RECOMBINANT MICROORGANISM HAVING IMPROVED ABILITY TO PRODUCE RECOMBINANT SILK PROTEIN AND METHOD FOR PRODUCING HIGH-MOLECULAR-WEIGHT RECOMBINANT SILK PROTEIN BY USING SAME

20230416755 ยท 2023-12-28

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a recombinant microorganism having enhanced ability to produce recombinant silk protein and a method of producing high-molecular-weight recombinant silk protein using the same, and more specifically, to a recombinant microorganism having an enhanced ability to produce spider silk protein, obtained by introducing a sequence encoding a synthetic sRNA that inhibits expression of eno gene into a microorganism having ability to produce recombinant silk protein. The recombinant silk protein derived from the recombinant strain according to the invention has a high molecular weight similar to that of dragline silk protein produced by spiders, and may be mass-produced, and thus it has properties similar to or better than those of natural silk protein when manufactured into fibers. Accordingly, the recombinant silk protein may be advantageously used in various industrial fields such as bioengineering and/or pharmaceutical fields where spider silk fibers are expected to be applied.

    Claims

    1. A recombinant microorganism having enhanced ability to produce spider silk protein, obtained by inhibiting expression of eno gene in a microorganism having ability to produce recombinant silk protein.

    2. The recombinant microorganism according to claim 1, wherein the inhibiting the expression of the eno gene is performed by at least one method selected from the group consisting of a method of introducing a sequence encoding a synthetic sRNA that inhibits the expression of the gene, a method of modifying a promoter, a method of introducing antisense RNA, and a method of introducing siRNA.

    3. The recombinant microorganism according to claim 1, wherein expression of at least one additional gene selected from the group consisting of gnd, ybcF, araC, purT, tdcD, ackA, pta, fsaA, fsaB, ptsH, ptsI, dhal, dhaK, pyrD, guaA, prsA, tesB, aas, acpP, ychM, cysZ, asnA, asnB, acpP, plsB, fadB, sucC, fldA, fade, sucA, sucB, and pykA has been inhibited.

    4. The recombinant microorganism according to claim 3, wherein the expression of the at least one additional gene has been inhibited by at least one method selected from the group consisting of a method of introducing a sequence encoding a synthetic sRNA that inhibits the expression of the at least one additional gene, a method of modifying a promoter, a method of introducing antisense RNA, and a method of introducing siRNA.

    5. The recombinant microorganism according to claim 3, wherein the at least one additional gene is pstI, asnA, ychM, tesB, dhaK, guaA, pck or purT.

    6. The recombinant microorganism according to claim 1, wherein the microorganism having the ability to produce recombinant silk protein is one into which a gene encoding a recombinant silk protein in which a peptide having the amino acid sequence of SEQ ID NO: 1 is repeated 1 to 160 times, or a recombinant vector containing the gene, and a recombinant vector containing a nucleotide sequence encoding tRNA, have been introduced.

    7. The recombinant microorganism according to claim 2 or 4, wherein the synthetic sRNA comprises: an Hfq binding site derived from sRNA of any one of MicC, SgrS and MicF; and a region forming a complementary bond with an mRNA of the eno gene.

    8. The recombinant microorganism according to claim 1, wherein the microorganism is selected from the group consisting of E. coli, Rhizobium, Bifidobacterium, Rhodococcus, Candida, Erwinia, Enterobacter, Pasteurella, Mannheimia, Actinobacillus, Aggregatibacter, Xanthomonas, Vibrio, Pseudomonas, Azotobacter, Acinetobacter, Ralstonia, Agrobacterium, Rhodobacter, Zymomonas, Bacillus, Staphylococcus, Lactococcus, Streptococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces, Bifidobacterium, Cyanobacterium, and Cyclobacterium.

    9. The recombinant microorganism according to claim 6, wherein the peptide is a repeating peptide unit constituting a dragline silk protein.

    10. A method for producing recombinant silk protein, the method comprising steps of: (a) producing recombinant silk protein by culturing the recombinant microorganism according to any one of claims 1 to 9; and (b) recovering the produced recombinant silk protein.

    11. The method according to claim 10, wherein step (b) comprises a salting-out step.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0015] FIG. 1 is a conceptual view explaining the mechanism of action of a synthetic sRNA of the present invention.

    [0016] FIG. 2(A) is a conceptual view showing an sRNA cassette for the eno gene screened according to one example of the present invention, and FIG. 2(B) is a map of a vector comprising the cassette.

    [0017] FIG. 3 is a map of a vector comprising an sRNA cassette for an additional gene screened according to one example of the present invention.

    [0018] FIG. 4(A) shows the results of analyzing the expression level of spider silk protein depending on the length of the target binding site of the eno gene screened according to one example of the present invention, FIG. 4(B) shows the results of calculating binding energy, and FIG. 4(C) is a graph showing the relationship between binding energy and expression level.

    [0019] FIGS. 5(A) and 5(B) show the results of analyzing the expression levels of recombinant silk protein in known strains, and FIG. 5(C) shows the results of comparing the expression level of recombinant silk protein following the inhibition of expression of the eno gene screened according to one example of the present invention.

    [0020] FIG. 6 shows the result of analyzing the expression levels of spider silk protein following knockdown of additional candidate genes screened according to one example of the present invention.

    [0021] FIG. 7 shows the result of analyzing the expression levels of spider silk protein following knockdown of additional candidate genes screened according to one example of the present invention.

    [0022] FIG. 8 shows the result of analyzing the expression levels of spider silk protein following knockdown of additional candidate genes screened according to one example of the present invention.

    [0023] FIG. 9(A) shows the results of analyzing the expression levels of spider silk protein following knockdown of the first screened genes among the additional candidate genes screened according to one example of the present invention, and FIG. 9(B) is a graph quantifying the results.

    [0024] FIG. 10(A) shows the results of analyzing the expression level of spider silk protein depending on the length of the target binding site of the ychM gene screened according to one example of the present invention, FIG. 10(B) shows the results of calculating binding energy, and FIG. 10(C) is a graph showing the relationship between binding energy and expression level.

    [0025] FIG. 11(A) is a schematic view predicting a modified metabolic pathway in a strain in which the expression of the eno gene and ychM gene screened according to one example of the present invention has been inhibited, FIG. 11(B) shows the results of measuring the expression level of recombinant silk protein in a strain, in which the expression of the eno gene and ychM gene screened according to one example of the present invention has been inhibited, 6 hours after induction with 1 mM IPTG when the OD.sub.600 at 30 C. reached 100 during fed-batch fermentation of the strain, and FIG. 11(C) shows the results of analyzing the expression level of the recombinant silk protein produced in a strain in which the expression of additional candidate genes in addition to the expression of the eno gene has been inhibited.

    [0026] FIG. 12 shows the results of RNA-seq analysis of strains in which the expression of the eno gene and ychM gene screened according to one example of the present invention has been inhibited. The left panel is a list of the most up-regulated genes, and the right panel is a list of the most down-regulated genes.

    [0027] FIG. 13 is a heatmap of a DEG list obtained using RNA-seq of strains in which the expression of the eno gene and ychM gene screened according to one example of the present invention has been inhibited, and shows that various genotypes were changed compared to those in existing recombinant silk protein strains.

    [0028] FIG. 14(A) the result of confirming the expression changes of glycine-, alanine-, and serine-related genes in strains in which the expression of the eno gene and ychM gene screened according to one example of the present invention has been inhibited, FIG. 14(B) shows the results of confirming the expression changes of genes related to transcription and translation, and FIG. 14(C) shows the results of confirming the amplification of glycine, alanine and serine tRNA.

    [0029] FIG. 15 shows the results of optimizing the concentration of ammonium persulfate in the salting-out method for isolation and purification of a strain in which the expression of the eno gene and ychM gene screened according to one example of the present invention has been inhibited.

    [0030] The left panel of FIG. 16 shows the results of analyzing the purity of the recombinant silk protein isolated and purified before microfiltration, and the right panel shows the results of analyzing the purity after microfiltration.

    [0031] FIG. 17(A) shows the results of 30-L fermentation of a strain in which the expression of the eno gene and ychM gene screened according to one example of the present invention has been inhibited, and FIG. 17(B) shows the results of 300-L fermentation of the strain.

    [0032] The left panel of FIG. 18 shows the results of 8% SDS-PAGE of the isolated and purified recombinant protein after 30-L fermentation of the strain according to one example of the present invention, and the right panel shows the results of 15% SDS-PAGE of the isolated and purified recombinant protein.

    DETAILED DESCRIPTION AND PREFERRED EMBODIMENTS OF THE INVENTION

    [0033] Unless otherwise defined, all technical and scientific terms used in the present specification have the same meanings as commonly understood by those skilled in the art to which the present invention pertains. In general, the nomenclature used in the present specification and the experimental methods described below are well known and commonly used in the art.

    [0034] The definition of main terms used in the detailed description of the invention is as follows

    [0035] As used herein, the term silk protein refers to a synthetic silk protein that approximates the molecular and structural profile of native silk proteins and is biosynthesized by a recombinant protein production method. Examples of the silk protein include dragline silk, silk fibroin, and flagelliform silk proteins. As used herein, the term silk-like protein refers to a protein which comprises, as a repeat unit, a peptide having a glycine content of 10% or more, similar to the silk protein, and is produced by, for example, a recombinant protein production method. Examples of the silk-like protein include elastin, byssus, and collagen.

    [0036] As used herein, the term spider silk fiber refers to a fiber which is produced from a synthetic recombinant silk protein and is substantially similar to a native spider silk fiber. The term spider silk-like fiber refers to a fiber which is produced from a synthetic recombinant silk-like protein and has physical properties similar to those of a spider silk protein.

    [0037] As used herein, the term recombinant protein refers to a protein produced by expression of a nucleic acid sequence which is incorporated into a vector, i.e., e.g., an autonomously replicating plasmid or virus, or into the genomic DNA of a host cell, or which exists as a separate molecule in the host cell.

    [0038] As used herein, the term host cell refers to any cell capable of expressing a functional gene and/or gene product introduced from another cell or organism.

    [0039] As used herein, the term sRNA (small RNA) is a short RNA having a nucleotide sequence length of 200 or fewer nucleotides, which is not translated into protein and effectively inhibits the translation of a specific mRNA by complementary binding.

    [0040] As used herein, the term ribosome binding site refers to an mRNA site to which a ribosome binds for mRNA transcription.

    [0041] As used herein, gene should be regarded in the broadest sense, and may encode a structural protein or a regulatory protein. Here, the regulatory protein includes a transcription factor, a heat shock protein, or a protein involved in DNA/RNA replication, transcription, and/or translation. In the present invention, the target gene whose expression is to be inhibited may exist as an extrachromosomal element.

    [0042] In the present invention, in order to develop a strain capable of mass-producing a high-molecular-weight recombinant silk protein by manipulating metabolic pathways in an existing strain producing a high-molecular-weight recombinant silk protein, candidate genes were screened using an sRNA library capable of inhibiting expression of each gene, and then an optimal gene combination was screened by comparing the production of recombinant silk protein between the screened genes. In this case, it was confirmed that it was possible to produce a high-molecular-weight recombinant silk protein with high purity.

    [0043] That is, in one example of the present invention, an sRNA library capable of knocking down each of all E. coli genes was introduced into an existing strain producing recombinant silk protein (KR 10-1317420), and then candidate genes whose inhibition of expression was expected to increase the production of recombinant silk protein were screened through a metabolic pathway simulation using knock-down regulation of two or more genes. It was confirmed that, when expression of the genes was inhibited using sRNA, the production of recombinant silk protein increased (FIGS. 2, 4 and 5).

    [0044] Additionally, other candidate genes were tested in the same manner, and it was confirmed that, when expression of additional genes in addition to the genes screened in the above step, the production of recombinant silk protein dramatically increased (FIG. 11).

    [0045] Therefore, in one aspect, [0046] the present invention is directed to a recombinant microorganism having an enhanced ability to produce spider silk protein, obtained by inhibiting expression of eno gene in a microorganism having the ability to produce recombinant silk protein.

    [0047] In the present invention, the inhibition of expression of the eno gene may be performed using any method known to those skilled in the art, and preferably, may be performed by at least one method selected from the group consisting of a method of introducing a sequence encoding a synthetic sRNA that inhibits expression of the gene, a method of modifying the promoter, a method of introducing antisense RNA, and a method of introducing siRNA, without being limited thereto.

    [0048] In addition, the recombinant microorganism may be one in which expression of at least one additional gene selected from the group consisting of gnd, ybcF, araC, purT, tdcD, ackA, pta, fsaA, fsaB, ptsH, ptsI, dhal, dhaK, pyrD, guaA, prsA, tesB, aas, acpP, ychM, cysZ, asnA, asnB, acpP, plsB, fadB, sucC, fldA, fade, sucA, sucB, and pykA has been inhibited.

    [0049] In the present invention, the additional gene may be pstI, asnA, ychM, tesB, dhaK, guaA, pck, or purT, more preferably ychM or pstI.

    [0050] In the present invention, the inhibition of expression of the gnd, ybcF, araC, purT, tdcD, ackA, pta, fsaA, fsaB, ptsH, ptsI, dhal, dhaK, pyrD, guaA, prsA, tesB, aas, acpP, ychM, cysZ, asnA, asnB, acpP, plsB, fadB, sucC, fldA, fade, sucA, sucB, or pykA gene may performed using any method known to those skilled in the art, and preferably, may be performed by at least one method selected from the group consisting of a method of introducing a sequence encoding a synthetic sRNA that inhibits expression of the gene, a method of modifying the promoter, a method of introducing antisense RNA, and a method of introducing siRNA, without being limited thereto.

    [0051] In the present invention, information on the gene may be gene information described in https://www.uniprot.org/, without being limited thereto.

    [0052] In the present invention, the microorganism having the ability to produce recombinant silk protein may be one into which a gene encoding a recombinant silk protein in which a peptide having the amino acid sequence of SEQ ID NO: 1 is repeated 1 to 160 times, preferably 8 to 160 times, more preferably 16 to 160 times, or a recombinant vector containing the gene, and a recombinant vector containing a nucleotide sequence encoding tRNA, have been introduced.

    [0053] In the present invention, the microorganism having the ability to produce recombinant silk protein may be E. coli BL21 (DE3) ((F-ompT hsdSB(rB-mB-)gal dcm (DE3) pTet-glyVXY(CmR) pSH16a, 32, 64, 96(KanR)), without being limited thereto.

    [0054] In the present invention, the nucleotide sequence encoding tRNA may be a nucleotide sequence encoding glycine tRNA.

    [0055] In the present invention, the peptide may be a repeating peptide unit constituting a dragline silk protein.

    [0056] In the present invention, the peptide having a glycine content of 10% or more, which constituents the silk protein or silk-like protein, may be a repeating peptide unit constituting a protein selected from the group consisting of dragline silk, elastin, silk fibroin, byssus, flagelliform silk, and collagen. The amino acid sequences of SEQ ID NOs: 1 to 4 are repeating peptide units of dragline silk protein, the amino acid sequences of SEQ ID NOs: 5 to 7 are repeating peptide units of elastin, the amino acid sequence of SEQ ID NO: 8 is a repeating peptide unit of silk fibroin, the amino acid sequence of SEQ ID NO: 9 is a repeating peptide unit of byssus, the amino acid sequence of SEQ ID NO: 10 is a repeating peptide unit of flagelliform silk, and SEQ ID NOs: 11 and 12 are repeating peptide units of collagen.

    TABLE-US-00001 SEQIDNO1: NH.sub.2-SGRGGLGGQGAGMAAAAAMGGAGQGGYGGLGSQGT-COOH SEQIDNO2: NH.sub.2-GPGQQ-COOH SEQIDNO3: NH.sub.2-GPGGY-COOH SEQIDNO4: NH.sub.2-GGYGPGS-COOH SEQIDNO5: NH.sub.2-GVGVP-COOH SEQIDNO6: NH.sub.2-VPGG-COOH SEQIDNO7: NH.sub.2-APGVGV-COOH SEQIDNO8: NH.sub.2-GAGAGS-COOH SEQIDNO9: NH.sub.2-GPGGG-COOH SEQIDNO10: NH.sub.2-GPGGX-COOH SEQIDNO11: NH.sub.2-GAPGAPGSQGAPGLQ-COOH SEQIDNO12: NH.sub.2-GAPGTPGPQGLPGSP-COOH

    [0057] In the present invention, it was confirmed that a recombinant silk protein prepared to comprise 48 repeats of the amino acid sequence set forth in SEQ ID NO: 1 (hereinafter referred to as 48-mer) had a molecular weight of about 148 kDa, and the production thereof was significantly higher than the production of recombinant silk protein in an existing silk. In addition, it was found that a recombinant silk protein prepared to comprise 96 repeats of the amino acid sequence set forth in SEQ ID NO: 1 (hereinafter referred to as 96-mer) had a molecular weight reaching 284.9 kDa, which is substantially similar to the molecular weight of native silk protein (250 to 320 kDa) obtained from spiders, and the production and purity thereof significantly increased compared to those in an existing strain.

    [0058] However, recombinant silk proteins comprising 160 repeats or more of the peptide sequence cannot be synthesized by E. coli. Thus, the recombinant silk or silk-like protein according to the present invention may have a structure in which the peptide is repeated 16 to 160 times, preferably 48 to 160 times, more preferably 96 to 160 times.

    [0059] In the present invention, the amino acid sequences that are used as repeat units are not limited to the exact sequences of SEQ ID NOS: 1 to 12. The amino acid sequences herein also comprise variants. Thus, the amino acid sequences of the proteins of the present invention also encompass all sequences differing from the herein-disclosed sequences by amino acid insertions, deletions, and substitutions.

    [0060] Preferably, amino acid substitutions are the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements. Amino acid substitutions may be made on the basis of similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

    [0061] Insertions or deletions in the repeat unit are typically in the range of about 1 to 5 amino acids, and preferably about 1, 2 or 3 amino acids. Amino acid additions in the repeat unit are typically less than 100, preferably less than 80, more preferably less than 50, most preferably less than 20 amino acids, which are inserted into the repeat unit of the present invention and added to and/or inserted into the protein of the present invention. It is noted that only those additions, which do not negatively affect the required characteristics of the protein disclosed herein, are contemplated in the present invention.

    [0062] The variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a protein using recombinant DNA techniques and assaying the resulting recombinant variants for activity. This does not require more than routine experiments for a person skilled in the art.

    [0063] Accordingly, the protein of the present invention may comprise, as a repeat unit, an amino acid sequence having a homology of at least 90% to SEQ ID NO: 1. As used herein, the phrase having a homology of at least 90% means that the protein has an identity of 91, 91.5, 92, 92.5, 93, 93.5, 94, 94.5, 95, 95.5, 96, 96.5, 97, 97.5, 98, 98.5, 99 or 99.5% with the sequence of SEQ ID NO: 1. The term homology refers to the degree of similarity between two amino acid sequences. Homologous proteins are those that are similar in sequence and function. Homology comparison may be conducted by eye, but usually, may be performed by calculating the percent homology between two or more sequences with the aid of readily available sequence comparison programs (Wilbur, W. J. & Lipman, D. J., Proc. Natl. Acad. Sd. USA., 80:726, 1983).

    [0064] In the present invention, the synthetic sRNA may comprise: an Hfq binding site derived from sRNA of any one of MicC, SgrS and MicF; and a region forming a complementary bond with the mRNA of the target gene.

    [0065] In the present invention, the sequence encoding the synthetic sRNA that inhibits expression of the eno gene may be represented by the nucleotide sequence of SEQ ID NO: 16.

    TABLE-US-00002 SEQIDNO:16(eno): ATGTCCAAAATCGTAAAA

    [0066] In the present invention, the sequences encoding the synthetic sRNAs that inhibit expression of the pstI, asnA, ychM, tesB, dhaK, guaA, pck, and purT gene may be represented by the nucleotide sequences of SEQ ID NOs: 17 to 24, respectively.

    TABLE-US-00003 SEQIDNO:17(pstI): ATGATTTCAGGCATTTTAGCATCC SEQIDNO:18(asnA): ATGAAAACCGCTTACATTGCCAAA SEQIDNO:19(ychM): GTGAACAAAATATTTTCCTC SEQIDNO:20(tesB): ATGAGTCAGGCGCTAAAAAATTTA SEQIDNO:21(dhaK): ATGAAAAAATTGATCAATGATGTG SEQIDNO:22(guaA): ATGACGGAAAACATTCATAAGCAT SEQIDNO:23(pck): ATGCGCGTTAACAATGGTTTGACC SEQIDNO:24(purT): ATGACGTTATTAGGCACTGCGCTG

    [0067] In the present invention, as a method of introducing the sequence encoding the synthetic sRNA that inhibits expression of the target gene into the microorganism, any method known to those skilled in the art may be used. Preferably, a recombinant vector containing the sequence encoding the synthetic sRNA that inhibits expression of the target gene may be used, or a method of introducing the sequence encoding the synthetic sRNA that inhibits expression of the target gene directly into the chromosome of a microorganism may be used, without being limited thereto.

    [0068] In the present invention, a recombinant vector containing the sequence encoding the synthetic sRNA that inhibits expression of the target gene may contain: a promoter; an Hfq binding site derived from sRNA of any one of MicC, SgrS and MicF; a region forming a complementary bond with a target gene mRNA; and a terminator.

    [0069] In the present invention, the promoter may be any type of promoter capable of inducing expression of sRNA, is preferably selected from the group consisting of tac, trc, T7, BAD, PR, and Anderson synthetic promoters, and may be represented by the nucleotide sequence of SEQ ID NO: 13.

    TABLE-US-00004 SEQIDNO13: 5-taacaccgtgcgtgttgactattttacct ctggcggtgataatggttgc-3

    [0070] In the present invention, the Hfq binding site may preferably be derived from MicC and may be represented by the nucleotide sequence of SEQ ID NO: 14.

    TABLE-US-00005 SEQIDNO14: 5-tttctgttgggccattgcattgccactgat tttccaacatataaaaagacaagcccgaacagt cgtccgggcttttttt-3

    [0071] In the present invention, the terminator may be any type of terminator capable of terminating transcription of sRNA, is preferably a T1/TE terminator, and is most preferably represented by the nucleotide sequence of SEQ ID NO: 15.

    TABLE-US-00006 SEQIDNO:15: 5-ccaggcatcaaataaaacgaaaggctcag tcgaaagactgggcctttcgttttatctgttg tttgtcggtgaacgctctctactagagtcaca ctggctcaccttcgggtgggcctttctgcgtt tata-3

    [0072] As used herein, the term complementary bond refers to base pairing between nucleic acid sequences, and means that the sequence of a partial region of a target gene mRNA and the sequence of the region forming a complementary bond with the target gene mRNA are complementary to each other by about 70 to 80% or more, preferably about 80 to 90% or more, even more preferably about 95 to 99% or more.

    [0073] As used herein, the term vector means a DNA construct containing a DNA sequence operably linked to a suitable control sequence capable of expressing DNA in a suitable host. The vector may be a plasmid, a phage particle, or simply a potential genome insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself. Since a plasmid is the most commonly used type of vector, the terms plasmid and vector are sometimes used interchangeably throughout the specification of the present invention. For the purpose of the present invention, a plasmid vector is preferably used. A typical plasmid vector that may be used for this purpose contains: (a) a replication origin by which replication occurs efficiently such that several to several hundred plasmid vectors per microorganism are created; (b) an antibiotic-resistant gene by which microorganisms transformed with the plasmid vector can be selected; and (c) restriction enzyme cutting sites into which foreign DNA fragments can be inserted. Even if suitable restriction enzyme cutting sites are not present in the vector, the use of a conventional synthetic oligonucleotide adaptor or linker enables easy ligation between the vector and the foreign DNA fragments. After ligation, the vector should be transformed into a suitable microorganism. The transformation can be easily achieved by the calcium chloride method or electroporation (Neumann, et al. EMBO J., 1:841, 1982). As the vector used for the expression of sRNA according to the present invention, any expression vector known in the art may be used.

    [0074] A nucleotide sequence is operably linked when it is arranged in a functional relationship with another nucleic acid sequence. The nucleotide sequence may be a gene and control sequence(s) linked to be capable of expressing the gene when a suitable molecule (e.g., transcription-activating protein) binds to the control sequence(s). For example, DNA for a pre-sequence or a secretory leader is operably linked to DNA encoding polypeptide when expressed as pre-protein participating in secretion of polypeptide; a promoter or an enhancer is operably linked to a coding sequence when affecting the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence when arranged to facilitate translation. Generally, the term operably linked means that the linked DNA sequences are contiguous, and in the case of the secretory leader, are contiguous and present in a reading frame. However, an enhancer is not necessarily contiguous. However, an enhancer is not necessarily contiguous. The linkage between these sequences is performed by ligation at a convenient restriction enzyme site. However, when the site does not exist, a synthetic oligonucleotide adaptor or a linker is used according to a conventional method.

    [0075] In the present invention, the microorganism may be selected from the group consisting of E. coli, Rhizobium, Bifidobacterium, Rhodococcus, Candida, Erwinia, Enterobacter, Pasteurella, Mannheimia, Actinobacillus, Aggregatibacter, Xanthomonas, Vibrio, Pseudomonas, Azotobacter, Acinetobacter, Ralstonia, Agrobacterium, Rhodobacter, Zymomonas, Bacillus, Staphylococcus, Lactococcus, Streptococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces, Bifidobacterium, Cyanobacterium, and Cyclobacterium.

    [0076] Meanwhile, in another example of the present invention, it was confirmed that, when recombinant silk protein was produced using the strain and then isolated and purified using a salting-out method, a high-purity recombinant silk protein could be obtained (FIG. 16).

    [0077] Therefore, in another aspect, the present invention is directed to a method for producing recombinant silk protein, the method comprising steps of: (a) producing recombinant silk protein by culturing the recombinant microorganism; and (b) recovering the produced recombinant silk protein.

    [0078] In the present invention, step (b) may comprise a salting-out step.

    [0079] Preferably, the step of recovering the recombinant silk protein may be performed by the following steps, without being limited thereto. [0080] Step (a) of settling down the cells of the fermentation broth (4,000 rpm/30 min), and then resuspending the cells in buffer A (1 mM Tris-HCl (pH8.0), 20 mM NaH.sub.2PO.sub.4) solution containing 8M urea and 2M thiourea; [0081] step (b) of mixing the cell suspension using a magnet at 25 C. for 6 hours; [0082] step (c) of pH to 4.0 using glacial acetic acid, followed by mixing using a magnet at 25 C. for 2 hours; [0083] step (d) of centrifuging at 10,000 rpm for 20 minutes; [0084] step (e) of collecting the supernatant, adding (NH.sub.4).sub.2SO.sub.4 thereto to a concentration of 0.85 M, followed by precipitation by mixing for 6 hours; [0085] step (f) of centrifuging at 100,000 rpm for 20 minutes; [0086] step (g) of collecting the supernatant, followed by precipitation using 1.3M (NH.sub.4).sub.2SO.sub.4; [0087] step (h) of collecting the precipitate, followed by dissolution using a solution containing buffer A and 8M urea; [0088] step (i) of performing dialysis using a solution containing 1.5M urea and buffer A for 12 hours; [0089] step (j) of performing dialysis using buffer A for 12 hours; and [0090] step (k) of freeze-drying the pellet collected by centrifugation.

    [0091] In the present invention, the centrifuged pellet may be concentrated by various known methods and then freeze-dried.

    EXAMPLES

    [0092] Hereinafter, the present invention will be described in more detail with reference to examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

    Example 1. Construction and Introduction of sRNA Suitable for Recombinant Silk Protein-Producing Strain

    [0093] An sRNA system (Na, Dokyun et al., Nature biotechnology, 31.2, pp. 170-174, 2013) constructed so as to be able to knock down each E. coli gene individually was newly introduced into a known recombinant silk protein-producing strain (KR 10-1317420) depending on a spider silk protein-producing strain. A new sRNA platform was constructed using a pColA-Sm vector having streptomycin (hereinafter referred to as Sm) as a marker and a pACYC184-Cm vector having chloramphenicol (hereinafter referred to as Cm) as a marker so as not to overlap the marker kanamycin (referred to as Km) of a spider silk protein-producing vector and the origin of replication ColE.

    [0094] The synthetic regulatory sRNA used in the present invention consisted of PR promoter, MicC scaffold and T1/TE terminator. The two synthetic regulatory sRNA platform plasmids were constructed by Gibson assembly of three DNA fragments, including an sRNA fragment, an antibiotic marker (antibiotic resistance gene) fragment, and a replication origin fragment (D. G. Gibson et al., Nature Methods (2009), 6(5), 343-345).

    Example 2. Target Gene Selection

    [0095] To screen effective gene deletion targets for increased production of spider silk protein, MOMA (minimization of metabolic adjustment) simulation was introduced. For MOMA simulation, in order to construct a spider silk protein production metabolic network model using gene-protein-biochemical reaction relationship, a microbial metabolic network model was constructed using the glycine and serine production pathways that form the core of the spider silk protein structure. Metabolic characteristics such as metabolic flux were analyzed using the constructed model, and deletion-target pairs that increase the production of spider silk protein when knocked down were screened using a simulation based on metabolic flux analysis.

    [0096] The deletion target screening method according to the present invention was performed by introducing a quadratic programming method, unlike an existing linear method (Segre et al. Proc. Nat.l Acad. Sci. 99: 15112-15117. 2002). Therefore, deletion targets can be efficiently predicted based on the simultaneous effect of knockdown of various targets rather than a single target on the expression of a target product.

    [0097] As a result, as shown in Table 1 below, about 30 gene pairs were selected from about 20 reaction pairs predicted to be the most effective targets, and the eno gene was present commonly in all of about 30 corresponding gene pairs. Thus, the eno gene was first knocked down, followed by optimization.

    TABLE-US-00007 TABLE 1 Table. Overall results of MOMA simulation Corresponding Biomass Production Target1 Target2 genes flux flux ENO GND gnd 0.396543 0.061807 ENO CBMKr ybcF, arcC 0.372821 0.057653 ENO ACKr purT, tdcD, ackA 0.378326 0.057237 ENO PTAr pta 0.378326 0.057237 ENO F6PA fsaA, fsaB 0.38008 0.057104 ENO DHAPT ptsH, ptsl, dhaL, dhaK 0.38008 0.057104 ENO DHORD2 pyrD 0.381865 0.056969 ENO GMPS guaA 0.382662 0.056908 ENO PRPPS prsA 0.388862 0.056875 ENO FACOAE161 tesB 0.385485 0.056853 ENO AACPS4 aas, acpP 0.385485 0.056853 ENO SO4t2pp ychM, cysZ 0.383507 0.056844 ENO ASNS2 asnA, asnB 0.384019 0.056806 ENO G3PAT161 acpP, plsB 0.386626 0.056798 ENO CTECOAl7 fadB 0.383772 0.056792 ENO SUCOAS sucC 0.384936 0.056785 ENO POR5 fldA 0.384363 0.05678 ENO ACOAD7f fadE 0.38394 0.05678 ENO AKGDH aucA, aucB 0.384941 0.056773 ENO PYK2 pykA 0.384474 0.056771

    Example 3. Verification of Effect of Knockdown of First Selected Eno Gene

    [0098] Based on the pColA-Sm vector, a synthetic regulatory sRNA for knocking down the eno gene was constructed using the pR promoter, MicC scaffold, and T1/TE terminator (Table 3). Since the eno gene is an essential gene for the growth of E. coli, it interferes with cell growth when completely knocked out or knocked down with high efficiency. Therefore, the length of the target binding site, which is the gene site to which sRNA binds, was adjusted to 15-nt to 24-nt (Table 2) to obtain the optimal knockdown effect.

    [0099] At this time, to calculate binding energy, the UNAFOLD (Unified Nucleic Acid Folding) program, which calculates the binding energy depending on the length and sequence information of nucleotides, was used (Markham, Nicholas R., and Michael Zuker. Bioinformatics. Humana Press, 2008).

    [0100] As a result, as shown in FIG. 4, it could be confirmed that, as the length of the binding site increased, the binding energy decreased and the knockdown effect increased. In addition, through experiments, it could be confirmed that the knockdown effect was poor at a binding site having a length of 15-nt or 16-nt, and when a binding site having a length of 22-nt or more was used, cell growth was greatly inhibited due to an excessively high knockdown effect. Finally, as a result of analyzing the expression level of the spider silk protein, in which the peptide was repeated 48 times, depending on the binding site length by SDS-PAGE and Bradford assay (Biorad, USA), it could be confirmed that the expression was the highest at an 18-nt binding site length.

    [0101] The spider silk expression ability of the eno-knockdown strain constructed using this method was compared with those of the glyA-amplified strain and the RnpA expression-inhibited strain, which are existing strains for increased production of spider silk. As a result, it could be confirmed that the spider silk protein expression level in the eno-knockdown group with an 18-nt binding site length was similar to or slightly higher than those in the existing strains for increased production (FIG. 5).

    [0102] Thereby, knockdown experiments on additional targets were conducted in order to obtain a strain, which exhibits increased production compared to existing systems, through additional engineering based on eno knockdown.

    TABLE-US-00008 TABLE2 VectorsequenceencodingSRNAtarget bindingregionofeno SEQIDNO. Name Sequence 25 Eno24 ATGTCCAAAATCGTAAAAATCATC 26 Eno23 ATGTCCAAAATCGTAAAAATCAT 27 Eno22 ATGTCCAAAATCGTAAAAATCA 28 Eno21 ATGTCCAAAATCGTAAAAATC 29 Eno20 ATGTCCAAAATCGTAAAAAT 30 Eno19 ATGTCCAAAATCGTAAAAA 16 Eno18 ATGTCCAAAATCGTAAAA 31 Eno17 ATGTCCAAAATCGTAAA 32 Eno16 ATGTCCAAAATCGTAA 33 Eno15 ATGTCCAAAATCGTA

    TABLE-US-00009 TABLE3 Primersusedincloning SEQID NO. Name Sequence 34 ColA_sRNA_ GCAACCATTATCACCGCCAGAGGTAAAA UniversalF 35 eno_24_R GATGATTTTTACGATTTTGGACATTTTC TGTTGGGCCATTGCATT 36 eno_23_R ATGATTTTTACGATTTTGGACATTTTCT GTTGGGCCATTGCATT 37 eno_22_R TGATTTTTACGATTTTGGACATTTTCTG TTGGGCCATTGCATT 38 eno_21_R GATTTTTACGATTTTGGACATTTTCTGT TGGGCCATTGCATT 39 eno_20_R ATTTTTACGATTTTGGACATTTTCTGTT GGGCCATTGCATT 40 eno_19_R TTTTTACGATTTTGGACATTTTCTGTTG GGCCATTGCATT 41 eno_18_R TTTTACGATTTTGGACATTTTCTGTTGG GCCATTGCATT 42 eno_17_R TTTACGATTTTGGACATTTTCTGTTGGG CCATTGCATT 43 eno_16_R TTACGATTTTGGACATTTTCTGTTGGGC CATTGCATT 44 eno_15_R TTACGATTTTGGACATTTTCTGTTGGGC CATTGCATT

    Example 4. Selection of Additional Target Genes

    [0103] Based on the pACYC184-Cm vector, synthetic regulatory sRNAs for knocking down additional target genes were constructed using the pR promoter, micC scaffold, and T1/TE terminator (Table 5). Since there was an essential gene among the additional targets, the present inventors performed screening based on a 20-nt binding site length and tried to optimize the length of the target binding site for the group with the highest expression level.

    [0104] About 30 gene pairs were selected from about 20 reaction pairs selected through MOMA simulation. As a result of analyzing the expression level of the spider silk protein, in which the peptide was repeated 48 times, by SDS-PAGE and Bradford assay (Biorad, USA), it was confirmed that the spider silk protein expression level in the eight gene groups (pstI, asnA, ychM, tesB, dhaK, guaA, pck, and purT) after first screening (n=3) was similar to or higher than that in the existing strain (FIGS. 6 to 8).

    [0105] As a result of reconfirming the spider silk protein expression in the above 8 gene groups and performing second screening, it could be confirmed that the spider silk protein expression in the ychM and pstI groups was much higher than that in the existing strain (FIG. 9). Thereamong, the best growth and protein expression were confirmed in the ychM group, which was then selected as the final group, and optimization of knockdown efficiency for that group was performed (Table 4).

    [0106] At this time, to calculate binding energy, the UNAFOLD (Unified Nucleic Acid Folding) program, which calculates the binding energy depending on the length and sequence information of nucleotides, was used (Markham, Nicholas R., and Michael Zuker. Bioinformatics. Humana Press, 2008).

    [0107] Thereby, it could be confirmed that, as the length of the binding site increased, the binding energy decreased and the knockdown effect increased. Finally, as a result of analyzing the expression level of the spider silk protein, in which the peptide was repeated 48 times, depending on the binding site length by SDS-PAGE and Bradford assay (Biorad, USA), it could be confirmed that expression was the highest at a 20-nt ychM binding site length (FIG. 10).

    TABLE-US-00010 TABLE4 VectorsequenceencodingSRNA targetbindingregionofychM SEQID NO. Name Sequence 45 ychM24 GTGAACAAAATATTTTCCTCACAT 46 ychM23 GTGAACAAAATATTTTCCTCACA 47 ychM22 GTGAACAAAATATTTTCCTCAC 48 ychM21 GTGAACAAAATATTTTCCTCA 19 ychM20 GTGAACAAAATATTTTCCTC 49 ychM19 GTGAACAAAATATTTTCCT 50 ychM18 GTGAACAAAATATTTTCC 51 ychM17 GTGAACAAAATATTTTC 52 ychM16 GTGAACAAAATATTTT 53 ychM15 GTGAACAAAATATTT

    TABLE-US-00011 TABLE5 Primersusedincloning SEQ ID NO. Name Sequence 54 UniversalF gcaaccattatcaccgccagaggtaaaa 55 asnB_R ACGCCAAAAATTGAACACATTTTCTGTTGGGCCATTGCATT 56 asnA_R GCAATGTAAGCGGTTTTCATTTTCTGTTGGGCCATTGCATT 57 pck_R AAACCATTGTTAACGCGCATTTTCTGTTGGGCCATTGCATT 58 ackA_R AGTACTAACTTACTCGACATTTTCTGTTGGGCCATTGCATT 59 pta_R AGCATAATAATACGGGACACTTTCTGTTGGGCCATTGCATT 60 ptsl_R GCTAAAATGCCTGAAATCATTTTCTGTTGGGCCATTGCATT 61 aas_R CGAAAAAAGCTAAAAAGCATTTTCTGTTGGGCCATTGCATT 62 gnd_R CCGATCTGTTGCTTGGACATTTTCTGTTGGGCCATTGCATT 63 prsA_R AAAAGCTTCATATCAGGCACTTTCTGTTGGGCCATTGCATT 64 tdcD_R ACAACCGGAAATTCATTCATTTTCTGTTGGGCCATTGCATT 65 tesB_R TTTTTTAGCGCCTGACTCATTTTCTGTTGGGCCATTGCATT 66 acpP_R CGTTCTTCGATAGTGCTCATTTTCTGTTGGGCCATTGCATT 67 araC_R TCATTTTGCGCTTCAGCCATTTTCTGTTGGGCCATTGCATT 68 dhaH_R ACTATGACCAGGTTTACCATTTTCTGTTGGGCCATTGCATT 69 dhaK_R TCATTGATCAATTTTTTCATTTTCTGTTGGGCCATTGCATT 70 dhaL_R TGAGTTCTGCTCAGTGACATTTTCTGTTGGGCCATTGCATT 71 dhaR_R TTGTTAAAAGCGCCACTCATTTTCTGTTGGGCCATTGCATT 72 fsaA_R GTATCCAGATACAGTTCCATTTTCTGTTGGGCCATTGCATT 73 fasB_R GTGTCCAGATACAGTTCCATTTTCTGTTGGGCCATTGCATT 74 guaA_R TTATGAATGTTTTCCGTCATTTTCTGTTGGGCCATTGCATT 75 ptsH_R GTAACTTCTTGCTGGAACATTTTCTGTTGGGCCATTGCATT 76 purT_R GCAGTGCCTAATAACGTCATTTTCTGTTGGGCCATTGCATT 77 pyrD_R CGAACGAAGGGGTAGTACATTTTCTGTTGGGCCATTGCATT 78 ychM_24_R ATGTGAGGAAAATATTTTGTTCACTTTCTGTTGGGCCATTGCATT 79 ychM_23_R TGTGAGGAAAATATTTTGTTCACTTTCTGTTGGGCCATTGCATT 80 ychM_22_R GTGAGGAAAATATTTTGTTCACTTTCTGTTGGGCCATTGCATT 81 ychM_21_R TGAGGAAAATATTTTGTTCACTTTCTGTTGGGCCATTGCATT 82 ychM_20_R GAGGAAAATATTTTGTTCACTTTCTGTTGGGCCATTGCATT 83 ychM_19_R AGGAAAATATTTTGTTCACTTTCTGTTGGGCCATTGCATT 84 ychM_18_R GGAAAATATTTTGTTCACTTTCTGTTGGGCCATTGCATT 85 ychM_17_R GAAAATATTTTGTTCACTTTCTGTTGGGCCATTGCATT 86 ychM_16_R AAAATATTTTGTTCACTTTCTGTTGGGCCATTGCATT 87 ychM_15_R AAATATTTTGTTCACTTTCTGTTGGGCCATTGCATT

    Example 5. Confirmation of Recombinant Silk Protein Production in Final Strain

    [0108] Finally, the group in which eno and ychM among the 30 target pairs selected in the MOMA simulation were knocked down was selected as the group with the best expression.

    [0109] As a result of confirming the production of spider silk in the selected strain through 5-L fed-batch fermentation, it was confirmed that the strain showed the highest expression 6 hours after induction with 1 mMv IPTG at an OD.sub.600 of 120 in culture at 30 C., and at this time, the 48-mer high-molecular-weight spider silk showed a high expression level corresponding to about 16% in terms of band intensity as determined by SDS-PAGE, which corresponds to about 10.5 g/L as determined by Bradford assay (FIG. 11). This is about 10 times higher than the previous highest titer (Xia, 2009, PNAS).

    Example 6. Final Gene Selection and Analysis of Improved Strain

    [0110] After final gene selection, RNA Seq was performed to analyze the improved strain. To this end, for a spider silk protein-producing strain sampled 6 hours after induction with 1 mM IPTG when the OD.sub.600 reached 0.4 in 50-ml baffled flask culture at 30 C., and the spider silk protein-producing strain with inhibited expression of eno and ychM genes, which was normalized to an OD.sub.600 of 4, RNA Seq was performed by Macrogen.

    [0111] As a result of checking the heatmap for the DEG list using RNA-seq of the strain in which the expression of the selected eno gene and ychM gene has been inhibited, it could be confirmed that various genotypes were changed compared to those in the existing recombinant silk protein-producing strain (FIGS. 12 and 13). Thereamong, changes in expression of glycine-, alanine-, and serine-related genes, changes in expression of genes related to transcription and translation, and amplification of glycine, alanine, and serine tRNA could be confirmed (FIG. 14).

    [0112] In addition, as a result of comparing the metabolic pathway in the wild-type strain with the metabolic pathway of the strain in which eno and ychM were knocked down, it was confirmed that, in the strain in which eno and ychM were knocked down, the process of converting glyceraldehyde 3-phosphate to pyruvate was inhibited, and the protein production pathways that form major structures such as serine, glycine, and alanine were further activated. In addition, the action of the fumarate and succinate exporters was inhibited, which inhibited the progress of the TCA cycle, and similarly, it is predicted that the protein production pathways that form major structures such as serine, glycine, and alanine are further activated (FIG. 11A).

    Example 7. Confirmation of Mass Production of Recombinant Silk Protein by Improved Strain

    [0113] In order to use spider silk protein industrially, the present inventors tried to optimize the isolation and purification process, which is one of the major challenges in recombinant protein production. In order to isolate protein from a large amount of fermentation broth relatively easily and with high efficiency, protein precipitation using salting out was performed. Usually, this method is used for protein concentration, but produced high molecular weight spider silk has a very large size of 147 kDa and there are not many proteins with a size larger than that in E. coli. Accordingly, it was expected that if the precipitation method was optimized using these characteristics, the desired target could be purified easily and with high efficiency.

    [0114] Therefore, as a result of separating and purifying the fermentation broth using various ammonium persulfate concentrations in first purification and second precipitation, it was confirmed that, when 1.0 M ammonium persulfate in the first purification and 1.3M ammonium persulfate in the second purification were added, the purification efficiency was the highest with a purity of about 75% (FIG. 15).

    [0115] In addition, as a result of analyzing the purified sample after microfiltration through a 50-kDa membrane filter (FIG. 16), it was confirmed that other proteins except for the very large spider silk protein were filtered out, and thus a higher purity corresponding to about 80% or more could be obtained. The same result (a purity of about 85%) was confirmed even in mass separation and purification conducted under the same conditions after mass fermentation at 30 L (FIG. 18).

    [0116] Although the present invention has been described in detail with reference to specific features, it will be apparent to those skilled in the art that this description is only of a preferred embodiment thereof, and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereto.

    INDUSTRIAL APPLICABILITY

    [0117] The recombinant silk protein derived from the recombinant strain according to the present invention has a high molecular weight similar to that of dragline silk protein produced by spiders, and may be mass-produced, and thus it has properties similar to or better than those of natural silk protein when manufactured into fibers. Accordingly, the recombinant silk protein may be advantageously used in various industrial fields such as bioengineering and/or pharmaceutical fields where spider silk fibers are expected to be applied.

    Sequence Listing Free Text

    [0118] Electronic file attached