Vaccinia Capping Enzyme Compositions and Methods
20230416701 ยท 2023-12-28
Assignee
Inventors
Cpc classification
International classification
Abstract
The present disclosure relates, according to some embodiments, to compositions, methods, and/or kits for producing vaccinia capping enzyme. For example, active, heterodimers of vaccinia capping enzyme may be produced as fusions comprising D1 and D12 subunits. Vaccinia capping enzyme fusion proteins may further comprise a linker.
Claims
1. A vaccinia capping enzyme fusion transcript comprising, in a 5 to 3 direction: (a) a sequence encoding a D1 subunit, (b) a linker, and (c) a sequence encoding a D12 subunit.
2. A composition comprising a vaccinia capping enzyme fusion transcript, wherein the vaccinia capping enzyme fusion transcript comprises, in a 5 to 3 direction: (a) a sequence encoding a D1 subunit; (b) a linker; and (c) a sequence encoding a D12 subunit.
3. A composition according to claim 2, wherein the D1 subunit has an amino acid sequence having at least 90% identity to positions 24 to 867 of SEQ ID NO: 1.
4. A composition according to claim 2, wherein the D1 subunit has an amino acid sequence having at least 90% identity to SEQ ID NO: 1.
5. A composition according to claim 2, wherein the linker has an amino acid sequence having at least 90% identity to SEQ ID NO: 3.
6. A composition according to claim 2, wherein the linker has an amino acid sequence having at least 90% identity to SEQ ID NO: 5.
7. A composition according to claim 2, wherein the D12 subunit has an amino acid sequence having at least 90% identity to SEQ ID NO: 2.
8. A composition according to claim 2, wherein the vaccinia capping enzyme fusion transcript further comprises (d) a cap.
9. A cell comprising the composition according to claim 2.
10. A cell according to claim 9, further comprising equimolar amounts of the D1 subunit and the D12 subunit.
11. A cell according to claim 9, further comprising an active vaccinia capping enzyme fusion protein.
12. A cell according to claim 10, wherein the vaccinia capping enzyme fusion protein has an amino acid sequence at least 90% identical to SEQ ID NO: 4 or at least 90% identical to SEQ ID NO: 6 or at least 90% identical to SEQ ID NO: 8.
13.-17. (canceled)
18. A method for producing an active vaccinia capping enzyme comprising: contacting (a) a vaccinia capping enzyme fusion transcript comprising, in a 5 to 3 orientation, (i) a sequence encoding D1, (ii) a sequence encoding a linker, and (iii) a sequence encoding D12; with (b) an expression system.
19. A method according to claim 18, wherein the expression system is a yeast expression system.
20. A method according to claim 19, wherein the yeast is Kluyveromyces lactis or Pichia pastoris.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0008] The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
[0009]
[0010]
[0011]
DETAILED DESCRIPTION
[0012] Aspects of the present disclosure can be further understood in light of the embodiments, section headings, figures, descriptions and examples, none of which should be construed as limiting the entire scope of the present disclosure in any way. Accordingly, the claims set forth below should be construed in view of the full breadth and spirit of the disclosure.
[0013] Each of the individual embodiments described and illustrated herein has discrete components and features which can be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present teachings. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.
[0014] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Still, certain terms are defined herein with respect to embodiments of the disclosure and for the sake of clarity and ease of reference.
[0015] Sources of commonly understood terms and symbols may include: standard treatises and texts such as Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Singleton, et al., Dictionary of Microbiology and Molecular biology, 2d ed., John Wiley and Sons, New York (1994), and Hale & Markham, the Harper Collins Dictionary of Biology, Harper Perennial, N.Y. (1991) and the like.
[0016] As used herein and in the appended claims, the singular forms a and an include plural referents unless the context clearly dictates otherwise. For example, the term a protein refers to one or more proteins, i.e., a single protein and multiple proteins. It is further noted that the claims can be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as solely, only and the like in connection with the recitation of claim elements or use of a negative limitation.
[0017] Numeric ranges are inclusive of the numbers defining the range. All numbers should be understood to encompass the midpoint of the integer above and below the integer i.e., the number 2 encompasses 1.5-2.5. The number 2.5 encompasses 2.45-2.55 etc. When sample numerical values are provided, each alone may represent an intermediate value in a range of values and together may represent the extremes of a range unless specified.
[0018] In the context of the present disclosure, active refers to catalytic activity. For example, an active vaccinia capping enzyme fusion has at least detectable RNA-triphosphatase activity, at least detectable RNA guanylyltransferase activity, and at least detectable RNA N7-guanine methyltransferase activity.
[0019] In the context of the present disclosure, cap refers to natural caps, such as .sup.7mG, and to a compound of the general formula R3p.sub.3N1-p-N(x), where R3 is a guanine, adenine, cytosine, uridine or analogs thereof (e.g., N.sup.7-methylguanosine; m.sup.7G), p.sub.3 is a triphosphate linkage, N1 and Nx are ribonucleosides, x is 0-8 and p is, independently for each position, a phosphate group, a phosphorothioates, phosphorodithioate, alkylphosphonate, arylphosphonate, or a N-phosphoramidate linkage. Cap analogs are added at the 5 end of an RNA transcript in a process called co-transcriptional capping to yield a 5 capped RNA.
[0020] In the context of the present disclosure, D1 and D1 subunit refer to the 97 kDa VCE subunit encoded by the vaccinia virus D1R gene (GeneID:3707562; UniProtKB ID: YP 232988.1) having RNA-triphosphatase, RNA guanylyltransferase and RNA N7-guanine methyltransferase enzymatic activities. D1 may have an amino acid sequence sharing at least 90%, at least 92%, at least 94%, at least 96%, or at least 98% identity with SEQ ID NO: 1. D1 optionally may comprise a histidine tag, for example, at its N-terminus. Unless otherwise indicated, D1 refers to the whole subunit. D1 optionally may comprise one or more modified amino acids (e.g., hydroxylated, phosphorylated, myristoylated, palmitoylated, isoprenylated, sulfated, ubiquitinated, glycosylated (e.g., N-linked, O-linked), lipoylated, acetylated, alkylated (e.g., methylated), biotinylated, amidated, oxidized (e.g., cysteines forming a SS bond) or reduced).
[0021] In the context of the present disclosure, D12 and D12 subunit refer to the 33 kDa VCE subunit encoded by the vaccinia virus D12L gene (GeneID:3707515; UniProtKB ID: YP 232999.1) and capable of enhancing the RNA N7-guanine methyltransferase activity of the D1 subunit (e.g., beyond such activity of D1 in the absence of D12). D12 may have an amino acid sequence sharing at least 90%, at least 92%, at least 94%, at least 96%, or at least 98% identity with SEQ ID NO: 1. Unless otherwise indicated, D12 refers to the whole subunit. D1 and D12 subunits may be associated with each other with or without a covalent linker. D12 optionally may comprise one or more modified amino acids (e.g., hydroxylated, phosphorylated, myristoylated, palmitoylated, isoprenylated, sulfated, ubiquitinated, glycosylated (e.g., N-linked, O-linked), lipoylated, acetylated, alkylated (e.g., methylated), biotinylated, amidated, oxidized (e.g., cysteines forming a SS bond) or reduced).
[0022] In the context of the present disclosure, expression system refers to systems for producing a protein from a polynucleotide template comprising components to produce the protein according to an RNA template (e.g., enzymes, amino acids, an energy source), (optionally) components to produce the RNA template according to another RNA template or a DNA template (e.g., enzymes, nucleotides, an energy source). An expression system may comprise a bacterial (e.g., Escherichia coli) or yeast (e.g., Kluyveromyces lactis or Pichia pastoris) expression system in which the protein is encoded by an RNA or DNA template within an expression cassette, a plasmid or other expression vector. An expression system may comprise a viral expression system in which the protein is encoded by an RNA or DNA template (e.g., in an expression cassette) within a viral genome or viral expression vector. Examples of cell-free expression systems may include or comprise cell extracts of Escherichia coli S30, rabbit reticulocytes or wheat germ; PUREEXPRESS (New England Biolabs, Ipswich, MA). An expression cassette may comprise, in some embodiments, an expression control sequence (e.g., promoter), a coding sequence encoding the gene product (e.g., protein) of interest (e.g., a vaccinia capping enzyme fusion), and/or one or more termination sequences (e.g., terminators). An expression control sequence (e.g., promoter) may comprise any promoter operative in a desired expression system, including, for example, a GAP promoter, an AOX1 promoter, a T7 promoter, a T5 promoter, a Ptac promoter, a Ptrc promoter, ParaBAD promoter, a PrhaBAD promoter, a Tet promoter or a PhoA phosphate-starvation promoter.
[0023] In the context of the present disclosure, fusion refers to two or more polypeptides, subunits, or proteins covalently joined to one another (e.g., by a peptide bond). For example, a protein fusion may refer to a non-naturally occurring polypeptide comprising the protein covalently joined to a reporter protein. Alternatively, where a protein comprises two separate polypeptide subunit chains, a fusion may comprise a non-naturally occurring combined polypeptide chain comprising the two subunits joined directly to each other by a peptide bond or through a peptide linker.
[0024] In the context of the present disclosure, GS refers to flexible linkers comprising glycine and serine, for example, repeats of glycine and serine residues (Gly.sub.xSer.sub.y).sub.n, where independently, x=1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, y=1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, and n=1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10. For example, x, y, and/or n independently may be in a range of 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, or more.
[0025] In the context of the present disclosure, 1D2A refers to a polypeptide comprising, in an N-terminal to C-terminal direction, 14 amino acid residues of the capsid protein 1D, and a 2A proteinase of picornaviruses including, for example, 2A proteinases of rhinoviruses. An 1D2A may comprise a 2A proteinase derived from foot and mouth disease virus.
[0026] In the context of the present disclosure, peptide linker refers to a peptide, oligopeptide, polypeptide chain comprising two or more (e.g., 2-25, 20-40, 5-50, 10-100, >100) amino acids adapted to form a link (e.g., via peptide bonds at the N-terminal and C-terminal ends of the linker) between subunits of vaccinia capping enzyme. A peptide linker may comprise one or more modified amino acids (e.g., hydroxylated, phosphorylated, myristoylated, palmitoylated, isoprenylated, sulfated, ubiquitinated, glycosylated (e.g., N-linked, O-linked), lipoylated, acetylated, alkylated (e.g., methylated), biotinylated, amidated, oxidized (e.g., cysteines forming a SS bond) or reduced). Examples of peptide linkers include GS and 1D2A.
[0027] In the context of the present disclosure, non-naturally occurring refers to a polynucleotide, polypeptide, carbohydrate, lipid, or composition that does not exist in nature. Such a polynucleotide, polypeptide, carbohydrate, lipid, or composition may differ from naturally occurring polynucleotides polypeptides, carbohydrates, lipids, or compositions in one or more respects. For example, a polymer (e.g., a polynucleotide, polypeptide, or carbohydrate) may differ in the kind and arrangement of the component building blocks (e.g., nucleotide sequence, amino acid sequence, or sugar molecules). A polymer may differ from a naturally occurring polymer with respect to the molecule(s) to which it is linked. For example, a non-naturally occurring protein may differ from naturally occurring proteins in its secondary, tertiary, or quaternary structure, by having a chemical bond (e.g., a covalent bond including a peptide bond, a phosphate bond, a disulfide bond, an ester bond, and ether bond, and others) to a polypeptide (e.g., a fusion protein), a lipid, a carbohydrate, or any other molecule. Similarly, a non-naturally occurring polynucleotide or nucleic acid may contain one or more other modifications (e.g., an added label or other moiety) to the 5-end, the 3 end, and/or between the 5- and 3-ends (e.g., methylation) of the nucleic acid. A non-naturally occurring composition may differ from naturally occurring compositions in one or more of the following respects: (a) having components that are not combined in nature, (b) having components in concentrations not found in nature, (c) omitting one or components otherwise found in naturally occurring compositions, (d) having a form not found in nature, e.g., dried, freeze dried, crystalline, aqueous, and (e) having one or more additional components beyond those found in nature (e.g., buffering agents, a detergent, a dye, a solvent or a preservative). All publications, patents, and patent applications cited, listed, or otherwise mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0028] In the context of the present disclosure, polynucleotide linker sequence refers to a polynucleotide sequence that links the 3 end of one subject polynucleotides to the 5 end of another polynucleotide. A polynucleotide linker sequence may encode a polypeptide linker (e.g., a GS linker) and/or may allow, cause or promote ribosome skipping during translation.
[0029] In the context of the present disclosure, transcript refers to a polynucleotide template for a polypeptide. A transcript may comprise RNA (e.g., ssRNA), a cap or cap analog, and/or a polyA tail. A transcript may be capable of translation in a cell (e.g., a bacterial cell and/or a yeast cell). For example, a transcript may be or comprise mRNA. A fusion transcript may comprise polynucleotide templates for two or more polypeptides in a single polynucleotide.
[0030] The potential for mRNA vaccines to transform the treatment of infectious diseases has gained considerable traction since it was first proposed. Manufacturing may be cell-free and scalable. Once the sequence of a desired immunogen is provided, the time required to produce clinical batches of vaccine might be weeks instead of months. Such rapid production may limit or even avert widespread outbreaks.
[0031] Production of stable mRNA capable of efficient translation upon introduction to a subject may require an appropriate cap structure. Vaccinia virus, like most viruses, has a robust set of tools to co-opt host cell machinery for the production of viral proteins. One such tool is the vaccinia capping enzyme, which forms a Cap 0 structure (m7Gppp5 N) at the 5 end of uncapped RNA molecules through its RNA triphosphatase, guanylyltransferase, and guanine methyltransferase activities. In cells, capping viral transcripts allows them to be transcribed by the infected cells. Other transcripts may be capped rapidly in vitro in the presence of the vaccinia capping enzyme, reaction buffer, GTP, and the methyl donor, SAM. Capping by VCE may be nearly 100% efficient and all capped structures may be added in the proper orientation (e.g., compared to co-transcriptional addition of some cap analogs). Capping by vaccinia capping enzyme may be desired or even required for production of an effective RNA vaccine. For example, a suitable cap structure may impact the stability and translatability of an RNA vaccine.
[0032] Production of active vaccinia capping enzyme for cell-free vaccine production can be challenging. Properties of VCE may impede production (e.g., high capacity production) and use of the enzyme. For example, efforts to express the vaccinia virus D1R gene in bacteria and yeast as a means to produce and recover the 97 kDa subunit result in low yields. Without limiting any embodiment to any specific mechanism of action, this appears to be due, at least in part, to the insolubility and/or hydrophobicity of the 97 kDa subunit. In addition, in vitro assembly of the small and large subunits into a heterodimer may yield an enzyme with little to no catalytic activity. Separately produced subunits may not be present in an appropriate ratio or conformation to efficiently or productively bind to one another and/or bind to substrates.
[0033] A 2A sequence derived from foot-and-mouth disease virus can be used as an alternative strategy to generate different proteins derived from a fusion protein precursor (Osborn et al. 2005). A region of 18 amino acid residues from 2A followed by a proline promoted cleavage in a co-translational manner using a nonproteolytic mechanism termed ribosome skipping (Donnelly, Luke et al. 2001). Addition of 14 amino acid residues of the capsid protein 1D to the N-terminal of 2A increased the activity of self-processing up to 99% (Donnelly, Hughes et al. 2001). An artificial polyprotein precursor comprising this 1D2A sequence flanked by reporter genes was efficiently processed into separate polypeptides in tested eukaryotic cells, including Pichia pastoris (Lee et al. 2012; Rasala et al. 2012; Chng et al. 2015; Sun et al. 2012; de Amorim Aradjo et al. 2015). After processing, the 1D2A peptide remains as a C-terminal extension of the upstream protein and all products downstream of 2A contain a proline residue at the N-terminal (Ryan et al. 1991; Donnelly, Luke et al. 2001; De Felipe et al. 2003).
[0034] Linkers used in the construction of multidomain proteins may comprise repeats of glycine and serine residues (Gly.sub.xSer.sub.y).sub.n. The combination of flexible (Gly) and hydrophilic (Ser) residues in these linkers has multiple advantages, since it may not interfere with a folding and function of the fusion proteins. The absence of protease-sensitive sites of the common eukaryotic proteases in the Gly-Ser linker sequences potentially contributes to the stability of the linker of the chimeric proteins (Crasto and Feng 2000).
[0035] The present disclosure relates to compositions, methods, and kits for producing active vaccinia capping enzyme. For example, compositions may comprise a vaccinia capping enzyme fusion comprising (e.g., in a single polypeptide chain) a D1 subunit, a D12 subunit, and a linker (e.g., a flexible linker, a cleavable linker) positioned between the carboxy terminal end of the D1 subunit and the amino terminal end of the D12 subunit. A vaccinia capping enzyme fusion may comprise, for example, in an N-terminal to C-terminal direction, (a) a polypeptide having a sequence at least 90% identical to positions 24 to 867 of SEQ ID NO:1, (b) a linker having at least 90% identity to SEQ ID NO: 3 or at least 90% identity to SEQ ID NO: 5, and (c) a polypeptide having a sequence at least 90% identity to SEQ ID NO: 2. For example, a composition may comprise a vaccinia capping enzyme fusion comprising a polypeptide having an amino acid sequence at least 90% (e.g., at least 92%, at least 95%, at least 97%) identical to SEQ ID NO: 4 or at least 90% (e.g., at least 92%, at least 95%, at least 97%) identical to SEQ ID NO: 6 or at least 90% (e.g., at least 92%, at least 95%, at least 97%) identical to SEQ ID NO: 8. A vaccinia capping enzyme fusion may be stable as a single polypeptide chain and/or may have a desired susceptibility to cleavage (e.g., by a protease at a location in or near the linker).
[0036] Compositions may comprise, in some embodiments, a vaccinia capping enzyme fusion transcript (e.g., a single polynucleotide chain) comprising a sequence encoding a vaccinia capping enzyme fusion. For example, a vaccinia capping enzyme fusion transcript may comprise, in a 5 to 3 direction: (a) a sequence encoding a D1 subunit, (b) a linker (e.g., an 1D2A linker, a sequence encoding a flexible linker or a cleavable linker), and (c) a sequence encoding a D12 subunit. For example, a composition may comprise a vaccinia capping enzyme fusion transcript may encode a polypeptide having an amino acid sequence at least 90% identical to SEQ ID NO: 4 or at least 90% identical to SEQ ID NO: 6 or at least 90% identical to SEQ ID NO: 8. A vaccinia capping enzyme fusion transcript, according to some embodiments, may comprise a cap (e.g., a 5 Cap 0). Compositions optionally may comprise one or more of the components set forth below for kits. In some embodiments, a composition may be glycerol-free, may be dry (e.g., as a result of lyophilization), and/or may be aqueous.
[0037] Methods for production of vaccinia capping enzyme may comprise, for example, contacting a vaccinia capping enzyme fusion polynucleotide comprising, in a 5 to 3 orientation, (a) a sequence encoding a polypeptide having at least 90% identity to D1, (b) a sequence encoding a linker having at 90% identity to 1D2A (SEQ ID NO: 3) or at least 90% identity to GS (SEQ ID NO: 5), and (c) at least 90% identity to D12, with an expression system (e.g., a bacterial expression system, a yeast expression system, a viral expression system or a cell-free expression system). A method may optionally comprise capping a vaccinia capping enzyme fusion polynucleotide with a cap or a cap analog.
Kits
[0038] The present disclosure further relates to kits including a vaccinia capping enzyme fusion. For example, a kit may include a vaccinia capping enzyme fusion and an uncapped ribonucleic acid, dNTPs, rNTPs, primers, other enzymes (e.g., decapping enzymes, polymerases, other enzymes, or both), buffering agents, or combinations thereof. A vaccinia capping enzyme fusion may be included in a storage buffer (e.g., comprising glycerol and a buffering agent). A kit may include a reaction buffer which may be in concentrated form, and the buffer may contain additives (e.g. glycerol), salt (e.g. KCl), reducing agent, EDTA or detergents, among others. A kit comprising dNTPs may include one, two, three or all four of dATP, dTTP, dGTP and dCTP. A kit comprising rNTPs may include one, two, three of all four or rATP, rUTP, rGTP and rCTP. A kit may further comprise one or more modified nucleotides. A kit may optionally comprise one or more primers (random primers, bump primers, exonuclease-resistant primers, chemically-modified primers, custom sequence primers, or combinations thereof). One or more components of a kit may be included in one container for a single step reaction, or one or more components may be contained in one container, but separated from other components for sequential use or parallel use. The contents of a kit may be formulated for use in a desired method or process.
[0039] A kit is provided that contains: (i) A vaccinia capping enzyme fusion; and (ii) a buffer. A vaccinia capping enzyme fusion may have a lyophilized form or may be included in a buffer (e.g., a storage buffer or a reaction buffer in concentrated form). A kit may contain a vaccinia capping enzyme fusion in a mastermix suitable for receiving and capping a template ribonucleic acid. A vaccinia capping enzyme fusion may be a purified enzyme so as to contain no other detectable enzyme activities. The reaction buffer in (ii) and/or storage buffers containing a vaccinia capping enzyme fusion in (i) may include non-ionic, ionic e.g. anionic or zwitterionic surfactants, denaturants, and/or crowding agents. A kit may include a vaccinia capping enzyme fusion and the reaction buffer in a single tube or in different tubes.
[0040] A subject kit may further include instructions for using the components of the kit to practice a desired method. The instructions may be recorded on a suitable recording medium. For example, instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or sub-packaging) etc. Instructions may be present as an electronic storage data file residing on a suitable computer readable storage medium (e.g., a CD-ROM, a flash drive). Instructions may be provided remotely using, for example, cloud or internet resources with a link or other access instructions provided in or with a kit.
EXAMPLES
[0041] Some specific embodiments may be illustrated by one or more of the examples provided herein.
Example 1: Expression of 2A Fusion Construct Produces Active Heterodimeric VCE
A. Plasmids and Linear Expression Cassettes
[0042] The pD912(GAP)/D1-1D2A-D12 plasmid comprises sequences encoding vaccinia mRNA capping enzyme D1 and D12 subunits, arranged to be expressible as a single polypeptide. A sequence encoding a D1 subunit having an amino-terminal His-tag (SEQ ID NO:1) was fused to a sequence encoding the amino-terminus of the un-tagged D12 subunit (SEQ ID NO:2) via a sequence encoding a 33 amino acid residue 1D2A linker (SEQ ID NO:3).
[0043] The plasmid was synthesized and assembled using PCR and in vitro DNA assembly methods. The pD912(GAP) was prepared from pD912(AOX) vector by replacing 462 bp long AOX1 promoter sequence with 483 bp long DNA fragment containing Pichia pastoris GAP promoter. The pD912(GAP) vector backbone without the sequence encoding for secretion leader was amplified by PCR. The ORFs of D1 and D12 were amplified from pET23bVCE plasmid using PCR method. All amplified DNA fragments were purified by gel extraction and assembled into the plasmid using NEBuilder HiFi DNA Assembly Mix. The resulting pD912(GAP)/D1-1D2A-D12 plasmid contained the self-processive D1-1D2A-D12 construct under control of the constitutive GAP promoter for the cytoplasmic expression in Pichia pastoris. The non-naturally occurring VCE protein sequence encoded by pD912(GAP)/D1-1D2A-D12 plasmid corresponds to SEQ ID NO:4.
[0044] Another variant of a heterodimeric D1-1D2A-D12 fusion was generated by assembling a construct into the pD912(AOX) vector. The resulting pD912(AOX1)/D1-1D2A-D12 plasmid contained a fusion construct under control of the methanol inducible AOX1 promoter for the cytoplasmic expression in Pichia pastoris.
[0045] Another active heterodimeric construct of vaccinia mRNA capping enzyme subunits was generated by fusion of D1 and D12 via flexible non-cleavable linker (Gly-Gly-Gly-Gly-Ser).sub.3 SEQ ID NO:5. The genes of D1 and D12 were amplified from pET23bVCE plasmid using PCR method. The pD912(GAP) vector backbone minus the sequence encoding for secretion leader was amplified by PCR. All amplified DNA fragments were purified by gel extraction and assembled into the plasmid using NEBuilder HiFi DNA Assembly Mix. The resulting pD912(GAP)/D1-GS-D12 plasmid contained D1-GS-D12 construct under control of the constitutive GAP promoter for the cytoplasmic expression in Pichia pastoris. The protein sequence encoded by pD912(GAP)/D1-GS-D12 plasmid corresponds to SEQ ID NO:6.
[0046] A linear expression cassette was PCR amplified from the assembled plasmids (
B. Yeast Transformation and Integration
[0047] Pichia pastoris aox1 (MutS) (ATUM, formerly DNA 2.0) strain was used in all experiments under this Example. Pichia pastoris electrocompetent cells were prepared by a lithium acetate/DTT method (Wu and Letchworth, 2004). 0.2 g of a purified linear expression cassette was introduced into Pichia pastoris electrocompetent cells (electroporation conditions: 1.5 KV, 25 F and 200 Ohm; 0.2 mm cuvette) followed by selection of transformants by growth on yeast peptone dextrose (YPD) agar medium supplemented with 1 M sorbitol and 500 g/mL Zeocin (Teknova) for 3-4 days at 30 C.
[0048] For the identification of transformants by PCR, genomic DNA was isolated from each colony selected for testing using a lithium acetate/sodium dodecyl sulfate (LiOAc/SDS) method (Looke et al., 2011). PCR was used to identify transformants having an integrated expression cassette. The amplified genomic DNA fragments were purified and used to verify the sequence of the integrated construct.
C. Yeast Culture Conditions and Expression
[0049] For constructs containing GAP promoter, Pichia pastoris transformants were grown at 30 C. in 5-25 mL of yeast medium (1% yeast extract, 2% peptone, 1.34% yeast nitrogen base (YNB) without amino acids, 0.0004% biotin, 10 mM potassium phosphate, pH 6.0) supplemented with 2% glycerol as the carbon source. After 48 hours, the cells and spent culture media were harvested.
[0050] For constructs containing AOX1 promoter, Pichia pastoris transformants were grown to near saturation (OD=20 at 600 nm) at 30 C. in 10 mL of yeast medium (1% yeast extract, 2% peptone, 1.34% yeast nitrogen base, 0.0004% biotin, 10 mM potassium phosphate, pH 6.0) supplemented with 1% glycerol as the carbon source. Cells were harvested and resuspended in 4 ml of the same medium with 0.5% (v/v) methanol instead of glycerol and incubated for 48 hours.
D. Protein Purification and Analysis
[0051] To prepare cell lysate, cells were resuspended in 20 mM Tris-HCl, pH7.5 buffer, containing 100 mM NaCl. The cells disrupted using a high pressure homogenizer at 30 KPsi (Dyhydromatics), and the cell lysate pre-cleared by centrifugation at 17000g for 45 minutes. The cell lysates and spent culture media were analyzed by SDS-PAGE on 10-20% polyacrylamide gel, followed by western blotting with His-tag antibodies (Thermofisher) or mouse monoclonal antibodies against D1 or D12 subunits (GenScript).
[0052] Purification of the expressed recombinant fusion proteins from cell lysates was performed using the NEBExpress Ni Spin columns according to manufacturer's recommendations (NEB).
E. In Vitro mRNA Capping Assay
[0053] In vitro capping reactions were carried out in a 10 L reaction containing 1 capping buffer (50 mM Tris pH 8.0, 5 mM KCl, 1 mM MgCl.sub.2, 1 mM DTT) supplemented with 0.1 mM S-adenosylmethionine, 0.5 mM GTP, 500 nM substrate RNA (5-pppGUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 (SEQ ID NO:7), Bio-Synthesis, Inc.), and purified enzyme at 37 C. for 30 minutes. Reactions were stopped by adding 10 L of quenching solution (20 mM EDTA, 2% SDS). Reactions were diluted in nuclease-free water to reach a final substrate concentration of 5 nM before capillary electrophoresis on either an Applied Biosystems 3130x1 Genetic Analyzer (16 capillary array) or an Applied Biosystems 3730x1 Genetic Analyzer (96 capillary array) using GeneScan 120 LIZ dye Size Standard (Applied Biosystems). Reaction products were analyzed using PeakScanner software (Thermo Fisher Scientific).
F. Results: Active Enzyme was Produced
[0054] Western blot analysis of the transformants expressing cytoplasmic heterodimer D1-1D2A-D12 indicated that the recombinant fusion protein is expressed in Pichia pastoris cytoplasm as a soluble protein. The results indicate, that the self-processive D1-1D2A-D12 is only partially processed, since D1 and D12 subunits were present in both fused and individual forms (
[0055] The cytoplasmic heterodimer D1-GS-D12 fusion protein containing flexible linker is also expressed as a single polypeptide (
REFERENCES
[0056] Cong, P. and S. Shuman (1993). Covalent catalysis in nucleotidyl transfer. A KTDG motif essential for enzyme-GMP complex formation by mRNA capping enzyme is conserved at the active sites of RNA and DNA ligases. J Biol Chem 268(10): 7256-60. [0057] Niles, E. G. and L. Christen (1993). Identification of the vaccinia virus mRNA guanyltransferase active site lysine. J Biol Chem 268(33): 24986-9. [0058] Higman, M. A. and E. G. Niles (1994). Location of the S-adenosyl-L-methionine binding region of the vaccinia virus mRNA (guanine-7-)methyltransferase. J Biol Chem 269(21): 14982-7. [0059] Mao, X. and S. Shuman (1994). Intrinsic RNA (guanine-7) methyltransferase activity of the vaccinia virus capping enzyme D1 subunit is stimulated by the D12 subunit. Identification of amino acid residues in the D1 protein required for subunit association and methyl group transfer. J Biol Chem 269(39): 24472-9. [0060] Gong, C. and S. Shuman (2003). Mapping the active site of vaccinia virus RNA triphosphatase. Virology 309(1): 125-34. [0061] Higman, M. A., N. Bourgeois, et al. (1992). The vaccinia virus mRNA (guanine-N-7-)-methyltransferase requires both subunits of the mRNA capping enzyme for activity. J Biol Chem 267(23): 16430-7. [0062] Higman, M. A., L. A. Christen, et al. (1994). The mRNA (guanine-7) methyltransferase domain of the vaccinia virus mRNA capping enzyme. Expression in Escherichia coli and structural and kinetic comparison to the intact capping enzyme. J Biol Chem 269(21): 14974-81. [0063] Osborn M J, Panoskaltsis-Mortari A, Mcelmurry R T, Bell S K, Vignali D A A, Ryan M D, Wilber A C, McIvor R S, Tolar J, Blazar B R. A picornaviral 2A-like sequence-based tricistronic vector allowing for high-level therapeutic gene expression coupled to a dual-reporter system. Mol Ther. 2005; 12:569-574. [0064] Donnelly M L L, Luke G, Mehrotra A, Li X, Hughes L E, Gani D, Ryan M D. b Analysis of the aphthovirus 2A/2B polyprotein cleavage mechanism indicates not a proteolytic reaction, but a novel translational effect: a putative ribosomal skip J Gen Virol. 2001; 82:1013-1025. [0065] Donnelly M L L, Hughes L E, Luke G, Mendoza H, ten Dam E, Gani D, Ryan M D. The cleavage activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring 2A-like sequences. J Gen Virol. 2001; 82:1027-1041. doi: 10.1099/0022-1317-82-5-1027. [0066] Lee D S, Lee K H, Jung S, Jo E J, Han K H, Bae H J. Synergistic effects of 2A-mediated polyproteins on the production of lignocellulose degradation enzymes in tobacco plants. J Exp Bot. 2012; 63:4797-4810. [0067] Rasala B A, Lee P A, Shen Z, Briggs S P, Mendez M, Mayfield S P. (2012). Robust expression and secretion of Xylanasel in Chlamydomonas reinhardtii by fusion to a selection gene and processing with the FMDV 2A peptide. PLoS One. 7:e43349. [0068] Chng J, Wang T, Nian R, Lau A, Hoi K M, Ho S C, Gagnon P, Bi X, Yang Y. (2015). Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells. MAbs. 7:403-412. [0069] Sun Y F, Lin Y, Zhang J H, Zheng S P, Ye Y R, Liang X X, Han S Y. (2012). Double Candida antarctica lipase B co-display on Pichia pastoris cell surface based on a self-processing foot-and-mouth disease virus 2A peptide. Appl Microbiol Biotechnol. 96:1539-1550. [0070] de Amorim Ardjo, J., Ferreira, T. C., Rubini, M. R., Duran, A. G., De Marco, J. L., de Moraes, L. M., & Torres, F. A. (2015). Coexpression of cellulases in Pichia pastoris as a self-processing protein fusion. AMB Express, 5(1), 84. [0071] Ryan M D, King A M Q, Thomas G P. (1991). Cleavage of foot-and-mouth disease virus polyprotein is mediated by residues located within a 19 amino acid sequence. J Gen Virol. 72:2727-2732. [0072] De Felipe P, Hughes L E, Ryan M D, Brown J D. (2003). Co-translational, intraribosomal cleavage of polypeptides by the foot-and-mouth disease virus 2A peptide. J Chem. 278:11441-11448. [0073] Crasto, C. J., & Feng, J. A. (2000). LINKER: a program to generate linker sequences for fusion proteins. Protein engineering, 13(5), 309-312. [0074] Wu, S., & Letchworth, G. J. (2004). High efficiency transformation by electroporation of Pichia pastoris pretreated with lithium acetate and dithiothreitol. BioTechniques, 36(1), 152-154. [0075] Loke, M., Kristjuhan, K., & Kristjuhan, A. (2011). Extraction of genomic DNA from yeasts for PCR-based applications. BioTechniques, 50(5), 325-328.