METHODS AND COMPOSITIONS FOR HAIR FOLLICLE GENERATION
20230414674 ยท 2023-12-28
Inventors
Cpc classification
A61K9/0021
HUMAN NECESSITIES
International classification
A61K35/36
HUMAN NECESSITIES
Abstract
Described herein are compositions and methods useful for hair follicle generation comprising transplanting human pluripotent stem cell-derived hair follicle bulge stem cells, wherein the developmental and molecular requirements for the generation of hair follicle following transplantation is ensured.
Claims
1. A method of growing a hair follicle comprising: (a) preparing human induced pluripotent stem cells (hiPSCs); (b) differentiating the hiPSCs into hair follicle bulge stem cells (HFBSCs); and (c) implanting the HFBSCs into skin of a subject, wherein the subject is a human subject.
2. The method of claim 1, wherein the hiPSCs have one, two, three, four, five, six, or more markers selected from the group consisting of CD200, ITGA6, ITGB1, OCT4, NANOG, SOX2, TRA-1-60, TRA-1-81, and SSEA4.
3. The method of claim 1, wherein the HFBSCs have one, two, three, four, five, six, or seven markers selected from the group consisting of CD200, ITGA6, ITGB1, KRT15, KRT18, KRT19, and P63.
4. The method of claim 1, wherein the preparing in (a) comprises introducing, by electroporation, non-integrating episomal plasmid vectors encoding OCT3/4, SOX2, KLF4, L-MYC, LIN28 and an shRNA for human p531.
5. The method of claim 4, wherein the electroporation is via a Neon transfection system.
6. The method of claim 1, wherein the differentiating in (b) comprises formation of embryoid bodies (EBs) in a floating culture.
7. The method of claim 6, wherein the differentiating in (b) comprises plating the EBs onto coated plates.
8. The method of claim 7, wherein the coated plates are collagen I coated plates.
9. The method of claim 1, further comprising, prior to (c), (b1) differentiating the hiPSCs into keratinocytes.
10. The method of claim 9, wherein the differentiating in (b1) comprises employing all-trans retinoic acid (ATRA) and L-ascorbic acid (L-AA) to induce the hiPSC to form ectoderm and then the addition of bone morphogenic protein-4 (BMP-4) and epidermal growth factor (EGF).
11. The method of claim 10, wherein the differentiating in (b1) is according to a sequential differentiation protocol.
12. The method of claim 1, wherein the implanting in (c) comprises intradermal injection, or the implanting in (c) occurs at 15-19 days in vitro (DIV).
13. (canceled)
14. The method of claim 12, wherein the implanting in (c) occurs 16-18 DIV.
15. The method of claim 1, wherein the HFBSCs have not yet started expressing the keratinocyte associated molecules KRT5 and KRT14.
16. The method of claim 1, further comprising treating hair loss and/or a condition in the subject in need thereof, the condition is alopecia, ectodermal dysplasia, monilethrix, Netherton syndrome, Menkes disease, or hereditary epidermolysis bullosa.
17. (canceled)
18. A composition, comprising (a) hair follicle bulge stem cells (HFBSCs); and (b) media, wherein the HFBSCs express markers CD200, ITGA6, ITGB1, KRT15, KRT18, KRT19, and P63.
19. The composition of claim 18, wherein the HFBSCs do not express the keratinocyte associated molecules KRT5 or KRT14.
20. The composition of claim 19, wherein the composition is made by a process comprising: (a) preparing human induced pluripotent stem cells (hiPSCs); and (b) differentiating the hiPSCs into the HFBSCs.
21. The composition of claim 20, wherein the hiPSCs have one, two, three, four, five, six, or more markers selected from the group consisting of CD200, ITGA6, ITGB1, OCT4, NANOG, SOX2, TRA-1-60, TRA-1-81 and SSEA4.
22-26. (canceled)
27. A method for hair follicle replacement, the method comprising: a. obtaining human pluripotent stem cells (hPSCs), wherein the hPSCs are human induced pluripotent stem cells derived hair follicle bulge stem cells (hiPSC-HFBSC); b. differentiating the hPSCs, thereby producing differentiated hPSCs toward becoming keratinocytes; c. capturing and isolating at least a portion of the differentiated hPSCs, wherein the portion of the differentiated hPSCs expresses hair follicle bulge stem cell markers (HFBSCM); and d. transplanting the portion of the differentiated hPSCs into a patient in need thereof, wherein the patient is a human.
28-46. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] The patent application contains at least one drawing executed in color. Copies of this patent or patent application with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0012] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
DETAILED DESCRIPTION
[0025] As disclosed herein, when using human induced pluripotent stem cells (hiPSCs) to achieve hair follicle (HF) replacement, one can emulate the earliest fundamental developmental processes of gastrulation, ectodermal lineage commitment, and dermo-genesis. Viewing hiPSCs as a model of the epiblast, mapping the dynamic up- and down-regulation of the developmental molecules that determine HF lineage can provide insights to ascertain the precise differentiation stage and molecular requirements for grafting HF-generating progenitors. To yield an integrin-dependent lineage like the HF in vivo, hiPSC derivatives may need to be co-expressed, just prior to transplantation, the following combination of markers: integrins a6 and b1 and the glycoprotein CD200 on their surface; and, intracellularly, the epithelial marker keratin 18 and the hair follicle bulge stem cell (HFBSC)-defining molecules transcription factor P63 and the keratins 15 and 19. If the degree of trichogenic responsiveness indicated by the presence of these molecules is not achieved (they peak on Days 11-18 of the protocol), HF generation may not be possible. Conversely, if differentiation of the cells is allowed to proceed beyond the transient intermediate progenitor state represented by the HFBSC, and instead cascades to their becoming keratin 14 keratin 5 CD200 keratinocytes (Day 25), HF generation is equally impossible. Day 16-18 of differentiation may be the preferred time for transplanting. At this time point, the hiPSCs have lost pluripotency, have attained optimal expression of HFBSC markers, have not yet experienced downregulation of key integrins and surface glycoproteins, have not yet started expressing keratinocyte-associated molecules, and have sufficient proliferative capacity to allow a well-populated graft. This panel of markers may be used for isolating (by cytometry) HF-generating derivatives away from cell types unsuited for this therapy as well as for identifying trichogenic drugs.
[0026] Regenerative Medicine seeks to use stem cells to replace cells that have undergone destruction or senescence and death. Among the most sought cell types are hair follicles (HFs) for patients with inherited or immunogenic alopecia, or alopecia following severe wounding (e.g., burns, trauma, or surgery), or androgenetic alopecia (Chueh, S. C., et al. Therapeutic strategy for hair regeneration: hair cycle activation, niche environment modulation, wound-induced follicle neogenesis, and stem cell engineering. Expert Opin Biol Ther. 2013; 13(3):377-391). There has long been a debate over what qualities a stem cell and its derivatives should possess to enable HF replacement (see, e.g., Veraitch, O., et al. Human induced pluripotent stem cell-derived ectodermal precursor cells contribute to hair follicle morphogenesis in vivo. J Invest Dermatol. 2013; 133(6):1479-1488; and Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nat Commun. 2014; 5:3071). Herein presented the developmental and molecular requirements that human pluripotent stem cells (hPSCs) and their derivatives must acquire to reconstitute HFs, whether using human embryonic stem cells (hESCs) or, more immunologically desirable, patient recipient-specific human induced pluripotent stem cells (hiPSCs). These insights into successful engraftment were gained by examining the dynamics of up- and down-regulation of the key molecules that ensure proper HF lineage commitment by hPSCs. hPSCs intended for HF replacement may need to co-express the following combination of markers: key components of the integrin signaling pathway-integrin a6 (ITGA6) (see, e.g., Li, A. et al. Identification and isolation of candidate human keratinocyte stem cells based on cell surface phenotype. Proc Natl Acad Sci USA. 1998; 95(7):3902-3907; and Ma, D. R., et al. A review: the location, molecular characterisation and multipotency of hair follicle epidermal stem cells. Ann Acad Med Singapore. 2004; 33(6):784-788) and integrin 131 (ITGB1) (see, e.g., Bata-Csorgo, Z., et al. Kinetics and regulation of human keratinocyte stem cell growth in short-term primary ex vivo culture. Cooperative growth factors from psoriatic lesional T lymphocytes stimulate proliferation among psoriatic uninvolved, but not normal, stem keratinocytes. J Clin Invest. 1995; 95(1):317-327; Jones, P. H. Epithelial stem cells. Bioessays. 1997; 19(8):683-690; and Jones, P. H. et al. Stem cell patterning and fate in human epidermis. Cell. 1995; 80(1):83-93; and Jones, P. H. et al. Separation of human epidermal stem cells from transit amplifying cells on the basis of differences in integrin function and expression. Cell. 1993; 73(4):713-724) and, just prior to transplantation, the surface glycoprotein CD200 (see, e.g., Ohyama, M. Hair follicle bulge: a fascinating reservoir of epithelial stem cells. J Dermatol Sci. 2007; 46(2):81-89; and Ohyama, M. et al. Characterization and isolation of stem cell-enriched human hair follicle bulge cells. J Clin Invest. 2006; 116(1):249-260) together with keratin 18 (KRT18) (an epithelial marker) (Maurer, J. et al. Contrasting expression of keratins in mouse and human embryonic stem cells. PLoS One. 2008; 3(10):e3451) and the following hair follicle bulge stem cell (HFBSC) markers: transcription factor P63 (see, e.g., Ma, D. R. et al. (2004), and Pallegrini, G. et al. p63 identifies keratinocyte stem cells. Proc Natl Acad Sci USA. 2001; 98(6):3156-3161), keratin 15 (KRT15) ((see, e.g., Ma, D. R. et al. (2004), and Lyle, S., et al. The C8/144B monoclonal antibody recognizes cytokeratin 15 and defines the location of human hair follicle stem cells. J Cell Sci. 1998; 111(Pt 21):3179-3188), and keratin 19 (KRT19) (see, e.g., Ma, D. R. et al. (2004); Commo, S. et al. The human hair follicle contains two distinct K19 positive compartments in the outer root sheath: a unifying hypothesis for stem cell reservoir?Differentiation. 2000; 66(4-5):157-164; and Michel, M. et al. Germain L. Keratin 19 as a biochemical marker of skin stem cells in vivo and in vitro: keratin 19 expressing cells are differentially localized in function of anatomic sites, and their number varies with donor age and culture stage. J Cell Sci. 1996; 109(Pt 5):1017-1028) CD200, ITGA6, and ITGB1 on the surface of the hPSC likely interact with specific matrix receptors that not only mediate cell adhesion, survival, and proliferation (Rowland, T. J., Roles of integrins in human induced pluripotent stem cell growth on Matrigel and vitronectin. Stem Cells Dev. 2010; 19(8):1231-1240), but also entrance into a differentiation pathway that allows the emergence of HFBSCs in vitro and HFs in vivo. If the developmental stage and degree of responsiveness indicated by the presence of these markers is not achieved, HF replacement will not be possible. In other words, to yield optimal HFs in vivo, we make the developmental case for transplanting at Day 16 of differentiationthe point at which the hPSCs have lost almost all expression of pluripotency markers; have attained optimal expression levels of HFBSC markers but not yet progressed toward a keratinocyte fate; have not yet experienced downregulation of key integrins and surface CD200; and possess sufficient proliferative capacity to produce a well-populated graft. In fact, the necessity of these markers may be used to separate hiPSC derivatives that will yield HFs away from a heterogeneous population of derivatives that are disadvantageous for this therapeutic indication or perhaps even inimical (i.e., tumorigenic). The markers may also be used to identify trichogenic drugs.
[0027] Disclosed herein is a method of growing a hair follicle. The method comprises: (a) preparing human induced pluripotent stem cells (hiPSCs); (b) differentiating the hiPSCs into hair follicle bulge stem cells (HFBSCs); and (c) implanting the HFBSCs into skin of a subject.
[0028] In some embodiments, the hiPSCs have at least one, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or more markers selected from the group consisting of CD200, ITGA6, ITGB1, OCT4, NANOG, SOX2, TRA-1-60, TRA-1-81, and SSEA4. In some embodiments, the hiPSCs have 1, 2, 3, 4, 5, 6, 7, or 8 markers selected from the group consisting of CD200, ITGA6, ITGB1, OCT4, NANOG, SOX2, TRA-1-60, TRA-1-81, and SSEA4. In some embodiments, the hiPSCs have all of the markers of CD200, ITGA6, ITGB1, OCT4, NANOG, SOX2, TRA-1-60, TRA-1-81, and SSEA4.
[0029] In some embodiments, the HFBSCs have at least one, at least two, at least three, at least four, at least five, at least six, or more markers selected from the group consisting of CD200, ITGA6, ITGB1, KRT15, KRT18, KRT19, and P63. In some embodiments, the HFBSCs have one, two, three, four, five, or six markers selected from the group consisting of CD200, ITGA6, ITGB1, KRT15, KRT18, KRT19, and P63. In some embodiments, the HFBSCs have all markers of CD200, ITGA6, ITGB1, KRT15, KRT18, KRT19, and P63.
[0030] In some embodiments, the preparing in (a) comprises introducing, by electroporation, non-integrating episomal plasmid vectors encoding OCT3/4, SOX2, KLF4, L-MYC, LIN28 and an shRNA for human p531. In some embodiments, the electroporation is via a Neon transfection system.
[0031] In some embodiments, the differentiating in (b) comprises formation of embryoid bodies (EBs) in a floating culture. In some embodiments, the differentiating in (b) comprises plating the EBs onto coated plates. In some embodiments, the coated plates are collagen I coated plates.
[0032] In some embodiments, the method further comprises, prior to (c), (b1) differentiating the hiPSCs into keratinocytes. In some embodiments, the differentiating in (b1) comprises employing all-trans retinoic acid (ATRA) and L-ascorbic acid (L-AA) to induce the hiPSC to form ectoderm and then the addition of bone morphogenic protein-4 (BMP-4) and epidermal growth factor (EGF). In some embodiments, the differentiating in (b1) is according to a sequential differentiation protocol.
[0033] In some embodiments, the implanting in (c) comprises intradermal injection. In some embodiments, the implanting in (c) occurs at 15-19 days in vitro (DIV). In some embodiments, the implanting in (c) occurs at 16-18 DIV. In some embodiments, the implanting in (c) occurs at 15 DIV. In some embodiments, the implanting in (c) occurs at 16 DIV. In some embodiments, the implanting in (c) occurs at 17 DIV. In some embodiments, the implanting in (c) occurs at 18 DIV. In some embodiments, the implanting in (c) occurs at 19 DIV.
[0034] In some embodiments, the HFBSCs have not yet started expressing the keratinocyte associated molecules KRT5 and KRT14.
[0035] In some embodiments, the method further comprises treating hair loss and/or a condition in a subject in need thereof. In some embodiments, the condition is alopecia, ectodermal dysplasia, monilethrix, Netherton syndrome, Menkes disease, or hereditary epidermolysis bullosa.
[0036] In some embodiments, the subject is a human subject.
[0037] In one aspect, the present disclosure provides a composition, comprising (a) hair follicle bulge stem cells (HFBSCs); and (b) media. In some embodiments, the HFBSCs express markers CD200, ITGA6, ITGB1, KRT15, KRT18, KRT19, and P63.
[0038] In some embodiments, the HFBSCs do not express the keratinocyte associated molecules KRT5 or KRT14. In some embodiments, the HFBSCs is made by any method disclosed herein in this application.
[0039] In some embodiments, the composition is made by a process comprising: (i) preparing human induced pluripotent stem cells (hiPSCs); and (ii) differentiating the hiPSCs into the HFBSCs.
[0040] In some embodiments, the hiPSCs have one, two, three, four, five, six, or more markers selected from the group consisting of CD200, ITGA6, ITGB1, OCT4, NANOG, SOX2, TRA-1-60, TRA-1-81 and SSEA4. In some embodiments, the preparing hiPSCs in (i) comprises introducing, by electroporation, non-integrating episomal plasmid vectors encoding OCT3/4, SOX2, KLF4, L-MYC, LIN28 and an shRNA for human p531.
[0041] In some embodiments, the differentiating in (ii) comprises formation of embryoid bodies (EBs) in a floating culture. In some embodiments, the differentiating in (ii) comprises plating the EBs onto coated plates. In some embodiments, the coated plates are collagen I coated plates.
[0042] In another aspect, the present disclosure provides a method for hair follicle replacement, the method comprising: (a) obtaining human pluripotent stem cells (hPSCs); (b) differentiating the hPSCs, thereby producing differentiated hPSCs toward becoming keratinocytes; (c) capturing and isolating at least a portion of the differentiated hPSCs, wherein the portion of the differentiated hPSCs expresses hair follicle bulge stem cell markers (HFBSCM); and (d) transplanting the portion of the differentiated hPSCs into a patient in need thereof.
[0043] In some embodiments, the hPSCs are human induced pluripotent stem cells (hiPSCs).
[0044] In some embodiments, the hPSCs are hiPSC-derived hair follicle bulge stem cells (hiPSC-HFBSC). In some embodiments, the hiPSCs are derived from cells of the patient. In some embodiments, the hiPSCs are derived from cells of another subject.
[0045] In some embodiments, the cells of the patient are selected from the group consisting of fibroblasts, renal epithelial cells, and blood cells.
[0046] In some embodiments, the transplanting in (d) occurs at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or more days after the differentiating in (b).
[0047] In some embodiments, the portion of the differentiated hPSCs is at a stage before the portion of the differentiated hPSCs has experienced downregulation of key integrins and key surface glycoproteins and before the portion of the differentiated hPSCs has started expressing keratinocyte-associated molecules.
[0048] In some embodiments, the key integrins comprise at least integrin 6 and/or integrin 1.
[0049] In some embodiments, the key surface glycoproteins comprise at least CD200.
[0050] In some embodiments, the stage is before the portion of the differentiated hPSCs has started expressing keratinocyte-associated molecules KRT5 and KRT14.
[0051] In some embodiments, the stage is after the portion of the differentiated hPSCs has expressed at least one of KRT15, KRT18, and KRT19, and P63.
[0052] In some embodiments, the transplanting in (d) comprises transplanting the portion of the differentiated hPSCs intradermally above the muscle coat.
[0053] In some embodiments, the capturing and isolating in (c) comprises flow cytometry.
[0054] In some embodiments, the capturing and isolating in (c) comprises capturing and isolating cells that co-express CD200 and integrin 6.
[0055] In some embodiments, the capturing and isolating in (c) comprises capturing and isolating cells that co-express CD200 and integrin 1.
[0056] In some embodiments, the patient in need thereof has alopecia or has lost hair follicles from an injury or burn.
[0057] Abbreviations used:
[0058] ATRA, all-trans retinoic acid; BMP, bone morphogenic protein; DAPI, 4, 6-Diamidino-2-phenylindole; DIV, days in vitro; EB, embryoid body; EGF, epidermal growth factor; FAD, a mixture of Ham's F12 and Dulbecco's Modified Eagle's Medium; FC, flow cytometry; hESCs, Human embryonic stem cells; HF, hair follicle; HFBSC, hair follicle bulge stem cell; hiPSC, human induced pluripotent stem cells; hiPSC-HFBSC, hiPSC-derived hair follicle bulge stem cells; hPSCs, human pluripotent stem cells; HSCA, human specific cytoplasmic antigen; HSNA, human specific nuclear antigen; ICC, immunocytochemistry; ITGA6, integrin a6; ITGB1, integrin 131; KRT, keratin; L-AA, L-ascorbic acid; LEF1, lymphoid enhancer-binding factor 1; MDC, mouse dermal cells; MSX2, msh homeobox 2; PHLDA1, Pleckstrin Homology Like Domain Family A Member 1; TDAG51, T-Cell Death-Associated Gene 51; TRPS1, trichorhinophalangeal syndrome type I.
[0059] Experimental Section
[0060] Material & Methods
[0061] Human Pluripotent Stem Cells (hPSCs)
[0062] Two types of hPSCs were used. For hESCs, the gold standard for hPSCs, the H9 line (Wicell) was employed. The hiPSCs were generated from normal human skin fibroblasts (obtained from de-identified donors) by using a Neon transfection system to introduce, by electroporation, non-integrating episomal plasmid vectors encoding OCT3/4, SOX2, KLF4, L-MYC, LIN28 and an shRNA for human p53 (see, e.g., Okita K., et al. A more efficient method to generate integration-free human iPS cells. Nat Methods. 2011; 8(5):409-412).
[0063] Characterization of hiPSCs
[0064] As previously described (see, e.g., Imaizumi Y. et al. Mitochondrial dysfunction associated with increased oxidative stress and alpha-synuclein accumulation in PARK2 iPSC-derived neurons and postmortem brain tissue. Mol Brain. 2012; 5:35; Ohta, S. et al. Generation of human melanocytes from induced pluripotent stem cells. PLoS One. 2011; 6(1):e16182; and Takahashi K., et al. Induction of pluripotent stem cells from fibroblast cultures. Nat Protoc. 2007; 2(12):3081-3089), hiPSCs colonies were characterized in vitro by both immune-cytochemistry (ICC) and flow cytometry (FC) for the presence of the following standard pluripotency markers using monoclonal antibodies against OCT4, NANOG, SOX2, TRA-1-60, TRA-1-81 & SSEA4. Pluripotency of the hiPSCs was further confirmed by proving their ability to form teratomas when injected into the flanks of immuno-incompetent (NSG) mice (Jackson Laboratory). The teratomas were examined histologically for the presence of cells representative of the 3 fundamental primitive germ layers (ectoderm, mesoderm, and endoderm), hence confirming pluripotency as disclosed herein.
[0065] Differentiation of hiPSCs into HFBSCs
[0066] As a continuation of previous work (Ibrahim M. R, et al. Deriving keratinocyte progenitor cells and keratinocytes from human-induced pluripotent stem cells. Curr Protoc Stem Cell Biol. 2020; 54(1):e119), the overall strategy was to differentiate hiPSCs toward becoming keratinocytes but, just prior to that end-point, capture and isolate an intermediate transient progenitor cell population in vitro that expressed HFBSCs markers and could generated HFs. As schematized in
[0067] More detailed explanation of the protocol is shown in
[0068] In Vitro Characterization of hiPSC-Derived HFBSCs (hiPSC-HFBSCs)
[0069] ICC was performed using primary monoclonal antibodies against KRT18 (an epithelial marker); ITGA6, ITGB1, P63, KRT15, and KRT19 (HFBSCs markers); and KRT14 (a terminally differentiated keratinocyte marker). The temporal expression of CD200, ITGA6, and ITGB1 were monitored in differentiating hiPSCs using FC analysis. Relative gene expression of OCT4, P63, KRT15, KRT19, KRT8, KRT18, KRT5, and KRT14 in hiPSC-derived cells at days in vitro (DIV) 0, 11, 18, and 25 was assessed using qPCR analysis as described herein.
[0070] Co-Culture of hiPSC-HFBSCs & Mouse Dermal Cells (MDCs) in Vitro
[0071] hiPSC-HFBSCs were co-cultured with freshly isolated MDCs using 2 systems: (1) a transwell system, which allows 2 types of cells in monolayer to communicate with each other, but only via diffusible factors because they are separated by a porous membrane that allows the transit of only molecules but not cells; and (2) a 3-dimensional (3D) aggregate of the 2 cell types which allows cell-cell contact. Co-culturing was performed for 1 week, from DIV 11 to DIV 18. For the transwell co-cultures, 2.510.sup.5 hiPSC-HFBSCs were seeded onto a collagen coated surface in the bottom well while an equal number of MDCs were seeded onto permeable transwell inserts in the top well (Corning, Corning, NY). For the 3D co-culture system, equal numbers of hiPSC-HFBSCs and MDCs (2.510.sup.5) were mixed together in a Matrigel supported aggregate (1:1 mixture of Matrigel and modified FAD medium) supplemented with BMP-4 (25 ng/mL), ATRA (1 mM), and EGF (20 ng/mL). qPCR analysis of hair differentiation markers was performed on the co-cultured hiPSC-HFBSCs at DIV 18. The HF-associated genes assayed included KRT75, msh homeobox 2 (MSX2), lymphoid enhancer-binding factor 1 (LEF1), and trichorhinophalangeal syndrome type I (TRPS1) (see, e.g., Fantauzzo, K. A. et al. Dynamic expression of the zinc-finger transcription factor Trps1 during hair follicle morphogenesis and cycling. Gene Expr Patterns. 2008; 8(2):51-57; Gu, L. H. and Coulombe, P. A. Keratin expression provides novel insight into the morphogenesis and function of the companion layer in hair follicles. J Invest Dermatol. 2007; 127(5):1061-; 1073; Kobielak, A. and Fuchs, E. Links between alpha-catenin, NF-kappaB, and squamous cell carcinoma in skin. Proc Natl Acad Sci USA. 2006; 103(7):2322-2327; Kobielak, A. and Fuchs, F. The new keratin nomenclature. J Invest Dermatol. 2006; 126(11):2366-2368; and Rendl, M. et al. Molecular dissection of mesenchymal-epithelial interactions in the hair follicle. PLoS Biol. 2005; 3(11):e331).
[0072] Transplantation and Characterization of hiPSC-HFBSCs In Vivo
[0073] Patch grafting assays were performed as described previously (see, e.g., Kobayashi, T. et al. Canine follicle stem cell candidates reside in the bulge and share characteristic features with human bulge cells. J Invest Dermatol. 2010; 130(8):1988-1995; and Zheng, Y. et al. Organogenesis from dissociated cells: generation of mature cycling hair follicles from skin-derived cells. J Invest Derma-tol. 2005; 124(5):867-876). hiPSC-HFBSCs were combined on DIV 16 with freshly isolated MDCs from the backs of black C57BL/6 mice. Equal numbers of HFBSCs and MDCs (2.510.sup.6 each) were combined in 100 mL phosphate buffered saline (PBS) and injected intradermally into anesthetized (general) SCID mice above the muscle coat, where the cells could remain tightly packed and in contact with each other with little dispersion. Intradermal injection, in contrast to subcutaneous injection, not only prevented dispersion of the cells (cell aggregation and cell-cell interaction proving critical for organogenesis) but also provided a more appropriate microenvironment for the transplanted cells, the dermis being the natural milieu for growing hair.
[0074] Three-to-six weeks after implantation, the resulting growths were dissected, and processed for histological and immunohistochemical evaluation as described herein. The protocol was approved by the Sanford Burnham Prebys Institutional Animal Care and Use Committee.
[0075] Statistical Analysis
[0076] One-Way ANOVA was used to calculate the P values. A P-value of <0.05 was considered significant.
[0077] Reprogramming of Normal Human Skin Fibroblasts into Normal hiPSCs Using Episomal DNA Cocktail
[0078] To generate hiPSCs, normal human skin fibroblasts obtained from de-identified donors were electroporated using a Neon transfection system to introduce non-integrating episomal plasmid vectors encoding OCT3/4, SOX2, KLF4, L-MYC, LIN28 and an shRNA for human p53 (Okita et al. (2011))
[0079] A. Thawing & Maintaining Human Skin Fibroblast Cells [0080] 1. Prepare one 10 cm dish for each fibroblast cell line
[0081] B. Electroporation of Human Fibroblasts Using Neon Transfection System [0082] 1. Add 2 mL antibiotic free FB culture media to each well of a 6-well plate, prepare one well for each sample [0083] 2. Wash the cells 2 using DPBS [0084] 3. Add 2 mL 0.25% Trypsin to each dish [0085] 4. Incubate at 37 C. for 5 minutes [0086] 5. Add 5 mL fibroblast media to the dish [0087] 6. Collect the cell suspension to a 15 mL tube [0088] 7. Count cell number [0089] 8. Transfer 0.7 million cells to another 15 mL tube [0090] 9. Centrifuge at 200 g (1,000 rpm) for 5 minutes at room temperature (RT) [0091] 10. Remove the supernatant [0092] 11. Resuspend the cells using 2 mL DPBS [0093] 12. Centrifuge at 200 g (1,000 rpm) for 5 minutes at RT [0094] 13. During Centrifuge, mix cocktail DNA with Buffer R (included in Neon kit) according to the number of samples (see Table 1)
TABLE-US-00001 TABLE 1 Amount of cocktail DNA and Buffer R according to the number of samples For one For five For ten sample (L) samples (L) samples (L) Cocktail DNA 4.4 22 44 Buffer R 105.6 528 1056 [0095] 14. Aspirate the supernatant from the tube after centrifuge [0096] 15. Resuspend the cells with 110 l DNA-buffer R mixture [0097] 16. Transfer the cells to an Eppendorf tube [0098] 17. Mix well with p200 pipet [0099] 18. Add 3 mL Buffer E2 to one neon cuvette [0100] 19. Put the neon cuvette into the neon pipette station [0101] 20. Using Neon pipette connected with an 100 ul Neon tip, aspirate the cocktail DNA/cell mixture [0102] 21. Put the Neon pipette into Neon cuvette placed in the Neon pipette station [0103] 22. Find the Fibroblast Reprogramming program saved in Neon transfection device: which is: 1650V, 10 ms, 3 time pulses [0104] 23. Push the Start button on the device [0105] 24. After the program completed, take the Neon pipette out from the device [0106] 25. Transfer the content instantly to the well with FB media without antibiotics [0107] 26. Change cuvettes and tips every time when transfect different cells [0108] 27. Rotate the plates many times then incubate at 37 C./CO.sub.2 incubator
[0109] C. Amplification of the Transfected Cells [0110] 1. Change the media the next day using media with antibiotics [0111] 2. Keep the cells in fibroblast culture media for 7 days, media should be changed every 3-4 days
[0112] D. Re-Seeding the Transfected Cells on Feeders [0113] 1. On day 6, seed feeders to a 6-well plate [0114] 2. On day 7, wash the cocktail DNA transfected cells 2 with DPBS [0115] 3. Add 0.5 mL 0.25% trypsin solution to each well [0116] 4. Incubate at 37 C. for 5 minutes [0117] 5. Add 2 mL FB media to the well [0118] 6. Collect the cell suspension to a 15 mL tube [0119] 7. Count the cell number [0120] 8. Centrifuge at 200 g (1,000 rpm) for 5 minutes at RT [0121] 9. Remove the supernatant [0122] 10. Resuspend the cells using 1 mL FB media [0123] 11. Mix well with p1000 pipet [0124] 12. Adjust the volume, the concentration of the cells should be 110.sup.4/mL [0125] 13. Seed the transfected cells on feeders in FB media with antibiotics, at three densities: 0.5, 1, 210.sup.4 cells/well (6-well plate) are recommended [0126] 14. Rotate the plates many times then incubate at 37 C./CO.sub.2 incubator
[0127] E. Reprogramming [0128] 1. On the next day, wash the cells once using DPBS [0129] 2. Change media to KOSR media [0130] 3. Change media every other day, for up to 6 weeks [0131] 4. Check iPSC colonies under stereo microscope, starting from week 3
[0132] F. Colony Pickup [0133] 1. Under a dissection microscope, manually pick up the colonies and transfer the colony to an Eppendorf tube, [0134] 2. Pipet up and down many times to break the colony into small clumps, [0135] 3. Prepare a MEF pre-seeded plate or a Matrigel coated plate, [0136] 4. Change media to KOSR medium supplemented ROCK inhibitor, [0137] 5. Transfer the colony from the eppendorf tube to the well, [0138] 6. Incubate overnight at 37 C. CO.sub.2 incubator, [0139] 7. Change media the next day, with media without ROCK inhibitor.
[0140] Differentiation of hiPSCs into HFBSCs and Keratinocytes:
[0141] The goal of these procedures was to differentiate hiPSCs into keratinocytes and to capture the intermediate transient multipotent stem cell population in vitro called the HFBSC. To differentiate hiPSCs into keratinocytes, we used a sequential differentiation protocol that employs ATRA and L-AA to induce hiPSC to form ectoderm, which was then differentiated into KPCs and keratinocytes. In this protocol ectoderm is precluded from continuing to become neuroectoderm via BMP4 suppression. The protocol is divided into 2 parts; formation of EBs in floating culture and plating of the obtained EBs on collagen I coated plates.
[0142] A. Reagents [0143] Embryoid Body (EB) formation medium (see Media section below for composition) [0144] Modified FAD medium (see Media section below for composition) [0145] Phosphate-buffered saline (PBS) [0146] Rock inhibitor (Y-27632) (STEMCELL technologies, Cat #72302) [0147] Collagen I (Corning, Cat #354236) [0148] Bone morphogenetic protein-4 (BMP-4) (R&D systems, Cat #314-BP) [0149] All-trans retinoic acid (ATRA) (1 M) (Sigma-Aldrich, Cat #R2625) [0150] Epidermal growth factor (EGF) (20 ng/mL) (Sigma-Aldrich, Cat #E9644) [0151] Dulbecco's Modified Eagle Medium (DMEM) (Life Technologies, Cat #11965) [0152] Ham's F12 Nutrient Mix, GlutaMAX (Life Technologies, Cat #31765) [0153] Fetal Bovine Serum (FBS) (Thermo Fisher Scientific, Cat #MT35010CV) [0154] Insulin (Sigma-Aldrich, Cat #19278) [0155] Hydrocortisone (Santa Cruz, Cat #sc-300810) [0156] Cholera toxin (Sigma-Aldrich, Cat #C8052) [0157] Triiodothyronine (T3) (Sigma-Aldrich, Cat #T6397) [0158] L-ascorbic acid (L-AA)(Sigma-Aldrich, Cat #255564) [0159] Adenine (Sigma-Aldrich, Cat #2786) [0160] Defined Keratinocyte Serum Free Medium (DKSM) (Thermo Fisher Scientific, Cat #10744019) [0161] Keratinocyte Serum Free Medium (KSM) (Thermo Fisher Scientific, Cat #17005042)
[0162] DKSM medium is a commercially-available serum-free medium optimized for the isolation and expansion of human keratinocytes without the need for bovine pituitary extract (BPE) supplementation or the use of fibroblast feeder layers. The abbreviation DKSM stands for Defined Keratinocyte Serum Free Medium and was obtained from Thermo Fisher Scientific (Cat #10744019). In this formulation, the growth-promoting activity of BPE has been emulated instead by defined trophic factors that can maintain cell morphology, physiological markers, and growth of the cultured keratinocytes. DKSM has a low calcium concentration (<0.1 mM) which maintains keratinocytes in an undifferentiated proliferative stage.
[0163] B. Media [0164] (i) Fibroblast (FB) Culture Medium (per 1,000 mL): [0165] 900 mL DMEM [0166] 100 mL FBS [0167] 10 mL Non-essential amino acids (NEAA) (Life Technologies, Cat #11140-050) [0168] 10 mL Anti-Anti (Antibiotic-Antimycotic) (Life Technologies, Cat #: 15240062) Filter, sterilize, and store at 4 C.; media will last for up to 14 days. [0169] (ii) Another FB culture medium (per 1,000 mL): [0170] 900 mL DMEM [0171] 100 mL FBS [0172] 10 mL NEAA (Life Technologies, Cat #11140-050) Filter, sterilize, and store at 4 C.; media will last for up to 14 days. [0173] (iii) Knockout serum replacement (KOSR) medium: [0174] 400 mL DMEM/F12 [0175] 100 ml KOSR (Fisher Scientific, Cat #A3181502) [0176] 5 mL NEAA (Life Technologies, Cat #11140-050) [0177] 0.9 mL Beta-ME [0178] 5 mL Anti-Anti (Antibiotic-Antimycotic) (Life Technologies, Cat #: 15240062) [0179] 50 lb FGF (100 ng/L) Can store up to 4 weeks at 4 C. or up to 4 months at 20 C. [0180] (iv) EB formation medium: [0181] 400 mL DMEM/F12 [0182] 100 mL KOSR [0183] 5 mL NEAA [0184] 5 mL Anti-Anti (Antibiotic-Antimycotic) [0185] 0.9 mL Beta-ME [0186] 0.5 mL Rock inhibitor (Y-27632) [0187] BMP-4 (1 ng/mL) [0188] No FGF2 Filter through a 0.22 m filter [0189] (v) EAD medium: [0190] 3:1 mixture of DMEM and Ham's F12 medium [0191] (vi) Modified FAD medium: [0192] 3:1 mixture of DMEM and Ham's F12 medium (standard FAD medium) [0193] FBS (2%) [0194] Insulin (5 g/mL) [0195] Hydrocortisone (0.5 g/mL) [0196] Cholera toxin (10.sup.10 mol/L) [0197] Triiodothyronine (1.37 ng/mL) [0198] L-AA (0.3 mmol/L) [0199] Adenine (24 g/mL)
[0200] Day 0:
[0201] Embryoid Body (EB) Formation [0202] Passage 20-35 healthy hiPSC lines were selected. [0203] On day 0, when hiPSC colonies had reached 80 to 90% confluence, wash with DBPS. [0204] Separate hiPSC colonies manually into small clusters. [0205] Use P-1000 to pipet up and down several times to reduce the cluster size (about 50-100 cells/cluster). [0206] The clusters were cultured in ultra-low adherence 6-well plate in EB suspension culture medium supplemented with ROCK inhibitor Y-27632 (1 W/ml), BMP-4 (1 ng/ml) without FGF2, in a volume of 3 mL/well. [0207] ROCK inhibitor: Improves EB formation
[0208] On the 2.sup.nd day (Day 1): [0209] Check EBs under stereo microscope. [0210] Collect EBs in a 15 mL conical tube. [0211] Wait 10 minutes to allow EBs to settle down by gravity. [0212] Remove supernatant. [0213] Resuspend in modified FAD medium supplemented with BMP-4 (1 ng/ml) and ATRA (1 M). [0214] After resuspension, plate the EBs in an ultra-low adherence 6-well plate using 10 ml sterile serological pipettes, aspirate quickly but gently (final volume 3 mL/well) [0215] Note: Quickly but gently move the plate in side-to-side, forward-to back motions to evenly distribute the EBs within the wells and to avoid EBs sticking together.
[0216] On Day 2: [0217] EBs were collected in a 15 mL conical tube and media were changed to modified FAD medium supplemented with BMP-4 (1 ng/mL) and ATRA (1 M)
[0218] From Day 3 to Day 7: [0219] Use modified FAD medium supplemented with BMP-4 (25 ng/mL), ATRA (1 M) and EGF (20 ng/mL) [0220] Note: Gentle shaking of the plate 1-2 times per day for the first few days of suspension culture may help to distribute the EBs in the well, and avoid EBs sticking together. Note: On day 5 (6th day) the floating EBs are plated on collagen I coated plates. [0221] Note: Coating plates with collagen I: Dilute collagen I to 50 g/mL with 0.02 N acetic acid. Add sufficient diluted collagen I to coat dishes, 5-10 g/cm surface. Incubate the coated plates for 2-3 hours at RT. Aspirate remaining solution and rinse wells with PBS 2 times remove acid. Plates can be used instantly or stored at 2-8 C. for up to one week under sterile conditions
[0222] From Day 8 to Day 11: [0223] Day 8: FAD medium: Defined Keratinocyte Serum Free Medium (DKSM)=3:1 [0224] Day 9: FAD medium: DKSM=1:1 [0225] Day 10: FAD medium: DKSM=1:3 [0226] Day 11: DKSM only [0227] From day 8 to day 11 the used medium was supplemented with insulin (5 g/mL), hydrocortisone (0.5 g/mL), cholera toxin (10.sup.10 mol/l), triiodothyronine (1.37 ng/mL), L-AA (0.3 mmol/l), and adenine (24 g/mL). [0228] Small molecules and growth factors, BMP-4 (25 ng/mL), ATRA (1 M) and EGF (20 ng/mL) were added to the medium.
[0229] From Day 12 to Day 25 [0230] Used equal amounts of DKSM and Keratinocyte Serum Free Medium (KSM) (DKSM: KSM 1:1) supplemented with BMP-4 (1 ng/mL) and EGF (20 ng/mL) [0231] The protocol was repeated with at least 10 technical replications on at least 2 different hiPSC clones, hence biological replicates
[0232] To passage hiPSC-HFBSCs: [0233] 1. Remove the medium. [0234] 2. Wash with PBS [0235] 3. Add 0.5 ml of pre-warmed 0.05% trypsin [0236] 4. Incubate hiPSC-KPC for 5 minutes at 37 C. with 5% CO.sub.2 and 95% humidity. [0237] 5. Remove the culture plate from the incubator and place in the hood. [0238] 6. Dislodge the cells by hitting the plate several times against the heal of your hand 3-5 times. [0239] 7. Transfer the cell contents into the 15 mL tube with 5 ml pre-warmed media. [0240] 8. Centrifuge at 200 g (1,000 rpm) for 5 minutes at RT [0241] 9. Remove the supernatant. [0242] 10. Resuspend the cells and plate on fresh collagen I coated plates.
[0243] Immunocytochemistry (ICC)
[0244] Materials: [0245] 24-well tissue culture plates [0246] PBS (without Mg2+ or Ca2+) [0247] 4% Paraformaldehyde in PBS (4% PFA) [0248] Triton X-100 [0249] Bovine serum albumin (BSA) [0250] DAPI [0251] Mounting medium (optional)
[0252] Prepare the Blocking Buffer (BB): [0253] Use PBS (the amount necessary to complete the ICC). Add 5-10% of BSA. [0254] For surface antigens, the BB is ready to use (RTU). [0255] For intracellular antigens, add 0.1% of Triton X-100. [0256] Store BB up to 6 months at 4 C.
[0257] Procedure: [0258] 1. Passage and culture cells in a 24-well plate till ready for ICC analysis. [0259] Note: Use matrigel coated plates for hiPSC. [0260] Note: Use collagen I coated plates for hiPSC-derived KPC and keratinocytes. [0261] 2. Wash each well 3 using 0.5 mL of RT PBS. [0262] 3. Fixation: use 0.5 mL 4% PFA/well and keep at RT for 20 minutes. [0263] 4. Remove the PFA then wash each well 3 with 0.5 mL PBS for 5 minutes. [0264] 5. Add 0.5 mL/well of BB to block non-specific antibody binding and keep at RT for 60 minutes. [0265] 6. Prepare the primary antibody by diluting it in BB (see Table 2).
TABLE-US-00002 TABLE 2 List of antibodies used in immunocytochemistry (ICC) Antibody Name Host Dilution Company Cat # OCT4 Rabbit 1:200 Cell Signaling 2840 NANOG Rabbit 1:200 Cell Signaling 4903 SOX2 Rabbit 1:200 Cell Signaling 3579 TRA-1-60 Mouse 1:200 Cell Signaling 4746 TRA-1-81 Mouse 1:200 Cell Signaling 4745 SSEA4 Mouse 1:200 Cell Signaling 4755 CD200 Mouse 5:200 eBioscience 12-9200-41 ITGA6 Rat 1:200 eBioscience 11-0495-80 ITGB1 Mouse 5:200 eBioscience 17-0299-41 Keratin15 Rabbit 1:100 Abcam ab52816 Keratin15 Mouse 1:200 NeoMarkers MS-1068-P0 Keratin19 Mouse 4:200 eBioscience 14-9898-80 Keratin18 Rabbit 1:200 Abcam ab133263 P63 Rabbit 1:200 STEMCELL 60154 Keratin14 Rabbit 1:200 Abcam ab51054 [0266] 7. Remove the BB and add the diluted primary antibody (200 L) to each well then keep the plate at 4 C. overnight. [0267] 8. Wash each well 3 using 0.5 mL PBS for 5 minutes. [0268] 9. Prepare the secondary antibody by diluting it in BB according to the manufacturer's instructions. [0269] 10. Add the diluted secondary antibody (200 L) to each well and keep at RT for 60 minutes while protecting the plate from light by wrapping with aluminum foil. [0270] 11. Wash each well 3 using 0.5 mL PBS for 5 minutes (protect the plate from light). [0271] 12. Prepare diluted DAPI (0.2 mg/mL) in PBS (1:10,000), for nuclear visualization during fluorescent imaging, and add 0.5 mL per well for 10 min at RT (protect the plate from light by covering with aluminum foil). [0272] 13. Wash each well once using 0.5 mL PBS for 5 minutes (protect the plate from light). [0273] 14. Aspirate any PBS remaining in the wells (You can add mounting medium 1-2 drops/well. [0274] 15. Examine the plate under the fluorescence microscope and take photos for each well.
[0275] Immunofluorescence Staining of Cells for Flow Cytometry (FC)
[0276] Materials: [0277] Flow Buffer [0278] Trypan blue [0279] 10% formalin solution [0280] PBS [0281] 15 mL conical tubes [0282] 1275 mm round-bottom tubes
[0283] Prepare the Flow Buffer: [0284] 99 mL PBS (1) [0285] 1 mL FBS [0286] 0.1 mL Sodium Azide (100%) [0287] For extracellular antigens, the flow buffer is RTU. [0288] For intracellular antigens, add Saponin to a final concentration of 0.1%. [0289] Store flow buffer at 4 C.
[0290] Procedure: [0291] 1. Prepare a single cell suspension then collect the dissociated cells in a 15 mL conical tube. [0292] 2. Count cell number using trypan blue and a hemacytometer. [0293] 3. Centrifuge at 300g for 5 minutes at 4 C. [0294] 4. Remove the medium then flick the tube to disrupt the cell pellet. [0295] For extracellular antigens, resuspend the cell pellet using 3 mL PBS. [0296] For intracellular antigens, resuspend the cell pellet in 2 mL 10% formalin solution and keep for 15 min at RT. [0297] 5. Centrifuge at 300g for 5 minutes at 4 C. [0298] 6. Remove the medium then flick the tube to disrupt the cell pellet. [0299] 7. Using appropriate amount of the flow buffer, set the cell suspension to a concentration of 2106 to 1107 cells/mL. Keep the cells on ice. [0300] 8. For each sample, add 100 L of the cell suspension to a 1275 mm round-bottom tube. [0301] 9. Add the suitable amount of primary antibody to each sample (see Table 3).
TABLE-US-00003 TABLE 3 List of antibodies Antibody Name Diluti Company Cat # CD200 5:200 eBioscience 12-9200-41 ITGA6 1:200 eBioscience 11-0495-80 ITGB1 5:200 eBioscience 17-0299-41 [0302] 10. Keep on ice for 1 hour while covering the tubes from light. [0303] 11. Add 4 mL flow buffer. [0304] 12. Centrifuge at 300g for 5 minutes at 4 C. [0305] 13. Remove the supernatant then flick the tube to disrupt the cell pellet. [0306] 14. Add the proper volume of flow buffer to each tube. [0307] 15. Analyze the cells by FC within 4 hours. [0308] Stained cells were analyzed using a LSRFortessaflow cytometer (BD Biosciences, San Jose, CA). Data were then analyzed using FACSDiVa v8.0.2 software (BD Biosciences, San Jose, CA).
[0309] Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
[0310] RNA Isolation: (RNeasy Mini Kit, Qiagen, Cat. #74104) [0311] 1. Collect cells (max. of 110.sup.7) as a cell pellet then add 350 L of Buffer RLT, vortex. [0312] 2. Add 1 volume of 70% ethanol to the lysate, then pipet to mix well. NO centrifugation. [0313] 3. Take 700 L of the sample (include any precipitate), to a RNeasy Mini spin column placed in a 2 mL collection tube. Close the lid, and centrifuge for 15 s at 8000g. Discard the flow-through. [0314] 4. Add 700 L Buffer RW1 to the RNeasy spin column. Close the lid, and centrifuge for 15 s at 8000g. Discard the flow-through. [0315] 5. Add 500 L Buffer RPE to the RNeasy spin column. Close the lid, and centrifuge for 15 s at 8000g. Discard the flow-through. [0316] 6. Add 500 L Buffer RPE to the RNeasy spin column. Close the lid, and centrifuge for 2 min at 8000g. [0317] Optional: Place the RNeasy spin column in a new 2 mL collection tube. Centrifuge at maximum speed for 1 min to dry the membrane. [0318] 7. Place the RNeasy spin column in a new 1.5 mL collection tube. Add 30-50 L RNase-free water directly to the spin column membrane. Close the lid, and centrifuge for 1 min at 8000g to elute the RNA. [0319] 8. If the expected RNA yield is >30 g, repeat step 7 using another 30-50 L of RNase-free water, or using the eluate from step 7 (if high RNA concentration is required). Reuse the collection tube from step 7.
[0320] Synthesize first-strand cDNA (SuperScript III First-Strand Synthesis SuperMix for qRT-PCR, Invitrogen, Catalog #11752-050) [0321] 1. Combine the following kit components in a tube on ice (see Table 4). For multiple reactions, a master mix without RNA may be prepared:
TABLE-US-00004 TABLE 4 Reagents for 1.sup.st strand cDNA Component Amount 2 RT Reaction Mix 10 L RT Enzyme Mix 2 L RNA (up to 1 g) x L DEPC-treated water to 20 L [0322] 2. Gently mix tube contents then incubate at 25 C. for 10 minutes. [0323] 3. Incubate tube at 50 C. for 30 minutes. [0324] 4. Terminate the reaction at 85 C. at 5 minutes, then chill on ice. [0325] 5. Add 1 L (2 U) of E. coli RNase H and incubate at 37 C. for 20 minutes. [0326] 6. Use diluted or undiluted cDNA in qPCR, or store at 20 C. until use.
[0327] Real-time PCR (SensiFAST SYBR No-ROX Kit, Bioline, BIO-98005) Reaction mix composition: Prepare a PCR master mix. The volumes given in Table 5 are based on a standard 20 L final reaction mix and can be scaled accordingly.
TABLE-US-00005 TABLE 5 Reagents for Real Time PCR 2 SensiFAST SYBR No-ROX Mix 10 L 1 10 M forward primer 0.8 L 400 nM 10 M reverse primer 0.8 L 400 nM Template up to 8.4 L H.sub.2O As required 20 L Final volume
The conditions for 3-step cycling are presented in Table 6.
TABLE-US-00006 TABLE 6 PCR Cycles Cycles Temperature Time Notes 1 95 C. 2 min Polymerase activation 40 95 C. 5 s Denaturation 60-65 C. 10 s Annealing 72 C. 5-20 s Extension (acquire at end of step) [0328] Messenger RNA expression levels were normalized to 18S expression based on the ACT method and calculated based on 2-ACT. [0329] The results are presented as meanstandard error of means (SEM). Statistical significance of the differences in RT-PCR analysis was determined using One-Way ANOVA test with P<0.05 considered significant. [0330] The sequences of the primers are presented in Table 7.
TABLE-US-00007 TABLE7 SequenceofthePCRprimers Gene Forwardsequence Reversesequence OCT4 CCTCACTTCACTGCACTGTA CAGGTTTTCTTTCCFTAGCT(SEQ (SEQIDNO:1) IDNO:9) TP63 CCGCCGTCCAATTTTAATCA CGTCGGCCCAGGACTTG(SEQID (SEQIDNO:2) NO:10) KRT15 CTTCAGGAGGTGGTGGTAGCA CACCTGTCCATCCACTGACTCTT (SEQIDNO:3) (SEQIDNO:11) KRT19 AACCAAGTTTGAGACGGAACA GAGCGGAATCCACCTCCAC(SEQ G(SEQIDNO:4) IDNO:12) KRT8 GATCGCCACCTACAGGAAGCT ACTCATGTTCTGCATCCCAGACT (SEQIDNO:5) (SEQIDNO:13) KRT18 GAGTATGAGGCCCTGCTGAAC GCGGGTGGTGGTCTTTTGGAT ATCA(SEQIDNO:6) (SEQIDNO:14) KRT5 ATCTCTGAGATGAACCGGAT CAGATTGGCGCACTGTTTCTT GATC(SEQIDNO:7) (SEQIDNO:15) KRT14 GGCCTGCTGAGATCAAAGACT CACTGTGGCTGTGAGAATCTTGT AC(SEQIDNO:8) T(SEQIDNO:16)
[0331] Patch Assay [0332] Mice: C57BL/6 [0333] Site: Back [0334] First Day:
[0335] Requirements: [0336] 1. 50 mL conical tubes (PBS with antibiotics) [0337] 2. Empty 50 mL conical tube [0338] 3. Surgical instruments [0339] 4. Surgical cover [0340] 5. Base for 50 mL conical tubes.
[0341] Procedure: Sterilize the Animal (Betadine and Ethanol 70%) [0342] Back skins were isolated, washed in PBS with antibiotic/antimycotic (5 times for 5 minutes shaking), [0343] Transfer placed on ice, [0344] Incubate in 0.01% Dispase overnight at 4 C.
[0345] Second Day (Day of Injection): [0346] Epidermal layers of skin were isolated with forceps, washed in PBS (with anti/anti) for 5 minutes and incubated in 0.1% Trypsin-EDTA solution at 37 C for 8 minutes. [0347] Dermal layers: homogenized with scissors and digested with 0.1% Trypsin EDTA (or collagenase) solution at 37 C. for 45 minutes. [0348] Add MEF media to block enzyme activity. [0349] Pipette epidermis and dermis vigorously for 10 minutes. [0350] Cell suspension was isolated with cell strainer. [0351] Centrifuge. [0352] Wash in PBS. [0353] Centrifuge. [0354] Resuspend in PBS. [0355] In all experiments, approximately equal numbers of epithelial and dermal cells (2.5 million each) were combined in 100 ul BPBS and kept on ice until transplanted intradermal into SCID mouse under general anesthesia.
[0356] Immunohistochemistry (IHC)
[0357] Using Shandon Apparatus Technique
[0358] Materials Required: [0359] Slides [0360] DPBS [0361] BSA [0362] Goat Serum [0363] Triton-X, antibodies [0364] Coverslips [0365] Mounting media (FluorSave) [0366] Hoechst (DAPI).
[0367] Procedures: [0368] 1. Section tissue (using cryostat or microtome) and place tissue in middle &/or lower half of the glass slide. [0369] 2. Label slides with tissue info, primary antibodies and concentration used, date, name. [0370] 3. Place slides into plastic slide holders against holder feet with tissue facing plastic/middle. Holding slides and holders together, place the slides and holders in the staining box. [0371] 4. Rehydrate tissue and clear out excess paraffin/OCT with 200 L DPBS quick wash. [0372] 5. Wash 2 for 5 minutes with 200 L DPBS. [0373] 6. Prepare enough blocking/permeabilization solution: 3% BSA, 3% Goat Serum, 0.1% Triton X-100 in DPBS. [0374] 7. Add 150 L of blocking/permeabilization solution to slides for 1 hour at RT. [0375] 8. Prepare primary antibody solutions in blocking solution (1:250) [0376] Note: If staining for multiple proteins, make sure the primary antibodies are different species. [0377] Note that the primary antibodies used are those in Table 2 except for the addition of the human-specific antibodies listed in Table 8 used following in vivo transplants to identify human-derived cells.
TABLE-US-00008 TABLE 8 Human-Specific Antibodies Used for Immunohistochemistry Following Transplantation Antibody Name Dilution Company Cat # Anti-human Nuclei 1:250 Sigma-Aldrich MAB-1281 antibody (HuNu) (Merck) STEM121 1:500 Takara Bio Y40410 [0378] 9. Wet and fold large kimwipes with deionized water at sink and place at top corners of Shandon rack foil box cover piece so that there is a good seal with the lid and box for humidity maintenance. Place box with slides and lid in cold room on a stationary bench/table overnight. [0379] 10. Next day, take slide box into lab and RT. Wash 3 for 5 minutes using 200 L DPBS. [0380] 11. Prepare secondary antibody solution in same blocking/permeabilization solution (1:1000). [0381] Note: If staining for multiple proteins, make sure the primary antibodies target correct species at different wavelengths/colors. Example: Goat anti Mouse 488 and Goat anti Rabbit 555 [0382] 12. Add 150 uL of appropriate secondary antibody solution to slides and incubate for 60 minutes at RT (protect the plate from light by covering with aluminum foil). [0383] 13. Do 1 quick wash using 200 L DPBS, then 35-minute 200 L DPBS washes, prepare DAPI solution. [0384] 14. Hoechst/DAPI=1:5000 in DPBS. Add 150 L to slides for 15 minutes at RT (protect the plate from light by covering with aluminum foil). [0385] 15. Do 1 wash using 200 L DPBS for 5 minutes (protect the plate from light by covering with aluminum foil). [0386] 16. Very carefully remove slide from box and the plastic slide holder. Watch to make sure tissue stays flat and straight on slide. [0387] 17. Very carefully using small kimwipe to dab dry surrounding DPBS liquid around tissue, but since you cannot dry everything, place the tissue face up in a drawer to let dry and protect from light. Check after 15 minutes to see if dry enough to coverslip. [0388] 18. Add two small drops of FluorSave mounting media. Make sure there is enough mounting media to cover the tissue and make sure there are no bubbles. [0389] 19. Place coverslip using one edge as a fulcrum to slowly apply coverslip. Carefully tap out any bubbles that are made by adding the coverslip by using the end of a paintbrush or something similar. [0390] 20. Place the cover-slipped slides in a drawer to protect from light for one hour for mounting media to dry and solidify. [0391] 21. Can start to image with fluorescent or confocal microscope. It may help to clean the coverslip and slide exteriors with gently wiping with Sparkle solution or just try with 70% Ethanol spray. [0392] 22. Short term storage of slides in slide box in 4 C. fridge. Long term storage at 80 C. freezer.
[0393] Results
[0394] One aspect of the present disclosure is to exploit insights from the dynamic up- and down-regulation of the key developmental molecules that determine HF lineage commitment by hPSCs. The insights can ascertain the precise differentiation stage and molecular requirements, as indicated by surrogate biomarkers for successful HF replacement in vivo based on the conversion of hiPSCs into engraftable hair generating cells. The results can produce a strategy that entailed differentiating hiPSCs toward becoming keratinocytes in vitro but, just prior to that end-point, capturing and isolating an intermediate transient progenitor cell population, which expressed HFBSC-associated markers and could generate HFs in vivo before going on to become (which may be less desirable) non-HF-producing keratinocytes (See
[0395] For more details, see Ibrahim, M. R., et al. (2021). The Developmental & Molecular Requirements for Ensuring that Human Pluripotent Stem Cell-Derived Hair Follicle Bulge Stem Cells Have Acquired Competence for Hair Follicle Generation Following Transplantation. Cell transplantation, 30, 9636897211014820, the content of which is entirely incorporated herein by reference.
[0396] Generation and Characterization of hiPSCs
[0397] hiPSCs were generated de novo by electroporating into de-identified normal human skin fibroblasts, non-integrating episomal plasmid vectors encoding OCT3/4, SOX2, KLF4, L-MYC, LIN28 and an shRNA for human p53 (Okita, K. (2011)). The hiPSC clones exhibited appropriate hPSC morphology and were isolated about 21-45 days post-transfection. Fourteen distinct clones were generated following 2 independent rounds of transfections. Of these 14 clones, 2 unrelated clones were selected at random for the studies described here.
[0398] Given that hESCs are the gold standard for hPSCs, hESCs were also studied through all subsequent steps in parallel with the hiPSCs for validation. Like the hESCs, the new hiPSCs expressed the following panel of pluripotency immunomarkers as determined by ICC and FC: the nuclear transcription factors NANOG, SOX2, and OCT4; the surface markers TRA-1-60, TRA-1-81, and SSEA4. Pluripotency of the hiPSC clones was further confirmed by demonstrating their ability to form teratomas containing cells representative of all 3 fundamental primitive germ layers in immunocompromised NSG mice as shown in
[0399]
[0400] Generation, Characterization, & Differentiation of hiPSCs into HFBSCs
[0401] With the conversion of hiPSCs into floating EBs (
[0402] As shown in
[0403] Co-expression of CD200, ITGA6, and ITGB1 along with SOX2 on hESCs as well as on hiPSCs, in
[0404] By DIV 5, the EBs acquired a cystic morphology, at which time they were plated (
[0405] Expression Dynamics of the Molecules Determining hiPSC-HFBSC Fate
[0406] The hPSC-derived cells obtained by the differentiation protocol can be divided into 3 stages: hPSCs (Stage #1) becoming HFBSCs (Stage #2), and then, if no additional cues are presented (including cues from an in vivo environment following transplantation), progression to becoming mature keratinocytes (Stage #3).
[0407] Emergence of the expression of KRT8, KRT18, P63, KRT15, and KRT19 indicated differentiation of the hPSCs toward HFBSCs (see
[0408]
[0409] The dynamic changes in these various lineage-determining molecules are detailed based on ICC, FC, and q-PCR.
[0410] By ICC and FC, expression of the pluripotency markers that defined the hPSCs decreased (See
[0411]
[0412] With regard to the surface glycoprotein CD200, its peak expression appeared obligatory for HFBSC generation. CD200 was uniformly expressed by undifferentiated hPSC and continued to be expressed during ectodermal differentiation and differentiation of those ectodermal cells into HFBSCs until DIV 18. CD200 expression persisted even as that of the pluripotency markers disappeared during the earliest differentiation stages. However, starting at DIV 18 and reaching a nadir at DIV 25 (FIG. Panels A and B), CD200 began to downregulate (about 40% of cells have lost CD200 expression by DIV 25) concomitant with increased expression of KRT14 (
[0413]
[0414] Hence, downregulation of CD200 with concomitant upregulation of KRT14 appeared to separate the HFBSC stage (Stage #2) from the keratinocyte stage (Stage #3). This border zone may hold translational significance if Stage #2 cells (hiPSC-HFBSCs) but not Stage 3 cells (KRT14+ keratinocytes), could engraft to yield HFs in vivo.
[0415] Before testing the above rationale/hypothesis directly via transplantation studies, one may need to determine whether Stage 2 cells had the competence to express hair differentiation markers when exposed to proper inductive cues (
[0416]
[0417] The bulge activation hypothesis holds that signals from the dermal papillae (DP) (the mesenchymal component of the HF) stimulate resting HFBSCs to generate transient amplifying cells which can then form HFs and hair shafts in vivo (Catsarelis, G. et al. Label-retaining cells reside in the bulge area of pilosebaceous unit: implications for follicular stem cells, hair cycle, and skin carcinogenesis. Cell. 1990; 61(7):1329-1337). Accordingly, an experiment was conducted to co-culture hiPSC-HFBSCs with freshly isolated MDCs for 1 week using two different paradigms (
[0418] Characterization In Vivo of hiPSC-HFBSCs Following Transplantation
[0419] In search for the optimal molecular profile for inducing hiPSCs to yield HF-competent HFBSCs, sustained co-expression of CD200, ITGA6 and ITGB1 together with emergence of other HFBSC-associated gene products such as P63, KRT15, KRT19, and KRT18 (i.e., Stage 2 cells) can be a solution. Towards that end, hiPSC-HFBSCs were translated into SCID mice at DIV 16. DIV 16 represented the time point at which there was maximal expression of CD200 (before its down-regulation, as shown by FC) as well as of KRT15, KRT19, and KRT18 (as shown by RT-PCR). Transplantation of the hiPSC-HFBSCs was accomplished by co-injection of HFBSCs and MDCs intradermally above the muscle coat, where the cells could remain tightly packed and in contact with each other with little dispersion. The hiPSC-derived HFBSCs yielded HF in vivo (
[0420]
[0421] Positive immunoperoxidase staining (brown) of representative reconstituted HFs with an antibody against TDAG51 (a known HF stem cell marker) are shown in
[0422] Three to six weeks following transplantation, histological analysis showed that the injected Stage 2 cells aggregated to form small cystic spheres in the host dermis. Human-like multilayered epidermis was also formed in the grafts. The cysts consisted of both basal keratinocytes and stratified epidermis. Pilosebaceous units growing outward from the cyst were evident (
[0423] Human origin of the epithelial cells in the HFs and epidermis was confirmed by immunopositivity for the human-specific nuclear antigen (HSNA) which was detected in about 60-70% of growing HFs cells. Human derivation of the cells was further confirmed by the positive immunoreactivity for a human-specific cytoplasmic antigen (HSCA) (
[0424]
[0425]
[0426] A cell-based treatment for alopecia has a challenge to ascertain that newly generated HFs contain a mechanism for cycling. The donor-derived HFs bore a bulge region in vivo rendering them capable of cycling and renewal. Indeed, KRT15 expression in the bulge region of the chimeric HFs and in the basal layer of the epidermis (
[0427] Assessing the Necessary & Sufficient Elements for HF Generation
[0428] An important step in confirming the necessity and causality of the putative suite of developmental determinants was to first eliminate and then re-add each factor systematically and demonstrate first an inability and then a reacquisition of the ability to yield engraftable HF-generating HFBSCs. However, all of the seven molecules (markers) required for complete HF generation were also fundamental to the earliest stages of normal development. Neither of the seven genes can be knock-out, and certainly not all seven, (even conditionally) in the hPSCs without disrupting normal development and confounding interpretation of the experiments. Furthermore, they could be knocked out even in the starting fibroblasts prior to being reprogrammed into hiPSCs because each is obligatory for the reprogramming process itself as well as for subsequent expansion, self-renewal, and acquisition of pluripotency (see, e.g., Sellheyer, K. et al. PHLDA1 (TDAG51) is a follicular stem cell marker and differentiates between morphoeic basal cell carcinoma and desmoplastic trichoepithelioma. Br J Dermatol. 2011; 164(1):141-147; and Sellbeyer, K. et al. Follicular stem cell marker PHLDA1 (TDAG5 1) is superior to cytokeratin-20 in differentiating between trichoepithelioma and basal cell carcinoma in small biopsy specimens. J Cutan Pathol. 2011; 38(7):542-550). Given these limitations, a series of studies that would serve the same purpose as a knock-out but without perturbing the system and obfuscating interpretation through ambiguity, were performed, as detailed below.
[0429] The expression profile of each of the markers that hPSC-derived HFBSC ultimately achieve is mapped. Test transplants of cells were done at each epoch along the developmental trajectory from epiblast (i.e., undifferentiated hPSC) to ectoderm to HFBSC to keratinocyte. Each period had a different constellation of markers among the seven. The question is which constellation yielded HFs in vivo.
[0430] Similar to what has been observed above, P63, KRT15, KRT18, and KRT19 start to be expressed at DIV 11, peak at DIV18, and decrease by DIV 25. CD200, while expressed earlier than DIV 11 (when the cells are still in their pluripotent state), ebb by DIV 25, the point at which KRT5 and KRT14 expression becomes ascendant, heralding the emergence of keratinocytes. ITGA6 and ITGB1 are expressed starting at DIV 0 through DIV 25; if these integrins are not expressed, HF also fails to develop. Transplantation of cells prior to DIV 11 or after DIV 25 fails to yield HF. Therefore, we could conclude that HF generation requires the expression of CD200, ITGA6, ITGB1, KRT15, KRT18, KRT19, and P63 and that a constellation lacking one or more of these molecules was insufficient to yield HFs.
[0431] Therefore, transplantation at DIV 16-18 may be favored, at which time the cells have lost expression of pluripotency markers, continue to express integrins ITGA6 and ITGB1, have attained optimal expression levels of the HFBSC markers KRT15 and KRT19 (in conjunction with P63), express the epithelial marker KRT18, have not yet experienced downregulation of the surface glycoprotein CD200, have not yet started expressing the keratinocyte-associated molecules KRT5 and KRT14, and have attained optimal proliferative capacity to allow a well-populated graft. The optimal site for transplantation was intradermal and above the muscle coat to prevent cell dispersion. Transplantation of MDCs alone failed to yield HFs in vivo.
[0432] Analysis
[0433] To find out how best to produce and select pluripotent stem cell derivatives for reliable and efficient therapeutic HF replacement, a developmental approach to this question can be taken by generating HFs as they might emerge if starting in the epiblast (a stage emulated by hESCs and, for clinical use, patient-specific hiPSCs) and progressing iteratively through gastrulation and on to dermal organogenesis.
[0434] The dynamic up- and down-regulation of specific molecules that serve as landmarks for each stage of this developmental process can be mapped. From the mapped dynamic, one can find the precise point at which the appropriate molecular and developmental requirements were attained by the cell (as indicated by surrogate biomarkers) to yield optimal HF generation in vivo if transplanted. What emerged was a 3-stage profile that entailed differentiating hiPSCs (Stage #1) toward becoming keratinocytes in vitro (Stage 3) but, just prior to that endpoint, capturing and isolating an intermediate transient progenitor cell population (Stage #2), which are bona fide HFBSCs, not only based on their co-expression of HFBSC-associated molecules but, most importantly, by their ability to generate HFs in vivo upon transplantation. Cells that cascaded beyond HFBSC Stage #2 into keratinocyte Stage #3 lost that ability to generate HFs upon grafting. In short, to ensure that hiPSC-derived HFBSC have acquired the competence for HF generation, they must come to express, at the time of transplantation, CD200, ITGA, and ITGB1 on their surface, and KRT18, P63, KRT15, and KRT196, but not KRT5 or KRT14 (keratinocyte markers), intracellularly. Expression of the HFBSCs markers P63, KRT15, and KRT19 as well as the HFBSC-associated epithelial marker KRT18 increases significantly from DIV 11 until DIV 18 (marking the transition from hiPSC Stage #1 to HFBSC Stage #2. Although CD200 is expressed starting in Stage #1, it begins to wane at DIV 18, reaching its nadir at DIV 25. Keratinocyte markers KRT5 and KRT14 are low through Stages #1 and #2, but dominate by DIV 25. DIV 18 appears to represent a developmental border between Stage #2 (CD200 engraftable HF-yielding HFBSCs) and Stage #3 (unengraftable mature non-HF yielding KRT5/14 keratinocytes). Therefore, to yield HFs, transplantation, we learned, should take place after DIV 11 but no later than DIV 18; we have chosen DIV 16-18 as our optimal transplant time to insure that all pluripotency markers have downregulated and the HFBSC-associated molecules are at their peaks.
[0435] The expression of CD200, ITGA6 and ITGB1 on hiPSCs and hESCs is a sine qua non for the differentiation of hPSCs into HFBSCs is unexpected. The ICC and FC data not only clearly confirm their expression on Stage #1 cells, in association with other known pluripotency markers such as NANOG, SOX2, TRA-1-60, TRA-1-81, and SSEA4, but suggest that in the absence of such integrin-related molecules and glycoproteins, hPSCs cannot proceed to becoming HFBSC Stage #2 cells with competence for yielding HFs. There are two supporting evidences. First, the 3D co-cultures show that induction of the molecules mediating HF generation required cell-cell contact between receptive HFBSCs and trichogenic mesenchymal cells, an interaction mediated by these integrins. Second, downregulation of CD200 coincided with progression of Stage #2 HFBSCs toward a Stage #3 keratinocyte fate incapable of HF generation, while transplantation of the Stage #2 cells at the peak of their CD200 expression in conjunction with expression of the integrins consistently yielded HFs in vivo.
[0436] Beyond our empiric data, the expression of these surface glycoproteins makes biologic sense for creating hPSC-derived HFs. Integrins are transmembrane glycoproteins composed of an x subunit and a 13 subunit that are linked via non-covalent bonds. The x6 subunit associates with the 131 subunit or the 134 subunit to form x6131 and x6134 integrin heterodimers. x6131 is expressed on a variety of cell types and functions as a cellular receptor for matrix laminin42. ITGA6 is the x6 subunit (also known as CD49f); ITGB1 is the 131 subunit. x6131 integrins along with x6134 integrins confer functional characteristics to stem cells; x6131 may be the dominant integrin. More than 30 different stem cell types have been found to express ITGA6 on their membranes. During the reprogramming of fibroblasts into hiPSCs, ITGA6 is upregulated and focal adhesion kinase (FAK) is inactivated (via dephosphorylation). During differentiation of the hiPSCs, the converse takes place: ITGA6 levels diminish and FAK is activated (phosphorylated at residue Y397). Activation of ITGB1 also leads to FAK phosphorylation and reduction of NANOG, OCT4, and SOX2. Knockdown of ITGA6 can mimic ITGB1 activation and reduce or eliminate normal hESC and hiPSC colony development, self-renewal, and pluripotency. Hence, while the presence of these two arms of the integrin system are necessary for hPSC maintenance and differentiation, they may play dynamic opposing roles; obviously an equilibrium must be struck between them for first reprogramming and then development to proceedin this case, all the way to becoming HF-competent HFBSCs. CD200 is a glycoprotein widely expressed on cancer stem cells (breast, colon, hematopoietic) and may be required to maintain growth, self-renew, metastasis, and to evade the immune system38. It is also a marker of HFBSCs (as well as limbal stem cells). This combination of surface molecules likely interacts with specific matrix receptors during culture which, in turn, influences the hiPSCs' adhesion, survival, proliferation, and entrance into particular differentiation programs. The expression of these molecules on hiPSCs appeared to ensure that the cells had acquired the molecular competence for becoming HFs in vivo. In fact, the necessity of these surface markers may be used for cytometry to extract hiPSC derivatives in Stage #2 that can yield HFs from a heterogeneous population that might contain cells disadvantageous for this therapeutic indication. For regulatory purposes, it might be a way to isolate therapeutic Stage #2 cells from undifferentiated and potentially tumorigenic hPSCs. These same markers, which are avatars for a desirable developmental trajectory, may be used to identify drugs that might enhance the efficiency of HF generation.
[0437] Based on the developmental dynamics mapped above, the transplantation at DIV 16-18 is favored. At DIV 16-18 the cells have lost expression of pluripotency markers, continue to express integrins ITGA6 and ITGB1, have attained optimal expression levels of the HFBSC-associated markers KRT15, KRT18, and KRT19 (as well as P63), have not yet experienced downregulation of CD200, have not yet started expressing the keratinocyte-associated molecules KRT5 and KRT14, and have attained optimal proliferative capacity to allow a well-populated graft. Transplantation should be done intradermally above the muscle coat, where the cells can remain tightly packed and in contact with each other with little dispersion. The guidance provided by the present study may bring us closer to replacing HFs lost in non-cicatricial and cicatricial alopecia through the use of a patient's own hiPSC-derived follicular stem cells.
[0438] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.