INHIBITION OF THE HIV-1 REPLICATION BY COMPOUNDS DIRECTED AGAINST A NEW TARGET OF THE VIRAL CYCLE

20230414632 · 2023-12-28

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention concerns a compound inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1) for use in a method for treating a type 1 human immunodeficiency virus (HIV-1).

    Claims

    1. A method for treating a type 1 human immunodeficiency virus (HIV-1), comprising administering to a mammal in need thereof a therapeutically effective amount of a compound inhibitor of the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1).

    2. The method according to claim 1, wherein said compound inhibits the interaction between an integrase of the type 1 human immunodeficiency virus and a mitochondrial lysyl-tRNA synthetase of a cell infected by the type 1 human immunodeficiency virus.

    3. A method of inhibiting the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus, comprising administering to a mammal in need thereof a therapeutically effective amount of a compound of formula (I), wherein said formula (I) is as follows: ##STR00010## wherein R.sup.1 is selected form the group consisting of: a hydrogen atom, an amino group NH.sub.2, and a C1-C10 alkyl group, linear or cyclic or branched, saturated or unsaturated, optionally comprising an heteroatom chosen from nitrogen, oxygen and sulfur, wherein R.sup.2, R.sup.3, R.sup.4 and R.sup.5 are independently selected from the group consisting of: a hydrogen atom, a halogen atom, a hydroxyl group, a C1-C20 alkyl group, linear or cyclic or branched, saturated or unsaturated, optionally substituted and/or optionally comprising a heteroatom, an aryl group, optionally substituted by at least one C1-C20 alkyl group, linear or cyclic or branched, saturated or unsaturated, optionally substituted and/or optionally comprising at least one heteroatom, an ester group of formula O(O)OR.sub.a or of formula O(O)OR.sub.a, R.sub.a and R.sub.a being independently selected from the group consisting of a C1-C30 alkyl group, linear or cyclic or branched, saturated or unsaturated, optionally substituted and/or optionally comprising at least one heteroatom, or R.sub.a being a C1-C30 alkylaryl group, wherein the alkyl is linear or cyclic or branched, saturated or unsaturated, linked to the aryl group, optionally substituted and/or optionally comprising at least one heteroatom; a carboxyl group (COOH), a nitro group (NO.sub.2), and a cyano group (CN), wherein R.sub.4 and R.sub.5 optionally form together a heterocycle, and/or a salt thereof and/or a solvate thereof.

    4. The method according to claim 3, wherein said compound is a compound of formula (I) as follows: ##STR00011## wherein R.sup.1, R.sub.a, R.sub.a, R.sup.4 and R.sup.5 are as defined in claim 3.

    5. The method according to claim 3, wherein R.sup.2 and R.sup.3 are each independently an ester group of formula C(O)OR.sub.a or of formula C(O)OR.sub.a, wherein R.sub.a and R.sub.a are independently selected from the group consisting of: a C1-C25 alkyl group R.sub.a1 optionally comprising at least one heteroatom chosen from nitrogen, oxygen and sulfur, said alkyl group R.sub.a1 being optionally substituted by at least one phenyl group, said phenyl group being optionally substituted by an halogen atom, a C1-C25 alkyl group R.sub.a2 comprising at least one heterocycle, said alkyl group R.sub.a2 being optionally substituted by at least one phenyl group, said phenyl group being optionally substituted by an halogen atom, and a heterocycle R.sub.a3 optionally substituted by at least one C1-C10 alkyl group optionally comprising at least one heteroatom chosen from nitrogen, oxygen and sulfur and/or optionally substituted by at least one terminal phenyl group.

    6. The method according to claim 3, wherein R.sub.4 and R.sub.5 are independently selected from the group consisting of: a hydrogen atom a halogen atom, a hydroxyl group, an C1-C20 alkyl group, linear or cyclic or branched, saturated or unsaturated, optionally comprising at least one heteroatom chosen from nitrogen, oxygen and sulfur and/or optionally substituted by a halogen atom, a carboxyl group (COOH), a nitro group (NO.sub.2), and a cyano group (CN), or R.sub.4 and R.sub.5 form together a heterocycle.

    7. The method according to claim 3, wherein R.sup.1 is selected form the group consisting of a methyl group CH.sub.3 and an amino group NH.sub.2.

    8. The method according to claim 3, wherein R.sup.2 and R.sup.3 are each independently an ester group of formula C(O)OR.sub.a or of formula C(O)OR.sub.a, wherein R.sub.a and R.sub.a are independently selected from the group consisting of: a C1-C10 alkyl group optionally comprising at least one oxygen atom, a C1-C25 alkyl group substituted by one or two terminal phenyl groups and optionally comprising at least one nitrogen atom, a C1-C15 alkyl group comprising at least one saturated heterocycle comprising from 2 to 7 carbon atoms and at least one nitrogen atom, said saturated heterocycle being substituted by at least one phenyl group and/or by at least one C1-C10 alkyl group optionally substituted by one or two terminal phenyl groups, and a saturated heterocycle comprising from 2 to 7 carbon atoms and at least one nitrogen atom, said heterocycle being substituted by at least one phenyl group and/or by at least one C1-C10 alkyl group optionally substituted by one or two terminal phenyl groups.

    9. The method according to claim 3, wherein R.sub.4 is hydrogen and R.sub.5 is different from hydrogen, or R.sub.5 is hydrogen and R.sub.4 is different from hydrogen.

    10. The method compound according to claim 3, wherein R.sup.2 and R.sup.3 are each independently an ester group of formula C(O)OR.sub.a or of formula C(O)OR.sub.a, or a compound of formula (I), wherein R.sub.a and R.sub.a are independently selected from the group consisting of: a C1-C5 alkyl group, linear or branched, saturated, optionally comprising at least one oxygen atom, a C1-C10 alkyl group, linear, saturated or unsaturated, substituted by one or two terminal phenyl group(s), a C1-C5 alkyl group, linear or branched, saturated, substituted by one or two terminal phenyl group(s) and comprising at least one nitrogen atom, a C1-C10 alkyl group, comprising at least one saturated heterocycle comprising from 3 to 5 carbon atoms and one or two nitrogen atoms, said saturated heterocycle being substituted by CHPh.sub.2 or CH.sub.2Ph, and a saturated heterocycle comprising from 3 to 5 carbon atoms and one or two nitrogen atoms, said saturated heterocycle being substituted by CHPh.sub.2 or CH.sub.2 Ph.

    11. The method according to claim 3, wherein R.sub.4 and R.sub.5 are independently selected from the group consisting of: a hydrogen atom, a halogen atom, a C1-C20 alkyl group, linear or branched, saturated or unsaturated, comprising at least one ester function, and a nitro group (NO.sub.2).

    12. The method according to claim 3, wherein said compound is selected from the group consisting of: ##STR00012## ##STR00013##

    13. A method of inhibiting the initiation step of the reverse transcription of RNA of a type 1 human immunodeficiency virus (HIV-1), comprising administering to a mammal in need thereof a therapeutically effective amount of a compound of formula (II), wherein said formula (II) is as follows: ##STR00014## wherein X and Z together represent a fused benzene ring, optionally substituted by at least one substituent selected from the group consisting of: a hydrogen atom, a halogen atom, a hydroxyl group, a carboxyl group (COOH), a nitro group (NO.sub.2), a cyano group (CN), a C1-C20 alkyl group, linear or cyclic or branched, saturated or unsaturated, optionally substituted and/or optionally comprising at least one heteroatom, and an aryl group, optionally substituted, wherein R and R are independently selected form the group consisting of: a hydrogen atom, a halogen atom, a hydroxyl group, a carboxyl group (COOH), a nitro group (NO.sub.2), a cyano group (CN), an amino group (NH.sub.2), a C1-C20 alkyl group, linear or cyclic or branched, saturated or unsaturated, optionally comprising an heteroatom and/or optionally comprising at least one internal or terminal aryl group, said aryl group being optionally substituted by at least one substituent selected from the group consisting of a halogen atom, a hydroxyl group, a carboxyl group, a nitro group, a cyano group and a C1-C10 alkyl group, a C1-C20 alkyl group comprising at least one internal or terminal heterocycle, said heterocycle being optionally substituted by at least one C1-C10 alkyl group, an aryl group, optionally substituted by at least one substituent selected from the group consisting of a halogen atom, a hydroxyl group, a C1-C20 alkyl group optionally comprising a halogen atom and/or an heteroatom, a carboxyl group, a nitro group and a cyano group, and a heterocycle optionally substituted by at least one C1-C10 alkyl group, and/or a salt thereof and/or a solvate thereof.

    14. The method according to claim 13, wherein said compound is a compound of formula (II) as follows: ##STR00015## wherein R and R are as defined in claim 13.

    15. The method according to claim 13, wherein R is selected form the group consisting of: a C1-C20 alkyl group, linear or cyclic or branched, saturated or unsaturated optionally comprising an heteroatom and/or optionally comprising at least one internal or terminal aryl group, said aryl group being optionally substituted by at least one substituent selected from the group consisting of a halogen atom, a hydroxyl group, a carboxyl group, a nitro group, a cyano group and a C1-C20 alkyl group, and an aryl group, optionally substituted by at least one substituent selected from the group consisting of a halogen atom, a hydroxyl group, a C1-C20 alkyl group optionally comprising a halogen atom and/or an heteroatom, a carboxyl group, a nitro group and a cyano group.

    16. The method according to claim 13, wherein R is selected form the group consisting of: a C1-C20 alkyl group comprising at least one internal or terminal saturated heterocycle comprising from 2 to 7 carbon atoms and at least one nitrogen atom, said heterocycle being optionally substituted by at least one C1-C10 alkyl group, and a saturated heterocycle comprising from 2 to 7 carbon atoms and at least one nitrogen atom, being optionally substituted by at least one C1-C10 alkyl group.

    17. The method according to claim 13, wherein R is a CH.sub.2Ph group, Ph being an aryl group, optionally substituted by at least one substituent selected from the group consisting of a halogen atom, a hydroxyl group, a C1-C20 alkyl group, a carboxyl group, a nitro group and a cyano group.

    18. The method compound according to claim 13, wherein said compound is a compound of formula (II) or (II), wherein R is a saturated heterocycle comprising from 2 to 7 carbon atoms and at least one nitrogen atom, said heterocycle being optionally substituted by at least one C1-C10 alkyl group.

    19. The method according to claim 13, wherein said compound has the following structure: ##STR00016##

    20. The compound according to claim 3 for treating the acquired immune deficiency syndrome.

    21. The method according to claim 3, comprising administering to a mammal in need thereof a therapeutically effective amount of a pharmaceutical composition comprising compound of formula (I).

    Description

    FIGURES

    [0247] FIG. 1 is a graph representing the ex-vivo evolution of the HIV-1 replication after 5 days in contact with compounds (I-a), (I-b) and (II-a) at different concentrations, and in control conditions for comparative purpose.

    [0248] FIG. 2 is a graph representing the ex-vivo evolution of the HIV-1 cell survival after 5 days in contact with compounds (I-a), (I-b) and (II-a) at different concentrations, and in control conditions for comparative purpose.

    EXAMPLES

    Materials and Methods

    [0249] Compound of formula I-a was purchase from Prestwick (commercial reference: Prestw-1297) or from Sigma-Aldrich (commercial reference: SML0946).

    [0250] Compound of formula I-b was purchase from Prestwick (commercial reference: Prestw-1376) or from Sigma-Aldrich (commercial reference: C1493).

    [0251] Compound of formula II-a was purchase from Prestwick (commercial reference: Prestw-1130) or from Sigma-Aldrich (commercial reference: A7611).

    In-Vitro Tests

    [0252] Experiments were performed on the interaction between the HIV-1 integrase (IN) and the catalytic domain of the human mitochondrial lysyl-tRNA synthetase (mLysRS), which constitutes the main contribution to the Gag Pol:mLysRS interaction.

    Expression of H6-mLysRS-HA in E. Coli and Purification

    [0253] The cDNA encoding the mitochondrial species of human lysyl-tRNA synthetase (mLysRS, from amino acid residues 31 to 625 of the pre-protein from transcript NM_001130089.2) was amplified by PCR with oligonucleotides 5-GGGGCTAGCCAACTTGCTCCTTTCACAGCGCCT (SEQ ID_NO 1) and 5-CCCCTCGAGCTAGGCATAATCTGGCACATCATAAGGGTAGACAGAACTGCCAACTGT TGT (SEQ ID_NO 2) and inserted into the pET28b plasmid (Novagen) digested with NheI and XhoI. The sequence of the recombinant plasmid was verified by DNA sequencing. The encoded protein, named H6-mLysRS-HA (SEQ ID_NO 3), contains a N-terminal His-tag (MGSSHHHHHH) (SEQ ID_NO 4), followed by a thrombin cleavage site (SSGLVPRGSHMAS) (SEQ ID_NO 5), and a C-terminal HA-tag (YPYDVPDYA) (SEQ ID_NO 6).

    [0254] The protein was expressed in E. coli BL21(DE3) grown in LB medium supplemented with kanamycin (50 g/ml). Culture (3 liters) was grown at 37 C. to an A.sub.600=0.25, transferred at 28 C. and grown to an A.sub.600=0.5, and expression was induced by addition of 1 mM IPTG for 4 hours. Cells were collected by centrifugation (3,000 g, 10 min, 4 C.), washed twice with ice-cold buffer A (20 mM K-phosphate pH 7.5, 150 mM NaCl, 5% glycerol, 5 mM 2-mercaptoethanol) containing 10 mM imidazole, resuspended in the same buffer (1 ml per g of cell pellet) and lysed in an Eaton Press after freezing in dry ice. All subsequent steps were conducted at 4 C. After addition of 2 vol. of buffer B (20 mM K-phosphate pH 7.5, 500 mM NaCl, 5% glycerol, 5 mM 2-mercaptoethanol) containing 10 mM imidazole, and of protease inhibitors (1 mM Pefabloc, 10 mM benzamidine and 10 mM PMSF), extracts were clarified by sonication and by centrifugation at 20,000 g for 20 min, and at 70,000 g for 1 hour.

    [0255] The clear supernatant was applied to a 5 ml column of Ni-NTA Superflow (Qiagen), at 4 C. The matrix was extensively washed with buffer B containing 10 mM imidazole, and elution was performed by a linear gradient of imidazole (10 to 500 mM) in buffer B. Fractions containing H6-mLysRS-HA were dialyzed against buffer AS (20 mM Tris-HCl pH 7.5, 50 mM KCl, 10% glycerol, 10 mM 2-mercaptoethanol), and were applied to a 1 ml column of Source 15S (GE Healthcare) equilibrated in the same buffer. Proteins were eluted by a linear gradient (50 column vol.) of KCl from 50 to 335 mM in the same buffer. Fractions containing H6-mLysRS-HA were dialyzed against storage buffer (25 mM K-phosphate pH 7.5, 55% glycerol, 2 mM DTT), and stored at 20 C.

    [0256] Protein concentration was determined by using a calculated absorption coefficient of 0.674 A.sub.280 units.Math.mg.sup.1.Math.cm.sup.2.

    Cleavage of H6-mLysRS-HA to Give mLysRS-HA

    [0257] A thrombin cleavage site is inserted between the N-terminal His-tag and the coding sequence of mLysRS-HA. The H6-tag was removed from the purified H6-mLysRS-HA protein to generate mLysRS-HA (SEQ ID_NO 7).

    [0258] H6-mLysRS-HA was incubated at a concentration of 1 mg/ml, in the presence of thrombin (Roche) at a ratio 50:1 (w:w), in a buffer containing 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 2.5 mM CaCl.sub.2, 2 mM DTT, 10% glycerol. After 30 min at 25 C., digestion was stopped by addition of Pefabloc at 2 mM. The loss of the H6-tag was monitored by Western blotting with anti-His antibodies (Qiagen #34660), and using the HTRF assay (see below). In this assay, when mLysRS-HA was incubated in the presence of anti His-tag and anti HA-tag antibodies, no HTRF signal was detected. The protein mLysRS-HA was stored at 20 C. after addition of 1 vol. of glycerol.

    Expression of HIV-1 Integrase in Insect Cells and Purification

    [0259] Expression and purification of integrase from HIV-1 was conducted essentially as previously described (Khoder-Agha et al. BMC Biochemistry 2018, 19:2).

    [0260] The HIV-1 integrase coding region from pNL4-3 (nucleotides 4230 to 5093) was amplified by PCR with oligonucleotides 5-CGCGGATCCCGGTCCGAAGCGCGCGGAATTCATAATGGCGTTTTTAGATGGAATAG ATAAGG (SEQ ID_NO 8) and 5-TCTCGACAAGCTTGGTACCGCATGCCTCGAGTTAGTGGTGGTGGTGGTGGTGATCC TCATCCTGTCTACTTG (SEQ ID_NO 9), and introduced in pFastBac1 (Life Technologies) digested with EcoRI and XhoI. The sequence of the recombinant plasmid was verified by DNA sequencing. A His-tag coding sequence has been appended at the C-terminus of integrase (the sequence of the resulting protein, named IN-H6, is SEQ ID_NO 10).

    [0261] Recombinant bacmids and baculoviruses were obtained as previously described (Kobbi et al. Biochim Open. 2016, 2:52-61).

    [0262] Baculoviruses were used to infect 8 liters of High Five cells (Life Technologies) grown in suspension in Express Five SFM medium (Life Technologies). After 68 h of culture at 27 C. with constant orbital shaking at 110 rpm, cells were harvested by centrifugation, washed with ice-cold buffer A containing 10 mM imidazole, and the cell pellet was stored at 80 C. Pellet was rapidly thawed at 37 C. and cells were lysed after addition of 120 ml of buffer A containing 10 mM imidazole and 1% Triton X-100, in the presence of 1 mM Pefabloc, 10 mM benzamidine and 10 mM PMSF. After addition of 240 ml of buffer B containing 50 mM imidazole, extract was clarified by centrifugation at 70,000 g for 30 min at 4 C. and incubated 1 h at 4 C. with 1 ml of Ni-NTA Superflow matrix (Qiagen). Beads were extensively washed with buffer B containing 50 mM imidazole, and elution was performed by adding 61 ml of buffer B containing 400 mM imidazole. Eluted proteins were dialyzed against buffer ASU (20 mM Tris-HCl pH 7.0, 1 M urea, 10% glycerol, 1 mM EDTA, 10 mM 2-mercaptoethanol) containing 150 mM NaCl, and applied to a Mono S HR5/5 column (GE Healthcare) equilibrated in the same buffer. Proteins were eluted by a linear gradient (40 column vol.) of NaCl from 150 to 450 mM in buffer ASU. Fractions containing integrase were concentrated by ultrafiltration (Vivaspin 6, 10 kDa), dialyzed against storage buffer (20 mM K-phosphate pH 7.5, 1 M NaCl, 2 mM DTT), and stored at 80 C. Protein concentration was determined by using a calculated absorption coefficient of 1.529 A.sub.280 units mg.sup.1 cm.sup.2.

    Homogeneous Time-Resolved Fluorescence Assay

    [0263] Homogeneous time-resolved fluorescence (HTRF) assays were performed in black, half-area, flat bottom, 96-well microplates (Costar #3694). Human mitochondrial LysRS with a C-terminal HA-tag (mLysRS-HA), diluted in HTRF buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl, 10 mM 2-mercaptoethanol, BSA at 1 mg/ml) was added (20 l at a dimer concentration of 3.75 nM) in the wells of microplates placed on ice. Compounds of formula I or II (1 l of a 10 mM solution in DMSO) were then added to the wells, and mixing was achieved by pipetting up and down 3-times 10 l. After centrifugation at 900 g for 1 min at 4 C., plates were placed at 4 C. on thermal modules of an epMotion 5075 v automated pipetting system (Eppendorf). A 10 l sample of IN-H6 diluted in HTRF buffer at a dimer concentration of 250 nM was added and mixing was achieved by pipetting up and down 3-times 15 l. Incubation was conducted at 4 C. for 1 h.

    [0264] A 10 l aliquot of a mix of antibodies prepared in HTRF buffer, directed to the His-tag, conjugated with Eu.sup.3+ cryptate (Cisbio #61HISKLB, 0.125 l per test, prepared as recommended by the supplier), and to the HA-tag, conjugated with XL665 (Cisbio #610HAXLB, 0.375 l per test, prepared as recommended by the supplier), was added and mixing was achieved by pipetting up and down 3-times 15 l. Incubation was conducted at 4 C. for 30 min.

    [0265] A 10 l solution of KF prepared in HTRF buffer at a concentration of 250 mM was then added and mixing was achieved by pipetting up and down 3-times 20 l. After centrifugation at 900 g for 3 min at 4 C., fluorescence of Eu.sup.3+ cryptate and of XL665 was recorded at 620 nm (I.sub.620) and 665 nm (I.sub.665), respectively, after excitation of Eu.sup.3+ cryptate at 317 nm, in an Infinite M1000 PRO microplate reader (TECAN). Results are expressed as the ratio of I.sub.665/I.sub.620. The HTRF signal corresponds to the ratio of fluorescence at 665 and 620 nm (I665/I620). HTRF (%) corresponds to normalization of the values (for each curve 100% corresponds to the value obtained without inhibitor).

    Control Tests

    [0266] Two control tests were performed to avoid false positives.

    [0267] The first control test utilizes p38-H6, instead of IN-H6. This protein p38-H6 is the scaffold protein from the cytoplasmic human multisynthetase complex that interacts with the catalytic domain of LysRS at a site distinct from that involved in the interaction with IN-H6 (Kobbi et al. J. Mol. Biol. 2011, 410:875-886). The assay was performed as described above, except that a 10 l sample of p38-H6 diluted in HTRF buffer at a dimer concentration of 50 nM was used, and anti HA-tag antibodies, conjugated with Eu.sup.3+ cryptate (Cisbio #610HAKLB, 0.125 l per test, prepared as recommended by the supplier), and anti His-tag antibodies, conjugated with XL665 (Cisbio #61 HISXLB, 0.125 l per test, prepared as recommended by the supplier), were used.

    [0268] In the second control, only H6-mLysRS-HA (a 30 l sample diluted in HTRF buffer at a dimer concentration of 1.34 nM) was added in the assay, in the absence of a partner protein. Fluorescence energy transfer results from the binding of one antibody to the N-terminal His-tag, and of the second antibody to the C-terminal HA-tag. Thus, a compound reducing the HTRF signal by interfering with the fluorescence donor (Eu.sup.3+) or acceptor (XL665) should be eliminated.

    In-Vitro Determination of the Half Maximal Inhibitory Concentration (IC50)

    [0269] IC50 of the compounds of formula I and II were determined in the HTRF assay after incubation of the protein partners in the presence of increasing concentrations of the compound of formula I or II (from 17 to 666 M). IC50s were obtained by nonlinear regression of the theoretical equation to the experimental curve using the KaleidaGraph 4.5 software (Synergy Software).

    Ex-Vivo Inhibition of the HIV-1 Virus Replication

    [0270] Ability of compounds of formula I or II to inhibit the HIV-1 replicative cycle ex vivo was conducted by methods commonly used in antiretroviral pharmacology.

    [0271] Cells and Viruses.

    [0272] MT4 cell line (Charneau et al. J. Virol. 1992, 66:2814) were maintained in RPMI 1640. HEK293T were maintained in Dulbecco's Modified Eagle Medium (DMEM). All media were supplemented with Glutamax and with 10% heat-inactivated fetal calf serum (Hyclone) and 1% penicillin/streptomycin (100 units/mL) (Gibco). All media were purchased from Gibco (Life Technologies Co.). All cell lines used here were incubated at 37 C., under 5% CO.sub.2 atmosphere. HIV-1 stocks were prepared by calcium phosphate-mediated transfection of HEK293T cells, as previously described (Manic et al. Human gene therapy methods 2012, 23:84), with shuttle vector plasmids encoding HIV-1 NL4-3 (GenBank: AF324493.1) or NLENG1-IRES-GFP (Levy et al. Proc. Natl. Acad. Sci. USA 2004, 101:4204). The latter vector comes from HIV NL4-3 strain, and contains a gfp-IRES-nef cassette at the nef locus. For clarity reason, we designate this vector here as HIV-1 gfp.sup.+.

    [0273] The HIV-1 p24.sup.gag antigen contents in viral inocula were determined by enzyme-linked immunosorbent assay (ELISA, Perkin-Elmer Life Sciences).

    [0274] HIV infectivity and toxicity assays.

    [0275] Replication of the NL4-3 virus was determined by the ELISA technique. The cytotoxicity is evaluated by the MTT technique.

    [0276] For HIV-1 gfp+ vectors, viral replication is followed by GFP expression [i.e. the percentage and geometric mean fluorescence intensity (MFI) of GFP.sup.+ cells]. Infectivity was estimated by flow cytometry using a FACSCalibur cytofluorometer (BD Biosciences). Toxicity is also assessed by flow cytometry (side and forward scatter).

    [0277] Effect of drugs on multi-cycle virus replication.

    [0278] At J0 (day zero) MT4 cells was used for infection with HIV gfp+ virus at multiplicity of infection (m.o.i.) reaching 0.1-0.2 (50 ng of p24.sup.gag antigen per 10.sup.6 cells). Two days post-infection (J2), MT4 cells are washed extensively (3 times with PBS) and resuspended using fresh RPMI medium (210.sup.5 cells per ml) and plated into 6 well plates (2 ml per well) in the presence of compounds of formula I or II at various molecules concentrations. A control not infected with the virus (MT4 Ninf), or brought into contact with DMSO (inf DMSO, the solvent of compounds of formula I or II), or with dolutegravir (DTG) at 100 nM, a known inhibitor of the integrase, are conducted in parallel. At time J5 (day five), cells are then collected for cytometry analysis to quantify the production of viral particles and cell survival.

    Example 1

    Determination of the Half Maximal Inhibitory Concentration (IC50) of Compounds of Formula I or II Regarding the mLysRS:IN Interaction

    [0279] IC50 of compounds of formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, and II-a were determined by HTRF, as described above. As the control test, the mLysRS:p38 interaction was also determined.

    [0280] The IC50 of compounds of formula I-a, I-b, I-c, I-d, I-e, I-f, I-g, and II-a are gathered in the table below.

    TABLE-US-00001 Compound IC50 (M) I-a 65 10 I-b 400 150 I-c 320 150 I-d 400 150 I-e 450 150 I-f 450 100 I-g 400 100 II-a 300 50

    [0281] These results demonstrate that compounds of formula I and II inhibit the interaction between the HIV-1 integrase (IN) and the catalytic domain of the human mitochondrial lysyl-tRNA synthetase (mLysRS).

    [0282] It was also demonstrated that compounds of formula I and II inhibit the mLysRS:Pol interaction with IC50 values comparable with those obtained for the mLysRS:IN interaction. Consequently, the inhibition of the mLysRS:IN interaction is sufficient to prevent the mLysRS:Pol association.

    Example 2

    In-Cellulo Tests

    [0283] Compounds of formula I-a, I-b and II-a were tested for their ability to inhibit the HIV-1 replicative cycle ex vivo following the method described above.

    [0284] The results regarding the HIV-1 replication at day 5 are presented in FIGS. 1 and 2.

    [0285] At a concentration of 10 M for compound II-a and of 33 M for compounds I-a and I-b, the production of viral particles is greatly reduced. At the same time, no cellular toxicity has been observed up to 10 M of compound of formula I-a, I-b or II-a.

    [0286] These results demonstrate the anti-viral activity of the compounds of formula I and II.