Novel compositions for neutralizing toxic effects of hydrogen peroxide in living cells or tissues

Abstract

The present invention relates to the field of food industry as well as to medicine, more particularly to novel compositions comprising hydrogen peroxide (H.sub.2O.sub.2) in combination with glycolic acid, glyoxylic acid, glycine, serine or salts thereof that allow using H.sub.2O.sub.2 as antimicrobial, especially antibacterial and antiviral or signaling agent yet neutralizing the toxic effects of the latter on the cell and tissues. The present invention also relates to a food product, an alcoholic/non-alcoholic beverage, or a nutritional supplement comprising the inventive composition and a method for production thereof.

Claims

1. A composition for neutralizing toxic effects of hydrogen peroxide in living cells or tissues, comprising at least two components, a component 1 and a component 2, wherein the component 1 is selected from the group consisting of glycolic acid, glyoxylic acid, glycine, serine or salts thereof and the component 2 is hydrogen peroxide.

2. The composition according to claim 1, wherein the component 1 is selected from the group consisting of glycolic acid, glyoxylic acid, glycine, serine or salts thereof in a concentration range from 0.1 mM to 20 mM, and the component 2 is hydrogen peroxide in a concentration range from 10 ppm to 150 mM.

3. The composition according to claim 1, wherein the glycolic acid, glyoxylic acid, or a salt thereof is presented in a concentration range between 5 mM and 20 mM, and the component 2 is presented in a concentration range from 0.1 mM to 150 mM.

4. The composition according to claim 1, wherein the glycolic acid, glyoxylic acid, or a salt thereof is presented in a concentration range between 9 mM and 11 mM.

5. The composition according to claim 1, wherein the concentration of glycolic acid, glyoxylic acid, or a salt thereof is 10 mM.

6. The composition according to claim 1, wherein glycine is presented in a concentration range between 0.1 mM and 2 mM, and the component 2 is presented in a concentration range from 0.1 mM to 150 mM.

7. The composition according to claim 1, wherein serine is presented in a concentration range between 0.5 mM and 2.0 mM, and the component 2 is presented in a concentration range from 0.1 mM to 150 mM.

8. The composition according to claim 1, further comprising a component 3, the component 3 is selected from the group consisting of rupintrivir, 2-(3,4-dichloro-phenoxy)-5-nitrobenzonitrile, benzothiophenes and ((biphenyloxy)propyl) isoxazoles.

9. The composition according to claim 8, wherein the component 3 is rupintrivir.

10. The composition according to claim 8, wherein the component 3 is contained in the composition in a concentration range from 0.1 mM to 5 mM.

11. The composition according to claim 8, wherein a molar ratio of hydrogen peroxide and the component 3 is in in a range from 1:1 to 1000:1.

12. The composition according to any one of the claims 1 to 11 in a form of a drink solution or a capsule.

13. (canceled)

14. (canceled)

15. (canceled)

16. (canceled)

17. (canceled)

18. (canceled)

19. (canceled)

20. A method of preparing a food product comprising at least two components, a component 1 and a component 2, wherein the component 1 is selected from the group consisting of gycolic acid, glyoxlic acid, glycine, serine or salts thereof and the component 2 is hydrogen peroxide, said method comprising the steps of: Providing pasteurized milk and mix of bacterial starters for making Joghurt, Matsoni, Dahi, Bathora that comprise Individual bacterial cultures comprising the following bacterial strains: Lactobacillus coryniformis, Lactobacillus delbrueckii, Lactobacillus rhamnosus, Lactococcuslactis, and Streptococcus thermophiles; mixing the predetermined amount of said starter or bacterial culture with the milk and fermenting the mixture under aerobic conditions by contacting the milk with air; measuring the hydrogen peroxide concentration in the surface layer after forming the texture of the fermentation product with the thickness of up to substantially 2 cm; removing the surface layer upon achieving the hydrogen peroxide concentration within the range of from 30 ppm to 50 ppm and refrigerating the surface layer so as to reduce the fermentation process therein; further fermenting the mass remaining after the step of removing the surface layer by repeating the preceding steps until the last surface layer has been fermented; combining all layers containing the hydrogen peroxide; adding the component 1 before or after the step of fermentation.

21. (canceled)

22. (canceled)

23. (canceled)

24. (canceled)

25. (canceled)

26. (canceled)

27. A kit for neutralizing toxic effects of hydrogen peroxide in living cells or tissues, comprising at least two components, a component 1 and a component 2, wherein the component 1 is selected from the group consisting of glycolic acid, glyoxylic acid, glycine, serine or salts thereof, and component 2 is hydrogen peroxide.

28. The kit according to claim 27, wherein the component 1 is selected from the group consisting of glycolic acid, glyoxylic acid, glycine, serine or salts thereof in a concentration range from 0.1 mM to 20 mM, and component 2 is hydrogen peroxide in a concentration range from 10 ppm to 150 mM.

29. The kit according to claim 27, further comprising a component 3, the component 3 being selected from the group consisting of rupintrivir, 2-(3,4-dichloro-phenoxy)-5-nitrobenzonitrile, benzothiophenes and ((biphenyloxy)propyl) isoxazoles.

30. The kit according to claim 29, wherein the component 3 is rupintrivir.

31. The kit according to claim 29, wherein the component 3 is contained in the composition in a concentration range from 0.1 mM to 5 mM.

32. (canceled)

33. The kit for use according to claim 32, for application to a subject in need of prophylaxis or treatment of bacterial and viral diseases through oral, nasal, auricle, topical or rectal rout.

34. The kit for use according to claim 32, wherein the component 1 and component 2 are administered to a subject in need of prophylaxis or treatment of bacterial and viral diseases in sequence, the time period between administering the component 1 and the component 2 being 30 minutes at most.

Description

DESCRIPTION OF FIGURES

[0138] FIG. 1. Glycolate supplementation maintains mitochondrial function and improves animal physiology of peroxide treated C. elegans worms. A) Mitochondrial membrane potential (m-MMP) was measured in the different strains after 3 days of treatment via MitoTracker Red CMXROS staining and recording the fluorescence intensities. B) Respiration rates in terms of oxygen consumption rate (OCR) determined after 4 days of treatment using a Seahorse Analyzer and normalized to number of worms. C) Size of worms after 4 days of treatment, where the lengths in m of at least 20 animals were averaged per condition in each experiment. In D, E and F, life span analysis without FUdR, brood size and embryonic lethality, respectively, is shown for worms that had been exposed to H.sub.2O.sub.2 and 10 mM GA, as indicated, during larval development. G) H.sub.2O.sub.2 levels in worms exposed to different conditions for 3 days. Then H.sub.2O.sub.2 accumulation was measured with AmplexRed and fluorescence intensity was normalized to protein levels. 100 mM H.sub.2O.sub.2, 10 mMglycolate (GA) and 0.5 mM BSO were used as indicated. Error bars represent standard error of the mean (n=3).

[0139] FIG. 2. Glycolate addition prevents the drop in the antioxidant capacity of glutathione caused by peroxide. A) Total glutathione (GSH+GSSG), B) GSSG and C) Ratio of GSH to GSSG levels in animals exposed to 100 mM H.sub.2O.sub.2 and supplemented or not with 10 mMglycolate (GA) and 0.5 mM L-buthioninesulfoximine (BSO). Values were determined after 3 days of treatment and normalized to number of worms. Error bars represent standard error of the mean (n=3). BSO was used as a substance that opposes the effect of glycolic acid and/or glycine. In the presence of BSO, as evident from FIG. 2, the biosynthesis of glutathione was inhibited so that glycolateor glycine cannot neutralize the toxic effect of hydrogen peroxide. Thus, adding BSO to glycolate or glycine will abolish the positive effect of glycolate and glycine and will lead to an increase of the oxidative stress.

[0140] FIG. 3. Metabolic pathway of glycolate in C. elegans. In red, genes used in this work. In bold, enzymes catalyzing each reaction. Dashed arrows indicate more than one enzymatic step. This diagram was constructed according to glyoxylate and dicarboxylate metabolism (cel00630), glycine, serine and threonine metabolism (cel00260) and one-carbon pool by folate (cel00670) from the KEGG pathway database and the metabolic network of glycolate, glycine and serine in WormFlux. GOX-1, glycolate oxidase 1; LDH-1, lactate dehydrogenase 1; GHPR-1, glyoxylate reductase/hydroxypyruvate reductase 1; AGTX, alanine-glyoxylate transaminase; Ala, L-alanine; Pyr, pyruvate; GCS, glycine cleavage system; MEL-32, serine hydroxymethyl transferase; MTHFD, methylene tetrahydrofolate reductase; GR, Glutathione reductase; 5,10-CH.sub.2THF, 5,10-methylen tetrahydrofolate; 10-forTHF, 10-formyl tetrahydrofolate; THF, tetrahydrofolate.

[0141] FIG. 4. Glycine and L-serine supplementation rescue mitochondrial function and developmental rate of glycolate-oxidation-deficient worms. Mitochondrial membrane potential (A), respiration rates (B) and size (C) of wild type (N2) or mutant strains (ghpr-1 and ghpr-1, gox-1, Idh-1) exposed to 100 mM H.sub.2O.sub.2 and supplemented, with 10 mMglycolate, 100 M glycine or 500 M L-serine, as indicated. Measurements were carried out as described in FIG. 2. Error bars represent standard error of the mean (n=3).

[0142] FIG. 5. Glycine and L-serine but not glycolate can ameliorate the antioxidant capacity of C. elegans mutants unable to metabolize glycolate to glyoxylate. A) Total glutathione (GSH+GSSG) levels, B) GSSG levels and C) ratio of GSH to GSSG in wild type (N2), single (ghpr-1) and triple (ghpr-1, Idh-1, gox-1) mutant animals exposed to 100 mM H.sub.2O.sub.2 and supplemented or not with 10 mMglycolate (GA), 100 M glycine or 500 M L-serine. Values were determined after 3 days of treatment and normalized to number of worms. Error bars represent standard error of the mean (n=3).

[0143] FIG. 6. SHMT and GCS activities are essential for the restoration of mitochondrial function and antioxidant capacity mediated by glycine, L-serine and glycolate upon peroxide treatment. Mitochondrial membrane potential (A), respiration rates (B), size (C), and GSH/GSSG ratios (D) of wild type animals (N2) fed with empty vector (EV) or RNAi bacteria against mel-32 or gcst-1 genes exposed to 100 mM H.sub.2O.sub.2 and supplemented or not with 10 mMglycolate (GA), 100 M glycine or 500 M L-serine. Measurements were carried out as described in FIGS. 2 and 3. Error bars represent standard error of the mean (n=3).

[0144] FIG. 7. Glycolate supplementation, via serine-glycine metabolism, increases the ratio of NADPH to NADP.sup.+ of peroxide-treated worms. Ratio of NADPH to NADP.sup.+ quantified by LC-MS and normalized to protein levels in samples of in N2 worms treated as follows. A) Animals were exposed to peroxide together with glycolate, glycine or L-serine, as indicated, for 3 days. B) Worms fed with empty vector (EV) or RNAi bacteria against SHMT (mel-32) genes were incubated with H.sub.2O.sub.2 alone or together with glycolate for 3 days. Error bars represent standard error of the mean (n=4). 100 mM H.sub.2O.sub.2, 10 mMglycolate, 100 M glycine and 500 M L-serine.

[0145] FIG. 8. Scheme of the proposed pathway for the glycolate-mediated antioxidant activity. Upon exposure to a strong oxidant (e.g. Paraquat), superoxide (O.sub.2.sup.) is produced that in turn can generate H.sub.2O.sub.2 (see text). Both ROS molecules disturb the mitochondrial activity (oxygen consumption rate and mitochondrial membrane potential, ) and animal growth rate. Exogenously added glycolate (GA) is converted into glycine and serine. This triggers the NADPH/NADP.sup.+ ratio that together with the generation of the building blocks for GSH synthesis, glycine and L-cysteine (the latter produced form L-serine), increase the GSH/GSSG ratio. The boosted GSH levels counteract the deleterious effects of H.sub.2O.sub.2 on mitochondrial function and growth but not those of superoxide itself.

[0146] FIG. 9. Influence of a Composition comprising GA and hydrogen peroxide on growth of mice. 4 groups of experimental animals of strain C57Bl_6NCtr, consisting of 11 males in each were established. Ptreated with 0.25% hydrogen peroxide in drinking water; Gtreated with 0.01M GA in drinking water; PGtreated with a composition of 0.25% hydrogen peroxide and 0.01M GA in drinking water; Wplain drinking water. Experiment were started when animals were 6 weeks old and continued until reaching 16.sup.th week of age. Mice were weighted once a week.

[0147] FIG. 10. Antimicrobial effect of a composition comprising 0.5% glycine and 0.3% hydrogen peroxide. Figure shows percentage of bacterial colonies that survive after processing of bacterial culture with the composition after 5, 10 and 15 minutes (black bars). As seen more than 99% of bacterial colonies are eliminated within 15 minutes. The composition comprising glycine is as active as the 0.3% solution of hydrogen peroxide alone (white bars).

EXAMPLES

[0148] The present invention is explained in more detail in the following by referring to examples, which are not to be constructed as limitative. In the following description,

Example 1

Materials and Methods

Chemicals

[0149] Sodium glycolate (G0111, TCI), sodium D-lactate (71716, Sigma), glycine (G7126, Sigma), L-serine (S4500, Sigma), L-glutathione reduced (G4252, Sigma), L-buthioninesulfoximine (B2525, Sigma), hydrogen peroxide (H1009, Sigma), paraquat (sc-257968, SantaCruz biotechnologies or 36541 Fluka from Sigma-Aldrich), IPTG (15529019, ThermoFisher) were used. [1-.sup.14C]-glycolate, [1-.sup.14C]-glycine and L-[1-.sup.14C]-serine were purchased from HARTMANN ANALYTIC (Braunschweig, Germany).

[0150] Worm Strains and Culture Conditions

[0151] C. elegans wild-type (N2) strain was received from Caenorhabditis Genetics Center, USA. Mutant strains were generated using the following primers. Idh-1: AATCAACAATTTTCATGTCT and TAAAAATCGCGCGCATTTGA; C31C9.2 (ghpr-1): TCTCGTATAAACAGAAAATATGG and GGGGCGCTCATTCTGGAAATTGGand F41E6.5 (gox-1): GAAGTTGCGTATGTCCTTCTandATAATTGTTTCGAATCATGG. The injection protocol consisted of a master mix of 15 l (5 M of each of the primers, Cas9-Protein NLS [12.5 M], tracrRNA-IDT [12.5 M], dpy10 Oligo-IDT [733 nM], dpy-10-sgRNA-IDT [2.5 M] and Protein Buffer-stock [2-3]) that was injected into young adults of N2 strain. Progeny of the rescued strains were genotyped for homozygous deletion with PCR primers for three generations. All mutants were outcrossed at least twice with the wild type to eliminate background mutations. Double and triple mutants were obtained by crossing single or double mutants and selecting the homozygous progeny by PCR.

[0152] Worms were maintained at 20 C. on nematode growth medium (NGM) agar plates seeded with Escherichia coli NA221.sup.1. Gravid adults on NGM agar plates were treated with alkaline hypochlorite solution (i.e., bleached) to purify eggs. On the day prior to setting up the experiment, eggs obtained after bleaching were allowed to hatch overnight in M9 buffer to obtain synchronized L1 population.

[0153] For RNAi experiments in liquid, E. coli HT115 containing L4440 empty vector or the indicated cDNA fragment in L4440 was inoculated in 100 ml of LB containing 100 g/ml ampicillin and incubated overnight at 37 C. in a shaking incubator at 250 rpm. To induce the production of dsRNA, a final concentration 0.8 mM IPTG was added to the collected bacterial pellet diluted 100-fold and incubated overnight at 25 C. in a shaking incubator at 250 rpm. Bacteria were then pelleted by centrifugation at 4000 rpm for 5 mins and resuspended in 200 l S-medium containing 100 g/ml ampicillin and 0.8 mM IPTG.

[0154] Peroxide Treatment

[0155] A population of synchronized L1 larvae was added to 30-ml glass tubes containing 2.5 ml of S-complete medium (liquid culture).sup.2 and NA22 or induced RNAi bacteria at an OD.sub.600 of 1.9. 100 mM H.sub.2O.sub.2, 8 mM GA, 100 mM L-glycine, 500 mM L-serine and 1 mM BSO were added as indicated. Worms were incubated at 15 C. and 150 rpm in a shaking incubator for 2-6 days, refreshing the medium every 2 days.

[0156] Mitochondrial Staining and Microscopy

[0157] Mitochondrial staining was performed as described previously.sup.3,4. Briefly, L1 worms were grown on plate or in liquid culture for 2-3 days at 15 C. Subsequently, they were pelleted in a 15-ml tube, rinsed twice with H.sub.2O and resuspended in 100 l of M9. 5 M MitoTracker Red CMXRos (Thermo Fisher Scientific, Germany) in DMSO was added to the worm suspension and incubated in this solution for 1.5 hr at room temperature in the dark. Next, the excess dye was washed off with M9 buffer and worms were incubated in 100 l M9 for 30 min to eliminate the excess dye in the gut. Finally, worms were paralyzed with 0.5 mM Levamizol (Sigma-Aldrich), placed on slides covered with a thin layer of 2% agarose on top of which the coverslip (2222 mm, Menzel-Glaser no. 1) was fixed using nail polish. We used a Zeiss LSM 700 inverted laser scanning confocal microscope and a Zeiss LCI Plan-Neofluar 63/1.3 ImmCorr DIC M27 objective to image mitochondria (Zeiss, Germany). MitoTracker Red CMXRos was excited at 555 nm and the emission above 560 nm was acquired by the second PMT. Optical sections at 0.10.10.5 m.sup.3 x-y-z resolution were collected in a 4D hyperstack. Final images were adjusted for intensity and merged in Fiji. No non-linear adjustments were made.

[0158] H.sub.2O.sub.2 Measurements.

[0159] Hydrogen peroxide was measured using the Amplex Red hydrogen peroxide/peroxidase assay kit (Molecular Probes, Eugene, OR), adapting the protocol to C. elegans. In the presence of hydrogen peroxide, Amplex Red is oxidized by horseradish peroxidase to form a red-fluorescent oxidation product whose fluorescence intensity can be measured.

[0160] To measure ROS production from C. elegans, 5000-7000 L1 worms were exposed to each condition for 2-3 days as indicated and then washed four times in 1 ml of the reaction buffer supplied with the kit. Volumes were adjusted to 700-1200 nematodes/50 l and 50 l was pipetted into a 96-well plate. A total of 50 l of the Amplex Red reaction buffer was then added to the wells, and after 1 hr fluorescence was measured with a fluorescence microplate reader using excitation at 53012.5 nm and fluorescence detection at 59017.5 nm. Background fluorescence, determined for a no-H.sub.2O.sub.2 control reaction, was subtracted from each value. The significance of differences between conditions was determined by an unpaired fest. GraphPadPrism 8.0 was used for these calculations. Three biological replicates were carried out for each condition.

[0161] Growth Rate Experiments

[0162] Synchronized L1 worms were incubated at 15 C. on plates or in liquid culture and exposed to different conditions as indicated. Single worms were selected randomly from the plates or aliquots were taken from the liquid cultures and added to NGM plates for immediate visualization. 25 worms per treatment were measured at 24-48 hr intervals and all growth curves were done four times. Images were analyzed using FIJI (Image J) software, with length measurements derived by the sum-total of a number of segmented lines of known length, down the center of the worm as described previously.sup.5.

[0163] Lifespan, Progeny Number and Embryonic Lethality Determination

[0164] Lifespan experiments were performed at 20 C. without fluorouracil, as described elsewhere (Liu, 2019). Briefly, for the treatment during larval development worms were incubated in liquid culture under different conditions from L1 until L4, and then transferred onto control NGM plates until death. During the reproductive period (days 1-8), worms were transferred to fresh plates every other day to separate them from their progeny. Survival was scored every other day throughout the lifespan and a worm was considered as dead when they did not respond to three taps. Worms that were missing, displaying internal egg hatching, losing vulva integrity, and burrowing into NGM agar were censored. Progeny number and embryonic lethality was determined the day after transferring the adult animals to fresh plates. Statistical analyses of lifespan were calculated by Log-rank (Mantel-Cox) tests on the Kaplan-Meier curves in GraphPad Prism. For progeny number and embryonic lethality, the significance of differences between conditions was determined using an unpaired t-test in GraphPadPrism 8.0. All experiments were performed in triplicate.

[0165] Oxygen Consumption Assay

[0166] Oxygen consumption of worms was measured with a Seahorse XFe96 system (Seahorse Bioscience, North Billerica, MA), as previously described.sup.4. L3 larvae of the different strains were grown on plates or in liquid culture and supplemented for 2-4 days as described for each experiment. After removing bacteria and debris, approximately 100 worms were pipetted into each well of a 96-well Seahorse XF.sup.e assay plate and OCR was measured until it stabilized. Then, 3 subsequent measurements were made at 6.5-min intervals. Finally, the exact number of worms in each well was counted and used for normalization. A small number of abnormal readings were also filtered out at this stage. On average, 7-8 wells (technical replicates) were used for each condition. Normalized OCR values were averaged for the last 3 measurements for each strain and condition. Four biological replicates were analyzed for each condition.

[0167] Quantification of Glutathione

[0168] Sample preparation was performed as described previously with some modifications.sup.6. From each condition 10,000 synchronized animals were harvested and washed 3 times with sterile water. Worms were resuspended in PBS buffer and 5-l aliquots were taken to estimate the total number of worms, after which they were vortexed and frozen immediately with liquid nitrogen. To thoroughly lyse the worms, 5 cycles of freezing and thawing were performed in a water bath at 37 C., followed by a 1-min sonication. The samples were then centrifuged and the supernatant tested for protein estimation and GSH quantification.

[0169] Total GSH, GSSG, and GSH/GSSG ratios were quantified using the GSH/GSSG-Glo assay kit (Promega) following the instructions of the manufacturer. Briefly, each sample was tested in triplicate in 96-well culture plates with total glutathione or GSSG lysis reagent, for total glutathione or GSSG measurement, respectively. The GSH probe, luciferin-NT, was converted to luciferin, which is coupled to a firefly luciferase. The plates were then read in an EnVisionLuminometer plate reader (Perkin Elmer, United States). The GSSG value was subtracted from the total glutathione to calculate GSH levels and GSH/GSSG ratio. Four biological replicates were analyzed for each condition.

[0170] NADPH and NADP.sup.+ Quantification

[0171] To measure NADP.sup.+ and NADPH from C. elegans, 10000-15000 L1 worms were exposed to each condition in duplicates for 3 days and then washed four times with H.sub.2O. After taking an aliquot for protein estimation, worms were resuspended in 100 l of H.sub.2O and 230 l of Eluent A (95% acetonitrile, 0.1 mM ammonium acetate and 0.01% NH40H) was added together with 1 l of 1 M chloropropamide as internal standard. 25 M solutions of each nucleotide were treated in parallel as standards. Homogenization for 15 min at 4 C. and 300 g was carried out in a TissueLyser II (Qiagen) after adding volume of 0.5 mm zirconium beads. The resulting mixture was centrifuged at 13,000 g and the supernatant transferred to a new tube.

[0172] LC-MS/MS analysis of the samples was performed on a high-performance liquid chromatography (HPLC) system (1200 Agilent) coupled online to G2-S QTOF (Waters). For normal phase chromatography Bridge Amide 3.5 ml (2.1100 mm) column from Waters was used. The mobile phase composed of eluent A and eluent B (40% acetonitrile, 0.1 mM ammonium acetate and 0.01% NH40H) was applied with the following gradient program: Eluent B, from 0% to 100% within 18 min; 100% from 18 min to 21 min; 0% from 21 min to 26 min. The flow rate was set at 0.3 ml/min. The spray voltage was set at 3.0 kV and the source temperature was set at 120 C. Nitrogen was used as both cone gas (50 L/h) and desolvation gas (800 L/h), and argon as the collision gas. MS.sup.E mode was used with Bridge Amide 3.5 l (2.1100 mm) column in ESI negative ionization polarity for the detection of the nucleosides. Mass chromatograms and mass spectral data were acquired and processed by MassLynx software (Waters). Three and four biological replicates were analyzed for each condition of mel-32 RNAi and EV, respectively.

[0173] Quantitative Real-Time PCR.

[0174] The differential expression of F41E6.5 (gox-1), C31C9.2 (ghpr-1), gcst-1, mel-32 and gcs-1 genes was measured using qRT-PCR. 5000 L1 N2 worms were exposed to each condition for 3 days at 15 Cas described above and then washed three times with H.sub.2O. Total RNA was isolated using the RNeasy Mini Kit (Qiagen) and equal amounts of all samples were reverse transcribed with SuperScript Ill (Invitrogen) using oligo(dT) 12-18 primers. cDNA quality was tested using standard PCR. qRT-PCR was performed using pre-designed TaqMan Gene Expression Assay (ThermoFischer Scientific) with at least three samples in triplicates. For the relative quantification of gene expression levels, the 2.sup.CT method and results were normalized to the expression level of the cdc-42 gene. Expression levels were averaged over technical and biological replicates,

[0175] Radioactive Labelling.

[0176] To quantify the uptake of glycolate, glycine and L-serine approximately 10000 synchronized L1 were incubated in liquid cultures as described above and grown for 3 days in the presence of 10 Ci of [1-.sup.14C]-glycolate, [1-.sup.14C]-glycine or L-[1-.sup.14C]-serine. At this stage, worms were snap-frozen and stored at 80 C. Animals were lysed by freezing/thawing and extracted by using the Bligh and Dyer method.sup.7. After phase separation, organic and aqueous fractions were recovered from the lower and upper phases, respectively. After drying and concentration, radioactivity was quantified using a scintillation counter and normalized for total number of worms.

[0177] Statistical Information

[0178] The number of biological replicates is stated above for each method. Results shown as means; error bars represent the standard error of the mean. The unpaired Student's t-test was used to determine statistical significance of differences between means (P<0.05 [*], P<0.01 [**], P<0.005 [***]) unless otherwise stated.

Example 2: Glycolate Neutralizes the Toxic Effects of H.SUB.2.O.SUB.2 .on an Organism

[0179] Glycolate Counteracts the Deleterious Effects of H.sub.2O.sub.2 on Mitochondrial Function, Animal Reproductive Capacity and Lifespan

[0180] When larvae of the nematode C. elegans were treated with peroxide, there was a drop in MMP, but coincubation with GA prevented this effect (FIG. 1A). H.sub.2O.sub.2 also induced a decline in the respiration rate and a concomitant growth delay (FIGS. 1B and 1C). Remarkably, GA was able to restore both traits (FIGS. 2B and 2C). BSO treatment prevented the GA-mediated improvement in MMP, OCR and growth rate, thus strongly indicating that glutathione synthesis is fundamental for the observed oxidative stress relief mediated by GA (FIGS. 1A, 1B and 1C).

[0181] Notably, GAsupplementation also ameliorated the shortened lifespan and reduced reproductive capacity caused by H.sub.2O.sub.2. Animals exposed to H.sub.2O.sub.2 during larval stages and transferred to control plates as young adults showed a significantly reduced lifespan (Control worms: 18.5+/1.19 days; H.sub.2O.sub.2 worms: 5.88+/1.47 days [p=0.0006]). Addition of GA significantly increased lifespan (14.13+/0.51 days [p=0.015]) making it comparable to that of untreated worms (FIG. 1D). A similar positive effect was observed when analyzing brood size and embryonic lethality in animals that had been treated only with H.sub.2O.sub.2 or in combination with GA (FIG. 1E and F, respectively).

[0182] Glycolate Supplementation Prevents the Drop in GSH/GSSG Ratio Caused by H.sub.2O.sub.2 Exposure

[0183] Glutathione is a tripeptide composed of glycine, cysteine and glutamate that coexists in two interconvertible forms: a reduced one, GSH, and an oxidized glutathione disulfide (GSSG), which is produced upon interaction with oxidative molecules. To test if GSH and GSSG concentrations are affected when treating C. elegans larvae with H.sub.2O.sub.2 and GA, glutathione levels upon exposure to peroxide were quantified (FIG. 2). It was observed that H.sub.2O.sub.2 treatment caused a significant decrease in total glutathione compared to non-treated animals, but this parameter was partially restored in the presence of GA (51% [p=0.0457] and 91% [p=0.1231] of the control, respectively). The effect of GA was again lost, however, if the inhibitor BSO was included in the medium (65% of the control [p=0.0051]) (FIG. 2A). More notable was the dramatic increase in the oxidized form of glutathione caused by H.sub.2O.sub.2, an effect that was also prevented by addition of GA (513% [p=0.0253] and 140% [p=0.0778] of the control, respectively) (FIG. 2B).

[0184] One of the most common markers of oxidative stress and the extent of damage caused by it is the ratio of the reduced to the oxidized form of glutathione (GSH/GSSG).sup.8. Remarkably, it was obtained a 10-fold reduction in this parameter in worms incubated with peroxide alone but only a 28% decrease if GA was included in the medium (GSH/GSSH per worm=107.5 in control; 11.3 in H.sub.2O.sub.2 [p=0.0078] and 77.4 in H.sub.2O.sub.2+GA [p=0.103]). The effect of the latter was partially prevented by inhibition of glutathione synthesis with BSO (GSH/GSSG per worm=36 [p=0.012]) (FIG. 2C), in agreement with previously reported alterations of redox homeostasis caused by this inhibitor. These results clearly demonstrate that GA exerts its action by modulating a major antioxidant defense parameter, namely the ratio of GSH to GSSG. Moreover, the accumulation of H.sub.2O.sub.2 was diminished in animals co-supplemented with peroxide and GA in comparison to those treated with peroxide alone, but unchanged if glutathione synthesis was blocked by BSO (FIG. 1G).

[0185] Oxidation of Glycolate is a Prerequisite for its Activity

[0186] How treatment with GA can lead to an increase in GSH/GSSG ratio? Therefore, the underlying metabolic pathways that could link alterations in glutathione levels to GA itself or some of its downstream metabolites were explored. Metabolization of GA in animals has been reported to occur mainly via its oxidation to glyoxylate (FIG. 3).sup.9-11, which can subsequently be transaminated to form glycine. In turn, glycine can undergo many transformations, among them, entering one-carbon metabolism (by donating a methyl group to tetrahydrofolate, THF) and the production of cysteine via conversion to serine (FIG. 3, KEGG pathway database).

[0187] To test whether glycolate needs to be metabolized to exert its antioxidant activity, it was sought to obtain a mutant unable to catalyze the oxidation of glycolate to glyoxylate. In C. elegans, there are three enzymes that can be potentially responsible for this reaction (FIG. 3). The corresponding genes are: F41E6.5 (gox-1), encoding the ortholog of the human glycolate oxidase (HAO-1); Idh-1 (encoding the lactate dehydrogenase), which has been found to have glyoxylate reductase activity.sup.12,13; and C31C9.2. The latter is predicted to encode the phosphoglycerate dehydrogenase involved in the biosynthesis of serine, but its sequence displays the highest homology to the human glyoxylate reductase/hydroxypyruvate reductase, reported to catalyze the interconversion of glyoxylate and glycolate.sup.14-17 (FIG. 3). From here, this gene will be designated as ghpr-1 (Glyoxylate/HydroxypyruvateReductase-1). Single mutants of gox-1 and Idl-1, or their double mutants showed no reduction in the effect of glycolate on MMP, OCR or growth. The deletion mutant of ghpr-1, however, displayed a significantly reduced effect of glycolate on MMP, oxygen consumption rate and developmental rate upon H.sub.2O.sub.2 treatment (FIG. 4A-4C). Remarkably, the glycolate-mediated protection was totally abolished in the ghpr-1; gox-1; Idh-1 triple mutant strain, demonstrating the overlapping activities of these three enzymes (FIG. 4A-4C).

[0188] To test whether the reduction or absence of positive effects of GA on these mutants is due to deficient ROS-scavenging abilities, relative glutathione levels were quantified. Interestingly, both ghpr-1 and ghpr-1; gox-1; Idh-1 strains exhibited decreased levels of total glutathione compared to untreated N2 worms, a situation that was worsened by peroxide treatment but, in contrast to wild-type animals, unaffected by the addition of GA (FIG. 5A). Additionally, the significant increase in the oxidized form of the antioxidant, GSSG, observed in animals treated with peroxide, was not rescued by co-incubating the mutants with GA (FIG. 5B). A similar lack of response to GA was observed when analyzing the ratio of GSH to GSSG (FIG. 5C). These results clearly demonstrate that oxidation of GA is catalyzed mostly by GHPR-1 but also by GOX-1 and LDL-1 and suggest that further metabolization of this compound is crucial for its protective role on mitochondrial function and growth upon oxidative damage.

[0189] Relief of Oxidative Stress Requires Entry of Glycolate into Serine-Glycine Metabolism

[0190] According to the scheme in FIG. 3, glycolate can be converted into glycine and L-serine via the serine-glycine metabolic pathway. Can these amino acids also have a positive influence on C. elegans larvae exposed to peroxide? Indeed, both glycine and L-serine were able to restore MMP, respiration, growth and GSH/GSSG ratio to control levels when added to H.sub.2O.sub.2-treated worms (FIGS. 4 and 5). Moreover, both glycine and L-serine supplementation could overcome the deleterious effects of peroxide on strains deficient in the oxidation of glycolate (single ghpr-1 and ghpr-1; gox-1; Idh-1 triple mutants). Thus, these compounds are downstream effectors in the metabolic pathway of GA, as depicted in FIG. 3.

[0191] The next step was to understand the molecular mechanisms underlying the action of these two amino acids. Glycine is a component of the tripeptide glutathione, but it can also be converted into L-serine, which is a precursor of L-cysteine, another building block of GSH. However, more important perhaps is the conversion of glycine to L-serine that feeds one-carbon metabolism with THF as a key player (FIG. 3). Transformation of glycine into L-serine requires two enzymatic activities: one catalyzed by serine hydroxymethyltransferase (SHMT, encoded by mel-32) and the other by the glycine cleavage system (GCS, composed of the subunits T, P, L and H) (FIG. 3).sup.18-20. Through the action of GCS, glycine can provide a methyl group for the production of 5,10-methylene-H.sub.4 folate (5,10-CH.sub.2-THF), which together with another unit of glycine is a substrate of SHMT for the synthesis of L-serine (FIG. 3). The action of GA, glycine and serine on worms upon knock down of the SHMT and the GCS activities by RNAi against mel-32 or gcst-1 (encoding SHMT and subunit T of the GCS in C. elegans, respectively) was tested (FIG. 3). Remarkably, none of these three compounds were able to restore either MMP, OCR or growth rate, in contrast to the restored parameters exhibited in worms fed with empty vector RNAi bacteria (FIG. 6A-6C). Moreover, the GSH-to-GSSG ratio that was maintained close to control levels when worms fed with empty vector were grown in the presence of GA, glycine or serine (FIG. 6D), was strongly reduced in animals defective in either mel-32 or gcst-1 independently of their supplementation with any of these three metabolites (FIG. 6D). In addition, animals defective in glycolate oxidation (ghpr-1 and the ghpr-1, Idh1, gox-1 mutants) exhibited a loss of response to glycine and L-serine when fed with mel-32 RNAi bacteria. With this, it is demonstrated that functional SHMT and GCS activities are essential for the observed GA-, glycine- and serine-mediated protection against oxidative damage. Supporting this conclusion, life-span extension caused by GA supplementation of worms treated with peroxide was lost in mel-32-knockdown animals.

[0192] Note, GA supplementation in the absence of H.sub.2O.sub.2 does not have a significant impact on any of the parameters analyzed (FIGS. 1 and 2). This suggests that treatment with H.sub.2O.sub.2 could induce the expression of one or more of the proteins involved in the GA-metabolizing pathway (FIG. 3). In fact, it has long been established the role of H.sub.2O.sub.2 as inducer of the transcription factor Nrf-2 and its C. elegans ortholog Skn-1 that upregulate a plethora of phase II detoxification genes.sup.21-25. One of the best known examples of genes induced by this transcription factor is gcs-1 encoding Glutamate Cysteine Ligase, the first enzyme in the biosynthesis of glutathione.sup.8,27,28. Therefore, the relative expression levels of 5 different genes by RT-PCR upon peroxide or glycolate supplementation, including gcs-1 were analyzed. Remarkably, four of the tested genes (gox-1, ghpr-1, mel-32 and gcs-1) exhibited a significant induction when worms were exposed to different peroxide concentrations. The only exception was gcst-1, the expression of which was not significantly altered by the treatments. Unexpectedly, GA also moderately induced expression of these genes. This demonstrates that both compounds contribute to the regulation of the GA-mediated antioxidant pathway. Although, their specific roles could differ.

[0193] Glycolate Supplementation Restores the NADPH/NADP.sup.+ Ratio Impaired by Peroxide Treatment

[0194] Considering that both SHMT and GCS can produce 5,10-CH.sub.2-THF, which is required for the regeneration of NADPH from NADP.sup.+ (FIG. 3), the most plausible explanation for the increase in GSH/GSSG ratio caused by GA is the alteration of NADPH levels. NADPH is the major regulator of cellular redox potential and is crucial for the action of different antioxidant systems, including the maintenance of reduced glutathione pools.sup.8,24,27 (FIG. 3). A series of recent publications has demonstrated that, in proliferating cells, the pentose phosphate pathway and the previously underestimated THF metabolism have nearly comparable contributions to the regeneration of NADPH from NADP.sup.+29-32 (FIG. 3). Thus, GA and consequently glycine could increase NADPH by entering serine-glycine metabolism.

[0195] When subjected to H.sub.2O.sub.2 treatment, C. elegans larvae showed a significantly decreased ratio of NADPH to NADP.sup.+ (FIG. 7). However, when animals were supplemented with either GA or glycine in the presence of H.sub.2O.sub.2, the proportion of the reduced to the oxidized nucleotides was fully rescued (FIG. 7A), in agreement with the restoration of GSH/GSSG under the same conditions (FIG. 2C). L-serine supplementation, on the other hand, provoked a much weaker, but still significant, increase in the proportion of NADPH to NADP.sup.+ (FIG. 7A). This observation cannot be explained by a reduced uptake of L-serine by the worms compared to that of GA or glycine since radioactivity measured in animals labelled with [.sup.14C]L-serine was actually 3 times higher than in those labelled with [.sup.14C]GA. Instead, the modest effect of L-serine on NADPH levels could be due to the fact that in C. elegans, SHMT is prone to synthesize serine from glycine.sup.18. Nevertheless, excessive amounts of exogenously added L-serine most probably cause the shift of equilibrium towards glycine and thus generate the improved reducing capacity of the worms. In addition, the conversion of L-serine to L-cysteine (FIG. 3) could also have a positive impact on GSH levels without affecting the relative amounts of NADP.sup.+ and NADPH.

[0196] Consistent with the emerging contribution of one-carbon metabolism to the regeneration of NADPH, knocking down of the C. elegans SHMT enzyme, MEL-32, caused a reversal of the NADPH/NADP.sup.+ ratio compared with worms fed with empty vector (FIG. 7B). Exposure of these mel-32 knocked down worms to H.sub.2O.sub.2 produced a further decline in the proportion of the reduced to the oxidized nucleotides, which was not significantly affected by co-supplementation with GA. This correlates again with the ineffectiveness of GA addition on GSH/GSSG ratio in worms fed with mel-32 RNAi (FIGS. 6D and 7B). With this one can conclude that glycolate exerts its beneficial effects on C. elegans exposed to oxidative stress via the glycine-serine pathway that feeds one-carbon metabolism and the folate cycle, and in this way, improves the redox state of the animals (FIG. 8).

Example 3: Influence of a Composition Comprising GA and Hydrogen Peroxide on Growth of Mice

[0197] The experimental treatment of wild-type mice (strain C57Bl_6NCtr) was performed as follows:

[0198] 4 groups of experimental animals were established, 11 males in each group. [0199] Group A: was treated with 0.25% hydrogen peroxide (H.sub.2O.sub.2) in drinking water [0200] Group B: was treated with 0.01M GA in drinking water [0201] Group C: was treated with a composition of 0.25% hydrogen peroxide (H.sub.2O.sub.2) and 0.01M GA in drinking water [0202] Group D: was on plain drinking water

[0203] Experiment were started when animals were 6 weeks old and continued until reaching 16.sup.th week of age. Mice were regularly weighted once a week.

[0204] As can be seen in FIG. 9, the treatment of mice with a composition of GA and hydrogen peroxide induces about 10% increase of their weight. Remarkably, H.sub.2O.sub.2 alone has also a slight positive effect.

Example 4: A Method of Preparing a Food Product Containing the Composition of the Present Invention

[0205] Pasteurized milk and mix of bacterial starters for making Joghurt, Matsoni, Dahi, Bathora that comprise Individual bacterial cultures comprising the following bacterial strains: Lactobacillus coryniformis, Lactobacillus delbrueckii, Lactobacillus rhamnosus, Lactococcuslactis, and Streptococcus thermophiles is provided. Next, the established amount known in the art of particular starter or bacterial culture is mixed with the milk and the mixture is fermented under aerobic conditions by contacting the milk with air. After forming the texture of the fermentation product with the thickness of up to substantially 2 cm, the hydrogen peroxide concentration in the surface layer is measured and upon achieving the hydrogen peroxide concentration within the range of 30 ppm to 50 ppm, the surface layer is removed and refrigerated so as to reduce the fermentation process therein. Then the mass remaining after the step of removing the surface layer is further fermented by repeating the preceding steps until the last surface layer has been fermented. Finally, all layers containing the hydrogen peroxide are combined. The component 1 is added before or after the step of fermentation.

Example 5

[0206] A method of preparing a beverage containing the composition of the present invention

[0207] Pasteurized juice and mix of bacterial starters for making Joghurt, Matsoni, Dahi, Bathora that comprise Individual bacterial cultures comprising the following bacterial strains: Lactobacillus coryniformis, Lactobacillus delbrueckii, Lactobacillus rhamnosus, Lactococcuslactis, and Streptococcus thermophiles is provided. Next, the established amount known in the art of particular starter or bacterial culture is mixed with the juice and the mixture is fermented under aerobic conditions by contacting the juice with air;

[0208] the hydrogen peroxide concentration is measured within the mass of the fermented mixture, and the component 1 is added when the hydrogen peroxide concentration reaches the amount of 30 ppm to 50 ppm.

Example 6: Anti-Viral Effect of Drug According to the Present Invention

[0209] The drug composition is tested according to the test of evaluation of the potential activity against a rhinovirus responsible for colds on fully differentiated human airway epithelial cells culture. The compositions are applied together with infectious virus and the incubation is carried out for 5 hours. 2 rinsing steps with the drug formulations are carried out. The remaining is collected and the RNA is dosed after cell lysis. The same collecting step is carried out 24 hours after and the same dosing step is carried out. The percentage expressed the changes in viral RNA, resulting in the 98% of inhibition of rhinovirus replication, leading to the anti-viral efficacy. In addition to the above described test, a kit comprising component 1 and component 2 was applied, wherein the component 2 was administered 15 minutes later than the component 1 was administered. The result in terms of inhibition of rhinovirus replication was the same as with the administration of the above mentioned drug composition.

Example 7: Antimicrobial Effect of a Composition Comprising Hydrogen Peroxide and Glycine on Staphylococcus aureus Bacterial Culture, According to the Present Invention

[0210] A composition comprising 0.5% Glycine and 0.3% Hydrogen peroxide was prepared on 0.9% sodium chloride solution. Water was sterile purified. 4.5 ml of the composition was added to the sterile test tubes containing 0.5 ml of Staphylococcus aureus bacterial culture (ATCC 25923, compatible with McFarland standard 2) with titer of around 10.sup.6.

[0211] After desired times, hydrogen peroxide was neutralized by 1 ml of sterile 2.5% sodium bisulfite solution. (Previously it was demonstrated that 2.5% sodium bisulfite solution on itself had no antimicrobial effect). After incubation for 4-5 minutes, sample from each test tube was diluted 1000 times with sterile water, and 100 ml was spread evenly on standard tryptic soy agar petri plate. Plates were incubated at 37 C. for 24 hours and bacterial colonies were counted. As a positive control (100% survival), was taken a sample, where the composition was neutralized by sodium bisulfite instantly (FIG. 10).

Example 8: Assessing Effects of Compositions Comprising GA, Glycine or Serine and Hydrogen Peroxide on Viability of Cells, According to the Present Invention

Materials

[0212] Cells: T3M4 (Fast growing pancreatic cancer cells); Media: Standard medium DMEM/10% FBS; Treatment mediumPBS/10% FBS.

Experimental Setup

[0213] Cells were grown under standard condition and were seeded in 96-well plate (5000 cells per well). Treatment was started after 12 hrs. After replacement of Standard medium with Treatment medium, cells were treated with different doses of H.sub.2O.sub.2. For cell viability assessment 10 l MTT solution (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) were added into each well. In 3-4 hours medium was be aspirated. After the plate was dried, formed formazan was solubilized with isopropanol and reads of absorbance at 570 nm and 630 nm wavelengths were taken. Measurements at Time Zero (12 hrs.), Day-1 (+24 hrs.), Day-2 (+48 hrs) and Day-3 (+72 hrs.) were recorded. All values have been normalized and cell growth curve was build. Each treatment group was measured in quadruples and the experiment was repeated for 3 times.

[0214] As first, we identified toxic dose of H.sub.2O.sub.2. After this, we have continued with 2 selected H.sub.2O.sub.2 doses and applied different concentrations of GA, glycine or serine. We also had an additional control group, containing only the latter compounds. Groups at each time points have been statistically compared.

Cyotoxicity Assessment Plate Example

[0215]

TABLE-US-00001 Day 0 Day 1 Day 2 1 2 3 4 5 6 7 8 9 10 11 12 A Control/blank Control/blank Control/blank B H.sub.2O.sub.2-dose 1 H.sub.2O.sub.2-dose 1 H.sub.2O.sub.2-dose 1 C H.sub.2O.sub.2-dose 2 H.sub.2O.sub.2-dose 2 H.sub.2O.sub.2-dose 2 D H.sub.2O.sub.2-dose 3 H.sub.2O.sub.2-dose 3 H.sub.2O.sub.2-dose 3 E H.sub.2O.sub.2-dose 3 H.sub.2O.sub.2-dose 3 H.sub.2O.sub.2-dose 3 F H.sub.2O.sub.2 H.sub.2O.sub.2 H.sub.2O.sub.2 concentration concentration concentration G H

REFERENCES

[0216] 1. Brenner, S. The genetics of Caenorhabditis elegans. Genetics 77, 71-94 (1974). 75 [0217] 2. Sulston, J. E. & Brenner, S. The DNA of Caenorhabditis elegans. Genetics 77, 95-104 (1974). [0218] 3. Toyoda, Y. et al. Products of the Parkinson's disease-related glyoxalase DJ-1, D-lactate and glycolate, support mitochondrial membrane potential and neuronal survival. Biol. Open 3, 777-784 (2014). [0219] 4. Erkut, C., Gade, V. R., Laxman, S. & Kurzchalia, T. V. The glyoxylate shunt is essential for desiccation tolerance in C. Elegans and budding yeast. Elife 5, 1-24 (2016). [0220] 5. Flavel, M. R. et al. Growth of Caenorhabditis elegans in Defined Media Is Dependent on Presence of Particulate Matter. G3 8, 567-575 (2018). [0221] 6. Caito, S. W. & Aschner, M. Quantification of glutathione in Caenorhabditis elegans. Curr. Protoc. Toxicol. 64, 6.18.1-6.18.6 (2015). [0222] 7. Bligh, E. G. and Dyer, W. J. Canadian Journal of Biochemistry and Physiology.

[0223] Can. J. Biochem. Physiol. 37, (1959). [0224] 8. Ferguson, G. D. & Bridge, W. J. The glutathione system and the related thiol network in Caenorhabditis elegans. Redox Biol. 24, 101171 (2019). [0225] 9. Baker, P. R. S., Cramer, S. D., Kennedy, M., Assimos, D. G. & Holmes, R. P. Glycolate and glyoxylate metabolism in HepG2 cells. Am. J. Physiol. Physiol. 287, C1359-C1365 (2004). [0226] 10. Holmes, R. P. & Assimos, D. G. Glyoxylate synthesis, and its modulation and influence on oxalate synthesis. J. Urol. 160, 1617-1624 (1998). [0227] 11. Salido, E., Pey, A. L., Rodriguez, R. & Lorenzo, V. Primary hyperoxalurias: Disorders of glyoxylate detoxification. Biochim. Biophys. Acta 1822, 1453-1464 (2012). [0228] 12. Sawaki, S., Hattori, N. & Yamada, K. Y. Reduction of glyoxylate by lactate dehydrogenase. J. Vitaminol. (Kyoto). 12, 210-213 (1966). [0229] 13. Mdluli, K., Booth, M. P. S., Brady, R. L. & Rumsby, G. A preliminary account of the properties of recombinant human Glyoxylate reductase (GRHPR), LDHA and LDHB with glyoxylate, and their potential roles in its metabolism. Biochim. Biophys. ActaProteins Proteomics 1753, 209-216 (2005). [0230] 14. Sallach, H. J. Formation of serine from hydroxypyruvate and L-alanine*. J. Biol. Chem. 223, 1101-1109 (1956). [0231] 15. Kim, W., Underwood, R. S., Greenwald, I. & Shaye, D. D. OrthoList 2: A New Comparative Genomic Analysis of Human and Caenorhabditis elegans Genes. Genetics 210, 445-461 (2018). [0232] 16. Greenberg, D. M. & Ichihara, A. Further studies on the pathway of serine formation from carbohydrate. J. Biol. Chem. 224, 331-340 (1957). [0233] 17. Do, S.-H., Lee, S.-Y. & Na, H.-S. The effect of repeated isoflurane exposure on serine synthesis pathway during the developmental period in Caenorhabditis elegans. Neurotoxicology 71, 132-137 (2019). [0234] 18. Liu, Y. J. et al. Glycine promotes longevity in caenorhabditiselegans in a methionine cycle-dependent fashion. PLoS Genet. 15, 1-23 (2019). [0235] 19. Wang, W. et al. Glycine metabolism in animals and humans: implications for nutrition and health. Amino Acids 45, 463-477 (2013). [0236] 20. Yilmaz, S. L. & Walhout, A. J. M. A Caenorhabditis elegans Genome-Scale Metabolic Network Model. Cell Syst. 2, 297-311 (2016). [0237] 21. Jiang, Z. Y., Lu, M. C. & You, Q. D. Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) Inhibition: An Emerging Strategy in Cancer Therapy. J. Med. Chem. 62, 3840-3856 (2019). [0238] 22. Covas, G., Marinho, H. S., Cyrne, L. & Antunes, F. Activation of Nrf2 by H2O2: De novo synthesis versus nuclear translocation. Methods Enzymol. 528, 157-171 (2013). [0239] 23. Naji, A. et al. The activation of the oxidative stress response transcription factor SKN-1 in Caenorhabditis elegans by mitis group streptococci. PLoS One 13, 1-19 (2018). [0240] 24. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y. & Isik, M. SKN1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radic. Biol.

[0241] Med. 88, 290-301 (2015). [0242] 25. Ristow, M. & Schmeisser, K. Mitohormesis: Promoting health and lifespan by increased levels of reactive oxygen species (ROS). Dose-Response 12, 288-341 (2014). [0243] 26. Bruns, D. R. et al. Nrf2 Signaling and the Slowed Aging Phenotype: Evidence from Long-Lived Models. Oxid. Med. Cell. Longev. 2015, (2015). [0244] 27. Townsend, D. M., Tew, K. D. & Tapiero, H. The importance of glutathione in human disease. Biomed Pharmacother. 57, 145-155 (2003). [0245] 28. Corpas, F. J. & Barroso, J. B. NADPH-generating dehydrogenases: their role in the mechanism of protection against nitro-oxidative stress induced by adverse environmental conditions. Front. Environ. Sci. 2, 1-5 (2014). [0246] 29. Maddocks, O. D. K., Labuschagne, C. F. & Vousden, K. H. Localization of NADPH Production: A Wheel within a Wheel. Mol. Cell 55, 158-160 (2014). [0247] 30. Lewis, C. A. et al. Tracing compartmentalized NADPH metabolism in the cytosol and mitochondria of mammalian cells. Mol. Cell 55, 253-263 (2014). [0248] 31. Fan, J. et al. Quantitative flux analysisreveals folate-dependent NADPH production. Nature 510, 298-310 (2014). [0249] 32. Labuschagne, C. F., van den Broek, N. J. F., Mackay, G. M., Vousden, K. H. & Maddocks, O. D. K. Serine, but not glycine, supports one-carbon metabolism and proliferation of cancer cells. Cell Rep. 7, 1248-1258 (2014).