in DMF with ETT as Activator
[0094] This example describes a 1.26 mmol trityl-off synthesis of SEQ ID NO:1 on an kta 100 OligoPilot using Nittophase High Loaded Unylinker 250 (NPHL 250) as solid synthesis support. 48.1 ml of the synthesis support, swollen in DMF (support density: 0.109 g/ml) were filled into the synthesis column (column diameter 3.5 cm, column height 5 cm), and after a pre-synthesis wash with ACN (424 cm/hr, 2 CV) the following synthesis cycle was used: (1) detritylation with DCA in toluene (first cycle: 10% DCA in toluene, 50 cm/hr; subsequent cycles: 3% DCA in toluene, 424 cm/hr; 2 CV) followed by ACN wash (2 CV at 200 cm/hr and 2 CV at 424 cm/hr); (2) conditioning with DMF (205 cm/hr, 1.5 CV); (3) coupling (activator: 0.6 M ETT in DMF; deoxynucleoside phosphoramidite (2.0 eq/support): 0.2 M in DMF; charge volume: 26.4 ml (12.6 ml amidite+13.8 ml activator), charge flow rate: 19.3 ml/min; push volume: 8 ml, push flow rate: 120 cm/hr; recycle time: 10 min, recycle flow rate: 212 cm/hr) followed by ACN wash (1 CV, 424 cm/hr); (4) pre-oxidation push with 0.5 CV Cap A (NMI/pyridine/ACN, 2:3:5 v/v/v, 29.0 ml/min); (5) oxidation with 50 mM 12 (3 eq) in pyridine/water (9:1 v/v), charge volume: ml, contact time: 2.6 min, charge/push flow rate: 29.0 ml/min, oxidation push volume: 1.1 CV, followed by ACN wash (1 CV, 424 cm/hr); (6) pre-capping conditioning with 1.5 CV DMF (205 cm/hr); (7) capping with 0.2 CV Cap A/ACN (1:1 v/v) followed by 0.75 CV of 1:1 (v/v) Cap A/Cap B (Isobutyric anhydride/ACN, 1:4 v/v), contact time 2.5 min, charge/push flow rate: 14.4 ml/min, push volume: 1.1 CV, wash volume: 1 CV, wash flow rate: 424 cm/hr. After final detritylation, the CNET protecting group was removed from the phosphodiester linkage with 20% TBA in ACN (5 CV, contact time not less than 45 min, followed by a wash with 4 CV ACN (424 cm/hr)). Cleavage and deprotection was achieved by on-column recirculation with 5 CV of 28-30% ammonia at 50 C. for 16 to 24 hrs followed by repeated washing steps of 1 CV water each until a UV reading of less than 40 OD/ml is reached.
[0095] The OD was determined by absorption measurement at 260 nm. The oligonucleotide yield (OD/mol) is given in Table 2.
[0096] Anion exchange analysis for determination of the crude oligonucleotide purity was performed on a Waters Alliance HPLC system on a Dionex DNAPac PA200 4250 mm column at 30 C. The samples are diluted to 6.25 OD/ml in HPLC buffer A (20 mM NaOH), 20 l of which were injected onto the column and separated at a flow rate of 1 ml/min using a gradient from 25 to 40% HPLC buffer B (20 mM NaOH, 1.5 M NaCl, 40% Methanol) during 5 min followed by a gradient from 40 to 55% buffer B during 35 min. The % full length product is given in Table 2 in comparison to the synthesis of Example 1 with DCI as activator. The data demonstrate that both yield of crude oligonucleotide and purity of FLP are further greatly increased by using ETT as activator. In addition, impurities and synthesis failures such as G101n and G10+1n, i.e. compounds comprising one or more G residues less or compounds comprising one or more G residues in addition to the targeted FLP, are further reduced compared to the synthesis with DCI as activator.
TABLE-US-00002 TABLE 2 Content Content Yield FLP 1n FLP + 1n Oligo Purity FLP relative relative Solvent Activator [OD/mol] [% of oligo] to FLP [%] to FLP [%] DMF DCI 181 56.3 5.75 0.62 DMF ETT 199 64.6 3.54 0.42
Example 3
[0097] This example describes the synthesis of Example 2 at 105 mmol scale. It demonstrates that the process is scalable to production scale.
[0098] This example describes a 105 mmol trityl-off synthesis of SEQ ID NO:1 on a GE OligoProcess oligonucleotide synthesizer using Nittophase High Loaded Unylinker 250 (NPHL 250) as solid synthesis support. 3.85 liter of the synthesis support, swollen in DMF (support density: 9.17 ml/g) were filled into the synthesis column (column diameter 35 cm, column height 4 cm), and after a pre-synthesis wash with ACN (424 cm/hr, 2 CV) the following synthesis cycle was used: (1) detritylation with DCA in toluene (first cycle: 10% DCA in toluene, 62 cm/hr; subsequent cycles: 3% DCA in toluene, 424 cm/hr; 2 CV) followed by ACN wash (2 CV at 200 cm/hr and 2 CV at 424 cm/hr); (2) conditioning with DMF (205 cm/hr, 1.5 CV); (3) coupling (activator: 0.6 M ETT in DMF; deoxynucleoside phosphoramidite (2.0 eq/support): 0.2 M in DMF; charge volume: 2.21 L (52.4% activator volume), charge flow rate: 1.68 L/min; push flow rate: 1.68 L/min; recycle time: 10 min, recycle flow rate: 3.40 L/min) followed by ACN wash (1 CV, 424 cm/hr); (4) pre-oxidation push with 0.5 CV Cap A (NMI/pyridine/ACN, 2:3:5 v/v/v, 2.42 L/min); (5) oxidation with 50 mM 12 (3 eq) in pyridine/water (9:1 v/v), charge volume: 6.30 L, contact time: 2.6 min, charge/push flow rate: 2.42 L/min, oxidation push volume: 1.1 CV, followed by ACN wash (1 CV, 424 cm/hr); (6) pre-capping conditioning with 1.5 CV DMF (205 cm/hr); (7) capping with 0.2 CV Cap A/ACN (1:1 v/v) followed by 0.75 CV of 1:1 (v/v) Cap A/Cap B (Isobutyric anhydride/ACN, 1:4 v/v), contact time 2.5 min, charge/push flow rate: 1.15 L/min, push volume: 1.1 CV, wash volume: 1 CV, wash flow rate: 424 cm/hr. After final detritylation and a final column wash (2 CV ACN, 424 cm/hr), the CNET protecting group was removed from the phosphodiester linkage with 20% TBA in ACN (5 CV, contact time not less than 45 min, followed by a wash with 4 CV ACN (424 cm/hr)). Cleavage and deprotection was achieved by on-column recirculation with 5 CV of 28-30% ammonia at 50 C. for 16 to 24 hrs followed by washing with not less than 4 CV water until a UV reading of less than 40 OD/ml is reached.
[0099] The OD was determined by absorption measurement at 260 nm.
[0100] Anion exchange analysis for determination of the crude oligonucleotide purity was performed on a Waters Alliance HPLC system on a Dionex DNAPac PA200 4250 mm column at 30 C. The samples are diluted to 6.25 OD/ml in HPLC buffer A (20 mM NaOH), 20 l of which were injected onto the column and separated at a flow rate of 1 ml/min using a gradient from 25 to 40% HPLC buffer B (20 mM NaOH, 1.5 M NaCl, 40% Methanol) during 5 min followed by a gradient from 40 to 55% buffer B during 35 min.
[0101] The crude oligonucleotide yield was 178 OD/mol (51.6% of max) with a FLP content of 66.7% demonstrating that the preferred process is scalable to production scale.
Example 4
[0102] This example describes the purification of crude oligonucleotide synthesized as described in Example 2. It demonstrates that the crude oligonucleotide synthesized using the preferred method can be purified to high purity.
[0103] Two batches of crude oligonucleotide synthesized as described in Example 2 were combined to create one feed for the purification process. The purity of FLP in the combined crude oligonucleotide pool was determined with 66.5%. A 7.5 cm diameter column was packed with Source15Q anion exchange matrix to a bed height of 20 cm (compression factor 1) and washed with not less than 3 CV of buffer B (25 mM NaOH, 2 M NaCl) at a flow rate of 100 cm/hr followed by equilibration with not less than 3 CV of buffer A (25 mM NaOH) at a flow rate of 100 cm/hr. The combined crude oligonucleotide was loaded at a concentration of 500 OD/ml at a flow rate of 100 cm/hr followed by a washing step with not less than 1 CV buffer A at 100 cm/hr until the UV signal was back to baseline. For elution, a gradient of 10% buffer B to 44% buffer B was applied over 17 CV at a flow rate of 100 cm/hr, the fraction size was 0.5 CV. Analytical results for mock pools of the fractions analyzed for OD (absorption measurement at 260 nm) and FLP purity (anion exchange HPLC) are shown in Table 3. Mock pools show a high purity of FLP in the range of 94% and high FLP recovery of 71 to 84%.
TABLE-US-00003 TABLE 3 Chromatography process mock pool data. Fractions OD recovery [%] FLP [%] FLP recovery [%] 17-30 58 94.3 82 17-31 59 94.3 84 18-31 55 94.4 78 19-30 50 94.9 71 18-30 53 94.7 76
[0104] Fractions 17 to 31 were pooled for further processing through ultrafiltration/diafiltration (Molecular weight cut-off: 3000) and freeze-drying leading to 6.6 g oligonucleotide (corrected for moisture) with a purity of 93.0% FLP (1% G101n and 0.53% G10+1n). The overall process yield was 2.6 g/mmol (19%).