THERAPEUTIC SMALL MOLECULES FOR TREATMENT OF PULMONARY HYPERTENSION
20230414590 ยท 2023-12-28
Inventors
Cpc classification
A61K45/06
HUMAN NECESSITIES
International classification
A61K31/4412
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
Abstract
Disclosed are pathogenic mechanisms in pulmonary hypertension and molecular inhibitors of the same. Particularly, GSTP1 (glutathione S-transferase P1) have been demonstrated as having a role in regulating the endothelial ISCU function in pulmonary hypertension. Accordingly, methods for treating pulmonary hypertension in a subject in need thereof comprising administering a therapeutically effective amount of a pharmaceutical composition that inhibits glutathione S-transferase P (GSTP1) and/or increasing ISCU expression are disclosed. The GSTP1 inhibitor can comprise a piperlongumine analog, such as BRD-K34222889, or a derivative thereof.
Claims
1. A method of treating pulmonary hypertension in a subject in need thereof, comprising administering a therapeutically effective amount of a pharmaceutical composition that inhibits glutathione S-transferase P (GSTP1), increases iron-sulfur cluster assembly (ISCU) protein stability, increases ISCU protein expression, or a combination thereof, in the subject.
2. The method of claim 1, wherein the pharmaceutical composition inhibits GSTP1.
3. The method of claim 1, wherein the pharmaceutical composition increases iron-sulfur cluster assembly (ISCU) protein stability, increases ISCU protein expression, or a combination thereof, in the subject.
4. The method of claim 1, wherein the pharmaceutical composition increases oxidative metabolism and/or decreases pulmonary arterial endothelial cell (PAEC) apoptosis in the subject.
5. (canceled)
6. (canceled)
7. The method of claim 1, wherein the pulmonary hypertension is pulmonary arterial hypertension.
8. The method of claim 1, wherein the pharmaceutical composition comprises BRD-K34222889 (a piperlongumine analog) or a derivative thereof.
9. The method of claim 8, wherein the pharmaceutical composition inhibits or reduces pulmonary arterial endothelial cell (PAEC) apoptosis in a subject in need thereof,
10. The method of claim 8, wherein the piperlongumine analog BRD-K34222889 or a derivative thereof has a structure according to Formula I: ##STR00006## wherein A.sub.1 is C(O) or S(O).sub.2; A.sub.2 is selected from CC or C(R)C(R), wherein R and R are independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halogen, or C.sub.1-C.sub.6 haloalkyl; X is selected from CH(R), C(O), SO, SO.sub.2, or NR, wherein R is selected from hydrogen, halogen, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.1-C.sub.6 alkoxy, or C.sub.1-C.sub.6 haloalkyl; D is selected from CC or C(R)C(R), wherein R and R are independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halogen, or C.sub.1-C.sub.6 haloalkyl; R.sub.1 is selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, or nitro, and wherein R.sub.1 is optionally substituted with one or more groups; R.sub.2, R.sub.3, and R.sub.4 are independently selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, nitro, carboxyl, ester, hydroxylamine, carbonyl substituted hydroxylamine, or thiol; R.sub.5, R.sub.6, R.sub.7, R.sub.8, and R.sub.9 are independently selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, nitro, carboxyl, ester, hydroxylamine, carbonyl substituted hydroxylamine, or thiol; n is 1 or 2; and ------- represents a bond that is present of absent; or a pharmaceutically acceptable salt, ester, or prodrug thereof.
11. The method of claim 10, wherein A.sub.1 is C(O) and A.sub.2 is CC.
12. The method of claim 10, wherein X is CH.sub.2.
13. The method of claim 10, wherein D is C(R)C(R), and wherein R and R are independently selected from hydrogen or C.sub.1-C.sub.3 alkyl.
14. The method of claim 10, wherein R.sub.2, R.sub.3, R.sub.4, and R.sub.7 are all C.sub.1-C.sub.3 alkoxy.
15. The method of claim 1, wherein R.sub.5, R.sub.6, R.sub.8, and R.sub.9 are all hydrogen.
16. The method of claim 1, further comprising administering at least one additional agent effective to treat pulmonary hypertension.
17. The method of claim 16, wherein the at least one additional agent comprises one or more of phosphodiesterase inhibitors, calcium channel blockers, endothelin receptor antagonists, inotropic agents, prostacyclin pathway agonists, anti-coagulants, guanylate cyclase stimulators, or a combination thereof.
18. (canceled)
19. (canceled)
20. A method for diagnosing pulmonary hypertension in a subject in need thereof, the method comprising: a) detecting a level of expression of glutathione S-transferase P (GSTP1) in a sample obtained from the subject; b) comparing the level of expression of GSTP1 in the sample compared to a control sample; c) diagnosing the subject as having pulmonary hypertension when the level of expression of GSTP1 in the sample is higher than the level of expression in the control sample; and d) treating the subject for pulmonary hypertension when the quantity of GSTP1 in the sample indicates elevated levels of GSTP1 compared to the control sample, wherein detecting the level of expression in the sample (a) and the control sample (b) comprises: assaying the sample or control sample using a GSTP1 antibody or isolating GSTP1 from the sample and subjecting the isolated GSTP1 to quantitative spectrometry.
21. (canceled)
22. A method of assaying the efficacy of a compound for treating pulmonary hypertension, the method comprising a) expressing glutathione S-transferase P (GSTP1) in a sample obtained from a subject; b) contacting the sample with the compound; and c) testing whether GSTP1 is inhibited in the sample.
23. (canceled)
24. The method of claim 10, wherein R.sub.2, R.sub.3, R.sub.4, and R.sub.7 are all methoxy.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DETAILED DESCRIPTION
[0042] The materials, compounds, compositions, and methods described herein may be understood more readily by reference to the following detailed description of specific aspects of the disclosed subject matter and the Examples included therein.
[0043] Before the present materials, compounds, compositions, and methods are disclosed and described, it is to be understood that the aspects described below are not limited to specific synthetic methods or specific reagents, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting.
[0044] Also, throughout this specification, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which the disclosed matter pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.
General Definitions
[0045] In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings:
[0046] Throughout the specification and claims the word comprise and other forms of the word, such as comprising and comprises, means including but not limited to, and is not intended to exclude, for example, other additives, components, integers, or steps.
[0047] As used in the description and the appended claims, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a composition includes mixtures of two or more such compositions, reference to an analog includes mixtures of two or more such analogs, and the like.
[0048] Optional or optionally means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0049] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Furthermore, when numerical ranges of varying scope are set forth herein, it is contemplated that any combination of these values inclusive of the recited values may be used. Further, ranges can be expressed herein as from about one particular value, and/or to about another particular value. When such a range is expressed, another aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent about, it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. Unless stated otherwise, the term about means within 5% (e.g., within 2% or 1%) of the particular value modified by the term about.
[0050] By reduce or other forms of the word, such as reducing or reduction, is meant lowering of an event or characteristic (e.g., apoptosis). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, reduces apoptosis means decreasing apoptosis relative to a standard or a control.
[0051] By prevent or other forms of the word, such as preventing or prevention, is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.
[0052] As used herein, treatment refers to obtaining beneficial or desired clinical results. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, one or more of the following: decreasing one more symptoms resulting from the disease, diminishing the extent of the disease, stabilizing the disease (e.g., preventing or delaying the worsening of the disease), preventing or delaying the occurrence of the disease, delay or slowing the progression of the disease, ameliorating the disease state, decreasing the dose of one or more other medications required to treat the disease, increasing the quality of life, and/or prolonging survival. In some variations, the composition reduces the severity of one or more symptoms associated with pulmonary hypertension by at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% compared to the corresponding symptom in the same subject prior to treatment or compared to the corresponding symptom in other subjects not receiving the composition. Also encompassed by treatment is a reduction of pathological consequence of pulmonary hypertension. The methods of the disclosure contemplate any one or more of these aspects of treatment.
[0053] As used herein, delaying the development of pulmonary hypertension refers to defer, hinder, slow, retard, stabilize, and/or postpone development of the disease. This delay can be of varying lengths of time, depending on the history of the disease and/or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. A method that delays development of pulmonary hypertension is a method that reduces probability of disease development in a given time frame and/or reduces the extent of the disease in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a statistically significant number of subjects. Pulmonary hypertension development can be detectable using standard methods, such as routine physical exams, x-ray, electrocardiogram, and echocardiogram. Development may also refer to disease progression that may be initially undetectable and includes occurrence and onset.
[0054] As used herein, an at risk individual is an individual who is at risk of developing pulmonary hypertension. An individual at risk may or may not have detectable disease, and may or may not have displayed detectable disease prior to the treatment methods described herein. At risk denotes that an individual has one or more so-called risk factors, which are measurable parameters that correlate with development of pulmonary hypertension, which are described herein. An individual having one or more of these risk factors has a higher probability of developing pulmonary hypertension than an individual without these risk factor(s).
[0055] The term patient preferably refers to a human in need of treatment with an anti-hypertensive agent or treatment for any purpose, and more preferably a human in need of such a treatment to treat pulmonary hypertension, or a disorder associated with ISCU protein stability or deficiency. However, the term patient can also refer to non-human animals, preferably mammals such as dogs, cats, horses, cows, pigs, sheep and non-human primates, among others, that are in need of treatment for pulmonary hypertension.
Chemical Definitions
[0056] As used herein, the term composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts.
[0057] References in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or article for which a part by weight is expressed. Thus, in a mixture containing 2 parts by weight of component X and 5 parts by weight component Y, X and Y are present at a weight ratio of 2:5, and are present in such ratio regardless of whether additional components are contained in the mixture.
[0058] A weight percent (wt. %) of a component, unless specifically stated to the contrary, is based on the total weight of the formulation or composition in which the component is included.
[0059] As used herein, the term substituted is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, and aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described below. The permissible substituents can be one or more and the same or different for appropriate organic compounds. For purposes of this disclosure, the heteroatoms, such as nitrogen, can have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valencies of the heteroatoms. This disclosure is not intended to be limited in any manner by the permissible substituents of organic compounds. Also, the terms substitution or substituted with include the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.
[0060] The term aliphatic as used herein refers to a non-aromatic hydrocarbon group and includes branched and unbranched, alkyl, alkenyl, or alkynyl groups.
[0061] The term alkyl as used herein is a branched or unbranched saturated hydrocarbon group of 1 to 24 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, dodecyl, tetradecyl, hexadecyl, eicosyl, tetracosyl, and the like. The alkyl group can also be substituted or unsubstituted. The alkyl group can be substituted with one or more groups including, but not limited to, alkyl, halogenated alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below.
[0062] The symbols A.sup.n is used herein as merely a generic substituent in the definitions below.
[0063] The term alkoxy as used herein is an alkyl group bound through a single, terminal ether linkage; that is, an alkoxy group can be defined as -OA.sup.1 where A.sup.1 is alkyl as defined above.
[0064] The term alkenyl as used herein is a hydrocarbon group of from 2 to 24 carbon atoms with a structural formula containing at least one carbon-carbon double bond. Asymmetric structures such as (A.sup.1A.sup.2)CC(A.sup.3A.sup.4) are intended to include both the E and Z isomers. This may be presumed in structural formulae herein wherein an asymmetric alkene is present, or it may be explicitly indicated by the bond symbol CC. The alkenyl group can be substituted with one or more groups including, but not limited to, alkyl, halogenated alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below.
[0065] The term alkynyl as used herein is a hydrocarbon group of 2 to 24 carbon atoms with a structural formula containing at least one carbon-carbon triple bond. The alkynyl group can be substituted with one or more groups including, but not limited to, alkyl, halogenated alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol, as described below.
[0066] The term aryl as used herein is a group that contains any carbon-based aromatic group including, but not limited to, benzene, naphthalene, phenyl, biphenyl, phenoxybenzene, and the like. The term heteroaryl is defined as a group that contains an aromatic group that has at least one heteroatom incorporated within the ring of the aromatic group. Examples of heteroatoms include, but are not limited to, nitrogen, oxygen, sulfur, and phosphorus. The term non-heteroaryl, which is included in the term aryl, defines a group that contains an aromatic group that does not contain a heteroatom. The aryl and heteroaryl group can be substituted or unsubstituted. The aryl and heteroaryl group can be substituted with one or more groups including, but not limited to, alkyl, halogenated alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein. The term biaryl is a specific type of aryl group and is included in the definition of aryl. Biaryl refers to two aryl groups that are bound together via a fused ring structure, as in naphthalene, or are attached via one or more carbon-carbon bonds, as in biphenyl.
[0067] The term cycloalkyl as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc. The term heterocycloalkyl is a cycloalkyl group as defined above where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkyl group and heterocycloalkyl group can be substituted or unsubstituted. The cycloalkyl group and heterocycloalkyl group can be substituted with one or more groups including, but not limited to, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein.
[0068] The term cycloalkenyl as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms and containing at least one double bound, i.e., CC. Examples of cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, and the like. The term heterocycloalkenyl is a type of cycloalkenyl group as defined above where at least one of the carbon atoms of the ring is substituted with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkenyl group and heterocycloalkenyl group can be substituted or unsubstituted. The cycloalkenyl group and heterocycloalkenyl group can be substituted with one or more groups including, but not limited to, alkyl, alkoxy, alkenyl, alkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, sulfonyl, sulfone, sulfoxide, or thiol as described herein.
[0069] The term cyclic group is used herein to refer to either aryl groups, non-aryl groups (i.e., cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl groups), or both. Cyclic groups have one or more ring systems that can be substituted or unsubstituted. A cyclic group can contain one or more aryl groups, one or more non-aryl groups, or one or more aryl groups and one or more non-aryl groups.
[0070] The term aldehyde as used herein is represented by the formula C(O)H. Throughout this specification C(O) is a short hand notation for CO.
[0071] The terms amine or amino as used herein are represented by the formula NA.sup.1A.sup.2A.sup.3, where A.sup.1, A.sup.2, and A.sup.3 can be, independently, hydrogen, an alkyl, halogenated alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.
[0072] The term carboxylic acid as used herein is represented by the formula C(O)OH. A carboxylate as used herein is represented by the formula C(O)O.sup..
[0073] The term ester as used herein is represented by the formula OC(O)A.sup.1 or C(O)OA.sup.1, where A.sup.1 can be an alkyl, halogenated alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.
[0074] The term ether as used herein is represented by the formula A.sup.1OA.sup.2, where A.sup.1 and A.sup.2 can be, independently, an alkyl, halogenated alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.
[0075] The term ketone as used herein is represented by the formula A.sup.1C(O)A.sup.2, where A.sup.1 and A.sup.2 can be, independently, an alkyl, halogenated alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.
[0076] The term halide as used herein refers to the halogens fluorine, chlorine, bromine, and iodine.
[0077] The term hydroxyl as used herein is represented by the formula OH.
[0078] The term nitro as used herein is represented by the formula NO.sub.2.
[0079] The term cyano as used herein is represented by the formula CN The term azido as used herein is represented by the formula N.sub.3.
[0080] The term sulfonyl is used herein to refer to the sulfo-oxo group represented by the formula S(O).sub.2A.sup.1, where A.sup.1 can be hydrogen, an alkyl, halogenated alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl group described above.
[0081] The term sulfonylamino or sulfonamide as used herein is represented by the formula S(O).sub.2NH.sub.2.
[0082] The term thiol as used herein is represented by the formula SH.
[0083] It is to be understood that the compounds provided herein may contain chiral centers. Such chiral centers may be of either the (R-) or (S-) configuration. The compounds provided herein may either be enantiomerically pure, or be diastereomeric or enantiomeric mixtures. It is to be understood that the chiral centers of the compounds provided herein may undergo epimerization in vivo. As such, one of skill in the art will recognize that administration of a compound in its (R-) form is equivalent, for compounds that undergo epimerization in vivo, to administration of the compound in its (S-) form.
[0084] As used herein, substantially pure means sufficiently homogeneous to appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), nuclear magnetic resonance (NMR), gel electrophoresis, high performance liquid chromatography (HPLC) and mass spectrometry (MS), gas-chromatography mass spectrometry (GC-MS), and similar, used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance. Both traditional and modem methods for purification of the compounds to produce substantially chemically pure compounds are known to those of skill in the art. A substantially chemically pure compound may, however, be a mixture of stereoisomers.
[0085] Unless stated to the contrary, a formula with chemical bonds shown only as solid lines and not as wedges or dashed lines contemplates each possible isomer, e.g., each enantiomer, diastereomer, and meso compound, and a mixture of isomers, such as a racemic or scalemic mixture.
[0086] The term therapeutically effective amount as used herein means that amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician. In reference to pulmonary hypertension, an effective amount comprises an amount that increases iron-sulfur cluster assembly (ISCU) protein stability, increases ISCU protein expression, increases oxidative metabolism and/or decreases pulmonary arterial endothelial cell (PAEC) apoptosis, or a combination thereof. In some embodiments, an effective amount is an amount sufficient to delay development. In some embodiments, an effective amount is an amount sufficient to prevent or delay occurrence and/or recurrence. An effective amount can be administered in one or more doses.
[0087] Effective amounts of a compound or composition described herein for treating a mammalian subject can include about 0.1 to about 1000 mg/Kg of body weight of the subject/day, such as from about 1 to about 100 mg/Kg/day, especially from about 10 to about 100 mg/Kg/day. The doses can be acute or chronic. A broad range of disclosed composition dosages are believed to be both safe and effective.
[0088] The term pharmaceutically acceptable refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio.
[0089] The term analog refers to a substance that shares one or more particular structural features, elements, components, or moieties with a reference substance. Typically, an analog shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways. In some embodiments, an analog is a substance that can be generated from the reference substance, e.g., by chemical manipulation of the reference substance. In some embodiments, an analog is a substance that can be generated through performance of a synthetic process substantially similar to (e.g., sharing a plurality of steps with) one that generates the reference substance. In some embodiments, an analog is or can be generated through performance of a synthetic process different from that used to generate the reference substance.
[0090] The term derivative refers to a structurally similar compound that retains sufficient functional attributes of the identified analog. The derivative may be structurally similar because it is lacking one or more atoms, substituted with one or more substituents, a salt, in different hydration/oxidation states, e.g., substituting a single or double bond, substituting a hydroxy group for a ketone, or because one or more atoms within the molecule are switched, such as, but not limited to, replacing an oxygen atom with a sulfur or nitrogen atom or replacing an amino group with a hydroxyl group or vice versa. Replacing a carbon with nitrogen in an aromatic ring is a contemplated derivative. The derivative may be a prodrug. Derivatives may be prepared by any variety of synthetic methods or appropriate adaptations presented in the chemical literature or as in synthetic or organic chemistry textbooks, such as those provide in March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, Wiley, 6th Edition (2007) Michael B. Smith or Domino Reactions in Organic Synthesis, Wiley (2006) Lutz F. Tietze hereby incorporated by reference.
[0091] Pharmaceutically acceptable derivative or pharmaceutically acceptable salt refers to a prodrug or salt that is pharmaceutically acceptable and has the desired pharmacological properties. Such derivatives or salts include those that may be formed where acidic protons present in the compounds are capable of reacting with inorganic or organic bases. Suitable inorganic salts include those formed with the alkali metals, e.g., sodium, potassium, magnesium, calcium, and aluminum. Suitable organic salts include those formed with organic bases such as the amine bases, e.g., ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine, and the like. Such salts also include acid addition salts formed with inorganic acids (e.g., hydrochloric and hydrobromic acids) and organic acids (e.g., acetic acid, citric acid, maleic acid, and the alkane- and arene-sulfonic acids such as methanesulfonic acid and benzenesulfonic acid). When two acidic groups are present, a pharmaceutically acceptable salt may be a mono-acid-mono-salt or a di-salt; similarly, where there are more than two acidic groups present, some or all of such groups can be converted into salts.
[0092] The term prodrug refers to an agent that is converted into a biologically active form in vivo. Prodrugs are often useful because, in some situations, they may be easier to administer than the parent compound. They may, for instance, be bioavailable by oral administration whereas the parent compound is not. The prodrug may also have improved solubility in pharmaceutical compositions over the parent drug. A prodrug may be converted into the parent drug by various mechanisms, including enzymatic processes and metabolic hydrolysis.
[0093] Examples of prodrugs that can be used include esters, optionally substituted esters, branched esters, optionally substituted branched esters, carbonates, optionally substituted carbonates, carbamates, optionally substituted carbamates, thioesters, optionally substituted thioesters, branched thioesters, optionally substituted branched thioesters, thiocarbonates, optionally substituted thiocarbonates, S-thiocarbonate, optionally substituted S-thiocarbonate, dithiocarbonates, optionally substituted dithiocarbonates, thiocarbamates, optionally substituted thiocarbamates, oxymethoxycarbonyl, optionally substituted oxymethoxycarbonyl, oxymethoxythiocarbonyl, optionally substituted oxymethoxythiocarbonyl, oxymethylcarbonyl, optionally substituted oxymethylcarbonyl, oxymethylthiocarbonyl, optionally substituted oxymethylthiocarbonyl, L-amino acid esters, D-amino acid esters, N-substituted L-amino acid esters, N,N-disubstituted L-amino acid esters, N-substituted D-amino acid esters, N,N-disubstituted D-amino acid esters, sulfenyl, optionally substituted sulfenyl, imidate, optionally substituted imidate, hydrazonate, optionally substituted hydrazonate, oximyl, optionally substituted oximyl, imidinyl, optionally substituted imidinyl, imidyl, optionally substituted imidyl, aminal, optionally substituted aminal, hemiaminal, optionally substituted hemiaminal, acetal, optionally substituted acetal, hemiacetal, optionally substituted hemiacetal, carbonimidate, optionally substituted carbonimidate, thiocarbonimidate, optionally substituted thiocarbonimidate, carbonimidyl, optionally substituted carbonimidyl, carbamimidate, optionally substituted carbamimidate, carbamimidyl, optionally substituted carbamimidyl, thioacetal, optionally substituted thioacetal, S-acyl-2-thioethyl, optionally substituted S-acyl-2-thioethyl, bis-(acyloxybenzyl)esters, optionally substituted bis-(acyloxybenzyl)esters, (acyloxybenzyl)esters, and optionally substituted (acyloxybenzyl)esters.
[0094] As used herein, salts refer to derivatives of the disclosed compounds where the parent compound is modified making acid or base salts thereof. Examples of salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines, alkylamines, or dialkylamines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. In typical embodiments, the salts are conventional nontoxic pharmaceutically acceptable salts including the quaternary ammonium salts of the parent compound formed, and non-toxic inorganic or organic acids. Preferred salts include those derived from an alkali agent such as sodium, potassium, calcium, magnesium, lithium, or a combination thereof. Other salts include those derived from organic compounds such as arginine, lysine, histidine, ornithine, creatine, agmatine, citrulline, or any combination thereof. Other salts can be derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like.
[0095] A pharmaceutically acceptable component is one that is suitable for use with humans and/or animals without undue adverse side effects (such as toxicity, irritation, and allergic response) commensurate with a reasonable benefit/risk ratio.
[0096] Pharmaceutically acceptable salt refers to a salt that is pharmaceutically acceptable and has the desired pharmacological properties. Such salts include those that may be formed where acidic protons present in the compounds are capable of reacting with inorganic or organic bases. Suitable inorganic salts include those formed with the alkali metals, e.g., sodium, potassium, magnesium, calcium, and aluminum. Suitable organic salts include those formed with organic bases such as the amine bases, e.g., ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine, and the like. Such salts also include acid addition salts formed with inorganic acids (e.g., hydrochloric and hydrobromic acids) and organic acids (e.g., acetic acid, citric acid, maleic acid, and the alkane- and arene-sulfonic acids such as methanesulfonic acid and benzenesulfonic acid). When two acidic groups are present, a pharmaceutically acceptable salt may be a mono-acid-mono-salt or a di-salt; similarly, where there are more than two acidic groups present, some or all of such groups can be converted into salts.
[0097] Pharmaceutically acceptable excipient refers to an excipient that is conventionally useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use. Such excipients can be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.
[0098] A pharmaceutically acceptable carrier is a carrier, such as a solvent, suspending agent or vehicle, for delivering the disclosed compounds to the patient. The carrier can be liquid or solid and is selected with the planned manner of administration in mind. Liposomes are also a pharmaceutical carrier. As used herein, carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated.
[0099] Reference will now be made in detail to specific aspects of the disclosed materials, therapeutic agents, compositions, and methods, examples of which are illustrated in the accompanying Examples.
[0100] Compounds
[0101] Molecular inhibitors of pulmonary hypertension are disclosed. Particularly, small molecules that differentially affect rewired pulmonary hypertension-related gene clusters are disclosed. Piperlongumine analogs and derivatives are disclosed here as being selectively sensitive to a hot-spot gene cluster that is dependent upon the iron-sulfur biogenesis gene ISCU, where deficiency drives pulmonary hypertension. Piperlongumine analogs and derivatives thereof are also disclosed herein to inhibit glutathione S-transferase pi 1 (GSTP1), an enzyme that conjugates proteins and compounds with reduced glutathione. Inhibition of GSTP1 is shown to increase ISCU protein stability via preventing glutathionylation and/or protein expression, thereby increasing oxidative metabolism and decreased PAEC apoptosis.
[0102] The piperlongumine analogs or derivatives thereof can have a structure below:
##STR00002## [0103] wherein [0104] A.sub.1 is C(O) or S(O).sub.2; [0105] A.sub.2 is selected from CC or C(R)C(R), wherein R and R are independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halogen, or C.sub.1-C.sub.6 haloalkyl; [0106] X is selected from CH(R), C(O), SO, SO.sub.2, or NR, wherein R is selected from hydrogen, halogen, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.1-C.sub.6 alkoxy, or C.sub.1-C.sub.6 haloalkyl; [0107] Y.sub.1-Y.sub.10 are independently selected from an heteroatom or carbon; [0108] D is selected from CC or C(R)C(R), wherein R and R are independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halogen, or C.sub.1-C.sub.6 haloalkyl; [0109] R.sub.1, R.sub.1, and R.sub.1 are independently selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, or nitro, and wherein R.sub.1 is optionally substituted with one or more groups; [0110] R.sub.2, R.sub.2, R.sub.3, R.sub.4, and R.sub.4 are independently selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, nitro, carboxyl, ester, hydroxylamine, carbonyl substituted hydroxylamine, or thiol; [0111] R.sub.5, R.sub.6, R.sub.7, R.sub.8, and R.sub.9 are independently selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, nitro, carboxyl, ester, hydroxylamine, carbonyl substituted hydroxylamine, or thiol; [0112] n is 1 or 2; and [0113] ------- represents a bond that is present of absent; [0114] or a pharmaceutically acceptable salt, ester, or prodrug thereof.
[0115] In some aspects of the formula disclosed herein, the piperlongumine analogs or derivatives thereof can have a structure according to Formula I:
##STR00003## [0116] wherein [0117] A.sub.1 is C(O) or S(O).sub.2; [0118] A.sub.2 is selected from CC or C(R)C(R), wherein R and R are independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halogen, or C.sub.1-C.sub.6 haloalkyl; [0119] X is selected from CH(R), C(O), SO, SO.sub.2, or NR, wherein R is selected from hydrogen, halogen, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.1-C.sub.6 alkoxy, or C.sub.1-C.sub.6 haloalkyl; [0120] D is selected from CC or C(R)C(R), wherein R and R are independently selected from hydrogen, C.sub.1-C.sub.6 alkyl, C.sub.1-C.sub.6 alkoxy, halogen, or C.sub.1-C.sub.6 haloalkyl; [0121] R.sub.1 is selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, or nitro, and wherein R.sub.1 is optionally substituted with one or more groups; [0122] R.sub.2, R.sub.3, and R.sub.4 are independently selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, nitro, carboxyl, ester, hydroxylamine, carbonyl substituted hydroxylamine, or thiol; [0123] R.sub.5, R.sub.6, R.sub.7, R.sub.8, and R.sub.9 are independently selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, nitro, carboxyl, ester, hydroxylamine, carbonyl substituted hydroxylamine, or thiol; [0124] n is 1 or 2; and [0125] ------- represents a bond that is present of absent; [0126] or a pharmaceutically acceptable salt, ester, or prodrug thereof.
[0127] In some embodiments of Formula I, the piperlongumine analog or derivative thereof can have a structure according to Formula I-A:
##STR00004## [0128] wherein [0129] X is selected from CH(R), C(O), SO, SO.sub.2, or NR, wherein R is selected from hydrogen, halogen, C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.1-C.sub.6 alkoxy, or C.sub.1-C.sub.6 haloalkyl; [0130] R.sub.1 is selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, or nitro, and wherein R.sub.1 is optionally substituted with one or more groups; [0131] R.sub.2, R.sub.3, and R.sub.4 are independently selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, nitro, carboxyl, ester, hydroxylamine, carbonyl substituted hydroxylamine, or thiol; [0132] R.sub.5, R.sub.6, R.sub.7, R.sub.8, and R.sub.9 are independently selected from hydrogen, halogen, alkyl, haloalkyl, heteroalkyl, alkenyl, haloalkenyl, alkynyl, haloalkynyl, alkoxy, haloalkoxy, amine, alkylamine, amide, alkylamide, hydroxyl, cycloalkyl, heterocycloalkyl, cyano, nitro, carboxyl, ester, hydroxylamine, carbonyl substituted hydroxylamine, or thiol; [0133] n is 1 or 2; and [0134] ------- represents a bond that is present of absent; [0135] or a pharmaceutically acceptable salt, ester, or prodrug thereof.
[0136] In some embodiments of the Formulas disclosed herein, A.sub.1 can be CO.
[0137] In some embodiments of the Formulas disclosed herein, A.sub.2 can be CC.
[0138] In some embodiments of the Formulas disclosed herein, A.sub.1 can be CO and A.sub.2 can be C C.
[0139] In some embodiments of the Formulas disclosed herein, X can be CH.sub.2.
[0140] In some embodiments of the Formulas disclosed herein, D can be C(R)C(R), and wherein R and R are independently selected from hydrogen or C.sub.1-C.sub.3 alkyl.
[0141] In some embodiments of the Formulas disclosed herein, R.sub.2, R.sub.3, R.sub.4, and R.sub.7 can all be C.sub.1-C.sub.3 alkoxy, preferably methoxy.
[0142] In some embodiments of the Formulas disclosed herein, R.sub.5, R.sub.6, R.sub.8, and R.sub.9 can all hydrogen.
[0143] In some examples, the piperlongumine analog can have a structure below:
##STR00005##
[0144] Also disclosed are pharmaceutical compositions that comprise a compound disclosed herein in combination with a pharmaceutically acceptable carrier. Pharmaceutical compositions adapted for oral, topical or parenteral administration, comprising an amount of a compound constitute a preferred aspect. The dose administered to a patient, particularly a human, should be sufficient to achieve a therapeutic response in the patient over a reasonable time frame, without lethal toxicity, and preferably causing no more than an acceptable level of side effects or morbidity. One skilled in the art will recognize that dosage will depend upon a variety of factors including the condition (health) of the subject, the body weight of the subject, kind of concurrent treatment, if any, frequency of treatment, therapeutic ratio, as well as the severity and stage of the pathological condition.
[0145] For the treatment of pulmonary hypertension, the piperlongumine analog or derivative described herein can be administered to a patient in need of treatment in combination with at least one additional agent effective to treat pulmonary hypertension. For example, piperlongumine analog or derivative described herein can be used in combination with at least one additional agents selected from one or more of phosphodiesterase inhibitors, calcium channel blockers, endothelin receptor antagonists, inotropic agents, prostacyclin pathway agonists, anti-coagulants, guanylate cyclase stimulators, PDE-5 inhibitors, or a combination thereof. In some instances, the additional agent can be a PDE-5 inhibitor, for example, avanafil, lodenafil, mirodenafil, sildenafil, tadalafil, vardenafil, udenafil, zaprinast, or icariin. Other agents include calcium channel blockers like dihydropyridines (e.g., amlodipine, nifefipine) and diltiazem; prostacyclin pathway agonists such as epoprostenol, treprostinil, iloprost, and selexipag; endothelin receptor antagonists such as bosentan, macitentan, ambrisentan, andsitaxsentan; guanylate cyclase stimulators such as riociguat; diuretics; toprimate; fusadil; or anti-coagulants like warfarin.
[0146] Methods of Use
[0147] As described herein, new pathogenic mechanisms in pulmonary hypertension have been identified and molecular inhibitors thereof are disclosed. It has been demonstrated that GSTP1 (glutathione S-transferase P1) regulates ISCU of GSSG which results in site-specific S-glutathionylation within ISCU on one or two cysteine residues. It has been shown that GSTP1 regulates ISCU stability by S-glutathionlyation. These observations indicate that GSTP1 have important role to regulate the endothelial ISCU function in pulmonary hypertension. Modulators of the GSTP1-ISCU axis in pulmonary hypertension represents a new target pathway for therapeutic development.
[0148] Piperlongumine analogs and derivatives thereof are shown as being selectively sensitive to a hot-spot gene cluster that is dependent upon the iron-sulfur biogenesis gene ISCU, where deficiency drives pulmonary hypertension. In vitro and in vivo models of PAH show the piperlongumine analog BRD-K34222889 inhibit glutathione S-transferase P (GSTP1), which increased ISCU protein stability via preventing glutathionylation and thereby increased oxidative metabolism and decreased PAEC apoptosis.
[0149] Disclosed herein are methods for treating pulmonary hypertension in a subject in need thereof. Pulmonary hypertension can be classified as either primary or secondary. When hypertension is not accompanied, or caused by another underlying heart or lung disease or condition, it is called primary pulmonary arterial hypertension. When hypertension is triggered by another disease state, it is designated secondary arterial pulmonary hypertension. Exemplary conditions which can cause secondary pulmonary hypertension include congenital heart defects, ventricular or atrial septal defects/holes, which are in some cases called Eisenmenger complex, as well as valve conditions such as stenosis. The methods disclosed herein include treating pulmonary arterial hypertension. Further disclosed herein are methods of treating a disorder associated with ISCU protein instability or deficiency in a subject in need thereof. Disorders associated with ISCU protein instability can include pulmonary hypertension.
[0150] In some aspects of the disclosed methods of treating pulmonary hypertension or disorder associated with ISCU protein instability, the methods can comprise administering a therapeutically effective amount of a pharmaceutical composition that inhibits glutathione S-transferase P (GSTP1). In some aspects of the disclosed methods of treating pulmonary hypertension, the methods can comprise administering a therapeutically effective amount of a pharmaceutical composition that increase iron-sulfur cluster assembly (ISCU) protein stability, increase ISCU expression, or a combination thereof. For example, the methods can include administering a therapeutically effective amount of a piperlongumine analog, such as BRD-K34222889, or a derivative thereof. The piperlongumine analog or derivative thereof can have a structure according to Formula I or I-A as described herein. In some instances, the GSTP1 inhibitor (such as piperlongumine analog) can inhibit or reduce pulmonary arterial endothelial cell (PAEC) apoptosis in the subject. In some instances, the GSTP1 inhibitor (such as piperlongumine analog) can increase iron-sulfur cluster assembly (ISCU) protein stability, increase ISCU protein expression, or a combination thereof, in the subject. In some instances, the GSTP1 inhibitor (such as piperlongumine analog) can increase oxidative metabolism and/or decreases pulmonary arterial endothelial cell (PAEC) apoptosis in the subject.
[0151] Methods for diagnosing pulmonary hypertension in a subject in need thereof are also disclosed. The method can include detecting an expression level of glutathione S-transferase P (GSTP1) in a sample obtained from the subject; comparing the level of expression of GSTP1 in the sample compared to a control sample; diagnosing the subject as having pulmonary hypertension when the level of expression of GSTP1 in the sample is higher than the level of expression in the control sample; and treating the subject for pulmonary hypertension when the quantity of GSTP1 in the sample indicates elevated levels of GSTP1 compared to the control sample. Detecting the level of expression in the sample (a) and the control sample (b) can comprises: assaying the sample or control sample using a GSTP1 antibody or isolating GSTP1 from the sample and subjecting the isolated GSTP1 to quantitative spectrometry. The GSTP1 antibody or GSTP1 can be conjugated to a fluorescent moiety or a radioactive moiety in the diagnostic methods.
[0152] Methods of assaying the efficacy of a compound for treating pulmonary hypertension are also disclosed. The method can include expressing glutathione S-transferase P (GSTP1) in a sample obtained from a subject; contacting the sample with the compound; and testing whether GSTP1 is inhibited in the sample. In some embodiments, the compound can include a piperlongumine analog or a derivative thereof.
[0153] In some instances, the compounds and compositions can be administered to a subject a single time, while in other cases compounds and compositions can be administered using an intervallic dosing regimen. For instance, compounds and compositions may be administered once, twice, or three times a day for a period of at least 1 week, for example 2 weeks, 4 weeks, 6 weeks, 8 weeks, 10 weeks, 20 weeks, 40 weeks, or 52 weeks. In some instances, compounds and compositions administration can be suspended for some period of time (e.g., 1, 2, 3, 4, 6, 8, 10, 20, 40 or 52 weeks) followed by another period of administration.
[0154] In some instances, an initial dosage (higher dose, relative to maintenance dose) and maintenance doses (lower dose, relative to initial dose) may be specified. For instance, an initial dosage may be administered over the course of 1, 3, 5, 7, 10, 14, 21 or 28 days, followed by a maintenance dosage which is administered for the duration of the treatment. In some instances, the compounds and compositions can be administered to the subject using an interval greater than a day. For instance, the compounds and compositions can be administered once every other day, once every third day, once a week, once every two weeks, once every four weeks, once a month, once every other month, once every third month, once every six months, or once a year. In some instance, injectable formulations, such as depot formulations, are suitable for dosing regimens with extended periods in between administration, however, oral formulations can also be used in such systems.
[0155] The dosage and dosage regimen may be calculated per kg body weight. The dosage regimen may vary from a day to a month. In some examples, the compositions disclosed herein may be administered at least once, twice or thrice a day in the dosing range from 0.05 mg to about 30 mg per kg per day, 0.1 mg to about 10 mg per kg per day, 0.5 mg to about 10 mg per kg per day, 0.5 mg to about 5 mg per kg per day, 1 mg to about 5 mg per kg per day, or as per the requirement of the patient to be treated.
[0156] The compounds and compositions may be provided in the form of a pharmaceutical composition such as but not limited to, unit dosage forms including tablets, capsules (filled with powders, pellets, beads, mini-tablets, pills, micro-pellets, small tablet units, multiple unit pellet systems (MUPS), disintegrating tablets, dispersible tablets, granules, and microspheres, multiparticulates), sachets (filled with powders, pellets, beads, mini-tablets, pills, micro-pellets, small tablet units, MUPS, disintegrating tablets, dispersible tablets, granules, and microspheres, multiparticulates), powders for reconstitution, transdermal patches and sprinkles, however, other dosage forms such as controlled release formulations, lyophilized formulations, modified release formulations, delayed release formulations, extended release formulations, pulsatile release formulations, dual release formulations and the like. Liquid or semisolid dosage form (liquids, suspensions, solutions, dispersions, ointments, creams, emulsions, microemulsions, sprays, patches, spot-on), injection preparations, parenteral, topical, inhalations, buccal, nasal etc. may also be envisaged under the ambit of the disclosure.
[0157] In some instances, the compounds and compositions can be administered by inhalation, for instance as a powder or aerosolizable formulation.
[0158] The bioavailability of the drug in a composition, depends on various attributes of the drug as well as the other inactive ingredients in the formulation. The particle size of the drug is one of such attribute that may affect the bioavailability of the drug, when administered to a patient. The particle size may thus be adjusted as per the requirements of the disclosure. In one embodiment, the compounds and compositions may be present in the form of nanoparticles which have an average particle size of less than 2000 nm, less than 1500 nm, less than 1000 nm, less than 750 nm, or less than 500 nm.
[0159] Suitable excipients may be used for formulating the dosage forms according to the present disclosure such as, but not limited to, surface stabilizers or surfactants, viscosity modifying agents, polymers including extended release polymers, stabilizers, disintegrants or super disintegrants, diluents, plasticizers, binders, glidants, lubricants, sweeteners, flavoring agents, anti-caking agents, opacifiers, anti-microbial agents, antifoaming agents, emulsifiers, buffering agents, coloring agents, carriers, fillers, anti-adherents, solvents, taste-masking agents, preservatives, antioxidants, texture enhancers, channeling agents, coating agents or combinations thereof.
[0160] In some instance, injectable formulations, such as depot formulations, are suitable for dosing regimens with extended periods in between administration, however, oral formulations can also be used in such systems.
[0161] In some embodiments, pulmonary arterial hypertension can be alleviated or treated by administration of piperlongumine analogs and derivatives disclosed herein in combination with one or more other drugs either simultaneously, sequentially, or separately.
[0162] In certain embodiments, the administration of the compounds and compositions disclosed, either alone or in combination with one or more drugs selected from but not limited to phosphodiesterase inhibitors such as sildenafil, tadalafil etc., endothelin receptor antagonists such as bosentan, macitentan etc., and stimulators of soluble guanylate cyclase such as riociguat.
[0163] In certain embodiments, the compounds and compositions can be co-administered with one or more additional agents effective to lower pulmonary hypertension. In some embodiments the co-administration includes a unitary dosage form containing desipramine (or a salt thereof) and at least one more agent. In other embodiments, desipramine (or a salt thereof) is administered separately from the other agent(s). The additional agent can be a PDE-5 inhibitor, for example, avanafil, lodenafil, mirodenafil, sildenafil, tadalafil, vardenafil, udenafil, zaprinast, or icariin. Other agents include calcium channel blockers like dihydropyridines (e.g., amlodipine, nifefipine) and diltiazem; prostacyclin pathway agonists such as epoprostenol, treprostinil, iloprost, and selexipag; endothelin receptor antagonists such as bosentan, macitentan, ambrisentan, andsitaxsentan; guanylate cyclase stimulators such as riociguat; diuretics; toprimate; fusadil; or anti-coagulants like warfarin.
[0164] It may be well appreciated by a person skilled in the art that the pharmaceutical composition comprising piperlongumine analogs or derivatives disclosed herein in combination with one or more drugs may require specific dosage amounts and specific frequency of administrations specifically considering their individual established doses, the dosing frequency, patient adherence and the regimen adopted. As described herein, considering that there are various parameters to govern the dosage and administration of the combination composition as disclosed herein, it would be well acknowledged by a person skilled in the art to exercise caution with respect to the dosage, specifically, for special populations associated with other disorders.
[0165] The use of piperlongumine analogs or derivatives thereof may preferably be associated with one or more of the above referenced drugs as a combination therapy (either of the same functional class or other) depending on various factors like drug-drug compatibility, patient compliance and other such factors wherein the said combination therapy may be administered either simultaneously, sequentially, or separately for the treatment of PAH.
[0166] Piperlongumine analogs or derivatives thereof may be provided with one or more drugs in the form of a kit, wherein the kit includes piperlongumine analog or a derivative thereof and at least one other drug, and instructions for their administration to a PAH patient.
[0167] Administration
[0168] The term administration and variants thereof (e.g., administering a compound) in reference to a compound disclosed herein means introducing the compound or a derivative of the compound into the system of the animal in need of treatment. When a compound or derivative thereof is provided in combination with one or more other active agents, administration and its variants are each understood to include concurrent and sequential introduction of the compound or prodrug thereof and other agents.
[0169] In vivo application of the disclosed compounds, and compositions containing them, can be accomplished by any suitable method and technique presently or prospectively known to those skilled in the art. For example, the disclosed compounds can be formulated in a physiologically- or pharmaceutically-acceptable form and administered by any suitable route known in the art including, for example, oral, nasal, rectal, topical, and parenteral routes of administration. As used herein, the term parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraperitoneal, and intrasternal administration, such as by injection. Administration of the disclosed compounds or compositions can be a single administration, or at continuous or distinct intervals as can be readily determined by a person skilled in the art.
[0170] The compounds disclosed herein can be formulated according to known methods for preparing pharmaceutically acceptable compositions. Formulations are described in detail in a number of sources which are well known and readily available to those skilled in the art. For example, Remington's Pharmaceutical Science by E. W. Martin (1995) describes formulations that can be used in connection with the disclosed methods. In general, the compounds disclosed herein can be formulated such that an effective amount of the compound is combined with a suitable carrier in order to facilitate effective administration of the compound. The compositions used can also be in a variety of forms. These include, for example, solid, semi-solid, and liquid dosage forms, such as tablets, pills, powders, liquid solutions or suspension, suppositories, injectable and infusible solutions, and sprays. The preferred form depends on the intended mode of administration and therapeutic application. The compositions also preferably include conventional pharmaceutically-acceptable carriers and diluents which are known to those skilled in the art. Examples of carriers or diluents for use with the compounds include ethanol, dimethyl sulfoxide, glycerol, alumina, starch, saline, and equivalent carriers and diluents. To provide for the administration of such dosages for the desired therapeutic treatment, compositions disclosed herein can advantageously comprise between about 0.1% and 99%, and especially, 1 and 15% by weight of the total of one or more of the subject compounds based on the weight of the total composition including carrier or diluent.
[0171] Formulations suitable for administration include, for example, aqueous sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient; and aqueous and nonaqueous sterile suspensions, which can include suspending agents and thickening agents. The formulations can be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and can be stored in a freeze dried (lyophilized) condition requiring only the condition of the sterile liquid carrier, for example, water for injections, prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powder, granules, tablets, etc. It should be understood that in addition to the ingredients particularly mentioned above, the compositions disclosed herein can include other agents conventional in the art having regard to the type of formulation in question.
[0172] Compounds disclosed herein, and compositions comprising them, can be delivered to a cell either through direct contact with the cell or via a carrier means. Carrier means for delivering compounds and compositions to cells are known in the art and include, for example, encapsulating the composition in a liposome moiety. Another means for delivery of compounds and compositions disclosed herein to a cell comprises attaching the compounds to a protein or nucleic acid that is targeted for delivery to the target cell. U.S. Pat. No. 6,960,648 and U.S. Application Publication Nos. 20030032594 and 20020120100 disclose amino acid sequences that can be coupled to another composition and that allows the composition to be translocated across biological membranes. U.S. Application Publication No. 20020035243 also describes compositions for transporting biological moieties across cell membranes for intracellular delivery. Compounds can also be incorporated into polymers, examples of which include poly (D-L lactide-co-glycolide) polymer; poly[bis(p-carboxyphenoxy) propane:sebacic acid] in a 20:80 molar ratio (as used in GLIADEL); chondroitin; chitin; and chitosan.
[0173] Compounds and compositions disclosed herein can be locally administered at one or more anatomical sites, e.g., injected or topically applied), optionally in combination with a pharmaceutically acceptable carrier such as an inert diluent. Compounds and compositions disclosed herein can be systemically administered, such as intravenously or orally, optionally in combination with a pharmaceutically acceptable carrier such as an inert diluent, or an assimilable edible carrier for oral delivery. They can be enclosed in hard or soft shell gelatin capsules, can be compressed into tablets, or can be incorporated directly with the food of the patient's diet. For oral therapeutic administration, the active compound can be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, aerosol sprays, and the like.
[0174] The tablets, troches, pills, capsules, and the like can also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring can be added. When the unit dosage form is a capsule, it can contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials can be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules can be coated with gelatin, wax, shellac, or sugar and the like. A syrup or elixir can contain the active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound can be incorporated into sustained-release preparations and devices.
[0175] Compounds and compositions disclosed herein, including pharmaceutically acceptable salts, hydrates, or analogs thereof, can be administered intravenously, intramuscularly, or intraperitoneally by infusion or injection. Solutions of the active agent or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms.
[0176] The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient, which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. The ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. Optionally, the prevention of the action of microorganisms can be brought about by various other antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the inclusion of agents that delay absorption, for example, aluminum monostearate and gelatin.
[0177] Sterile injectable solutions are prepared by incorporating a compound and/or agent disclosed herein in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.
[0178] For topical administration, compounds and agents disclosed herein can be applied in as a liquid or solid. However, it will generally be desirable to administer them topically to the skin as compositions, in combination with a dermatologically acceptable carrier, which can be a solid or a liquid. Compounds and agents and compositions disclosed herein can be applied topically to a subject's skin to reduce the size (and can include complete removal) of malignant or benign growths, or to treat an infection site. Compounds and agents disclosed herein can be applied directly to the growth or infection site. Preferably, the compounds and agents are applied to the growth or infection site in a formulation such as an ointment, cream, lotion, solution, tincture, or the like. Drug delivery systems for delivery of pharmacological substances to dermal lesions can also be used, such as that described in U.S. Pat. No. 5,167,649.
[0179] Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water-alcohol/glycol blends, in which the compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers, for example.
[0180] Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user. Examples of useful dermatological compositions which can be used to deliver a compound to the skin are disclosed in U.S. Pat. Nos. 4,608,392; 4,992,478; 4,559,157; and 4,820,508.
[0181] Useful dosages of the compounds and agents and pharmaceutical compositions disclosed herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949.
[0182] Kits
[0183] Kits for practicing the methods disclosed herein are further provided. By kit is intended any manufacture (e.g., a package or a container) comprising at least one reagent, e.g., anyone of the compounds described herein. The kit may be promoted, distributed, or sold as a unit for performing the methods disclosed herein. Additionally, the kits may contain a package insert describing the kit and methods for its use. Any or all of the kit reagents may be provided within containers that protect them from the external environment, such as in sealed containers or pouches.
[0184] To provide for the administration of such dosages for the desired therapeutic treatment, in some embodiments, pharmaceutical compositions disclosed herein can comprise between about 0.1% and 45%, and especially, 1 and 15%, by weight of the total of one or more of the compounds based on the weight of the total composition including carrier or diluents. Illustratively, dosage levels of the administered active ingredients can be: intravenous, 0.01 to about 20 mg/kg; intraperitoneal, 0.01 to about 100 mg/kg; subcutaneous, 0.01 to about 100 mg/kg; intramuscular, 0.01 to about 100 mg/kg; orally 0.01 to about 200 mg/kg, and preferably about 1 to 100 mg/kg; intranasal instillation, 0.01 to about 20 mg/kg; and aerosol, 0.01 to about 20 mg/kg of animal (body) weight.
EXAMPLES
[0185] The following examples are set forth below to illustrate the methods and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention, which are apparent to one skilled in the art.
[0186] Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in C. or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of reaction conditions, e.g., component concentrations, temperatures, pressures, and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.
Example 1Computational Repurposing of Therapeutic Small Molecules from Cancer to Pulmonary Hypertension
[0187] ABSTRACT. Cancer therapies are being considered for treating rare non-cancerous diseases like pulmonary hypertension (PH), but effective computational screening is lacking. Via transcriptomic differential dependency analyses leveraging parallels between cancer and pulmonary hypertension, a landscape of cancer drug functions dependent upon rewiring of pulmonary hypertension gene clusters was mapped. Bromodomain and extra-terminal motif (BET) protein inhibitors were predicted to rely upon several gene clusters inclusive of galectin-8 (LGALS8). Correspondingly, LGALS8 was found to mediate the BET inhibitor-dependent control of endothelial apoptosis, an essential role for pulmonary hypertension in vivo. Separately, a piperlongumine analog's actions were predicted to depend upon the iron-sulfur biogenesis gene ISCU. Correspondingly, the analog was found to inhibit ISCU glutathionylation, rescuing oxidative metabolism, decreasing endothelial apoptosis, and improving pulmonary hypertension. Thus, crucial drug-gene axes central to endothelial dysfunction and therapeutic priorities for pulmonary hypertension were identified. These results establish a wide-ranging, network dependency platform to redefine cancer drugs for use in non-cancerous conditions.
[0188] Teaser: A network dependency platform was generated to define a landscape of cancer drug mechanisms in pulmonary hypertension.
[0189] INTRODUCTION. The repurposing of small molecules for disease therapy has gained traction, given the potential to reduce cost and time necessary for de novo drug development. Specifically, computational drug repurposing is emerging as a viable method, leveraging available large-scale clinical and molecular profiling and combining those with in silico methodologies of machine learning, network modeling, and clinical text mining to define new drug activities (Park K. Transl Clin Pharmacol. 2019, 27, 59-63). However, the vast majority of such strategies have depended upon identification of differentially expressed genes (DEGs) (Vanhaelen Q et al. Drug Discov Today. 2017, 22, 210-222), which can define some but not all key intergenic relationships. Molecular network mapping utilizing connections among genes with a tendency to be regulated together (i.e. gene regulatory dependencies) addresses some of the DEG-based analysis limitations. However, because of the large amount of data required for calculating differential dependencies across gene networks, such analytics are often not feasible across the limited -omics datasets of rare or emerging diseases.
[0190] Pulmonary hypertension (PH) represents such an enigmatic vascular disease that consists of 5 World Symposium of Pulmonary Hypertension (WSPH) groups (Simonneau G et al. Eur Respir J 2019, 53, 1801913). In particular, WSPH Group 1 (pulmonary arterial hypertension, PAH) and Group 3 (due to hypoxic lung disease) pulmonary hypertension subtypes are driven by shared triggers of hypoxia and inflammation, and mortality is high. Current medications primarily vasodilate, are mostly used to treat Group 1 pulmonary arterial hypertension, and are not curative. Thus, an unmet need exists for new drug discovery. In particular, endothelial pathobiology is a characteristic and pathogenic feature of pulmonary hypertension contributing to the inflammation and aberrant vascular remodeling observed in this disease (Evans C E et al. Eur Respir J. 2021, 2003957). However, due to complex spatio-temporal manifestations that balance critical processes such as apoptosis and proliferation during disease progression (Michelakis E D. Circ Res. 2006, 98, 172-175; Goldthorpe H et al. Am J Respir Cell Mol Biol. 2015, 53, 712-718), therapeutic targeting of endothelial dysfunction in pulmonary hypertension has been challenging. The advancing appreciation of broad molecular parallels between pulmonary hypertension and cancer in general (Pullamsetti S S et al. Am J Respir Crit Care Med. 2017, 195, 425-437), as well as the direct link between developing pulmonary hypertension in the setting of lung cancer specifically (Pullamsetti S S et al. Sci Transl Med. 2017, 9, eaai9048), have increased enthusiasm for repurposing existing small molecule inhibitors from cancer to pulmonary hypertension (Prins K W et al. J Am Heart Assoc. 2019, 8, e011343). This may be particularly relevant for precise therapeutic targeting of dysregulated endothelial survivala process also crucial for hypoxic and inflammatory-driven tumorigenesis (Dudley A C. Cold Spring Harb Perspect Med. 2012, 2, a006536). To date, however, the broad molecular profiling existing in cancer datasets has yet to be leveraged for such pulmonary hypertension drug discovery. As such, mapping gene regulatory dependency networks relevant to pulmonary hypertension and investigating rewiring of these networks in connection to cancer drug activity present a unique opportunity. Here, it was hypothesized that deep analysis of the relationship between drug response and molecular rewiring in cancer cells of pathways implicated both in pulmonary hypertension and cancer will offer insight into how vascular cells in pulmonary hypertension will respond to specific drugs, and in turn support repurposing of these drugs for pulmonary hypertension.
[0191] To investigate this notion, the design of a computational strategy identifying differential dependency networks (DDNs) of genes in cancer cells associated with drug response and also overlapping with a rare disease such as pulmonary hypertension was sought. Namely, the capabilities of EDDY (Evaluation of Differential DependencY) (Jung S et al. Nucleic Acids Res. 2014, 42, e60), a prior-knowledge-assisted algorithm that defines differential dependency networks based on the rewiring of dependency interactions among genes in a network under different conditions, for example, cancer cell's response to drug, were applied. EDDY has been utilized in the study of human diseases (Jung S et al. Nucleic Acids Res. 2014, 42, e60) as well as transcriptomic analyses from human pulmonary hypertension lung tissue (Stearman R S et al. Am J Respir Cell Mol Biol. 2018, 60, 637-649) to identify differential dependency networks in disease. Importantly, EDDY was applied to a dataset derived from the Cancer Cell Line Encyclopedia (CCLE; encompassing a catalog of RNA sequencing data from 810 cancer cell lines (Barretina J et al. Nature. 2012, 483, 603-607)), and the Cancer Therapeutics Response Portal (CTRP; surveying the response of those cell lines to 368 small molecules (Seashore-Ludlow B et al. Cancer Discov. 2015, 5, 1210-1223; Rees M G et al. Nat Chem Biol. 2016, 12, 109-116)). In doing so, for each cancer drug surveyed, this EDDY-CTRP identified differential dependency networks that define drug response by virtue of their specific rewiring in sensitive vs. resistant cells (Speyer G et al. Pac Symp Biocomput. 2017, 22, 497-508).
[0192] Leveraging those principles, a computational platform (EDDY-CTRP-PH) was developed to predict the landscape of cancer drug functions that rely upon rewired differential dependency networks of genes common to cancer and pulmonary hypertension as well as have shared links to hypoxia and inflammationthus exerting robust activity in controlling multiple pulmonary hypertension subtypes. Two highly ranked candidate drugs and their predicted gene network effectors were identified and experimentally tested. First, bromodomain and extra-terminal motif (BET) protein inhibitors, which target the epigenetic modifiers bromodomain containing 2/4 (Brd2/4) and are already being tested in pulmonary hypertension (Meloche J et al. Circ Res. 2015, 117, 525-535; Chabert C et al. Int J Mol Sci. 2018, 19, 2224; Van der Feen D E et al. Am J Respir Crit Care Med. 2019, 200, 910-920), were predicted to selectively affect a pulmonary hypertension gene cluster encompassing galectin-8 (LGALS8). LGALS8, a member of the galectin family that regulates inflammation (Cattaneo V et al. Glycobiology. 2014, 24, 966-973) and apoptosis (Hadari Y R et al. J Cell Sci. 2000, 113 (Pt 13), 2385-2397), has not been previously implicated in pulmonary hypertension nor connected to BET inhibitors. Second, an analog of the alkaloid piperlongumine, BRD-K34222889 or BRD2889 (Adams D J et al. Proc Natl Acad Sci USA. 2012, 109, 15115-15120), was predicted to selectively target a pulmonary hypertension cluster dependent on the iron-sulfur biogenesis gene ISCU. While deficiency of endothelial ISCU is known to drive pulmonary hypertension (White K et al. EMBO Mol Med. 2015, 7, 695-713), and piperlongumine and its analogs are reported to inhibit glutathione S-transferase pi 1 (GSTP1) (Harshbarger W et al. J Biol Chem. 2017, 292, 112-120), any functional connections among BRD2889 and GSTP1 to ISCU and to pulmonary hypertension have yet to be reported. Thus, by coupling in vitro and in vivo experimentation with in silico findings, the definition of a computational-to-empirical pipeline was sought for identifying and ranking the most robust actions of specific cancer therapeutics, revealing their disease-relevant downstream targets in an example of a rare non-cancerous disease such as pulmonary hypertension.
[0193] Results
[0194] EDDY-CTRP-PH: In silico mapping of small molecules that depend upon rewired pulmonary hypertension-specific differential dependency networks for activity. To identify pulmonary hypertension-specific differential dependency networks that mediate crucial cellular responses to specific small molecules, a catalog of gene networks integral to pulmonary hypertension pathogenesis was necessary for initial input. Building upon prior methodology (Bertero T et al. J Biol Chem. 2014, 290, 2069-2085), 55 pulmonary hypertension-relevant gene clusters were identified (Table 1-Table 2) and analyzed by EDDY in the context of the CCLE and CTRP datasets (EDDY-CTRP-PH workflow,
[0195] To assess the landscape of functional connections catalogued by EDDY-CTRP-PH, small molecules and clusters were sorted according to their rewiring scores as defined in Methods (
[0196] The EDDY-CTRP-PH platform also offered granular molecular information via either defining new pulmonary hypertension pathways targeted by known pulmonary hypertension drugs or identifying connections linking new drugs to known pulmonary hypertension pathways. As an example of the former, in addition to being selectively sensitive to a differential dependency network enriched for oxidative metabolism genes via well-established links (Cluster 23) (Ryan J J et al. Circulation. 2015, 131, 1691-1702), the PDK inhibitor AZD7545 was predicted to be associated with the differential dependency networks of immune response Cluster 37 (TNF signaling) and Cluster 26 (CD4 lymphocyte signaling). Similarly, while canonically PDE5 inhibitors are used clinically to treat pulmonary hypertension in the context of nitric oxide signaling and regulation of vasomotor tone, EDDY-CTRP-PH predicted sildenafil as dependent upon rewiring of pulmonary hypertension gene Cluster 28, a cluster enriched particularly with genes involved in apoptosis. Evidence of PDE5 activity in apoptosis and cell survival has more recently been reported (Yamamura A et al. Eur J Pharmacol. 2017, 810, 44-50), offering validation of such predictions. Moreover, differential dependency networks with new and known functions were uncovered for other drugs with already existing pulmonary hypertension connections, including the HDAC inhibitor apicidin and the carbonic anhydrase inhibitor indisulam, among others (Table 1-Table 3, full listing under EDDY-CTRP-PH: Individual Drugs). Alternatively, EDDY offered an ability to define complementary drugs that converge upon a single pulmonary hypertension pathway (full website listing under EDDY-CTRP-PH: Cluster View). For example, eight small molecules were found to converge upon Cluster 6, a network enriched for extracellular matrix (ECM) organization genes (
[0197] EDDY-CTRP-PH identifies a functional connection between BET inhibitors and Cluster 15. Experimental validation of key predictions by EDDY-CTRP-PH, linking as-of-yet undiscovered pulmonary hypertension pathways to drugs currently under therapeutic development, was sought. An example included the epigenetic drug class of BET inhibitors being tested for pulmonary hypertension treatment (Van der Feen D E et al. Am J Respir Crit Care Med. 2019, 200, 910-920). Notably, BET inhibitors have mainly been studied in the context of smooth muscle cells in pulmonary hypertension (Meloche J et al. Circ Res. 2015, 117, 525-535; Chabert C et al. Int J Mol Sci. 2018, 19, 2224), with only a partial identification of BET activity in controlling endothelial processes in this disease (Van der Feen D E et al. Am J Respir Crit Care Med. 2019, 200, 910-920). Three BET inhibitors (JQ-1, I-BET151, and I-BET762) were included in EDDY-CTRP-PH analyses, with I-BET151 emerging as one of the top-ranked drugs (
[0198] I-BET protects against apoptosis and alters C.sub.15 gene expression in pulmonary endothelial cells (PAECs). To predict functional convergence of BET inhibition on specific C.sub.15 genes, the C.sub.15 differential dependency network for the collective actions of all BET inhibitors was reconstructed (
[0199] To determine the relevance of C.sub.15 genes in such endothelial function, expression of C.sub.15 genes was measured under the same conditions. Seven of eleven C.sub.15 genes were expressed in human PAECs, and six of thoseLGALS3, LGALS8, ABCC4, CD47, SLC9A3R1, and DAG1were reversed by I-BET (
[0200] Of the two major isoforms of LGALS8, LGALS8-M and L (Cattaneo V et al. Glycobiology. 2014, 24, 966-973), it was found that LGALS8-L transcript in cultured PAECs was increased by IL-1 and reversed by I-BET, whereas LGALS8-M was reduced by IL-1 but not altered by I-BET (
[0201] To demonstrate the translational relevance of these findings, LGALS8 was stained in pulmonary arterioles (<100 m diameter) of two WSPH subtypes (Table 4): those with severe Group 1 pulmonary arterial hypertension and those Group 3 pulmonary hypertension due to hypoxic lung disease. LGALS8 was upregulated in the pulmonary vasculature, consistent with its known intracellular and extracellular forms and with notable increased expression CD31+ endothelial cells (
[0202] Consistent with the known binding of integrin receptor 301 to LGALS8 in other contexts (Hadari Y R et al. J Cell Sci. 2000, 113 (Pt 13), 2385-2397), integrin 3 (ITG3) binding to LGALS8 in PAECs was demonstrated using a proximity ligation assay (
[0203] I-BET reduces endothelial LGALS8 and improves existing pulmonary arterial hypertension in rats. To investigate whether I-BET controls LGALS8 and pulmonary arterial hypertension in vivo, I-BET was administered i.p. daily in two separate models of Group 1 pulmonary arterial hypertension in ratsmonocrotaline (MCT) exposure followed by 26 days in normoxia and SU5416-hypoxia exposure (3 weeks, Days 0-21) followed by 2 weeks of normoxia (Days 21-35). In both exposures, a disease-reversal protocol was utilized, whereby I-BET was administered only after disease manifested (at Days 12-26 post-MCT and at Days 21-35 after 3 weeks of SU5416-hypoxia) (
[0204] I-BET and genetic deficiency of LGALS8 protect against hypoxic pulmonary hypertension in mice. Stemming from the known link between hypoxia and inflammatory activation (Eltzschig H K et al. N Engl J Med. 2011, 364, 656-665), it was reasoned that IBET-762 and LGALS8 may also be relevant to inflammatory pathways activated in hypoxia and thus in Group 3 pulmonary hypertension due to hypoxic lung disease. As such, in cultured PAECs, it was found that IBET-762 and LGALS8 control inflammatory and apoptotic endothelial pathways driven by hypoxia (
[0205] EDDY-CTRP-PH identifies a functional connection between BRD2889, its target GSTP1, and the Cluster 43 gene ISCU. In addition to predictions of new pathways that mediate actions of drugs already under study for pulmonary hypertension, EDDY-CTRP-PH also offered central insights into small molecules never before investigated in this disease and into their activities that have never before been connected to known pulmonary hypertension pathways. To identify the most robust and new candidate drug-pathway axes, Cluster 43 (C.sub.43), which had the highest level of rewiring across all small molecules tested (
[0206] In PAECs, it was found that BRD2889 directly altered two C.sub.43 gene transcripts, partially reversing the decrease of mTOR and fully reversing the hypoxic decrease of ISCU (
[0207] In PAECs, consistent with known inhibition of GSTP1 by piperlongumine (Adams D J et al. Proc Natl Acad Sci USA. 2012, 109, 15115-15120), while BRD2889 did not affect GSTP1 expression (
[0208] GSTP1 promotes and depends upon ISCU glutathionylation for ameliorating metabolic endothelial dysfunction. Given the connection of BRD2889 and GSTP1 to the control over ISCU and the known action of protein glutathionylation to regulate protein expression and activity (Tew K D et al. Drug Metab Rev. 2011, 43, 179-193), it was hypothesized that GSTP1 controls ISCU via direct protein S-glutathionylation. In PAEC lysate, -GSTP1 immunoprecipitation revealed that ISCU was specifically pulled down with GSTP1 (
[0209] A definition of the functional role of BRD2889 on ISCU glutathionylation (
[0210] Beyond pure hypoxic exposure alone, an appreciation is advancing of the mechanistic connections of ISCU specifically with IL-6 (Virga F et al. Sci Adv. 2021, 7, eabf0466), suggesting the importance of hypoxia and IL-6 together in controlling ISCU-dependent pathophenotypes. Thus, in PAECs exposed to a combination of recombinant IL-6/soluble IL-6 receptor (sIL-6R) and hypoxia, BRD2889 reversed the increase in GSTP1 activity and reversed the decrease in ISCU expression (
[0211] The GSTP1-ISCU axis is active in human pulmonary hypertension, and BRD2889 improves existing pulmonary arterial hypertension across multiple pulmonary arterial hypertension rodent models. To go beyond the limitations of cultured cell data and determine the relevance of the GSTP1-ISCU axis in human pulmonary hypertension, in situ staining of pulmonary arterioles of WSPH Groups 1 and 3 pulmonary hypertension patients revealed a reduction of ISCU and increase of GSTP1 in CD31+ endothelial cells compared with non-pulmonary hypertension patients (
[0212] Similarly, BRD2889 was administered in a disease-reversal dosing protocol in the same two pulmonary arterial hypertension rat models tested for I-BET762-MCT and SU5416-hypoxic rats (
[0213] DISCUSSION In this study, the computational strengths of differential dependency analysis were leveraged to develop EDDY-CTRP-PH as a platform to predict the landscape of cancer drug functions controlling rare non-cancerous conditions such as pulmonary hypertension. BET inhibitors and BRD2889 separately were predicted and demonstrated experimentally to modulate endothelial LGALS8 and GSTP1-ISCU, respectively, under hypoxic and inflammatory conditions, thus controlling pulmonary hypertension in vivo. The results pinpoint specific compounds for future therapeutic repurposing in endothelial pathobiology across multiple pulmonary hypertension subtypes. More broadly, these findings offer wide-ranging implications for the advancement of computational network pharmacology and repurposing of drugs from cancer to other rare and often neglected conditions of health and disease (
[0214] Drug repurposing has been viewed as an attractive method for reducing the cost and time of drug development, particularly for rare diseases like pulmonary hypertension where investment is lower than other prevalent diseases (Polamreddy P et al. Drug Discov Today. 2018, 24, 789-795). Relevant to the COVID-19 pandemic, repurposing has also been pursued for emerging diseases where prior knowledge of pathogenic target genes or pathways can be used as a linchpin for systems-wide predictions of therapeutic drug activity (Gordon D E et al. Nature. 2020, 583, 459-468). Here, the computational strengths in gene dependency analyses of EDDY-CTRP-PH coupled with the vast cancer cell data answer an unmet need for a rapid and systems-wide method to identify therapies for rare diseases, such as pulmonary hypertension, without a priori knowledge of the molecular drug target of interest. As deep sequencing projects mature for pulmonary hypertension and are continually applied to EDDY-CTRP-PH, broader predictions of drug-pathway interactions will be possible, extending beyond the existing pulmonary hypertension gene clusters derived from curated literature searches and the known gene interactome. This may be particularly relevant for epigenetic and pleiotropic regulators such as BET inhibitors. Given the increasing appreciation of links of lung cancer specifically to pulmonary hypertension (Prins K W et al. J Am Heart Assoc. 2019, 8, e011343), EDDY-CTRP-PH predictions could also be further honed by concentrating only on lung cancer cell responses to various tested compounds. Extension of advancing deep learning methods utilizing scientific literature with computational linguistics and graph theory (Gramatica R et al. PLoS One. 2014, 9, e84912), epidemiologic data (Shameer F et al. AMIA Jt Summits Transl Sci Proc. 2018, 2017, 108-117), and advanced network theory (Cheng F et al. Nat Commun. 2018, 9, 2691) with EDDY-CTRP-PH would be attractive. Such endeavors could offer predictions of cancer drug activity in diseases beyond pulmonary hypertension, the cell-type and context specificity of drugs, a pharmacologic differentiation of therapeutic vs. toxic drug activities across disease contexts, and the synergistic responses to specific small molecules. Moreover, with the statistical power to map differential dependency networks within a single blood or tissue sample via single cell sequencing, future applications of EDDY-CTRP-PH to precision medicine could be envisioned via identification of individuals and/or disease subtypes with specific differential dependency network profiles who are most likely to respond to repurposed cancer drugs.
[0215] The experimental validation of EDDY-CTRP-PH also advances the understanding of complex cellular pathways in pulmonary hypertension and offers guidance for translation of both I-BET762 and BRD2889 to pulmonary hypertension. First, for both drugs, their therapeutic roles emphasized the importance of endothelial pathobiology in pulmonary hypertension, with both long-term and immediate translational implications, as early human clinical trials are underway for BET inhibitors in pulmonary arterial hypertension (NCT03655704). Second, EDDY-CTRP-PH identified multiple rewiring events for these molecules, particularly in the hotspot and extensively altered clusters C.sub.15 and C.sub.43. Notably, some C.sub.15 genes were previously implicated in pulmonary hypertension supporting the accuracy of these predictions: for example, inhibition of ABCC4 improved pulmonary hypertension in mice (Hara Y et al. J Clin Invest. 2011, 121, 2888-2897) and identification of LGALS3 (galectin-3) as a pathogenic factor in pulmonary hypertension (Barman S A et al. Am J Respir Crit Care Med. 2018, 197, 1488-1492) and right ventricular fibrosis (Crnkovic S et al. Am J Respir Crit Care Med. 2018, 199, 1550-1560). In parallel, certain C.sub.43 genes have also been implicated in pulmonary hypertension, namely MTOR and its control over proliferative and survival programs (Goncharova E A. FASEB J. 2013, 27, 1796-1807). Yet, the large majority of functional drug-pulmonary hypertension gene axes implicated here by EDDY have never been identified previously, offering a different scale of predictions and advancing understanding of the layers of interconnections among seemingly disparate mechanisms.
[0216] Separately, the computational predictions and experimental work implicate LGALS8 and GSTP1 as crucial effectors of endothelial dysfunction in pulmonary hypertension. In regard to LGALS8, prior studies characterized pro-inflammatory activities of this molecule in endothelium of other vascular beds (Cattaneo V et al. Glycobiology. 2014, 24, 966-973), consistent with these findings of its dependence on inflammation-relevant BRD2/4. Indeed, these findings uncovered a key undiscovered role for LGALS8 as a mediator of BRD2/4 and I-BET controlling endothelial pathophysiology in pulmonary hypertension. In delineating the connections between BET inhibitors with LGALS8, these findings specifically define a BRD-specific regulation of the LGALS8-L isoform in human PAECs, potentially reflecting the emerging role of BRD4 in splicing (Uppal A et al. Cell Rep. 2019, 29, 2450-2460 e2455) and with previous reports on differential regulation of different isoforms of LGALS8 under different stimuli (Cattaneo V et al. Glycobiology. 2014, 24, 966-973). Moreover, while the data implicated LGALS8 as essential for I-BET's control of endothelial apoptosis and pulmonary hypertension, LGALS8 did not reverse all I-BET effects (
[0217] In parallel, the EDDY-based predictions that define GSTP1's role in regulating ISCU also advance the understanding of protein S-glutathionylation in pulmonary hypertension and the pulmonary endothelium, particularly in relation to oxidative stress (Tew K D et al. Drug Metab Rev. 2011, 43, 179-193). The hypoxia-dependent (Chan S Y et al. Cell Metab. 2009, 10, 273-284) and endocrine (Zhao J et al. Circ Res. 2020, 127, 677-692) activity of microRNA-210 is known to potently downregulate ISCU transcript in pulmonary hypertension (White K et al. EMBO Mol Med. 2015, 7, 695-713), but the findings herein reveal a more complex regulatory schema for this scaffolding protein. While S-glutathionylation has been reported in pulmonary hypertension extensively (Weise-Cross L et al. Antioxid Redox Signal. 2019, 31, 898-915), key regulator proteins have not been comprehensively identified. In cancer, GSTP1 has been found to be a tumor suppressor (Mian O Y et al. Prostate. 2016, 76, 199-206) or oncogene, depending upon the tumor of interest. Single nucleotide variants in this gene have been associated with susceptibility to hypobaric hypoxia and high altitude pulmonary edema (He Y et al. Oncotarget. 2017, 8, 18206-18212; Mishra A et al. Clin Sci (Lond). 2012, 122, 299-309), often thought to be driven by compromise of the endothelial barrier function. GSTP1 mutations have also been linked to chronic obstructive pulmonary disease (COPD) (Zhong L et al. Am J Respir Crit Care Med. 2010, 181, 763-765), a disease with clear etiologic connections to pulmonary hypertension. Interestingly, pulmonary GSTP1 is known to carry a predominant role in detoxification of toxic compounds and pollutants (Tew K D et al. Drug Metab Rev. 2011, 43, 179-193). While the exact relation of pollution exposure to pulmonary hypertension is emerging (Sofianopoulou E et al. Eur Respir J. 2019, 53, 1801429), these findings of increased GSTP1 in pulmonary hypertension may suggest a molecular mechanism for such a link.
[0218] Finally, the identification of BRD2889 as a robust modulator of the GSTP1-ISCU axis in pulmonary hypertension offers an intriguing new compound and target pathway for therapeutic development. Differences between doses of BRD2889 in mice revealed differential effects on ISCU levels likely owing to cell-specific effects of the two doses used. Dosing sensitivity protocols should clarify this issue and pave the way for clinical therapeutic development. BRD2889's parent compound piperlongumine has been tested as an anti-inflammatory and senolytic drug in select cancers (Piska K et al. Eur J Med Chem. 2018, 156, 13-20) but carries distinct roles in other contexts and non-transformed cells. Notably, the EDDY-based predictions found specific pulmonary hypertension pathway rewiring responsible only to BRD2889 but not the parent drug or other analogs, also indicating the context-specific activity of this drug class and potentially its interactions with its target GSTP1. Thus, even among drug analogs, these distinctions emphasize the power of EDDY-CTRP-PH via its efficiency and granular detail to map and compare downstream molecular drug responses. While the piperlongumine parent drug has minimal toxicity to normal, non-transformed cells, its derivatives have displayed low levels of reversible liver and kidney toxicity when administered systemically (Bezerra D P et al. J Appl Toxicol. 2008, 28, 156-163). Given the presence of ascites in some BRD2889-dosed rats, future therapeutic development of BRD2889 should assess for toxicity closely and may benefit from localized delivery to the lung, as has been described recently with PLGA microparticles (Acharya A P et al. J Am Heart Assoc. 2021, 10, e019091), to avoid any putative systemic side effects. Additionally, future work to integrate EDDY-CTRP-PH with a structural analytic pipeline would be appealing to define potential biophysical mechanisms by which modifications of piperlongumine can be mapped to downstream pathway rewiring. Tailored development of EDDY will be valuable to determine if the combinatorial effects of I-BET762 and BRD2889 in PAECs can be predicted and tuned.
[0219] In summary, a computational approach with experimental validation was leveraged to identify systems-level molecular relationships between pulmonary hypertension and existing cancer small molecule drugs, resulting in predictions and proof of their therapeutic potential. These results not only offer key insights into the endothelial pathobiology in pulmonary hypertension but also establish the validity of leveraging cancer-based transcriptomics for identifying the hidden activities of therapeutic small molecules in this disease. As such, this work establishes the validity for a platform of computational repositioning of cancer drugs in other rare and emerging diseases that has not yet been possible.
[0220] Materials and Methods
[0221] Experimental Design: The goal of this study was to generate a computational-to-empirical pipeline for identifying and ranking the most robust actions of specific cancer therapeutics, and revealing their disease-relevant downstream targets in an example of a rare non-cancerous disease such as pulmonary hypertension. Data sources for EDDY-CTRP-PH included CCLE (Barretina J et al. Nature. 2012, 483, 603-607), CTRP (Seashore-Ludlow B et al. Cancer Discov. 2015, 5, 1210-1223; Rees M G et al. Nat Chem Biol. 2016, 12, 109-116), and a specific pulmonary hypertension gene network (Table 1-Table 2).
[0222] Following identification of I-BET151/762 with convergent actions on pulmonary hypertension Gene Cluster 15 (including the gene LGALS8), gene expression, mitochondrial redox levels, and cellular apoptosis were measured in primary human pulmonary arterial endothelial cells (PAECs). To determine the effect of this drug on pulmonary hypertension in vivo, C.sub.57BL/6 mice suffering from hypoxia-induced Group 3 pulmonary hypertension as well as two models of Sprague Dawley rats suffering from Group 1 pulmonary hypertension (monocrotaline exposure and SU5416-hypoxia) were treated with I-BET762. To determine the pathogenic actions of LGALS8 in pulmonary hypertension, male and female Lgals8/ mice were also exposed to chronic hypoxia. Lgals8/ mice and their littermate controls was limited on the availability by breeding. Following identification of BRD2889 with actions on pulmonary hypertension Gene Cluster 43 (including the gene ISCU), gene expression, ISCU glutathionylation, GSTP1-ISCU binding, and downstream phenotypes were measured in PAECs and PA smooth muscle cells. To determine the effect of this drug on Group 1 pulmonary hypertension in vivo, IL-6 transgenic C.sub.57BL/6 mice exposed to hypoxia as well as monocrotaline rats and SU5416-hypoxic rats were treated with drug vs. vehicle control. Hemodynamic and histologic indices were evaluated in murine models. Sample size and statistical analyses for each experiment are described below and in the figure legends; rodent studies were performed via random assignment to various experimental groups, and hemodynamic and histologic analyses were performed in a blinded fashion. Human Group 1 and Group 3 pulmonary hypertension lung (Table 4), non-diseased lung, as well as peripheral plasma were studied (Bertero T et al. J Cin Invest. 2014, 124, 3514-3528). Rodent numbers were chosen to achieve 0.80 power for detecting at least a 25% difference among means with a standard deviation of 20%. The number of recruited patients was determined primarily by availability of clinically validated samples. All experimental procedures involving human tissue and blood were approved by institutional review boards at the University of Pittsburgh. Ethical approval for this study and informed consent conformed to the standards of the Declaration of Helsinki. All animal experiments were approved by the University of Pittsburgh (IACUC). Key resources are summarized in Table 5.
TABLE-US-00001 TABLE 5 Key Resources. Reagent/resource Source Identifier PAECs Lonza CC-2530 PASMCs Lonza CC-2581 Endothelial cell Lonza CC-3121, CC-4133 growth media Smooth muscle cell Lonza CC-3182 growth media Human Peprotech 200-01B recombinant IL-1 DMSO Sigma 41639 I-BET151 Selleckchem S2780 I-BET762 Selleckchem S7189 Human R&D 1305-GA-050 recombinant Systems galectin-8 IL-6/IL-6R alpha Millipore 8954-SR Protein Chimera BRD2889 Broad Adams D J et al. Proc Natl Acad Sci USA. 2012, 109, Institute 15115-15120 MG132 Sigma 474791 Aldrich C57BL/6J mice Jackson RRID: IMSR_JAX: 000664 Laboratory Lgals8/ mice KOMP RRID: MGI: 5824822 Sprague-Dawley Charles River RRID: RGD_10395233 rats Laboratory IL-6 transgenic Steiner M K et al. Circ Res. 2009, 104, 236-244, 228p mice following 244 human LGALS8 RnD Systems Cat# AF1305, RRID: AB_2137229 mouse/rat Lgals8 Abcam Cat# ab69631, RRID: AB_1268941 pSTAT1 Abcam Cat# ab29045, RRID: AB_778096 STAT1 Abcam Cat# ab47425, RRID: AB_882708 GSTP1 Abcam Cat# ab153949, RRID: AB_2877700 ISCU Prointech Cat#14812-1-AP, RRID: AB_2280362 Glutathione Abcam Cat# ab19534, RRID: AB_880243 HIF2A Novous Cat# NB100-122, RRID: AB_10002593 -Tubulin Millipore Cat# CP06, RRID: AB_2617116 sigma ACTB Santa Cruz Cat# sc-47778, RRID: AB_2714189 IL-1 Abcam Cat# ab9722, RRID: AB_308765 cleaved caspase3 Cell Cat# cs-9661, RRID: AB_2341188 Signaling -SMA Sigma Cat# F3777, RRID: AB_476977 CD31 Abcam Cat# ab7388, RRID: AB_305905 Taqman primers Thermo LGALS8 (Hs01057135_m1), LGALS3 Fisher (Hs00173587_m1), NHERF1 (Hs00188594_m1), Scientific NHERF2 (Hs01033104_g1), ABCC4 (Hs00988721_m1), CD47 (Hs00179953_m1), DAG1 (Hs00189308_m1), LGALS8-L (Hs01062767_g1), VCAM1 (Hs01003372_m1), VEGF (Hs00900055_m1), CD31 (Hs00169777_m1), CDH5 (Hs00901465_m1), BRD2 (Hs01121986_g1), BRD4 (Hs04188087_m1), STAT1 (Hs01013996_m1), GSTP1 (Hs04419827_g1), ISCU (Hs00384510_m1), RECK (Hs00221638_m1), MT1G (Hs02578922_g1), MTOR (Hs00234508_m1), GOLGA2 (Hs01067737_m1), MID2 (Hs00201978_m1), KRT40 (Hs01057909_m1), BANP (Hs00215370_m1), AGTRAP (Hs01564425_m1), RBL2 (Hs00180562_m1)
[0223] Development of EDDY-CTRP-PH: Details of pulmonary hypertension gene network and clustering and EDDY-CTRP-PH are described in below.
[0224] Data and code availability: All the microarray data have been submitted to GEO (accession no. GSE125508 and GSE160255 for I-BET and BRD2889, respectively). EDDY software is available at GitHub repository (https://github.com/dolchan/eddy-gpu). The EDDY-CTRP-PH analysis for all the clusters and small molecule is available: https://chan.vmi.pitt.edu/eddy-ctrp-ph/
[0225] Cell culture: Primary human pulmonary artery endothelial cells (PAECs) and human pulmonary artery smooth muscle cells (PASMCs) were purchased from Lonza (302-05A, CC-2581). Of note, the same two male donors were the source of all PAECs in the experiments shown. Two additional male donors were the source for all PASMCs in the experiments shown. Cells from these and any donors were characterized by flow cytometry for consistent expression of cell surface markers and by RNA (RT-qPCR) analysis of endothelial and smooth muscle gene expression. PAECs were cultured in EGM-2 media (CC-3121) along with supplements (CC-4133), and PASMCs were cultured in SmGM-2 culture media (Lonza, CC-3182) at 5% CO.sub.2 in a humidified incubator.
[0226] To assess the effect of I-BET under inflammatory conditions, cells were treated with recombinant human IL-1 (10 ng/ml, Peprotech) at about 70-80% confluency for 48 h in complete media along with vehicle control (DMSO, Sigma-41639), I-BET151 (500 nM), I-BET762 (500 nM) (Selleckchem-S2780/S7189), as indicated. Human recombinant galectin-8 (1305-GA-050) was purchased from R&D Systems and was used at a working concentration of 30 nM.
[0227] For hypoxia exposure, cells were plated in 6-well cell culture plates at 110{circumflex over ()}5 cells/well, grown for 24 hr and placed into a normobaric hypoxia chamber (1% O.sub.2) for 24 h under specific treatment conditions. Namely, for I-BET and siLGALS8 exposures, cells were either pre-treated with I-BET/vehicle control (VC) or transfected with siLgals8/Scr for 24 h. Then, they were cultured in basal media at 1% 02. After 24 h, caspase activity and mitochondrial superoxide levels were quantified. To detect activation status of pSTAT1/STAT1 by immunoblot, cells were exposed to 8 h of hypoxia.
[0228] In IL-6/sIL-6R+hypoxia experiments, a human recombinant IL-6/IL-6R alpha protein chimera (25 ng/ml, Millipore) was administered at 70-80% confluency for 48 h in complete media along with vehicle control (DMSO, Sigma-41639). BRD2889 (1 uM) vs. vehicle control were added, as indicated, and placed into a hypoxia chamber for 24 h. The hypoxia chamber (modular incubator chamber) was obtained from Billups-Rothenberg Inc. (Del Mar, Calif) and placed in regulated CO.sub.2 incubator at 37 C.
[0229] Animal models: For the hypoxia-induced pulmonary hypertension mice, male C.sub.57BL/6J mice (8 weeks old) (RRID:IMSR_JAX:000664) were purchased from Jackson laboratory and acclimatized for 3-4 days in this facility. Subsequently, mice scheduled for normoxic vs. hypoxic exposure were maintained in either normoxia or a normobaric hypoxia chamber for 1 or 3 weeks (OxyCycler, Biospherix Ltd.), where consistent exposure to 10% oxygen and control for temperature and humidity were possible. For testing the activity of I-BET in hypoxia-induced pulmonary hypertension mice, three experimental groupsnormoxia+VC (vehicle control), hypoxia+VC (vehicle control), and hypoxia+I-BET were used. I-BET762 (SelleckChem, 30 mg/kg) was administered by daily oral gavage for the duration of hypoxic exposure (Wyce A et al. Oncotarget. 2013, 4, 2419-2429; Chaidos A et al. Blood. 2014, 123, 697-705).
[0230] Generation of the SU5416-hypoxia pulmonary hypertension rat model was described previously (Meloche J et al. Circ Res. 2015, 117, 525-535). Briefly, 10 week old male Sprague-Dawley rats were injected i.p. with 20 mg/kg of SU5416 (Sigma), placed in normobaric hypoxia (10% O.sub.2) for 3 weeks and then transferred to normoxia for 2 weeks. During hypoxic exposure, chambers were opened twice a week for cleaning and replenishment of food and water. For I-BET762 vs vehicle control dosing, daily i.p. injections (SelleckChem, 30 mg/kg) were administered during the final two weeks of normoxia. For BRD2889 vs. vehicle control dosing, i.p. injections every 5 days (5 mg/kg) were administered during the final two weeks of normoxia. Oxygen concentrations were continuously monitored with blood gas analyzers.
[0231] For the monocrotaline (MCT) pulmonary hypertension rat model, male Sprague-Dawley rats (10-14 week old) were injected (i.p.) with 60 mg/kg monocrotaline vs. PBS and kept for 26 days in normoxia (n=4/group), as previously described (Bertero T et al. J Clin Invest. 2014, 124, 3514-3528). For I-BET762 vs vehicle control dosing and BRD2889 vs. vehicle control dosing experiments, dosing strategies similar to those in SU5416-chronic hypoxic rats were used from Days 12-26 post-monocrotaline injection.
[0232] I-BET was dissolved in DMSO at 100 concentration and then made into a working solution in 20% PEG400 and 80% 1PBS. BRD2889 was made into a working solution of 2.5% DMSO.
[0233] Lgals8/ C.sub.57BL/6N mouse sperm was purchased from KOMP (14305A-F8) (Chen W S et al. Nat Commun. 2016, 7, 11302), and reconstituted in house and genotyped, as per KOMP's instructions. Male and female 8 week old Lgals8/ mice were exposed to hypoxia for 3 weeks.
[0234] Littermates were used as wildtype (WT) control when comparing with knockout mice. Prior to euthanasia, echocardiography was performed as described (Bertero T et al. J Cin Invest. 2014, 124, 3514-3528; Bertero T et al. J Cin Invest. 2016, 126, 3313-3335), followed by closed-chest right heart catheterization (Song Y et al. Am J Physiol Heart Circ Physiol. 2008, 295, H677-690) to measure right ventricular systolic pressure (RVSP) and heart rate. For rats, invasive catheterization of the abdominal aorta was performed to quantify systemic blood pressure. Following euthanasia, right ventricle/[left ventricle+septum] (RV/LV+S) mass ratio (Fulton index) was quantified, accompanied by Tissue-Tek OCT (VWR) tissue preparation for histologic staining, as described elsewhere (Bertero T et al. J Clin Invest. 2014, 124, 3514-3528; Bertero T et al. J Clin Invest. 2016, 126, 3313-3335).
[0235] Pulmonary-specific IL-6 transgenic mice (C.sub.57BL/6 background) were described previously (Steiner M K et al. Circ Res. 2009, 104, 236-244, 228p following 244). These mice were bred in house, and 12 week old male transgenic mice vs. control littermates were compared. Mice were injected i.p. every 3 days with vehicle control (2.5% DMSO) vs. BRD2889 (5 mg/kg vs. 10 mg/kg), followed by exposure to normobaric hypoxia (10% O.sub.2; OxyCycler chamber, Biospherix Ltd, Redfield, NY) for 14 days, as described (Steiner M K et al. Circ Res. 2009, 104, 236-244, 228p following 244).
[0236] Animal numbers were chosen to achieve 0.80 power for detecting >25% difference among means with a standard deviation of 20%. All animal experiments were approved by the University of Pittsburgh (IACUC). Randomization of the animals assigned to different experimental groups was achieved. Briefly, populations of animals sharing same gender, same genotype, and similar body weight were generated and placed in one container. Then, each animal was picked randomly and assigned in a logical fashion to different groups. For example, the first one is assigned to group A, second to group B, third to group A, fourth to group B, and so forth. No animals were excluded from analyses.
[0237] Human samples: Human Group 1 pulmonary hypertension (pulmonary arterial hypertension or PAH), Group 3 pulmonary hypertension, and non-diseased lung samples as well as peripheral plasma are described in Table 4 and previously described elsewhere (Bertero T et al. J Clin Invest. 2014, 124, 3514-3528). The number of recruited patients was determined primarily by the availability ofclinical samples. Experimental procedures involving human tissue were approved by institutional review boards at the University ofPittsburgh. Ethical approval for this study and informed consent conformed to the standards of the Declaration of Helsinki.
TABLE-US-00002 TABLE 4 Clinical characteristics of WSPH Group 1 pulmonary arterial hypertension and Group 3 pulmonary hypertension patients used for in situ staining and plasma profiling. CHD, congenital heart disease; COPD, chronic obstructive pulmonary disease; CTD, connective tissue disease; IPAH, idiopathic pulmonary arterial hypertension; IPF, idiopathic pulmonary fibrosis; PH, pulmonary hypertension. mPAP* Age Gender (mmHg) Diagnosis Clinical description PAH patients 34 Female 50 IPAH Cardiopulmonary arrest (autopsy) 64 Female 55 IPAH Cardiopulmonary arrest (autopsy) 68 Female 44 Scleroderma (PAH) Bilateral lung transplant 12 Male 53 BMPR2 mutation Bilateral lung transplant (Hereditary PAH) 16 Male 62 IPAH Bilateral lung transplant 1 Male 50 Trisomy 21 (PAH) Lung resection 19 Male 48 IPAH Lung resection 42 Female 57 Scleroderma (PAH Bilateral lung transplant Group 3 PH patients 62 Male 28 IPF (Group 3 PH) Bilateral lung transplant 58 Male 28 IPF (Group 3 PH) Bilateral lung transplant 63 Male 27 IPF (Group 3 PH) Bilateral lung transplant 50 Male 30 IPF (Group 3 PH) Bilateral lung transplant 61 Male 37 IPF (Group 3 PH) Bilateral lung transplant 69 Female 29 IPF (Group 3 PH) Bilateral lung transplant 72 Male 46 IPF (Group 3 PH) Rapid autopsy 66 Male 34 IPF (Group 3 PH) Bilateral lung transplant PERIPHERAL PLASMA SAMPLES 46 Female Control 61 Male Control 59 Female Control 50 Female Control 65 Female Control 34 Female Control 49 Female Control 31 Male Control 52 Female Control 35 Male Control 43 Male Control 31 Female Control 51 Female Control 61 Female Control 54 Female Control 58 Female 53 IPAH 47 Male 52 IPAH 43 Female 53 CHD (PAH) 83 Male 45 IPAH 53 Female 54 IPAH 47 Female 32 CTD (PAH) 73 Female 28 IPAH 55 Female 52 CTD (PAH) 41 Male 51 IPAH 73 Female 41 Scleroderma (PAH) 65 Female 32 Scleroderma (PAH) 57 Male 53 IPAH 26 Female 34 IPAH 58 Male 61 IPAH 58 Female 53 CTD (PAH) 73 Female 32 Scleroderma (PAH) 37 Male 37 Scleroderma (PAH) 72 Female 27 Scleroderma (PAH) 67 Male 49 Portopulmonary hypertension (PAH) 58 Male 43 CTD (PAH) 68 Female 25.3 COPD (Group 3 PH) 70 Male 37 COPD (Group 3 PH) 40 Female 29 COPD (Group 3 PH) *Mean pulmonary arterial pressure (mPAP)
[0238] BRD2889 synthesis: BRD2889 was prepared from commercially available piperlongumine via a reported 2-step procedure (ca-iodination and Sonogashira coupling) and purified by silica gel chromatography followed by recrystallization (Adams D J et al. Proc Natl Acad Sci USA. 2012, 109, 15115-15120).
[0239] Transfection: Human PAECs were transfected at about 70-80% confluency in OptiMEM media (Thermo Fisher Scientific) with 6.25 nM of scrambled (4390843) or LgalsS (s8158), Brd2 (s12070), Brd4 (s23901), Jak1 (s7646), Jak2 (s7651), Statl (s279) silencer select siRNA (Thermo Fisher Scientific), 5 nM of non-target pool (D-001810-10-05) or 5 nM GSTP1 (J-011179-07-0010) siRNA (Dhannacon, a Horizon Discovery Group) and 5 nM JSCU (J-012837-11-0020) siRNA using Lipofectamine 2000, according to manufacturer's instructions (Thermo Fisher Scientific). After 6 hours, OptiMEM was replaced by endothelial growth media, and cells were analyzed 48 h post-transfection. Similarly, HEK293 cells (ATCC no. CRL 1573) were transfected with 0.5 g WT-ISCU, C.sub.69S-ISCU, C.sub.69A-ISCU, or pcDNA3.1 empty vector using Lipofectamine 2000, according to the manufacturer's instructions (Thermo Fisher Scientific). After 48 hr transfection, the cells were exposed to hypoxia for 24 hr prior to harvesting for cellular lysate.
[0240] Statistical analysis: Data are represented as meanSEM. For cell culture data, these represent 3 independent experiments performed in triplicate. The normality of data distribution was confirmed by Shapiro Wilk testing. For normally distributed data, a 2-tailed Student's t test was used for comparisons between two groups. For comparisons among groups, one-way ANOVA and post-hoc Bonferroni testing were performed. A p-value less than 0.05 was considered significant.
[0241] Detailed descriptions of other standardized and published approaches are provided in the below.
[0242] Construction of the pulmonary hypertension-extended gene network: Adapted from a prior version of the pulmonary hypertension gene network (Bertero T et al. J Clin Invest. 2014, 124, 3514-3528), the network was constructed with a set of 416 seed genes which were identified as related to pulmonary hypertension from a contemporaneous curated literature review. Functional interactions for the network were collected from DIP (Salwinski L et al. Nucleic Acids Res. 2004, 32, D449-451), BioGRID (Chatr-Aryamontri A et al. Nucleic Acids Res. 2015, 43, D470-478), CORUM (Ruepp A et al. Nucleic Acids Res. 2010, 38, D497-501), InnateDB (Breuer K et al. Nucleic Acids Res. 2013, 41, D1228-1233), IntAct (Orchard S et al. Nucleic Acids Res. 2014, 42, D358-363), MINT (Licata L et al. Nucleic Acids Res. 2012, 40, D857-861), and MatrixDB (Launay G et al. Nucleic Acids Res. 2015, 43, D321-327). The total union of interactions from all these databases was referred to as the consolidated interactome (CI).
[0243] Not all 416 seed genes were interconnected into a single largest connected component (LCC). In order to ensure inclusion of all the seed genes within a single LCC, intermediate non-seed genes were included into an expanded network. The process began by finding the LCC seeds which would form the base network. Intermediate non-seed genes were added into the network if they would connect one of the yet to be included seeds into the existing network. This process was repeated until the maximum number of possible seeds was included. It included a vast majority of the original pulmonary hypertension genes but yielded a very dense network of interactions. To decrease the network's density in order to ensure meaningful computational predictions, interactions were pruned based on the p-values assigned to each interaction computed using Monte Carlo simulation. 10,000 random networks were generated using random sets of 416 seed genes. The p-value of each interaction corresponded to its frequency of appearance in these random networks. Interactions were removed from the pulmonary hypertension network in order of descending p-value until the point where removing any additional interactions would disconnect one of the seed genes. This process generated the pulmonary hypertension (PH)-extended network, comprising 2,946 interactions among 747 genes. Finally, the pulmonary hypertension-extended network was subdivided into 55 groups of related genes (Table 1-Table 2), using the Map Equation (Bohlin L et al. Measuring Scholarly Impact. Springer, 2014, Cham. 3-34) which clusters and divides genes based on density of interactions and ready to feed into EDDY-CTRP-PH.
[0244] Development of EDDY-CTRP-PH pipeline: First, RNA expression data from the CCLE was quantified using the transcript expression quantification tool Salmon (Patro R et al. Nat Methods. 2017, 14, 417-419), log.sub.2-transformed, and quantized using median absolute deviation (MAD) into under-expressed, intermediate, and over-expressed levels. Second, drug sensitivity data from the CTRP was used to group sensitive, intermediate, and non-sensitive CCLE cell lines. Third, the pulmonary hypertension-related gene clusters allowed the computational interrogation of gene co-expression to be constrained to subgroups of interest. Finally, previously known interactions mined from Pathway Commons 2 (www.pathwaycommons.org) were utilized as prior knowledge in EDDY analysis with a weight of 0.5, decreasing false-discovery rate without overly reducing differential dependency detection sensitivity (Speyer G et al. Pac Symp Biocomput. 2016, 21, 33-44).
[0245] Once these input sources were assembled, EDDY (Jung S et al. Nucleic Acids Res. 2014, 42, e60) was used to construct graphs for gene dependencies in cells sensitive and resistant to a given small molecules, where edges between nodes were defined by a pairwise independence test (c.sup.2 test) of gene expression, with known interactions (edges) given a priority. By repeated resampling of each group (sensitive vs. resistant cells), multiple unique networks were constructed for each group, and upon scoring, each group was characterized with a network likelihood distribution. The significance of the divergence between the two distributions was assessed via permutation test. Thus, statistically significant differential rewiring among gene networks between cells resistant and sensitive to a small molecules was catalogued. These clusters were then visualized with a differential dependency network (DDN). Across 368 compounds, 810 cell line responses presented different sensitive and non-sensitive groupings, which, in turn, yielded specific significant pulmonary hypertension cluster lists from EDDY. Of note, even when the same cluster was found to be statistically significant for two different compounds, its differential dependency network often displayed substantially different wiring. For visualization, each characteristic line in differential dependency networks indicated the identified relationship between nodes (genes): drug-sensitive (red), drug-resistant (blue), and both (gray) as well as known interactions with directionality (solid edges+/arrow) and previously unknown statistical dependencies (dashed edges).
[0246] For each differential dependency network, genes important to the integrity of the network were identified by network analysis. Namely, the betweenness-centrality metric assessed a node's essentiality within a network (Freeman L C. Sociometry. 1977, 40, 35-41) and was visualized in the condition-specific network through the node size. In each differential dependency network, essentiality mediators were identified as those with the highest (top 10%) betweenness-centrality difference between the two condition-specific networks and the size of the nodes in each differential dependency network represented the betweenness-centrality difference. The condition-specific rewiring metric identified genes with a significant proportion of condition-specific edges assessed against the binomial distribution of these edges across the entire graph. In each differential dependency network, these specificity mediators were identified, highlighting particularly highly altered roles between conditions. Both essentiality and condition-specific mediators were indicated by square nodes.
[0247] Furthermore, in order to shortlist, the small molecules and clusters were ranked based on three criteria: 1) average p-value (
denotes the average p-value for the pulmonary hypertension cluster P.sub.i. A drug is then ranked for N.sub.C(D.sub.j), m..sub.j (both in descending order), and 7, (in ascending order), and denoted as r.sub.C(D.sub.j), r.sub.m(D.sub.j), and r.sub.p(D.sub.j), respectively. As shown in Table 1-Table 3, ultimately, the overall rank score of a drug was the sum of these three ranks, (r(D.sub.j)=r.sub.C(D.sub.j)+r.sub.m(D.sub.j)+r.sub.p(D.sub.j)), and a drug was ranked based on the overall rank score (ascending order), r(D.sub.j). Similarly, a pulmonary hypertension cluster was ranked for N.sub.D (C.sub.i), m.sub.i. (both in descending order), and
TABLE-US-00003 TABLE 1 Genes in each cluster . Cluster Genes in cluster 1 AAMP, CCDC8, ACO1, ACTB, MDM2, S100A7, YAP1, ALOX5, MKL1, ZC3H12A, ANK3, UBD, APP, ARG1, ARG2, ANKRD13A, DDX3Y, ATP2B1, SUMO2, ILVBL, FBXW11, NTRK1, PAPSS2, NOMO1, GUCY1A3, GUCY1B3, PARK2, WBP1, CDKN2D, DPF2, HK2, STK17B, UBC, SERPINB8, HSD17B4, VCAM1, TNC, CLIC4, FSD1, XPO1, PREP, CTGF, VHL, CALML5, ISYNA1, ZSCAN32, FBXO6, MFN2, ARIH2, LAMB2, RGS3, NAMPT, PBRM1, EGFR, ZNF197, PRMT3, CDK2, FLOT1, AK2, SMAD3 2 GLS, MEOX2, CEBPB, CCL2, CCL3, CCL5, MMP1, MMP3, CX3CL1, CREB3, SGTA, CXCR6, AZGP1, GATA3, STAT1, STAT3, STAT4, NFATC2, KLF5, NFKB1, NFKB2, NOS2, ENTPD1, TLR4, CCRL2, SERPINE1, CD44, TNF, RELA, HGF, HMOX1, PLA2G4A, CCR1, ICAM1, TBX21, POLR2F, NOX4, ATF2, CRP, NCOR1, CCL19, SRGN, VCAN, RBPJ, IL1A, IL1B, IL1R1, IL-6, CX3CR1, IL13, CXCL10, VIP, UBQLN4, IRF4, CD82, HSD17B8, FOS, JUN, SMAD4, CTNNB1 3 ABAT, AP2A1, AP1B1, FDPS, BCAR3, AKR1B1, MPG, ACLY, SEC31A, RHOA, RHOB, IGF1R, FOXI2, ATIC, SOD2, NUP62, SNX3, GLO1, TAGLN, NME2, DSTN, ARHGEF12, CAT, CBS, PEBP1, NME1-NME2, CFL1, CFL2, SLC25A32, HPRT1, HSPE1, CST4, CTH, PTMA, JAK1, WDR1, SLC25A41, WDYHV1, DUT, HSD17B14, LIMK1, NUTF2, RPE, ENO2 4 MAX, YWHAB, AKT1, CAMKK1, TRIM23, ATF6, MT2A, CNDP2, GP1BA, MAP3K2, MYC, SRD5A1, PDE10A, NFU1, PRKACA, SFN, NEDD4L, TH, TPH1, PDE3A, PDK2, CYTH2, SH3BP4, UBE3A, HSPA5, HSPB1, XBP1, CPS1, YWHAZ, MAP2K5, PSMA1, TFIP11, PTPN3, KCNK3, EPM2A 5 MAP4, MAPK12, RACK1, AGTR1, ALB, APOE, SLAMF1, HSD17B6, ATP12A, ATP2B2, ATP2B3, ATP2B4, SNTA1, SNTB1, ERBIN, NOS1, NOS3, CAV1, GUCY1A2, SCN5A, PTGIS, PTGS2, LRP8, KCNA5, HTR2B, DLG1, DLG2, DLG3, DLG4, LRP2, PATJ 6 MMP2, MMP9, CXCL12, FN1, SP3, CAND1, C3, TAC1, LOXL3, CALR, TGFBI, THBS1, TIMP1, PDGFA, PDGFB, PDGFRA, PDGFRB, COL1A1, COL1A2, COL4A1, COL4A2, VWF, COL3A1, LOX, ITGAV, LRP1, ERAL1, VEGFA, KDR, ELN, EPAS1 7 ADA, SOCS7, ANGPT4, FOXO1, ANGPT1, ANGPT2, NCKIPSD, AR, MST1, FYN, SRC, GATA2, STAT5A, SPHK1, SKAP2, TEK, ANGPTL1, PRDM14, GRB2, CCR7, LYN, SNX17, E2F4, RGS16, EFNA1, EGF, TRPV4 8 RPL29, ESR2, ACTA2, ACTG2, PLA2G4B, DYSF, TRIM59, SEMA3F, FYTTD1, ESR1, SHBG, SNRNP70, JMJD7-PLA2G4B, SLC37A1, CASP8, PSTPIP1, SNAPIN, IL13RA2, DES, PRL 9 SNTB2, TNFSF10, APOBEC3C, NFS1, TP53, HDAC1, KLF4, PHF1, SENP1, HSD17B13, VIPR2, LLGL2, CTBP1, HDAC4, HDAC5, TSPAN10, ELAVL1 10 GDF5, NCOA3, SMAD6, GDF2, BMP2, BMP4, BMP6, BMP7, BMPRIA, BMPRIB, BMPR2, BMP10, NOG, MIR27A, GREM1, EGR1, SMAD1, SMAD5 11 KLHL1, ESRRB, CNDP1, CDC37, HLA-DRB1, HLA-DRB5, LOXL4, HSPA8, SMYD3, HSP90AA1, PPID, PRKG2, HSP90AB1, PKM 12 MAPK9, SLC6A4, TNFSF11, NEFH, NFATC3, MAPK14, MAPK1, MAPK8, DUSP1, DUSP7, EEF1A1, GAN, EIF2AK4 13 EWSR1, AGT, HSD17B7, TIMM21, TERT, ZNF589, HNF4A, HSD17B2, HSD17B1, POLB, XDH, PRG2, RMND5B, ACE 14 RYR2, B2M, SRI, CACNA1C, CALM1, CALM2, CALM3, PDE1A, CRHR1, PRKAR2A, PRKAR2B, ACE2, VIPR1 15 ABCC4, LGALS9C, PDZK1, CD47, CFTR, SLC9A3R2, LPAR1, SLC9A3R1, LGALS3, CSPG4, DAG1, ANO1, LGALS8 16 CBL, HSD17B3, MIRLET7B, MIRLET7C, MIRLET7D, MIRLET7E, PCDH20, PRKAA2, CCND1, RYK, WNT1, CDK6, MIR21, SMAD2 17 A2M, MAOA, APOD, ATP5A1, CYP19A1, CAPN6, EZR, CPB2, ATP6V1B2, SELP, PTX3 18 SPRY2, TMEM17, NT5C3A, GORAB, TMEM216, EPB41L3, DYNLT1, EBAG9, NAF1, HMOX2, ZRANB2, EVC2, DVL1, DVL2, DVL3, VANGL1 19 ERG, ACPP, NDRG1, SIAH2, SLC9A1, NEDD4, ROCK1, RGS2, ROCK2, CRMP1, EIF3E, PMEPA1 20 CDKN2A, RGS19, MAP2K4, SH3GL2, GCH1, NOL3, MAPK10, PACSIN2, PACSIN3, CSNK2A1 21 FHL1, CBX4, MIR424, CCNE1, CDC25A, CDKN1B, MIR503, PIM1, CCND3, ID1, MAP2K1, FOXO3, SMURF1 22 CD209, SP1, HAS2, HTR1A, HTR1B, HTRID, S1PR1 23 LGALS1, HLA-B, HSD17B10, ATP1B1, PDHA1, PDK3, USP4, PDK1, PTBP1, DLD 24 HEXIM1, UBE20, MIR328, HIF1A, NPPB, LYST, CSNK2B, LEP, LEPR 25 CD226, CA8, GHRL, LNX1, TBXA2R, PRKCA, PTGIR, CLDN4 26 CD4, CD74, HLA-DPA1, HLA-DPB1, HLA-DQB1, CTSD, INS, RTN4, RFX1, RFXAP 27 ACVRL1, TGFB1, TGFBR1, TGFBR2, TGFBR3, ENG, SMAD7 28 F2RL1, SRF, BCL2, CAPN1, CAPN2, CAPNS1, CASP9, XIAP 29 FOXF1, PCBP4, GLI1, GLI3, PDGFRL, PFKM, CAV3, PRMT1, QKI, PCBP1 30 MME, APBB1, EDN3, CMA1, KEL, EDN1, EDN2, EDNRA, EDNRB, TSHZ1 31 DHDDS, HDAC11, OTUB1, AHSA1, SPINT2, NUS1, UTS2, UTS2R, HMGCR, TCTN3, HSD17B12, TCTN2 32 NRIP1, ESRRG, ESRRA, PPARGC1A, PPARG, PPM1B, MIR130A, PDK4 33 ACTN1, ACTN2, MEF2A, ADORA2A, ACTN4, ACTN3, CAMK2D, HIRA, CNR1 34 IKZF1, CSNK1G1, NOTCH1, SIN3B, GZMB, MIR145, DFFA, F11R 35 MDFI, APLNR, TINAGL1, APLN, TAZ, RBPMS, CYBA, PSMA3, LOXL2 36 NCOA2, APEH, SIRT3, SERPINA1, VKORC1, PLP2, HAX1, FGL1, DNM1L 37 BIRC2, APOA1, TNFSF13B, CD40LG, TRAF2, TNFRSF25, TNFSF4, TNFSF12, CLEC4G 38 CALCOCO2, TPD52L2, TP53RK, GDF15, CYP1B1, MRPL50, GIT2, SAE1 39 ATP8B4, ACP5, TMEM30A, SARAF, SPP1, SRPK1, OS9, FBXO15, UBA7 40 SSSCA1, ZPR1, KDM4A, NRAS, PLIN1, DNAJB1, PNPLA2, ABHD5, NME6, SMAD9 41 NYX, TOPBP1, BRD4, CLK1, WNT5A, SHROOM1, AMIGO3, AMIGO2, ECE1, PTPRK 42 CEP164, NPHP3, NPHP1, AARSD1, SNX11, PRF1, IDO1, DDX24, KRT31 43 RECK, MT1G, MTOR, GOLGA2, MID2, ISCU, KRT40, BANP, AGTRAP, RBL2 44 FLNA, KCNIP1, CASR, KCNE4, KCND3, KCNIP2, KCND2 45 PDE5A, TRPC1, TRPC3, TRPC6, PRKG1, TRPC4 46 F2R, S100A4, AGER, PRMT5, NEK6, GNAT1, UNC119, ID2 47 AP1M1, SIRT4, MLYCD, ECH1, FAM9B, ZADH2, PEX5 48 XPO5, GSTK1, ATP2A2, PTP4A3, MIRLET7A1, PEX19, RAN, HSD17B11 49 RTEL1, FYCO1, RAF1, ZNFX1, SS18L2 50 NOTCH3, WWP2, POU5F1, DTYMK 51 TCTA, ATXN1, PTGDS, LOXL1 52 KBTBD7, ATF4, FOSL2, DDIT3 53 PRKD2, MIR17, RAE1 54 FBXO32, EIF3F, TSC1 55 GPER1, HES5, PTEN
TABLE-US-00004 TABLE 2 Cluster information and scores. Clusters were sorted according to their rewiring scores as defined in Methods. This score considered the average p-value (mean(log10(p))); 2) number (or frequency) of small molecules linked to rewiring of a given cluster (freq_drug); and 3) frequency of mediator involvement (freq_mediator). Rankings of clusters by these criteria individually (rank.pval, rank.freq_drug, rank.freq_mediator) as well as overall (rank.sum = sum of the ranks, rank.overall = rank based on sum.ranks) are listed. mean rank.freq_media- Cluster (log10(p)) freq_drug freq_mediator rank.pval rank.freq_drug tor rank.sum rank.overall 6 1.644 8 23 29 35 1 65 27 10 1.330 1 4 43 42 37 122 42 11 1.636 17 11 30 14 2 46 12 12 1.734 28 11 21 4 2 27 3 13 1.544 14 10 36 22 6 64 26 14 1.623 14 10 32 22 6 60 22 15 1.721 36 11 24 2 2 28 4 16 2.126 59 6 5 1 25 31 6 17 1.769 15 7 18 18 17 53 14 18 1.340 2 5 42 41 30 113 40 19 1.486 5 9 39 38 10 87 35 20 1.704 8 7 27 35 17 79 34 21 1.422 10 11 41 33 2 76 32 23 1.675 17 10 28 14 6 48 13 24 1.910 14 6 10 22 25 57 16 25 1.831 18 7 13 11 17 41 9 26 1.839 20 9 12 8 10 30 5 27 1.732 23 5 22 7 30 59 21 28 1.727 27 8 23 5 14 42 10 29 1.715 15 8 25 18 14 57 16 30 1.574 16 6 35 17 25 77 33 31 1.585 15 10 34 18 6 58 19 32 2.064 11 5 6 29 30 65 27 33 1.884 11 5 11 29 30 70 31 34 2.037 15 4 7 18 37 62 24 35 1.760 11 7 20 29 17 66 29 36 1.792 17 7 14 14 17 45 11 37 1.983 11 5 8 29 30 67 30 38 1.761 13 7 19 27 17 63 25 39 1.513 14 5 37 22 30 89 38 40 1.473 5 9 40 38 10 88 37 41 1.712 14 9 26 22 10 58 19 42 2.195 19 6 2 10 25 37 7 43 2.185 34 8 3 3 14 20 1 44 1.597 4 2 33 40 41 114 41 45 1.495 1 1 38 42 43 123 43 46 2.210 20 7 1 8 17 26 2 47 2.181 12 6 4 28 25 57 16 48 1.780 24 7 16 6 17 39 8 49 1.786 18 5 15 11 30 56 15 50 1.771 10 4 17 33 37 87 35 51 1.633 6 2 31 37 41 109 39 52 1.914 18 3 9 11 40 60 22
TABLE-US-00005 TABLE 3 Small molecule scores. Drugs were sorted according to their rewiring scores as defined in Methods. This score considered the average p-value (mean(1og10(p)); avg_pval); 2) number (or frequency) of rewired clusters linked to a given drug (freq_cluster); and 3) frequency of mediator involvement (freq_mediator). Rankings of clusters by these criteria individually (rank.pval, rank.freq_drug, rank.freq_mediator) as well as overall (rank.sum = sum of the ranks, rank.overall = rank based on sum.ranks) are listed. Mean freq_me- rank.freq_me- rank.over- Drug.Name (log10(p)) freq_cluster diator rank.pval rank.freq_cluster diator rank.sum all AZD6482 2.595 6 16 14 8 5 27 1 BRD-K34222889 2.303 6 11 24 8 15 47 2 I-BET151 2.072 7 18 43 2 2 47 2 indisulam 1.971 7 22 57 2 1 60 4 MK-1775 1.991 8 14 55 1 8 64 5 momelotinib 1.994 6 11 53 8 15 76 6 apicidin 2.626 4 9 11 37 29 77 7 entinostat 2.127 6 9 40 8 29 77 7 TG-101348 2.146 5 9 37 16 29 82 9 BRD-K11533227 1.917 7 12 69 2 12 83 10 ML083 2.061 5 10 44 16 23 83 10 chlorambucil 2.027 5 9 49 16 29 94 12 AZD7545 2.616 4 7 12 37 48 97 13 VER-155008 2.876 5 6 7 16 76 99 14 austocystin D 2.164 5 7 36 16 48 100 15 fumonisin B1 1.969 4 14 58 37 8 103 16 NSC95397 1.899 5 11 75 16 15 106 17 cytarabine 1.819 7 12 94 2 12 108 18 hydrochloride 16-beta- 1.972 5 8 56 16 38 110 19 bromoandrosterone crizotinib 1.807 7 12 98 2 12 112 20 AA-COCF3 2.164 3 11 35 64 15 114 21 Ch-55 2.356 3 9 21 64 29 114 21 ABT-199 2.912 3 7 6 64 48 118 23 brivanib 1.864 6 10 87 8 23 118 23 dabrafenib 1.859 5 11 88 16 15 119 25 tivozanib 1.899 4 14 74 37 8 119 25 pevonedistat 2.141 4 7 38 37 48 123 27 NSC30930 2.132 4 7 39 37 48 124 28 hyperforin 1.879 4 15 83 37 6 126 29 WAY-362450 1.761 6 13 112 8 11 131 30 XL765 2.449 3 7 19 64 48 131 30 mitomycin 2.342 3 7 22 64 48 134 32 BRD-K63431240 1.913 4 9 70 37 29 136 33 necrostatin-1 2.002 4 7 51 37 48 136 33 PDMP 1.818 5 9 96 16 29 141 35 necrostatin-7 2.215 3 7 30 64 48 142 36 B02 2.661 3 6 9 64 76 149 37 PIK-93 2.507 4 5 17 37 95 149 37 isoevodiamine 1.885 4 8 81 37 38 156 39 tosedostat 1.871 3 15 86 64 6 156 39 PL-DI 1.818 5 7 95 16 48 159 41 teniposide 2.035 3 7 47 64 48 159 41 KU 0060648 1.724 5 10 121 16 23 160 43 PLX-4720 1.666 6 11 140 8 15 163 44 tipifarnib-P2 1.886 4 7 80 37 48 165 45 BRD1812 1.734 6 8 120 8 38 166 46 CAY10594 1.899 3 9 76 64 29 169 47 PHA-793887 1.680 5 11 138 16 15 169 47 barasertib 1.875 4 7 85 37 48 170 49 sotrastaurin 1.638 5 17 152 16 4 172 50 SGX-523 1.858 4 7 89 37 48 174 51 BRD-K80183349 1.953 3 7 64 64 48 176 52 ML239 1.945 3 7 65 64 48 177 53 BRD-K03536150 2.038 3 6 46 64 76 186 54 UNC0321 1.644 5 10 147 16 23 186 54 quizartinib 1.783 4 7 102 37 48 187 56 ABT-737 1.723 4 9 123 37 29 189 57 ibrutinib 1.574 7 11 173 2 15 190 58 imatinib 2.191 3 5 31 64 95 190 58 GSK-3 inhibitor IX 1.683 5 8 137 16 38 191 60 PYR-41 2.721 3 4 8 64 123 195 61 BYL-719 1.878 3 7 84 64 48 196 62 NVP-231 1.557 5 18 182 16 2 200 63 BRD-K02492147 1.642 5 8 150 16 38 204 64 belinostat 1.659 5 7 141 16 48 205 65 erismodegib 1.834 4 6 92 37 76 205 65 ML311 1.637 5 8 153 16 38 207 67 RO4929097 1.581 5 10 169 16 23 208 68 vorapaxar 2.001 2 7 52 110 48 210 69 elocalcitol 1.791 4 6 101 37 76 214 70 GSK4112 1.658 4 8 142 37 38 217 71 purmorphamine 1.889 3 6 78 64 76 218 72 canertinib 2.187 3 4 32 64 123 219 73 tamoxifen 2.536 2 5 16 110 95 221 74 BRD-K26531177 1.941 3 5 67 64 95 226 75 OSI-930 1.845 3 6 91 64 76 231 76 tretinoin 3.025 2 4 4 110 123 237 77 PF-573228 1.635 4 7 154 37 48 239 78 PRIMA-1-Met 1.710 4 6 127 37 76 240 79 bexarotene 1.553 5 8 188 16 38 242 80 MK-2206 1.762 4 5 111 37 95 243 81 valdecoxib 1.778 3 6 107 64 76 247 82 STF-31 1.649 3 8 146 64 38 248 83 ML029 1.755 3 6 113 64 76 253 84 SRT-1720 1.754 3 6 114 64 76 254 85 ML031 1.524 4 10 196 37 23 256 86 tacedinaline 1.566 4 7 177 37 48 262 87 pluripotin 1.780 3 5 104 64 95 263 88 tubastatin A 1.890 2 6 77 110 76 263 88 KW-2449 1.715 3 6 125 64 76 265 90 ciclopirox 1.957 2 5 62 110 95 267 91 ruxolitinib 1.773 3 5 108 64 95 267 91 IU1 1.554 4 7 186 37 48 271 93 CD-437 1.554 4 7 187 37 48 272 94 WP1130 1.689 3 6 134 64 76 274 95 NSC19630 1.846 3 4 90 64 123 277 96 JQ-1 1.597 3 7 166 64 48 278 97 HLI 373 1.824 2 6 93 110 76 279 98 PF-750 1.528 4 7 195 37 48 280 99 MGCD-265 1.654 3 6 143 64 76 283 100 GDC-0879 1.903 3 3 73 64 147 284 101 BRD-K27188169 1.714 3 5 126 64 95 285 102 GSK2636771 1.700 3 5 129 64 95 288 103 temozolomide 1.959 2 4 60 110 123 293 104 vorinostat 1.616 3 6 156 64 76 296 105 etomoxir 1.521 3 8 198 64 38 300 106 Ko-143 1.813 3 3 97 64 147 308 107 YL54 1.782 2 5 103 110 95 308 107 cytochalasin B 1.519 3 7 199 64 48 311 109 axitinib 1.888 2 4 79 110 123 312 110 BRD-K61166597 1.508 3 7 203 64 48 315 111 PD 153035 2.450 2 2 18 110 187 315 111 LE-135 1.615 3 5 158 64 95 317 113 BRD-K37390332 1.954 2 3 63 110 147 320 114 tacrolimus 1.609 3 5 162 64 95 321 115 BRD-K51490254 1.555 3 6 184 64 76 324 116 ML203 2.233 2 2 28 110 187 325 117 OSI-027 2.179 2 2 33 110 187 330 118 afatinib 2.174 2 2 34 110 187 331 119 KH-CB19 4.000 1 3 1 188 147 336 120 BRD-K13999467 1.696 2 5 132 110 95 337 121 bosutinib 3.398 1 3 3 188 147 338 122 PF-4800567 1.883 2 3 82 110 147 339 123 hydrochloride BRD-K90370028 2.043 2 2 45 110 187 342 124 tamatinib 2.602 1 3 13 188 147 348 125 BRD-K99584050 1.550 3 5 190 64 95 349 126 BRD-A94377914 1.735 2 4 118 110 123 351 127 piperlongumine 1.804 2 3 99 110 147 356 128 foretinib 1.581 2 6 171 110 76 357 129 BRD-K28456706 1.512 3 5 201 64 95 360 130 CHIR-99021 1.623 2 5 155 110 95 360 130 masitinib 1.706 2 4 128 110 123 361 132 lapatinib 1.779 2 3 105 110 147 362 133 CAY10576 1.778 2 3 106 110 147 363 134 Compound 7d-cis 1.694 2 4 133 110 123 366 135 PRL-3 inhibitor I 1.772 2 3 109 110 147 366 135 BIBR-1532 1.586 2 5 168 110 95 373 137 SU11274 1.551 3 4 189 64 123 376 138 JW-74 1.652 2 4 144 110 123 377 139 UNC0638 1.943 1 4 66 188 123 377 139 Platin 1.644 2 4 148 110 123 381 141 compound 1B 1.560 2 5 181 110 95 386 142 sunitinib 1.614 2 4 160 110 123 393 143 tipifarnib-P1 1.494 3 4 206 64 123 393 143 IC-87114 1.611 2 4 161 110 123 394 145 BRD6340 2.377 1 2 20 188 187 395 146 AT7867 1.548 2 5 191 110 95 396 147 ML258 1.959 1 3 61 188 147 396 147 Repligen 136 1.602 2 4 164 110 123 397 149 RITA 2.337 1 2 23 188 187 398 150 TPCA-1 1.594 2 4 167 110 123 400 151 itraconazole 1.523 2 5 197 110 95 402 152 SB-431542 1.651 2 3 145 110 147 402 152 BRD9647 2.229 1 2 29 188 187 404 154 epigallocatechin- 1.643 2 3 149 110 147 406 155 3-monogallate fingolimod 1.510 2 5 202 110 95 407 156 AZD1480 1.738 2 2 117 110 187 414 157 SJ-172550 1.615 2 3 157 110 147 414 157 BMS-195614 3.699 1 1 2 188 225 415 159 nutlin-3 2.092 1 2 41 188 187 416 160 avrainvillamide 2.076 1 2 42 188 187 417 161 BRD-K17060750 3.000 1 1 5 188 225 418 162 serdemetan 1.555 2 4 185 110 123 418 162 BRD-K24690302 1.606 2 3 163 110 147 420 164 bardoxolone methyl 1.601 2 3 165 110 147 422 165 BRD8899 2.658 1 1 10 188 225 423 166 nilotinib 2.032 1 2 48 188 187 423 166 BMS-536924 1.454 2 5 219 110 95 424 168 BRD-K66532283 2.009 1 2 50 188 187 425 169 AZD4547 1.581 2 3 170 110 147 427 170 BRD-K71781559 1.451 2 5 222 110 95 427 170 BRD-K55473186 2.553 1 1 15 188 225 428 172 pyrazolanthrone 1.991 1 2 54 188 187 429 173 RG-108 1.438 2 5 224 110 95 429 173 MLN2480 1.573 2 3 174 110 147 431 175 BMS-270394 1.567 2 3 175 110 147 432 176 decitabine 1.518 2 4 200 110 123 433 177 neratinib 1.685 2 2 136 110 187 433 177 MI-2 1.565 2 3 178 110 147 435 179 tigecycline 1.564 2 3 179 110 147 436 180 CBB-1007 2.284 1 1 25 188 225 438 181 ETP-46464 2.284 1 1 25 188 225 438 181 AC55649 2.237 1 1 27 188 225 440 183 semagacestat 1.381 2 5 236 110 95 441 184 dasatinib 1.921 1 2 68 188 187 443 185 cabozantinib 1.482 2 4 212 110 123 445 186 fluorouracil 1.364 2 5 240 110 95 445 186 pifithrin-mu 1.764 1 3 110 188 147 445 186 gefitinib 1.910 1 2 71 188 187 446 189 BIRB-796 1.541 2 3 192 110 147 449 190 PF-543 1.338 2 5 245 110 95 450 191 skepinone-L 1.724 1 3 122 188 147 457 192 AZD8055 1.507 2 3 204 110 147 461 193 tanespimycin 1.492 2 3 208 110 147 465 194 nintedanib 1.473 2 3 214 110 147 471 195 thalidomide 1.967 1 1 59 188 225 472 196 istradefylline 1.463 2 3 216 110 147 473 197 Ki8751 1.364 2 4 241 110 123 474 198 BRD-K07442505 1.796 1 2 100 188 187 475 199 PF-184 1.334 2 4 246 110 123 479 200 CCT036477 1.575 1 4 172 188 123 483 201 pitstop2 1.429 2 3 226 110 147 483 201 CIL41 1.907 1 1 72 188 225 485 203 spautin-1 1.638 1 3 151 188 147 486 204 pandacostat 1.418 2 3 230 110 147 487 205 carboplatin 1.415 2 3 231 110 147 488 206 BRD-K92856060 1.391 2 3 233 110 147 490 207 COL-3 1.745 1 2 115 188 187 490 207 MK-0752 1.387 2 3 235 110 147 492 209 BRD-K50799972 1.735 1 2 119 188 187 494 210 BRD-K33199242 1.375 2 3 238 110 147 495 211 SB-525334 1.717 1 2 124 188 187 499 212 NVP-BEZ235 1.699 1 2 130 188 187 505 213 lenvatinib 1.567 1 3 176 188 147 511 214 myricetin 1.469 2 2 215 110 187 512 215 BIX-01294 1.454 2 2 220 110 187 517 216 BRD-K88742110 1.454 2 2 221 110 187 518 217 O-6-benzylguanine 1.447 2 2 223 110 187 520 218 BRD-A71883111 1.421 2 2 229 110 187 526 219 saracatinib 1.745 1 1 115 188 225 528 220 BRD-K09587429 1.407 2 2 232 110 187 529 221 EX-527 1.697 1 1 131 188 225 544 222 BRD-K16147474 1.484 1 3 211 188 147 546 223 BRD-K99006945 1.688 1 1 135 188 225 548 224 sildenafil 1.310 2 2 251 110 187 548 224 simvastatin 1.680 1 1 139 188 225 552 226 marinopyrrole A 1.556 1 2 183 188 187 558 227 VU0155056 1.431 1 3 225 188 147 560 228 ISOX 1.539 1 2 193 188 187 568 229 BRD-A02303741 1.538 1 2 194 188 187 569 230 CIL55 1.614 1 1 159 188 225 572 231 BRD-K14844214 1.343 1 3 243 188 147 578 232 alisertib 1.474 1 2 213 188 187 588 233 Mdivi-1 1.457 1 2 217 188 187 592 234 BEC 1.562 1 1 180 188 225 593 235 Compound 1541A 1.381 1 2 237 188 187 612 236 nelarabine 1.374 1 2 239 188 187 614 237 ciclosporin 1.355 1 2 242 188 187 617 238 dexamethasone 1.499 1 1 205 188 225 618 239 linsitinib 1.493 1 1 207 188 225 620 240 BRD-K03911514 1.491 1 1 209 188 225 622 241 BRD-K29313308 1.485 1 1 210 188 225 623 242 trametinib 1.306 1 2 252 188 187 627 243 azacitidine 1.456 1 1 218 188 225 631 244 GSK1059615 1.426 1 1 227 188 225 640 245 A-804598 1.425 1 1 228 188 225 641 246 BCL-LZH-4 1.390 1 1 234 188 225 647 247 vandetanib 1.341 1 1 244 188 225 657 248 BRD-K79669418 1.334 1 1 247 188 225 660 249 BRD-K48477130 1.320 1 1 248 188 225 661 250 TG-100-115 1.313 1 1 249 188 225 662 251 VAF-347 1.312 1 1 250 188 225 663 252
[0248] Gene set enrichment analysis: Gene set enrichment analysis (GSEA) was performed using fgsea (Sergushichev A A. bioRxiv. 2016, 060012), adapted from the original description (Subramanian A et al. Proc Natl Acad Sci USA. 2005, 102, 15545-15550). Gene Ontology (Ashburner M et al. Nat Genet. 2000, 25, 25-29; The Gene Ontology Consortium. Nucleic Acids Res. 2017, 45, D331-D338) biological processes were retrieved from the molecular signatures database (MSigDB) (Liberzon A et al. Bioinformatics. 2011, 27, 1739-1740; Subramanian A et al. Proc Natl Acad Sci USA. 2005, 102, 15545-15550).
[0249] Global transcriptome analysis: Total RNA isolated from PAECs treated with IL-1 and vehicle or I-BET762 using RNeasy kit (Qiagen) according to manufacturer's instruction and were analyzed to determine global transcriptome expression using Affymetrix Clariom S array. The gene expression was normalized with Robust Multiarray Analysis (RMA). For BRD2889, the same approach was employed using Affymetrix Clariom S array on RNA isolated from PAECs treated with BRD2889 or vehicle and subjected to either hypoxia or normoxia. Differentially expressed genes were defined as any gene for which the FDR adjusted p-value was below 0.05 (n=3/grp). Reversed genes were further defined as those genes that were differentially expressed in both (hypoxia versus normoxia) and in (hypoxia+BRD2889 versus hypoxia)+vehicle as well as were regulated in opposite directions. Similarly, for I-BET that were differentially expressed in IL-1+VC versus control and IL-1+I-BET versus IL-1+VC and were regulated in opposite directions. The data for both I-BET and BRD2889 have been submitted to the NCBI Gene Expression Omnibus with accession numbers GSE125508 and GSE160255, respectively.
[0250] RT-qPCR analysis: Cells were lysis in 1 ml of QiaZol reagent (Qiagen). Total RNA content was extracted using the RNeasy kit (Qiagen), according to the manufacturer's instructions. Total RNA concentration was determined using a BioTek Synergy multimode plate reader. Messenger RNAs were reverse transcribed to generate cDNA using the Multiscript RT kit (Thermo Fisher Scientific). cDNA for specific gene targets was amplified and quantified via fluorescently-labeled Taqman primer sets and Taqman fast advanced master mix (Thermo Fisher Scientific) using an Applied Biosystems QuantStudio 6 Flex Real-Time PCR System. Taqman primers used for RT-qPCR are listed in Table 5.
[0251] Protein stability assay: The proteasome inhibitor MG132 (M7449, Sigma) was stored at 20 C. at a concentration of 10 mM diluted in dimethyl sulfoxide (DMSO). PAECs were exposed to MG132 (5 mM) vs. DMSO vehicle control for 2 hr under hypoxia, prior to harvesting of cellular lysate for immunoblotting.
[0252] Proximity ligation assay: A Duolink PLA assay was developed according to the manufacturer's instructions (Sigma Aldrich, DUO96020). Briefly, PAECs were grown on coverslips, and then blocked for 1 hr with Duolink Blocking Solution. Samples were then stained with the indicated antibodies (anti-Integrin 3 (E-8), Santa Cruz Biotechnology, sc-393298; anti-Galectin 8/Gal-8 antibody, Abcam, ab109519; and normal Goat IgG Control, R&D Systems, AB-108-C) overnight at 4 C., diluted 1:100 in Duolink Antibody Diluent. PLUS and MINUS secondary PLA probes against rabbit and mouse IgG in Duolink Antibody Diluent were added, and the cells were incubated at 37 C. for 1 h with, followed by incubation with ligation mix for 30 min at 37 C. Amplification mix was then applied for 100 min at 37 C. The coverslips were mounted on microscope slides with Duolink Mounting Medium with Dapi, and the cells photographed under a fluorescence microscope.
[0253] Mitochondrialfunction assays: Baseline mitochondrial function and mitochondrial stress response were measured by oxygen consumption rate (OCR) using the Cell Mito Stress Kit with a XF24 extracellular flux analyzer (SeaHorse Bioscience, North Billerica, MA) following manufacturer's instructions. Briefly, 30,000 cells per well were grown overnight and, for OCR measurements, washed with XF assay medium (SeaHorse Bioscience) containing 10 mM Glucose, 1 mM Sodium-Pyruvate and 2 mM L-Glutamine set to pH=7.40. OCR was measured over time at baseline and following consecutive injections of 1 M Oligomycin, 1 M FCCP and a mix of 1 M Rotenone+1 M Antimycin A. Following the manufacturer's instructions, maximal mitochondrial respiration was determined as OCR following FCCP (Carbonylcyan ideptrifluoromethoxyphenylhydrazone) injection. Spare respiratory capacity was defined as OCRFCCP-baseline and mitochondrial ATP production as OCR Baseline-Oligomycin. For extracellular acidification rate (ECAR) measurements cells were washed in glucose-free XF base medium (Seahorse Bioscience) containing 2 mM L-Glutamine at pH 7.35. ECAR was determined after serial injections with 10 mM D-Glucose, 1 M Oligomycin, and 100 mM 2-Deoxyglucose.
[0254] Mitochondria isolation: Mitochondrial fraction from cultured PAECs with drug and siGSTP1 using the Mammalian Mitochondria Isolation Kit for Tissue & Cultured Cells (Biovision, Inc.) according to the manufacturer's instructions.
[0255] Measurement of mitochondrial complex activities: Complex I activity of isolated mitochondria were measured using Complex I Enzyme Activity Microplate assay kit (Abcam, ab109721) according to the manufacturer's protocol. These enzymes were captured within the wells of the microplate coated by the corresponding complex enzyme antibody, and activities were detected colorimetrically.
[0256] Flow cytometry detection of mitochondrial superoxide: For measuring mitochondrial superoxide, cells were incubated with 5 M of MitoSOX Red mitochondrial superoxide indicator (Thermo Fisher Scientific) for 10 min in 37 C. CO.sub.2 incubator. Next, cells were washed with 1PBS, trypsinized, and fluorescence (488 nm/580 nm) was measured on flow analyzer (BD LSR FORTESSA or BD LSRII) using BD FACSDIVA software.
[0257] Cellular apoptosis: Caspase-3/7 activity was quantified using the Caspase-Glo 3/7 Assay (Promega), according to manufacturer's instructions. Caspase-3/7 activity was normalized to total protein content determined by BCA method (Thermo Fisher Scientific).
[0258] BrdU growth assay: Cell proliferation was assayed relative to day 0 using a BrdU Cell Proliferation Assay Kit (#6813, Cell Signaling) according to the manufacturer's protocol after incubation for 2 h with BrdU.
[0259] Lentivirus production: HEK293 cells were transfected using Lipofectamine 2000 (Invitrogen) with indicated lentiviral plasmids along with packaging plasmids (pPACK, System Biosciences), according to the manufacturer's instructions. Virus was harvested, sterile filtered (0.22 m), titered via serial dilution and visualization of GFP expression, and utilized for subsequent infection of PAECs for gene transduction.
[0260] Immunoblot and densitometry: Cells were lysed in RIPA buffer (Sigma) along with 1 protease inhibitor cocktail (Sigma). Protein lysate was resolved by gradient 4%-15% SDS-PAGE gels and transferred onto a 0.2 m PVDF membrane (Bio-Rad). Membranes were blocked in 5% non-fat milk in 1PBST buffer for one hour at room temperature. Later, they were incubated in the presence of the primary antibody overnight at 4 C. and then appropriate HRP-conjugated secondary antibodies (Life Technologies). The following antibodies were used: human LGALS8 (AF1305, RnD Systems), mouse/rat Lgals8 (ab69631, Abcam), pSTAT1 (ab29045, Abcam) and STAT1 (ab47425, Abcam), GSTP1 (ab153949, Abcam), ISCU (14812-1-AP, Prointech), Glutathione (ab19534, Abcam), HIF2A (NB100-122, Novous), -Tubulin (CP06, Millipore sigma), and ACTB (sc-47778, Santa Cruz). The immunoreactive bands were visualized with the Chemidoc XRS+system (Bio-Rad) using SuperSignal West Femto chemiluminescent substrates (Thermo Fisher Scientific). The images were later quantified using AlphaEaseFC software (Alpha Innotech).
[0261] Plasmids: To construct a lentiviral plasmid carrying a GSTP1 transgene, oligonucleotides were synthesized by Integrated DNA Technologies. The primer sequences were as follows: forward, CGGGATCCCATGCCGCCCTACACCGTGGTG (SEQ ID NO: 1) and reverse, AGTTTAGCGGCCGCGTCAGTGGTGGTGGTGGTGGTGCTGTTTCCCGTT (SEQ ID NO: 2). The GSTP1 PCR products were amplified from a purchased plasmid (RG2030086, OriGene Technologies) and cloned into the vector pCDH-CMV (CD511B-1, System Biosciences) at the BamHI (underlined)/NotI (underlined) sites. Appropriate GSTP1 sequence was confirmed in comparison to sequence reference GenBank: NM_000852.4. The control lentiviral vector expressing GFP was used as a negative control.
[0262] Site-directed mutagenesis: The full-length human ISCU sequence (NCBI accession number BC061903) was used as the reference sequence for wildtype (WT) ISCU and cloned using the primers: forward, CCGGAATTCGACTACAAAGACGATGACGACAAGATGGCGGCGGCTGGGGCTTTC (SEQ ID NO: 3); and reverse, CGGGATCCCGTCATTTCTTCTCTGCCTCTCCTTTTTTGGGTTCTTG (SEQ ID NO: 4).
[0263] Via the QuikChange Primer Design tool (Agilent Technologies), mutagenesis forward primers and their reverse complement were then designed to replace the 69th cysteine residue position of ISCU to serine (5-CATTACGTCACCACTTGCTGGAGCCCCCA-3) (SEQ ID NO: 5) or alanine (5-TGCCGTCGACCCCATTGACGGCAGCACGCTGATGAGCAAG-3) (SEQ ID NO: 6). Specifically, the codon TGT for Cys69 was replaced by TCT for serine and by GCT for alanine. Site directed mutagenesis was carried out using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, CA). XL10-Gold Ultracompetent Cells were transformed with the PCR products. The cells were plated on LB agar containing ampicillin (100 g/mL) and kept at 37 C. overnight. Plasmids were extracted and transformed into BL21 (DE3) competent cells for protein expression and purification. Mutagenesis was confirmed by sequencing and cloned into the vector pCDH-CMV-GFP (CD511B-1, System Biosciences) at the EcoRI (underlined)/BamHI (underlined) sites.
[0264] LGALS8 (Galectin-8) ELISA: Human LGALS8 ELISA quantification was performed using a kit (Sigma-Aldrich, RAB1050) according to the manufacturer's instructions.
[0265] Measurement of GST activity: The GST activity from lung tissue and PAECs was assayed using GST assay kit (Cayman, MI, USA) per the manufacturer's instructions.
[0266] Rodent echocardiography: Echocardiography was performed using a 15-45 MHz transthoracic transducer and a Visual Sonics Vevo 3100 system (Fujifilm). Inhaled isoflurane anesthesia was used at 2% in 100% O.sub.2 during positioning and hair removal and then decreased to isoflurane 0.8% during imaging. Digital echocardiograms were analyzed off-line for quantitative analysis as previously described (Bertero T et al. J Clin Invest. 2014, 124, 3514-3528).
[0267] Immunoprecipitation: PAECs were transfected with the indicated combinations of siRNAs by Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer's instructions and/or treated with BRD2889 (1 mM, 24 h). Whole cell extract (200 g) of cells were immunoprecipitated with IgG control (1 mg, Abcam), anti-GTSP1 Ab (1 mg, Abcam), anti-GSH Ab (1 mg, Abcam), or anti-ISCU (1 mg, Abcam) and the immune complexes were pulled down with protein A/G agarose beads (Santa Cruz, sc-2003). After extensive washing, the immunoprecipitated proteins were analyzed by immunoblotting with the indicated antibodies.
[0268] Immunofluorescent staining: Cryostat sections were cut from OCT-embedded lung tissues at 5-10 m and mounted on gelatin-coated histological slides. Slides were thawed at room temperature for 10-20 min and rehydrated in wash buffer for 10 minutes. All sections were blocked in 10% donkey serum and exposed to primary antibody and Alexa 488, 568 and 647-conjugated secondary antibodies (Thermo Fisher Scientific). The following primary antibodies were used: Lgals8 (Ab69631, Abcam; 1/200), IL-1 (ab9722, Abcam; 1/200), GSTP1 (ab153949, Abcam; 1:100), ISCU (14812-1-AP, Proteintech; 1:100), cleaved caspase 3 (cs-9661, Cell Signaling; 1/400), -SMA (F3777, Sigma; 1/200) and CD31 (ab7388, Abcam; 1/200). Images were obtained using Nikon A1 confocal microscope with 40 objective. Small pulmonary vessels (10 vessels/section) that were not associated with bronchial airways were selected for analysis. Intensity of staining was quantified using ImageJ software (NIH). Degree of pulmonary arteriolar muscularization was assessed in OCT lung sections stained for -SMA by calculation of the proportion of fully and partially muscularized peripheral (<100 m diameter) pulmonary arteriole to total peripheral pulmonary arterioles (Bertero T et al. J Clin Invest. 2014, 124, 3514-3528).
[0269] Other advantages which are obvious and which are inherent to the invention will be evident to one skilled in the art. It will be understood that certain features and sub-combinations are of utility and may be employed without reference to other features and sub-combinations. This is contemplated by and is within the scope of the claims. Since many possible embodiments may be made of the invention without departing from the scope thereof, it is to be understood that all matter herein set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense.