Human neural precursor cells with inducible STIM1 knockdown

Abstract

Human Neural precursor cells (hNPCs)/cell lines derived from human pluripotent stem cells have been stably transduced with inducible lentiviral constructs for knockdown of STIM1 thereby changing their gene expression. The said Human Neural precursor cells (hNPCs)/cell lines has selectively inducible knockdown of STIM1 via stable transduction of lentiviral shRNA vector followed by Doxycycline treatment. Human Neural precursor cells (hNPCs)/cell lines with stable knockdown STIM1 exhibits attenuated SOCE with downregulation of genes associated with cell proliferation and upregulation of genes for neural differentiation.

Claims

1. A process for transducing human neural precursor cells (hNPCs) or human neural precursor cell lines with lentiviral constructs for knockdown of STIM1 expression by shRNA comprising: providing a lentiviral transfer vector containing sequences that package as a viral genome and encode for the shRNA for knockdown of STIM1 expression, wherein the sequences encoding the shRNA comprises TAATATTGCACCTCCACCTCAT (SEQ ID NO: 1), TTTATGATCTACATCATCCAGG (SEQ ID NO:2), and TCCAGTGAGTGGATGCCAGGGT (SEQ ID NO: 3); co-transfecting the lentiviral transfer vector with lentivirus-based second generation packaging vectors encoding env, gag and pol protein into a packaging cell line for releasing viral particles therefrom; harvesting the viral particles that contain the sequences that package as a viral genome and encode for the shRNA for knockdown of STIM1 expression from the supernatant of the packaging cell line; providing human neural precursor cells (hNPCs) or human neural precursor cell lines; and carrying out gene expression modulation of said human neural precursor cells (hNPCs) or human neural precursor cell lines by applying the harvested viral particles to said human neural precursor cells (hNPCs) or human neural precursor cell lines and inducing shRNA expression for knockdown of STIM1 expression, thereby regulating intracellular calcium signaling and decreasing Store Operated Calcium Entry (SOCE).

2. The process of claim 1, wherein said human neural precursor cells (hNPCs) or human neural precursor cell lines are derived from pluripotent stem cell lines selected from human embryonic stem cell line (hESCs) or human induced pluripotent stem cell line (hiPSC).

3. The process of claim 1, wherein the step of inducing shRNA expression comprises adding doxycycline.

4. The process of claim 1, wherein the step of inducing shRNA expression comprises passaging said human neural precursor cells (hNPCs) or human neural precursor cell lines for at least 5 passages with doxycycline.

Description

BRIEF DESCRIPTION OF NON-LIMITING ACCOMPANYING FIGURES

(1) FIG. 1 illustrates the steps of Experimental design.

(2) FIG. 2A illustrates Derivation of neural precursor cells (NPC) from hESC. Phase contrast images of (A) hESC colony grown on matrigel (B) Day 4 EBs showing epithelial outgrowths (white arrowheads) when grown in the presence CHIR99021, a GSK 3 inhibitor and Purmorphamine, an activator of Shh pathway (C) Neural precursor cells (NPCs) at passage 5, three days after split. Immunostaining of NPCs with antibodies raised against the neural stem/precursor cell markers as indicated (D) Nestin (E) Sox1 (F) Sox2. NPCs showing robust expression of (G) STIM1 protein, the ER calcium sensor and (H) Ki-67, a proliferation marker (I) Karyogram of NPCs at passage 10 showing a normal karyotype (XX). Differentiation of NPCs into neural derivatives where cells were allowed to spontaneously differentiate for 10 to 14 days, (J) Phase contrast image of a day 12 spontaneously differentiating NPC culture, immunostained for the neuronal markers (K) Dcx (L) Tuj 1 (M) MAP2 and the astroglial progenitor marker (N) Vimentin. (0) TH positive dopaminergic neuron after 21 days in culture. Nuclei are counterstained with DAPI in all immunostaining panels. Scale bars are 100 m (A-H) and 50 m (K-O). Representative images are from 2-4 independent experiments.

(3) FIG. 2B illustrates Derivation of neural precursor cells (NPC) from iPSC. Immunostaining of NPCs with antibodies raised against the neural stem/precursor cell markers as indicated (A) Sox1 (B) Sox2 (C) Pax6 (D) Nestin and (E) Ki-67, a proliferation marker. Nuclei are counterstained with DAPI in all immunostaining panels. Scale bars are 50 m.

(4) FIG. 3A illustrates Knock-down of STIM1 attenuates SOCE in human NPCs. (A, B) Ca.sup.2+-responses during ER-store release and SOCE induced by Thapsigargin (TG, 10 M) measured using the ratiometric Ca.sup.2+-indicator indo-1-AM in wild-type (WT) hNPCs (A) or hNPCs treated with pharmacological inhibitors of SOCE, BTP-2 and 2-APB at the indicated concentrations or DMSO as a solvent control (B). Each trace represents the mean+SEM for 25-100 cells. Ionomycin (Iono, 10 M) was added at the end of each imaging to determine the peak F405/485 ratio obtained after saturation of the Ca-indicator with Ca.sup.2+ (C) Box plots quantifying the peak F405/485 values for store-release and SOCE in the indicated treatment conditions. Mann-Whitney U test with Bonferroni correction. p=1.81910.sup.23 for DMSO control compared to BTP-2 treatment and p=1.44210.sup.45 for DMSO control compared to 2-APB treatment (D)

(5) (Top) A representative Western blot showing levels of STIM1 protein in hNPCs transduced with an NTC (non-targeting control) or an sh-RNA targeting STIM1 (STIM1 KD). Actin serves as the loading control. (Bottom) Quantification of STIM1 band intensities normalized to the loading control Actin from three independent biological replicates (p=0.00069, Student's t-test). (E) Ca.sup.2+-responses during store-release and SOCE in hNPCs transduced with NTC and STIM1 KD. (F) Box plots quantifying the peak F405/485 values for store-release and SOCE in the indicated genotypes. Peak F405/485 for store-release were not significantly different between NTC and STIM1 KD NPCs. p=0.0001 for peak F405/485 during SOCE compared between NTC- and STIM1 KD NPCs (G) Quantification of basal cytosolic [Ca.sup.2+] values using Fura-2-AM in NTC and STIM1 KD NPCs (p=1.11510.sup.8. Mann-Whitney U test. *** indicates p<0.001).

(6) FIG. 3B illustrates Knock-down of STIM1 attenuates SOCE in human iPSC derived NPCs. (A) A representative Western blot showing levels of STIM1 protein in iPSC derived NPCs transduced with an NTC (non-targeting control) or an sh-RNA targeting STIM1 (STIM1 KD). Actin serves as the loading control. (B) Quantification of STIM1 band intensities normalized to the loading control Actin from three independent biological replicates (p=0.009, Student's t-test). (C) Ca.sup.2+ changes during ER-store depletion using Thapsigargin, TG (10 M) and SOCE after Ca.sup.2+ add-back. Fura-2 was used as an indicator. The trace shows the mean [Ca.sup.2+]SEM from >35 cells. (D) Box plot quantifying the peak store-release and SOCE in hNPCs. Ratio of F340 and F380 (F340/F380) for each time point was measured and calibrated into [Ca.sup.2+] by using the Grynkiewicz equation as follows:
[Ca.sup.2+](nM)=K.sub.d(RR.sub.min)/(R.sub.maxR),
where K.sub.d for Fura-2 in human cells=225 nM, refers to scaling factor and R refers to F340/F380 ratio at a particular time point. R.sub.min refers to the minimum F340/F380 obtained after addition of 10 mM EGTA to maximally chelate most of free cytosolic Ca.sup.2+. R.sub.max refers to the maximum F340/F380 obtained after addition of Ionomycin (10 M) in presence of 10 mM extracellular Ca.sup.2+. This results in saturation of the Fura-2 with Ca.sup.2+ and hence gives the maximum possible value of R.

(7) FIG. 4 illustrates Transcriptome analysis reveals global level changes in NPCs on STIM1 knockdown: (A) A dendrogram of Jensen-Shannon divergences analyzing the pattern of gene expression between wild type, NTC and STIM1 knockdown NPCs. Hierarchical clusterin showing the STIM1 knockdown cells to form a separate cluster (B) Box plots indicating the distribution of reads across all the samples sequenced (C) Venn Diagrams representing the number of up and down regulated genes in the STIM1 knockdown NPCs. Genes were tested for differential expression according to Cuffdiff (blue), DESeq (red), and edgeR (green), intersection of genes that were considered differentially transcribed in comparison to control cells were used for further analysis (D) Normalized read counts of the differentially expressed genes involved in SOCE in NTC and STIM1 knockdown conditions represented as a heat map; FPKMFragments Per Kilobase per Million reads (**p=0.006; two-tailed t-test) (E) Functional gene enrichment analysis performed in FunRich with genes in the intersection (115 and 208 downregulated) showing biological processes which are differentially regulated in the STIM1 knockdown NPCs based on FPKM values. The number in parentheses represents the number of genes associated with each process in the data set. Three biological replicates per condition were run for RNAseq.

(8) FIG. 5 illustrates Biological pathways affected by STIM1 knockdown in NPCs. Genes that were differentially expressed between NPCs with or without STIM1 knockdown were identified using an enrichment analysis using the DAVID web server (A) Gene-GO term enrichment analysis by DAVID highlighting the most relevant upregulated biological pathways based on the gene IDs, Each bar represents the Fisher Exact P-Value associated with the corresponding enriched pathway and the number in each bar denotes the number of genes involved in each pathway (B) GO terms downregulated in the STIM1 knockdown NPCs based on the gene IDs. Each bar represents the Fisher Exact P-Value associated with the corresponding enriched pathway and the number in each bar denotes the number of genes involved in each pathway (C) Heat map representing normalized read counts of some of the differentially expressed genes in the control and STIM1 knockdown NPCs (D) Heat map representing fold changes of the indicated genes, as validated by qPCR (p<0.05). Four independent samples were used for validation of the RNAseq using RT-PCR. FPKMFragments Per Kilobase per Million reads

(9) FIG. 6A illustrates STIM1 knockdown represses proliferation of NPCs (A) Control (NTC transduced) cells expressing ZsGreen (B) STIM1 knockdown NPCs undergo spontaneous differentiation as evident by the presence of neurite-like processes and branches (C-D) Neurosphere forming assay (NSA) of NTC and STIM1 knockdown NPCs at 48h (E) Quantification of neurosphere (NS) numbers per well after a week of seeding NTC and STIM1 knockdown NPCs (n=3, p=0.0008) (F) Quantification of NS size in microns (m) at day 7 (n=4, p=0.00067) (G) Skeletonized (ImajeJ) NS to show the size difference at day 7 of representative NTC and STIM1 knockdown.

(10) FIG. 6B illustrates STIM1 knockdown represses proliferation of iPSC-derived NPCs by Cell growth assays. (A) Growth curve of the control NTC and STIM1 knockdown NPCs grown as adherent monolayer at 5 DIV in triplicates, n=3. Morphology of (B) NTC, control cells and (C) STIM1 knockdown NPCs at 5 DIV. Arrows indicate spontaneous differentiation (neuronal projections). DIV-Days In Vitro, Scale bars are 50 m.

(11) FIG. 7A illustrates STIM1 knockdown in NPCs promotes early neurogenesis. Immunostaining and western blot analysis of multipotent and differentiation markers (A, B) Immunostaining of the control and STIM1 knockdown NPCs for the proliferation marker Ki-67 and (C) its quantification as shown in the graph (p=0.0043) (D, E) Expression of Doublecortin (DCX) a marker of newly born neurons in the NTC and STIM1 knockdown NPCs and (F) its quantification as shown in the graph (p=1.67104)(G, H) Neuron-specific Class III -tubulin (Tuj 1) in the NTC and STIM1 knockdown NPCs and (I) its quantification STIM1 as shown in the graph (p=0.0087) (J, K) Sox2, the multipotent neural stem cell marker the NTC and STIM1 knockdown NPCs and (L) its quantification as shown in the graph, not significant. Scale bar-50 m. Total number of cells counted (n) as indicated in each panel. Western blot analysis showing (M) STIM1, p=0.0006 (N) Sox2, p=0.008 (0) DCX, p=0.0056 (P) Tuj 1 protein (p=0.043) levels in the control and knockdown cells (Q) Heat map representing normalized read counts of selected neuronal and glial genes which are up regulated in the knockdown NPCs. N=3, t-test used for all significance tests. Asterisks indicate ***p<0.001, **p<0.01, *p<0.05.

(12) FIG. 7B illustrates STIM1 knockdown in iPSC-derived NPCs promotes early neurogenesis Immunostaining of the control and STIM1 knockdown NPCs for the proliferation marker Ki-67 and its quantification (Right) as shown in the graph (p=0.031) (B) Expression of Doublecortin (DCX) a marker of newly born neurons in the NTC and STIM1 knockdown NPCs and its quantification (Right) as shown in the graph (p=0.018).

EXAMPLE 1: STEPS OF EXPERIMENTAL DESIGN

(13) FIG. 1 illustrates the experimental design of the present invention. Small molecule induced hNPCs are generated from a well-characterized human embryonic stem cell line (hESCs) H9/induced pluripotent stem cell (iPSC) line NIH1 and successfully knocked down STIM1, an essential element of SOCE, through lentiviral transduction to obtain expandable stable STIM1 knockdown hNPC cell lines. Small molecule derived hNPCs are transduced with STIM1 shRNA-miR. Ca.sup.2+ imaging and immunoblots confirmed STIM1 knockdown and the attenuation of SOCE. To investigate cellular and molecular changes brought about by loss of SOCE RNAseq analyses of the STIM1 knockdown NPCs and their appropriate vector, controls are performed that helped to identify significant changes in gene expression. Changes in expression levels of selected genes, identified by RNAseq, are further validated by real-time PCR. To understand the functional significance of SOCE-regulated changes in gene expression, Gene Ontology analyses are performed and a set of enriched biological pathways were identified that underwent significant up or down-regulation. These pathways helped to design experiments for phenotypic/functional characterization of the STIM1 knockdown NPCs. Such experiments based on the identified GO pathways, corroborated a cell fate change in STIM1 knockdown NPCs. The statistics and p-value of the bioinformatics analyses and wet lab experiments are provided in the corresponding segments.

EXAMPLE 2: MAINTENANCE AND NEURAL INDUCTION OF HUMAN EMBRYONIC STEM CELLS (HESCS)

(14) The hESC cell line comprising undifferentiated cells H9/WA09 (RRID: CVCL 9773) used for this study were initially cultured on irradiated mouse embryonic fibroblasts and gradually adapted to grow under feeder-free conditions by culturing on 0.5% Matrigel in complete mTeSR media (Stem Cell Technologies, Vancouver, Canada). Passage of cells was initiated by washing with phosphate-buffered saline (PBS) followed by incubation at 37 C. in CTK dissociation solution (PBS containing 0.25% trypsin, 1 mg/mL collagenase IV, 20% KSR (all from Invitrogen, Carlsbad, CA, USA), and 1 mM CaCl.sub.2) (Sigma, St Louis, MO, USA). hESC cultures were allowed to form embryoid bodies (EBs) by forced aggregation in low attachment dishes.

(15) For neural induction, as described earlier two-day EBs were supplemented for neural induction with 10 mM SB431542 (Stem Cell Technologies), 1 mM dorsomorphin (Tocris Cookson, Ballwin, MO, USA), 3 mM CHIR99021 (Stem Cell Technologies) and 0.5 mM purmorphamine in suspension cultures. Four-day EBs were treated with 1:1 DMEM/F12 neurobasal medium supplemented with 1:200 N2, 1:100 B27 along with neural induction media factors in suspension cultures. Six-day EBs were plated onto Matrigel-coated plates in maintenance medium containing 1:1 DMEM/F12 neurobasal medium supplemented with 1:200 N2, 1:100 B27, 3 M CHIR99021, 0.5 mM purmorphamine and 150 M ascorbic acid (Sigma, St Louis, MO, USA). Neural precursor cells (NPCs) were then passaged enzymatically with Accutase (Invitrogen) and freeze thawed as per requirement (protocol adapted from Reinhardt et al. 2013). NPCs could be maintained for >25 passages. For spontaneous differentiation, neural precursors were allowed to grow in media without small molecules only in the presence of N.sub.2 and B27 supplements for 14-21 days. Media was replenished every alternate day for NPCs and spontaneously differentiating cultures.

(16) Induced pluripotent stem cell (iPSC) line NIH1 were also used alternatively for generating human NPCs for the present invention.

(17) FIG. 2 illustrates the derivation of hNPCs from the hESC. FIG. 2A illustrates the same as described above from iPSC.

EXAMPLE 3: SHRNA-MIRS AND LENTIVIRAL TRANSDUCTION FOR STIM1 KNOCKDOWN

(18) ShERWOOD-UltramiR short hairpin RNA (shRNA), are vector-based RNAi that triggers with a new generation shRNA-specific design and an optimized microRNA scaffold UltramiR. STIM1 knock-down was performed using a mixture of STIM1-ULTRA-3374033 (TAATATTGCACCTCCACCTCAT-SEQ. ID. NO.:1), ULTRA-3374029 (TTTATGATCTACATCATCCAGG)-SEQ. ID. NO.: 2) and ULTRA-3374031 (TCCAGTGAGTGGATGCCAGGGT SEQ. ID. NO.:3) (transOMIC Technologies, Hunstsville) in NPCs. The mixture of all 3 shRNAs when used for the study was found to surprisingly achieve high transduction efficiency along with desired knockdown of protein. A non-targeting shRNA construct was used as a control for all experiments. The inducible ZIP (all-in-one) vector contains the components necessary for regulated expression of the shRNA-mir, including the TRE3GS inducible promoter positioned upstream of the shRNA, and the Tet-On 3G transcriptional activator (Tet-On 3G TA), which is expressed constitutively from an internal promoter. The Tet-On 3G TA binds to the TRE3GS promoter in the presence of Doxycycline and induces expression of ZsGreen and the shRNA-mir. This allows for direct visual confirmation of induced shRNA expression. A puromycin resistance gene (PuroR) is also encoded for rapid selection of transduced cells. The lentiviral transfer vector (pZIP) was co-transfected with the desired packaging vectors (pCMV-dR8.2 and pCMV-VSVG from Addgene RRID: SCR 002037) encoding the env, gag and pol protein into a packaging cell line (HEK293T-ATCC Cat #CRL-3216, RRID:CVCL 0063). The transfer vector contained sequences that packages as the viral genome and code for the shRNA-mir against STIM1 and selection cassette that integrates into the target cell's genome. Viral particles released from the packaging cell were harvested from the supernatant of the packaging cell for three days. The resulting viral supernatant was filtered through a 0.4511m PVDF syringe filters (Millipore), concentrated using a Lenti-X-concentrator, tested with a Lenti-X GoStix (Clontech) and applied to NPCs. After 24 hrs the media was discarded and fresh media with Doxycycline was added to induce shRNA expression. An MOI of 10 was used for the study. NPCs at P-10 were transduced with the viruses and at least 5 passages (with Doxycycline) were allowed to pass to obtain a stable knockdown NPC cell line.

(19) Human NPCs transduced with a non-targeting vector control (NTC) were used as controls for all subsequent experiments. Western blot analyses confirmed maximal STIM1 knockdown (>90%, p=0.00067) in NPCs transduced with a pool of three STIM1 targeting shRNAs. Subsequent experiments were performed with NPCs at P18-P22. NPCs with STIM1 knockdown (referred to as STIM1 knockdown henceforth) exhibited a significant reduction in SOCE as compared to the corresponding control whereas release of store Ca.sup.2+, after inhibition of the sarco-ER Ca.sup.2+-ATPase by thapsigargin treatment, appeared similar to control cells (FIG. 3A). This was reproducible in the iPSC-derived NPCs also as illustrated in FIG. 3B. The mean basal cytosolic calcium levels of the control and STIM1 knockdown cells were 38 nM and 32 nM respectively. Thus, STIM1 knock-down causes a small but statistically significant reduction in basal [Ca.sup.2+]. shRNA-miR against STIM1 has been purchased from a transOMIC Technologies, Huntsville, USA.

EXAMPLE 4: SOCE IN HNPCS AND ITS ATTENUATION WITH STIM1 SHRNA-MIR

(20) To determine whether small molecule-derived NPCs exhibit SOCE, ER stores were depleted using 10 M thapsigargin (TG), an inhibitor of the sarco-endoplasmic reticulum Ca.sup.2+ ATPase pump in a Ca.sup.2+-free solution and studied Ca.sup.2+ influx after re-addition of extracellular 2 mM Ca.sup.2+. ER-store Ca.sup.2+ release followed by SOCE after re-addition of external Ca.sup.2+ was revealed consistently across several passages in human NPCs. CRAC channels (calcium release-activated channels), identified as Orai1 and distinguished by high Ca.sup.2+ selectivity and a unique pharmacological profile function in mouse NPCs as Store-Operated Calcium channels (Somasundaram et al., 2014). Therefore, it was tested if potent CRAC channel inhibitors like BTP-2 and 2-aminoethoxy-diphenyl borate (2-APB, Prakriya and Lewis, 2001) affect SOCE in human NPCs. Both BTP-2 (Bootmann et al., 2002) and 2-APB significantly inhibited SOCE in human NPCs. Thus, the pharmacological profile of SOCE in human NPCs is consistent with that of CRAC channels and resembles SOCE in primary mouse NPCs. FIG. 3A represents that knock down STIM1 attenuates SOCE in human NPCs derived from hESC whereas FIG. 3B represent that knock down STIM1 attenuates SOCE in human NPCs derived from iPSC.

EXAMPLE 5: TRANSCRIPTIONAL PROFILING OF STIM1 KNOCKDOWN NPCS

(21) To identify potential gene expression changes by STIM1 knockdown in human NPCs, several parameters were analysed: parallel genome-wide analysis of mRNA expression profiles in non-transduced NPCs, non-targeting vector control (NTC) and the STIM1 knockdown NPCs. Stable knockdown of STIM1 lead to global transcriptional changes as evident by the clustering together of non-transduced NPCs with the NTC, whereas the STIM1 knockdown formed a separate cluster as observed using Jensen-Shannon divergence as a metric. Three independent methods, CuffDiff, EdgeR and DESeq were used for differential expression analysis and by overlap of genes identified in the three methods further analysis of 115 upregulated genes and 208 down-regulated genes was done. Thus, genes obtained by the intersection of all three methods were considered as the differentially expressed genes (DEGs) in the STIM1 knockdown NPCs. To understand if STIM1 knockdown modulates expression of STIM2 and the SOCE channel Orai, we looked at the FPKM values of these genes and confirmed that STIM1 was the only gene that was significantly down-regulated. The nature of biological processes that might be affected by STIM1 knockdown was predicted next by analysis of the differentially expressed genes (DEGs). Upregulated genes associated with biological processes such as signal transduction, regulation of nucleic acid metabolism and energy pathways, whereas down-regulated genes clustered with metabolism, cell growth and maintenance, and cell communication. Genes regulating cellular transport were both up- and down-regulated. The down-regulated processes appeared consistent with a less proliferative state, whereas the upregulated processes suggested increased cellular specialization and differentiation. To understand the nature of signaling mechanisms regulated by STIM1 in hNPCS, DAVID was used to assess the Gene Ontology (GO) of DEGs. Biological pathways that were significantly upregulated in STIM1 knockdown NPCs relative to control NTCs appeared consistent with neuronal differentiation and included nervous system development (GO:0007399), membrane depolarization (GO:0051899), neuron cell-cell adhesion (GO:0007158) and chemical synaptic transmission (GO:0007268). Conversely, significantly down-regulated pathways in STIM1 knockdown NPCs suggested reduced cell proliferation and included rRNA processing (GO:0006364), cell proliferation (GO:0008283), G1/S transition of mitotic cell cycle (GO:0000082) and DNA replication (GO:0006260). FIG. 4 illustrates the analysis of Transcriptome of knock down STIM1

(22) These data support the hypothesis that STIM1 knockdown in the NPCs reduces their proliferative and self-renewal capacities and concomitantly induces premature neural differentiation.

EXAMPLE 6: STIM1 KNOCKDOWN LEADS TO DECREASED PROLIFERATION AND EARLY NEUROGENESIS OF NPCS

(23) Based on analysis of the RNAseq data, the morphology and proliferative potential of STIM1 knockdown NPCs were studied. The STIM1 knockdown cells exhibited rapid spontaneous differentiation evident as branched neurites and sparse cell clustering. The control NTC cells however resembled wild type NPCs. Their growth rates were similar to that of wild type cells (24h population doubling time, passaged every 3-4 days). In contrast STIM1 knockdown NPCs cultures took much longer (>7 days) to become confluent. Presumably this is because cells committed to a more differentiated phenotype were lost on passaging and the remaining undifferentiated NPCs repopulated the culture more slowly, owing to their reduced numbers. To obtain a measure of the self-renewal capacity of STIM1 knockdown cells as compared to NTCs, both were tested by a neurosphere formation assay. Neural stem cells are known to continuously divide in culture to generate non-adherent spherical clusters of cells, commonly referred to as neurospheres when appropriate plating densities are established. At 48 hrs neurospheres were visible in both NTCs and STIM1 knockdown cultures; however it was evident that neurosphere size was greatly reduced in the STIM1 knockdown condition. This impaired proliferation was measured by counting neurospheres generated after a week in culture. Greater than 50% reduction of neurosphere numbers was observed in the STIM1 knockdown cells. Moreover neurospheres that formed in the NTC cultures were larger in size (180.08.3 m), irrespective of the general heterogeneity in sphere sizes across cultures, as compared with neurospheres in STIM1 knockdown cultures (76.04.32 m). The percentage of bigger spheres also appeared reduced in STIM1 knockdown cells. Very small spheres (<50 m) in both conditions were not scored. It is evident from these experiments that the clonogenic and proliferative capacities of human NPCs are impaired upon STIM1 knock down (FIG. 5 and FIG. 6 illustrate the morphological and proliferation rate changes in STIM1 knockdown hNPCs).

(24) Premature differentiation and the reduced proliferative potential of STIM1 knockdown NPCs were further assessed by immunostaining with appropriate markers (FIG. 7). Premature differentiation and the reduced proliferative potential of STIM1 knockdown NPCs from iPSC is shown in FIG. 6B and FIG. 7B.

(25) STIM1 knockdown in human NPCs induces early neurogenesis that would eventually deplete the NPC pool. Indeed, transcript levels of many neuronal (NPY, NPTX2, DLG4, NLGN4X, NRXN2, CEND1, NEFH, NEUROG2, NEUROG1) and some early glial markers (HESS, SLC1A3, CD44, PDGFRA) were also significantly upregulated in the STIM1 knockdown NPCs as evident from RNAseq data (GSE109111). Physiologically NPCs/NSCs need to fine-tune quiescence and proliferation/commitment to guarantee lifelong neurogenesis and avoid premature exhaustion. Knock-down of STIM1 appears to tip this balance and push the cells towards a differentiated phenotype.

EXAMPLE 7

(26) A. Ca.sup.2+ Imaging in hNPCs:

(27) Quantification of basal cytosolic [Ca.sup.2+] from hNPCs was performed using the dual-excitation single emission ratiometric Ca.sup.2+-indicator Fura-2-AM. hNPCs plated as single adherent cells on PDL-coated coverslips were washed thrice with culture medium, following which they were loaded with 504 Fura-2-AM in dark for 45 mins at room temperature. The dye was dissolved in the culture medium supplemented with 0.002% Pluronic F-127. After dye loading, cells were washed thrice with culture medium. The culture medium was finally replaced with HBSS containing 2 mM Ca 2+(20 mM HEPES, 137 mM NaCl, 5 mM KCl, 10 mM Glucose, 1 mM MgCl2, 2 mM CaCl2, pH=7.3). Fura-2 was excited using dual 340/380 nm excitation and the emission intensity was recorded at 510 nm. Basal changes in cytosolic Ca.sup.2+ were recorded for 10 frames at an interval of 5s. After this, 10 mM EGTA was added to obtain the minimum fluorescence values obtained after chelating all the available cytosolic Ca.sup.2+ following which fluorescence changes were recorded every 5s for 85 frames. Subsequently, the extracellular medium was supplemented with 10 mM Ca.sup.2+ and the maximum fluorescence intensity was recorded after saturating the dye loaded within the cell with Ca.sup.2+ by adding 10 M Ionomycin. Images were acquired after Ionomycin addition for 20 frames at 5s interval. The peak fluorescence value was generally obtained within the first 2 frames (corresponding to 10s) of Ionomycin addition. The emission intensities corresponding to excitation at 340 nm and 380 nm were used to calculate the F340/380 ratio for each cell across all the time points. The basal F340/380 at the start of imaging (t=0) was calibrated to [Ca.sup.2+] using the Grynkiewicz equation
[Ca.sup.2+](nM)=K.sub.d(RR.sub.min)/(R.sub.maxR),
where, Rmin and Rmax corresponds to the minimum F340/380 and maximum F340/380 obtained after EGTA and Ionomycin addition, respectively. K d for Fura-2 in human cells=225 nM. (Scaling factor) is the ratio of the fluorescence emission intensities of the Ca.sup.2+-free and the Ca.sup.2+-bound forms of the dye after excitation at 380 nm. =5.

(28) B. Library Preparation, Sequencing and RNASEQ Data Analysis

(29) Total RNA was isolated from hNPCs using TRIzol as per manufacturer's instructions.

(30) The RNA was run on a Bio-analyzer chip (Agilent) to ensure integrity. Approximately 500 ng of total RNA was used per sample to prepare libraries (RIN values>9) using a TruSeq RNA Library Prep Kit v2 (Illumina) following manufacturer's instructions. The prepared libraries were run on a DNA1000 chip of a Bio-analyzer to check their size. Libraries were then quantified by qPCR and run on an Illumina Hiseq 2500 platform, for a single end and 75 bp read protocol (SciGenom, India).

(31) Nine samples were run in a single lane. Biological triplicates were performed for each sample consisting of RNA isolated from wild type NPCs, shRNA control NPCs (referred to as the Non-Targeting Control or NTC) and STIM1 knockdown NPCs.

(32) More than 100 million reads were obtained per sample with a uniform distribution of reads across samples (FIG. 4B). Reads (FASTQ sequences) obtained after sequencing were aligned to the annotated UCSC human genome (GRCh37/hg19) using HISAT2, RRID: SCR_015530 (Version-2.0.5). These aligned SAM files were converted to BAM files using SAM tools (Version-1.3) The resulting alignment data from SAM tools were then fed to CuffDiff2, RRID: SCR_001647, a software package that takes the reads aligned in BAM format as input, and uses geometric normalization on gene-length normalized read counts (FPKM, fragments per kilo base of exon per million reads), a beta negative binomial model for distribution of reads and t-test for calling differentially expressed genes. A corrected p-value was set, referred to as the q-value cut-off of 0.05 and Fold change >1=1.5(+/) to identify differentially expressed genes by this method. Read counts for each transcript or exon were also calculated independently using python based package HTSeq (Version 0.9.1) (Anders et al., 2015). These read counts were then used as inputs for the differential analysis with DESeq, RRID:SCR_000154 and EdgeR, RRID:SCR_012802 (Anders and Huber, 2010; Robinson et al., 2010) empirical analysis of digital gene expression in R), two R based Bioconductor software that analyses the read counts per transcript per sample and normalizes (genes having very low read counts were removed) them using the Trimmed Mean of M-values (TMM) method and then fitting the values in a negative binomial model with variance and mean linked by local regression to identify differentially expressed genes. A fold change of 1.5(+/) and p-value of 0.05 in DESeq and FDR p-value of 0.05 was set as cut-off in EdgeR. Genes found to be significantly altered by all the three different differential gene expression analysis methods were considered further. Significantly up and down regulated genes were subjected separately to a gene ontology based gene enrichment analysis tool, DAVID (Version 6.8) (Database for Annotation, Visualization and Integrated Discovery) and FunRich (Pathan et al., 2015) (Functional Enrichment analysis tool) using the human genome as the background gene set. In DAVID after converting the input gene IDs to corresponding DAVID gene IDs, the Functional Annotation Tool was used to carry out gene enrichment analysis based on the DAVID knowledge base. Fisher Exact P Value method was employed to measure the gene-enrichment in DAVID with a P value cut-off of 0.1 and the count threshold kept at 2 to speculate maximum information. Most significant biological pathways (GO level 5) enriched in DAVID have been reported as bar graphs. Gene enrichment analysis was also performed using the human Gene Ontology database, HPRD2 and FunRich (Pathan et al., 2015). Selected biological processes were identified by FunRich based on the presence of a higher percentage of genes (>6%). The genes enriched in each identified pathway have been represented as heat maps based on the FPKM values of the individual genes. The density box plot and dendrogram were generated using CummeRbund, RRID:SCR_014568 (Goff et al., 2012). Heat maps were generated using Matrix2png, RRID: SCR_011614.

(33) (Pavlidis and Noble, 2003) and HemI (Heatmap Illustrator, Version 1.0.3.7) (Deng et al., 2014). Comparison of significantly altered gene lists from CuffDiff, DESeq and EdgeR and generation of Venn Diagrams were performed using FunRich. The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus (Edgar et al., 2002) and are accessible through GEO Series accession number GSE109111.

(34) Table 1: Illustrates Biological pathways enriched by DAVID in STIM1 KD hNPCs. Top biological pathways up- and down-regulated in STIM1 KD NPCs vs control cells. Fisher Exact P-values are shown and GO terms are arranged according to their FDR value (False Discovery Rates). All over-represented pathways had a fold change >2. Both Benjamini Hochberg and Bonferroni multiple testing correction methods for the occurrence of false positive identifications by adjusting p-values are given. Shown are the gene lists identified in the data set and associated with each pathway. #indicates p-value>0.05.

(35) TABLE-US-00001 TABLE 1 FOLD GO TERM PATHWAY P-VALUE ENRICHMENT BONFERRONI BENJAMINI FDR GENES GO:0007268 Chemical 6.96E05 6.491 0.038 0.019 0.101 NRXN2, KIF5A, Synaptic NPTX2, GRIK4, Transmission DLG4, CHRNA4, PRKCG, CACNB3, CACNA1B GO:0007158 Neuron Cell-Cell 0.003 32.458 0.876 0.407 5.265 NRXN2, NLGN4X, Adhesion ASTN1 GO:0051899 Membrane 0.008 20.773 0.993 0.637 12.289 CHRNA4, CACNB3, Depolarization CACNA1B GO:0030534 Adult Behavior 0.009 19.974 0.995 0.598 13.201 NRXN2, NLGN4X, SHANK1 GO:0007411 Axon Guidance 0.013 5.443 0.999 0.656 17.590 KIF5A, NGFR, UNC5C, CHL1, SLIT3 GO:0060997 Dendritic #0.066 28.852 1.0 0.950 63.527 DLG4, SHANK1 Spine Morphogenesis GO:0007399 Nervous System #0.082 3.015 1.0 0.933 71.593 IGSF8, CPLX2, Development DLG4, SPOCK1, ELAVL3 DOWNREGULATED GO:0006364 rRNA 1.62E07 6.130 2.21E04 2.21E04 2.66E04 EMG1, PNO1, Processing EXOSC5, RPS27L, DIEXF, MRTO4, NOP14, EBNA1BP2, PA2G4, DKC1, DHX37, DDX21, PES1, LTV1, WDR43 GO:0008283 Cell 1.00E06 4.301 0.001 6.82E04 0.001 POLR3G, TP53, Proliferation CD70, MCM10, PRDX1, CDC25A, PLCE1, PA2G4, DKC1,ASCC3, FRAT2, TXNRD1, NRG1, LRP2, PES1, MYC, EMP1, GNL3 GO:0000082 G1/S Transition 2.43E06 8.574 0.003 0.001 0.003 CCNE1,CDC6, Of Mitotic CDC45, CDKN1A, Cell Cycle RRM2, ID4, CDK6, RCC1, MCM10, CDC25A GO:0006260 DNA 4.01E04 5.078 0.420 0.127 0.655 EXO1, CDC6, Replication CDC45, POLE3, RRM2, MCM10, C10ORF2, CDC25A, DSCC1 GO:0042771 Intrinsic Apoptotic 4.01E04 14.106 0.420 0.103 0.656 CDKN1A, AEN, Signaling Pathway TP53, RPS27L, In Response To PHLDA3 DNA Damage By p53 Class Mediator

EXAMPLE 8: QUANTITATIVE REAL TIME PCR

(36) RNA was isolated from cells using TRIzol as per manufacturer's instructions. Quantity of the isolated RNA was estimated by a NanoDrop spectrophotometer (Thermo Scientific).

(37) Approximately 1 g of total RNA was used per sample for cDNA synthesis. Three or more independently isolated RNA samples were tested for validation of gene expression by quantitative PCR. Total RNA was treated with 0.5 U of DNase I (amplification grade) in a reaction mixture (22.1 l) containing 1 mM DTT and 20U of RNase inhibitor. The reaction mixture was kept at 37 C. for 30 min followed by heat inactivation at 70 C. for 10 min. To this, 200U of MMLV reverse transcriptase, 50 M random hexamers, and 1 mM dNTPs were added in a final volume of 25111 for cDNA synthesis. The reaction mixture was kept at 25 C. for 10 min, then 42 C. for 60 min, and finally heat inactivated at 70 C. for 10 min. Quantitative real-time PCRs (qPCRs) were performed in a total volume of 10111 with Kapa SYBR Fast qPCR kit (KAPA Biosystems) on an ABI 7500 fast machine operated with ABI 7500 software (Applied Biosystems). Duplicates were performed for each qPCR reaction. GAPDH was used as the internal control. The fold change of gene expression in any experimental condition relative to wild-type was calculated as 2.sup.Ct, where Ct=(Ct (target gene)Ct (GAPDH)) from STIM1 knockdown cDNA(Ct (target gene)Ct (GAPDH)) from NTC cDNA. Four independent samples in addition to the samples used for the RNA-Seq were quantified for each gene. Statistical significance was determined by the unequal variance t-test. Primer sequences (F, forward primer and R, reverse primer) for each gene tested by qPCR are given below:

(38) TABLE-US-00002 GAPDH F-TCACCAGGGCTGCTTTTAACTCSEQ.ID.NO.:4 R-ATGACAAGCTTCCCGTTCTCAGSEQ.ID.NO.:5 STIM1 F-CACACTCTTTGGCACCTFCCSEQ.ID.NO.:6 R-TGACAATCTGGAAGCCACAGSEQ.ID.NO.:7 UNC5C F-ACGATGAGGAAAGGTCTGCGSEQ.ID.NO.:8 R-AAGTCATCATCTTGGGCGGCSEQ.ID.NO.:9 ELAVL3 F-CAAGATCACAGGGCAGAGCSEQ.ID.NO.:10 R-ACGTACAGGTTAGCATCCCGSEQ.ID.NO.:11 DLG4 F-ACCAAGATGAAGACACGCCCSEQ.ID.NO.:12 R-CCTGCAACTCATATATCCTGGGGSEQ.ID. NO.:13 NFAT4 F-CCGTAGTCAAGCTCCTAGGCSEQ.ID.NO.:14 R-TCTTGCCTGTGATACGGTGCSEQ.ID.NO.:15 LIN28A F-AAGAAGTCAGCCAAGGGTCTGSEQ.ID.NO.:16 R-CACAGTTGTAGCACCTGTCTCSEQ.ID.NO.:17 BAX F-CGGGGTTTCATCCAGGATCGSEQ.ID.NO.:18 R-CGGCAATCATCCTCTGCAGCSEQ.ID.NO.:19

(39) Thus the present invention provides for the first time human neural precursor cells line comprising lentiviral transduced Dox inducible STIM1 knockdown. The STIM1 knockdown hNPcells are useful for investigating STIM1 function and SOCE in neurodevelopmental, neurodegenerative and psychiatric disorders and generating novel therapeutic insights. The said hNPCs cell lines comprising selectively Dox inducible knockdown STIM1 are helpful to study disorders with aberrant NPC regulation such as Rett's syndrome, schizophrenia. The glial cells and neurons differentiated form said hNPCs with STIM1 knockdown are helpful to study late stage disorders such as Parkinson's disease, Alzheimer's disease and Huntington's disease.