Membrane-type metalloprotease inhibitory protein and pharmaceutical and pharmaceutical composition containing same, and respective uses thereof

Abstract

Disclosed is a membrane-type metalloprotease inhibitory protein T1.sup.PrTACE and use thereof, which can be used for preparing drugs targeting MT1-MMP or TACE endonuclease. Also disclosed are an antitumor pharmaceutical composition comprising BHK-21 cells and an artificial basal membrane which expresses T1.sup.PrTACE protein.

Claims

1. A membrane-type metalloprotease inhibitory protein T1.sup.PrTACE comprising the amino acid sequence of Seq ID No. 1.

2. A drug, comprising the membrane-type metalloprotease inhibitory protein T1.sup.PrTACE of claim 1 and a pharmaceutically acceptable excipient.

3. The drug of claim 2, wherein the excipient is a carrier, a solvent, a emulsifier, a dispersant, a humectant, an adhesive, a stabilizer, a colorant or a flavor.

4. The drug of claim 2, wherein the drug is a tablet.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a schematic view of the amino acid sequences of T1.sup.PrTACE and wild type TIMP-1.

(2) FIG. 2 is a schematic view of the inhibitory mechanism of T1.sup.PrTACE on MT1-MMP and TACE. As shown, T1.sup.PrTACE is made up of two functionally distinct domains, namely: (1) An N-terminal inhibitory domain that binds directly to the catalytic clefts of MT1-MMP (K.sub.i.sup.app 7.70 nM, Table 1) and TACE (K.sub.i.sup.app 0.14 nM, Table 1). (2) A C-terminal glycosylphosphatidylinositol (GPI) anchor that tethers the TIMP to the cell membrane and thus, to the vicinity of MT1-MMP and TACE.

(3) FIG. 3 summarizes the findings from two independent immunostaining experiments carried out under non-permeabilized condition; wherein FIG. 3A demonstrates the co-localization of T1.sup.PrTACE and MT1-MMP on the cell membrane, FIG. 3B shows the same interaction between T1.sup.PrTACE and TACE on the cell surface. Both experiments are conducted on CaKi-1 cells stably transduced with the TIMP.

(4) FIG. 4 highlights the ability of T1.sup.PrTACE in blocking gelatin film degradation by MT1-MMP on a fluorescent gelatin-coated plate in T1.sup.PrTACE-transduced HT1080 fibrosarcoma cells.

(5) FIGS. 5A and 5B are findings from two independent cell-based assays that highlight the potency of T1.sup.PrTACE in preventing TACE-mediated HB-EGF and TNF- shedding in T1.sup.PrTACE-transduced HT1080 fibrosarcoma cells.

(6) FIG. 6 shows the findings from an in vivo experiment carried out using NOD/SCID mice that proves that T1.sup.PrTACE lacks cell potentiation activity on CaKi-1 renal carcinoma cells.

(7) FIG. 7 illustrates the amino acid sequence of T1.sup.PrTACE in the present application.

(8) FIG. 8 contains immunostaining images that show the membrane localization of T1.sup.PrTACE on BHK+T1.sup.PrTACE cell surface.

(9) FIG. 9 shows the encapsulation and inhibitory effects the BHK+T1.sup.PrTACE:Matrgel composition has on CaKi-1 renal carcinoma cells.

(10) FIG. 10 are images captured with a fluorescent microscope that demonstrate the anti-proliferative effects that (i) BHK+T1.sup.PrTACE:Matrigel composition and (ii) BHK:Matrigel composition have on Caki-1 cells (samples in quadruplet). As shown, BHK+T1.sup.PrTACE cells are more effective at encapsulating and inhibiting CaKi-1 cells than unmodified BHK-21 cells.

(11) FIG. 11 summarizes the number of surviving Caki-1 cells from the BHK+T1.sup.PrTACE group, unmodified BHK-21 group and control group after 37 days of incubation. In all, there are far fewer CaKi-1 cells that survived the BHK+T1.sup.PrTACE group than the other groups (p<0.005).

(12) FIG. 12 contains microscope images that illustrate the relative fluorescent intensity of surviving HeLa cells in the BHK+T1.sup.PrTACE group, unmodified BHK-21 group and control group towards the end of incubation. As with CaKi-1 cells in FIG. 10, BHK+T1.sup.PrTACE cells are far more superior than unmodified BHK-21 cells in hindering HeLa cell proliferation.

(13) FIG. 13 is a summary of the number of surviving HeLa cells from the BHK+T1.sup.PrTACE group, unmodified BHK-21 group and control group at the end of incubation. Again, there are far fewer HeLa cells that survived the BHK+T1.sup.PrTACE group than the other groups (p<0.00001).

DETAILED DESCRIPTION

(14) Specific embodiments of the present application is described in detail below with reference to the drawings.

I. MATERIALS

(15) 1. Experimental Animal

(16) NOD-SCID mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.)

(17) 2. Drugs and Reagents

(18) 2.1 Drugs: puromycin; basal membrane Matrigel, from BD Bioscience; BHK-21 cell strain (Shanghai cell bank GNHa10). CaKi-1 cells (Shanghai cell bank TChu135). HeLa cells (Shanghai cell bank TChu187); medium: 5% fetal bovine serum, penicillin-streptomycin solution (1) and DMEM medium.

(19) 2.2 Reagents: TIMP-1 antibody (Abcam), MT1-MMP antibody (Abcam), TACE antibody (Abcam), Alexa Fluor488 anti-mouse secondary antibody (Invitrogen), Alexa Fluor555 anti-rabbit secondary antibody (Invitrogen), ProLong Antifade reagent with DAPI (Thermo Fisher), 38% paraformaldehyde (Sigma), porcine Oregon Green 488-conjugated gelatin (Thermoscientific), lipofectamine transfection kit (Invitrogen), propylene glycol methyl ether acetate (PMA), phosphate substrate (Sigma), TNF- Elisa kit (Sino Bio), EcoR I endonuclease (Thermoscientific), Xho I endonuclease (Thermoscientific), Apa I endonuclease (Thermoscientific), Nde I endonuclease (Thermoscientific), related gene sequences and primers synthesized by Sangon Biotech (Shanghai) Co. Ltd.

(20) 2.3 Instruments: LS-55 fluorescence spectrometer (PerkinElmer Life Sciences). C1-Si laser confocal microscope (Nikon), upright fluorescence microscope (Nikon), inverted fluorescence microscope (Nikon), multifunctional Microplate Reader (Thermoscientific); FACSAriaII cell sorter (BD Bioscience), automatic cell counter (Invitrogen).

II. EXAMPLE

Example 1: Inhibitory Effects of T1.SUP.PrTACE .on MT1-MMP and TACE

(21) The study was performed according to the methods disclosed in the following references: 1. Lee M H, Rapti M. Knauper V. Murphy G. Threonine 98, the pivotal residue of tissue inhibitor of metalloproteinases (TIMP)-1 in metalloproteinase recognition. J. Biol. Chem. 2004:279(17):17562-69. 2. Lee M H, Rapti M. Murphy G. Unveiling the surface epitopes that render tissue inhibitor of metalloproteinase-1 inactive against membrane type 1-matrix metalloproteinase. J. Biol. Chem. 2003; 278(41):40224-30.

(22) Specific procedures are as follows. 1. MT1-MMP (R&D, 918-MP-010) and TACE (R&D, 930-ADB-010) proteins were purchased from R&D Systems. 2. The N-terminal (i.e. the inhibitory) domain of wild type TIMP-1 (GenBank: S68252.1) was prepared by PCR amplification using the following primers (synthesized by Sangon Biotech): forward primer: 5-GAACCATATGTGCACCTGTGTACCACCCCACCCA-3 (Nde I restriction site is marked, as shown in Seq ID No. 3), and reverse primer: 5-TCAACTGCTCGAGTTAATGATGATGATGATGATGATGATGGGCTATCTGGGACCGC AGGGACTG-3 (Xho I restriction site is underlined, as shown in Seq ID No. 4). 3. Likewise, the N-terminal domain of T1.sup.PrTACE was prepared by PCR amplification, wherein the forward primer was 5-GAAC CATATGTGCACCTGTTCCCCACCCCACCCA-3 as shown in Seq ID No. 5, and the reverse primer is the same to that for wild type TIMP-1. 4. TIMP-1 and T1.sup.PrTACE PCR amplicons were digested with Nde I and Xho I and cloned into a pRSET-c expression vector (Invitrogen) to generate expression plasmids bearing the TIMP cDNAs. The plasmids were sequenced (Sangon Biotech (Shanghai) Co. Ltd.) to ensure that no unwanted mutation had been accidentally introduced during the PCR amplification process. 5. pRSET-c plasmids containing the N-terminal domains of TIMP-1 and T1.sup.PrTACE were transformed into BL21(DE3)pLys competent cells for protein expression. 6. The binding affinities of TIMP-1 and T1.sup.PrTACE were tested on MT1-MMP and TACE with a LS-55 fluorescence spectrofluorimeter.

(23) Results are shown in Table 1.

(24) TABLE-US-00001 TABLE 1 Inhibitory Affinities of Wild Type TIMP-1 (inhibitory domain) and T1.sup.PrTACE (inhibitory domain) on MT1-MMP and TACE (K.sub.i.sup.app, unit: nM) TIMP-1 T1.sup.PrTACE MT1-MMP 178 20 7.70 2.84 TACE 356 87 0.14 0.06
Kinetic analysis shows that the binding affinities of T1.sup.PrTACE on MT1-MMP and TACE was substantially stronger than that of the wild type TIMP-1.

(25) Table 1 shows the inhibitory effects of wild type TIMP-1 and T1.sup.PrTACE on MT1-MMP and TACE. By measuring the changes in the intensity of the fluorescent substrate (Mca-K-P-L-G-L-Dpa-A-R-NH2, R&D Systems) with a LS-55 fluorescence spectrofluorimeter, the affinity of the TIMPs on MT1-MMP and TACE were measured and calculated. Data show that the affinity of T1.sup.PrTACE for MT1-MMP and TACE (K.sub.i.sup.app was 7.70 nM and 0.14 nM, respectively) was significantly higher than that of the wild type TIMP-1 (K.sub.i.sup.app>150 nM in both occasions).

Example 2: Co-Localization of T1.SUP.PrTACE .with MT1-MMP and TACE on the Cell Surface

(26) 1. Lentiviruses carrying TIMP-1 and T1.sup.PrTACE cDNAs were prepared as follows: a. Wild type TIMP-1 (GenBank: S68252.1) was amplified by PCR using the following primers: forward primer: 5-GCAGCAGAATTCACCATGGCCCCCTTTGAGCCCCTGGCT-3 (EcoR I restriction site is underlined, as shown in Seq ID No. 6), and reverse primer: 5-TCAACTGGGGCCCTTAGGCTATCTGGGACCGCAGGGACTG-3 (Apa I restriction site is underlined, as shown in Seq ID No. 7). b. Likewise, T1.sup.PrTACE cDNA was similarly prepared, wherein the forward primer was identical to that for TIMP-1, the reverse primers were composed of three overlapping primers {circle around (1)}5-GGCCTGAGATTCCCTCTCGTACTGGGCTATCTGGGACCGCAGGGACTG-3, as shown in Seq ID No. 8: {circle around (2)} 5-CACAGGTGGGGAGGAGAAGAGGACCATGCTCGATCCTCTCTGGTAATAGGCCTGA GATTCCCTCTCGTACTG-3, as shown in Seq ID No. 9; and {circle around (3)} 5-TAAACGGGCCCTCATCCCACTATTAGGAAGATGAGGAAAGAGATCAGGAGGATCA CAGGTGGGGAGGAGAAG AGGAC-3, as shown in Seq ID No. 10. In short, one forward and three (overlapping) reverse primers were used to generate T1.sup.PrTACE cDNA that carries a GPI signal peptide at the C-terminus. c. The PCR amplicons were digested with EcoR I and Apa I for insertion into pLVX-puro (Takara) vector. The plasmids were sequenced to ensure that no unwanted mutation had been introduced during the PCR amplification process. d. pLVX-puro plasmids containing TIMP-1 and T1.sup.PrTACE cDNAs were extracted and purified with a Maxiprep plasmid kit (AXYGEN) for downstream packaging application. e. Lenti-X One-Shot Packaging mix (Takara 631276) was dissolved in 0.5 ml sterile water and mixed with 10 g of TIMP-1 or T1.sup.PrTACE plasmid DNA. f. The packaging-plasmid mix were added to Lenti-X 293T cells in 10 cm cell culture plates to allow for viral packaging in a humidified cell culture incubator. Media containing lentivirus was harvested 3 days later. g. CaKi-1 cells were transduced with lentivirus containing TIMP-1/T1.sup.PrTACE and stably transduced cells were obtained by selection with puromycin (1 g/mL).

(27) 2. Co-localization of T1.sup.PrTACE with MT1-MMP and TACE on the Cell Surface

(28) The study was performed according to the method disclosed in the following document: Jiang B, Zhang Y, Liu J, et al. Ensnaring membrane type 1-matrix metalloproteinase (MT1-MMP) with tissue inhibitor of metalloproteinase (TIMP)-2 using the haemopexin domain of the protease as a carrier: a targeted approach in cancer inhibition. Oncotarget, 2017, 8(14): 22685.

(29) Specific procedures are as follows. (1) CaKi-1 cells stably expressing TIMP-1 and T1.sup.PrTACE were seeded on a chamber slide and cultured for 2 days at 37 C. (2) The cells were fixed in 4% paraformaldehyde for 10 minutes followed by rinsing with PBS for 3 times. (3) Following a 2-hour blocking with 5% bovine serum albumin (BSA)/PBS, two antibody pairs TIMP-1+MT1-MMP or TIMP-1+TACE were added to the slide for overnight incubation at 4 C. (4) The slide was rinsed three times with PBS, 5 minutes each. (5) Anti-mouse/rabbit secondary antibodies were added to the slide. Incubation was allowed at room temperature for 2 hours. (6) Following rinsing with PBS, the slides were mounted in ProLong Antifade reagent and inspected under a confocal laser scanning microscope.

(30) Result: As shown in FIGS. 3A and 3B: owe largely to its high solubility, wild type TIMP-1 was not detected on the cell membrane. In contrast, T1.sup.PrTACE was found to be present in abundance on the cell surface and in association with MT1-MMP or TACE.

Example 3: T1.SUP.PrTACE .Inhibits Gelatin Degradation by MT1-MMP in HT1080 Cells

(31) The study was performed according to the methods disclosed in the following document: Jiang B, Zhang Y, Liu J, et al. Ensnaring membrane type 1-matrix metalloproteinase (MT1-MMP) with tissue inhibitor of metalloproteinase (TIMP)-2 using the haemopexin domain of the protease as a carrier: a targeted approach in cancer inhibition. Oncotarget, 2017, 8(14): 22685.

(32) Specific procedures are as follows: 1. HT1080 cells were infected with lentivirus bearing TIMP-1 and T1.sup.PrTACE genes as described under Example 2.1. Using the same procedures, HT1080 cells stably expressing TIMP-1 and T1.sup.PrTACE were generated. 2. Nunc LabTek II Chamber Slides were pre-coated with fluorescent gelatin (0.5 mg/mL; overnight). 3. Following rinsing with PBS, the cells were fixed with 4% paraformaldehyde for 10 minutes. 4. The slides were rinsed with PBS for 5 times to ensure the complete removal of paraformaldehyde 5. HT1080 cells stably transduced with TIMP-1 or T1.sup.PrTACE were seeded on the chamber slides and incubated overnight at 37 C. 6. The cells were fixed with paraformaldehyde and washed with PBS following the procedure in steps (3) and (4) above. 7. Cell membrane permeabilization was carried out by incubation with cold methanol for 20 min; wash slides with PBS for three times. 8. The slides were blocked with 5% BSA in 0.3% Triton X-100 before MT1-MMP antibody was added for overnight incubation at 4 C. 9. Following washing with PBS, the cells were incubated with a secondary antibody at room temperature for 2 hours.

(33) Result: FIG. 4: HT1080 cells stably expressing T1.sup.PrTACE demonstrates a much lower gelatinolytic ability than wild type TIMP-1-expressing cells.

Example 4: T1.SUP.PrTACE .Inhibits TACE-Mediated TNF- and HB-EGF Shedding

(34) The study was performed according to the method disclosed in the following document: Duan J X, Rapti M, Tsigkou A, Lee M H. Expanding the activity of tissue inhibitors of metalloproteinase (TIMP)-1 against surface-anchored metalloproteinases by the replacement of its C-terminal domain: Implications for anti-cancer effects [J]. PloS one, 2015, 10 (8): e0136384.

(35) Specific procedures are as follows: 1. 110.sup.5 of unmodified, TIMP-1 or T1.sup.PrTACE-transduced HT1080 cells were seeded in triplicates in a 24-well plate and cultured overnight. 2. 0.1 g of HB-EGF/TNF- plasmid was transfected into the cells and cultured for 2 days. 3. To induce shedding by TACE, the culture medium was replaced with fresh DMEM containing 200 ng/mL phorbol-12-myristate-13-acetate (PMA) (or no PMA as controls). Shedding was allowed for 3 hours at 37 C. 4. Media containing shed HB-EGF/TNF- was collected and used for analysis. 5. Colorimetric assay on HB-EGF (PMA/+PMA 200 ng/ml) was conducted by adding the media to an alkaline phosphate substrate in diethanolamine buffer at 37 C. until a change in color was detected. 6. The amount of HB-EGF released was read by a microplate reader 7. The amount of shed TNF- (PMA/+PMA 200 ng/ml) was assayed using a TNF- ELISA kit (Sino Bio).

(36) Result: The lower level of soluble HB-EGF and TNF- detected in T1.sup.PrTACE media indicates that T1.sup.PrTACE is more efficient at TACE inhibition than wild type TIMP-1.

Example 5: Unlike Wild Type TIMP-1. T1.SUP.PrTACE .has No Cell Potentiation Activity

(37) Materials: T175 flasks (Corning), cell count wafers (Invitrogen), 1 ml syringes

(38) Reagents: 0.4% trypan blue solution (Sigma), DMEM

(39) Instruments: automatic cell counter (Invitrogen), caliper, balance

(40) Method: 1. Unmodified CaKi-1 cells and CaKi-1 cells stably expressing wild type TIMP-1 or T1.sup.PrTACE were cultured in 20-cm dishes until the number of cells required was reached. 2. The cells were resuspended in DMEM to the concentration of 210.sup.6 cells/mL for each cell type. 3. NOD/SCID mice were randomly divided into three groups, namely: control group, TIMP-1 group and T1.sup.PrTACE group, each consisting of eight mice. 4. 210.sup.5 of cells (equivalent to 0.1 mL of cell suspension) were injected subcutaneously into the left and right flanks of the mouse abdomens. 5. Tumor formation was monitored for 35 days with a digital caliper. 6. At the end of the experiment, the mice were sacrificed and the tumors collected and weighed.

(41) Results: FIG. 6, of the eight mice implanted with TIMP-1-expressing CaKi-1 cells, six developed tumors of various sizes ranging between 20 mm.sup.3 and 248 mm.sup.3 in volumes. In contrast, no tumor was found in mice from the control and T1.sup.PrTACE groups (*p<0.05). The result shows that, unlike the wild type TIMP-1, T1.sup.PrTACE has no cell potentiation activity.

Example 6: Preparation and Detection of BHK-21 Cells Expressing T1.SUP.PrTACE .(Named BHK+T1.SUP.PrTACE.)

(42) 1. BHK-21 cells were transduced with lentivirus bearing T1.sup.PrTACE or wild type TIMP-1 genes as described in Example 2.1. Stable cell line selection was carried out with puromycin (named BHK+T1.sup.PrTACE hereafter). 2. BHK+T1.sup.PrTACE cells were seeded onto a chamber slide, fixed, blocked, rinsed and incubated overnight with TIMP-1 antibody (Abcam, ab1827). 3. The slide was rinsed three times with PBS and incubated with a secondary antibody at room temperature for 2 hours. 4. Following washing with PBS, the cells were inspected with a fluorescence microscope. Result: FIG. 8, Upper panel: nucleus staining with 4,6-diamine-2-phenylindole (DAPI). Lower panel: whilst no trace of TIMP-1 could be found on the surface of unmodified BHK-21 cells. TIMP-1 was found to be present in abundance on the surface of BHK+T1.sup.PrTACE cells.

Example 7: BHK+T1.SUP.PrTACE.:Matrigel Composition Inhibits CaKi-1 Renal Carcinoma Cell Proliferation

(43) Method: 1. For the ease of identification, Caki-1 cells were stably transduced with a lentivirus bearing a RFP (purchased from Genomeditech Co., Ltd.). 2. BHK+T1.sup.PrTACE and CaKi-1 cells were premixed at the final concentration of 2.510.sup.5 cells/mL for each cell type (1:1 ratio) on ice in 50% Matrigel/DMEM supplemented with 5% FBS. 3. The cell-Matrigel mixture was dispensed as 8 L micro droplets onto the center of the wells of a 24-well tissue culture plate and allowed to solidify for at least 30 minutes in a 37 C. incubator before 1 mL DMEM/5% FBS was added to the wells. 4. Incubation was allowed for up to 37 days. 5. At the end of the incubation period, the cells were inspected and photographed with a fluorescence microscope.

(44) Results: FIG. 9: BHK+T1.sup.PrTACE formed spheroid-like structure, capturing within the structure CaKi-1 cells that happened to be in the vicinity.

Control Example 1: Comparing the Inhibitory Potency of BHK-21 and BHK+T1.SUP.PrTACE .Spheroids on Caki-1 Growth

(45) Method: 1. BHK+T1.sup.PrTACE group: BHK+T1.sup.PrTACE and CaKi-1 cells were premixed at the final concentration of 2.510.sup.5 cells/mL for each cell type (1:1 ratio) on ice in 50% Matrigel/DMEM supplemented with 5% fetal bovine serum (FBS). The cell-Matrigel mixture was dispensed as 8 L micro droplets onto the center of the wells of a 24-well tissue culture plate and allowed to solidify for at least 30 minutes in a 37 C. incubator before 1 mL DMEM/5% FBS was added to the wells. 2. Unmodified BHK-21 group: BHK+T1.sup.PrTACE cells were replaced by the same number of unmodified BHK-21 cells following the exact procedure as described in step (1) above. 3. Control group: RFP-labelled CaKi-1 cells were cultured in the absence of BHK-21 cells, following the same procedure/medium as described in step (1) above.

(46) At the end of the incubation period, the number of fluorescent CaKi-1 cells in the spheroids was counted, averaged and analyzed.

(47) Result I:

(48) FIG. 10: BHK-21 expressing T1.sup.PrTACE demonstrated a significantly better anti-proliferative and anti-growth activities on CaKi-1 cells than unmodified BHK-21 cells.

(49) Result II:

(50) At the end of the incubation, the number of RFP-labelled cancer cells in the spheroid was counted, averaged and analyzed.

(51) As shown in Table 2: the number of surviving CaKi-1 cells in the BHK+T1.sup.PrTACE group was only one tenth of that of the unmodified BHK-21 group (p=0.00132). The data further strengthen the finding that BHK+T1.sup.PrTACE cells are more effective at CaKi-1 inhibition than unmodified BHK-21 cells.

(52) TABLE-US-00002 TABLE 2 Number of Number of seeded CaKi-1 surviving CaKi-1 cells cells after 37 days CaKi-1 5,000 495,000 113,812 CaKi-1 + BHK-21 5,000 850 339 CaKi-1 + BHK-21 + T1.sup.PrTACE 5,000 85 13

Control Example 2: Comparing the Inhibitory Potency of BHK-21 and BHK+T1.SUP.PrTACE .Spheroids on HeLa Cell Growth

(53) Method: the procedure employed for HeLa cells in this case was identical to those of the Control example 1 (CaKi-1).

(54) Result I:

(55) FIG. 12: the fluorescence intensity of surviving HeLa cells in the BHK+T1.sup.PrTACE group was much lower than that of the unmodified BHK-21 group. The data show that BHK+T1.sup.PrTACE cells are more effective in encapsulating and restricting the growth of HeLa cells than unmodified BHK-21 cells.

(56) Result II:

(57) FIG. 13: the number of surviving HeLa cells was counted, averaged and analyzed at the end of the 28-day incubation period.

(58) Table 3 show that the number of surviving HeLa cells in BHK+T1.sup.PrTACE group was significantly lower than that of the unmodified BHK-21 group (p<0.0001).

(59) TABLE-US-00003 TABLE 3 Number of Number of seeded HeLa surviving HeLa cells cells after 28 days HeLa-1 5,000 1,536,000 195,414 HeLa + BHK-21 5,000 185,100 29,639 HeLa + BHK-21 + T1.sup.PrTACE 5,000 6,999 4,858

(60) Results from the study confirm that BHK+T1.sup.PrTACE is more effective in inhibiting HeLa cells than unmodified BHK-21 cells.

(61) Data presented above illustrate and describe the basic principles, main features and advantages of the present invention. It must be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and description merely describe the principles of the present invention. Various modifications and improvements may be made to the present invention without departing from the spirit and scope of the present invention. These modifications and improvements are within the scope of the present invention. The scope of the present invention is defined by the appended claims and equivalents thereof.