INHIBITING OR DOWNREGULATING GLYCOGEN SYNTHASE BY CREATING PREMATURE STOP CODONS USING ANTISENSE OLIGONUCLEOTIDES
20210030893 ยท 2021-02-04
Inventors
- Carol A. Nelson (Westford, MA, US)
- Bruce M. Wentworth (Northborough, MA, US)
- Ronald K. Scheule (Hopkinton, MA)
- Timothy E. Weeden (Sturbridge, MA, US)
- Nicholas P. Clayton (Sudbury, MA, US)
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present disclosure relates to antisense oligonucleotides (AONs) for modulating the expression of glycogen synthase. AONs of the present disclosure may be useful in treating diseases associated with the modulation of the expression of the enzyme glycogen synthase, such as Pompe disease. Also provided by the present disclosure are compositions comprising AONs, as well as methods of down regulating mRNA coding for glycogen synthase, methods for reducing glycogen synthase in skeletal and cardiac muscle, and methods for treating Pompe disease.
Claims
1. A method of down regulating mRNA coding for glycogen synthase comprising administering an effective amount of an antisense oligonucleotide to an animal, wherein the antisense oligonucleotide comprises a sequence complementary to a nucleic acid sequence encoding for glycogen synthase, and wherein the hybridization of the antisense oligonucleotide to the nucleic acid sequence encoding for glycogen synthase induces exon skipping.
2. The method of claim 1, wherein the antisense oligonucleotide is a PMO.
3. The method of claim 1, wherein the antisense oligonudeotide is a PMO linked to a CPP.
4. The method of claim 1, wherein the antisense oligonudeotide is selected from an oligonucleotide comprising subunits of one of Formula I-VI.
5. The method of claim 1, wherein mRNA coding for glycogen synthase is reduced by 80%.
6. The method of claim 1, wherein mRNA coding for glycogen synthase is reduced by 90%.
7. The method of claim 1, wherein mRNA coding for glycogen synthase is reduced by 95%.
8. The method of claim 1, wherein the effective amount ranges from 5 to 500 mg per dose.
9. The method of claim 1, wherein the compound is administered intravenously.
10. The method of claim 1, wherein the down regulation of mRNA coding for glycogen synthase occurs in skeletal and cardiac muscle.
11. The method of claim 1, wherein the antisense oligonucleotide is at least 85% complementary to the nucleic acid sequence encoding for glycogen synthase.
12. The method of claim 1, wherein the antisense oligonucleotide is at least 90% complementary to the nucleic acid sequence encoding for glycogen synthase.
13. The method of claim 1, wherein the antisense oligonucleotide is at least 95% complementary to the nucleic acid sequence encoding for glycogen synthase.
14. A method for reducing glycogen synthase in skeletal and cardiac muscle comprising administering to an animal an effective amount of an antisense oligonucleotide to an animal, wherein the antisense oligonucleotide comprises a sequence complimentary to a nucleic acid sequence encoding for glycogen synthase, and wherein the hybridization of the antisense oligonucleotide to the nucleic acid sequence encoding for glycogen synthase induces exon skipping.
15. A method for treating Pompe disease comprising administering to an animal an effective amount of an antisense oligonucleotide to an animal, wherein the antisense oligonucleotide comprises a sequence complimentary to a nucleic acid sequence encoding for glycogen synthase, and wherein the hybridization of the antisense oligonucleotide to the nucleic acid sequence encoding for glycogen synthase induces exon skipping.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
DEFINITIONS
[0027] Glycogen synthase is an enzyme involved in converting glucose into glycogen. In humans there are two different forms called isozymes or isoforms, glycogen synthase 1 and glycogen synthase 2, which are encoded for by the genes GYS1 and GYS2, respectively. Glycogen synthase 1 is located in muscles and other tissues, and glycogen synthase 2 is found only in the liver. GYS1 encodes for a pre-mRNA that has 16 exons. Exemplary human GYS1 sequences may be found at NCBI Reference Sequence: NM_002103.4 also shown in SEQ ID NO.: 1 (DNA/RNA) and SEQ ID NO.: 2 (CDS) or via the Human Gene Nomenclature Committee at HGNC: 4706 (see
[0028] The term RNA target refers to an RNA transcript to which a morpholino binds in a sequence specific manner. In some embodiments the RNA target is one or more GSY1 mRNA or pre-mRNA molecules.
[0029] Morpholino or morpholino antisense oligonucleotide refer to an oligonucleotide analog composed of morpholino subunit structures, where (i) the structures are linked together by phosphorus-containing linkages, one to three atoms long, preferably two atoms long, and preferably uncharged or cationic, joining the morpholino nitrogen of one subunit to a 5 exocyclic carbon of an adjacent subunit, and (ii) each morpholino ring bears a purine or pyrimidine base-pairing moiety effective to bind, by base specific hydrogen bonding, to a base in a polynucleotide. In some embodiments, the morpholino binds to an RNA target which blocks translation of the RNA target into a protein. In other embodiments, the morpholino prevents aggregation of the RNA target with itself or with other cellular RNAs, proteins, or riboproteins, such as, but not limited to, RNAs, proteins, and riboproteins associated with the cellular mRNA splicing apparatus.
[0030] An individual can be a mammal, such as any common laboratory model organism, or any other mammal. Mammals include, but are not limited to, humans and non-human primates, farm animals, sport animals, pets, mice, rats, and other rodents.
[0031] As used herein. treatment (and grammatical variations thereof such as treat or treating) refers to clinical intervention designed to alter the natural course of the individual or cell being treated during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
[0032] As used herein, prevention Includes providing prophylaxis with respect to occurrence or recurrence of a disease or the symptoms associated with a disease in an individual. An individual may be predisposed to, susceptible to, or at risk of developing a disease, but has not yet been diagnosed with the disease.
[0033] An effective amount or therapeutically effective amount refers to an amount of therapeutic compound, such as an antisense oligomer, administered to a mammalian subject, either as a single dose or as part of a series of doses, which is effective to produce a desired therapeutic effect. For an antisense oligomer, this effect is typically brought about by inhibiting translation or natural splice-processing of a selected target sequence.
[0034] As used herein, the singular form a, an, and the includes plural references unless indicated otherwise.
[0035] It is understood that aspects and embodiments of the invention described herein include comprising, consisting, and consisting essentially of aspects and embodiments.
[0036] It is intended that every maximum numerical limitation given throughout this specification includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.
DETAILED DESCRIPTION OF THE INVENTION
[0037] Acid maltase or -glucosidase (GAA) is a lysosomal enzyme that catalyzes the breakdown of glycogen to glucose. Mutations in the GAA gene that lead to a reduction in the amount or activity of the enzyme are the molecular basis of Pompe disease (glycogen storage disease type II). This autosomal recessive metabolic myopathy results as a consequence of the progressive accumulation of undegraded glycogen, primarily in the lysosomes of cardiac and skeletal muscle. Patients with Pompe disease (incidence of approximately 1 in 40,000) present with a broad spectrum of disease severity that is inversely correlated with the amount of residual enzyme activity. Complete loss of enzyme activity results in an Infantile presentation (so called floppy babies) with affected individuals rarely living beyond 2 years of age. Varying degrees of residual enzyme activity lead to a progressive myopathy in young adults as well as older individuals that is invariably fatal.
[0038] Pompe disease is managed by periodic infusions of a recombinant enzyme (rhGAA) preparation that gained regulatory approval in 2006. Systemic infusion of rhGAA has been shown in clinical trials to improve cardiomyopathy and prolong survival in children and to improve walking ability as well as stabilize pulmonary function in adults. However, it is evident from long-term survivors that despite the availability of enzyme therapy, patients still present with some aspects of the disease. For example, residual muscle weakness and hearing loss are still evident, and the risk for developing arrhythmias, dysphagia and osteopenia remain undiminished. These residual deficits may be due in part to inefficient delivery of the enzyme to some of the affected tissues or to the host Immune response to the administered protein. In response to these unmet medical needs, modified forms of rhGAA conjugated with mannose 6-phosphate-bearing oligosaccharides or engineered to express a portion of IGF-1 have been developed that show improved delivery to muscle and bioactivity in animal studies. In addition, a small molecule chaperone that reportedly improves the stability of the enzyme and enhances glycogen clearance in Pompe mice is being tested clinically. Gene therapy with recombinant AAV vectors encoding the enzyme deficient in Pompe disease is also being evaluated as a treatment modality.
[0039] Substrate reduction that abates the production of glycogen represents yet another potential therapeutic strategy. The merits of this concept have been demonstrated in the context of the lysosomal storage disorders Gaucher and Fabry disease. Cytoplasmic glycogen polymers are synthesized through the action of glycogen synthase, whose activity is suppressed by phosphorylation of serines 641 and 645 in a process controlled by the mTORC1 pathway. Recent preclinical data have shown that glycogen synthase enzyme activity in Pompe mice is greatly elevated and that this increased activity could be suppressed by rapamycin treatment. Treating Pompe mice with rapamycin effectively reduced glycogen buildup in skeletal muscle, and when used in combination with rhGAA infusions lowered glycogen levels in skeletal muscle and diaphragm. Rapamycin treatment did not affect glycogen clearance in the heart, an organ already well served by rhGAA, perhaps due to the relatively high levels of the cation-independent mannose 6-phosphate receptors in cardiac tissue. An advantage of rapamycin as a substrate reduction approach was that Its impact on glycogen synthase was restricted to muscle, with no effect on the liver enzyme isoform. However, a disadvantage was that the lowest dose of rapamycin effective at reducing glycogen accumulation was also immunosuppressive.
[0040] The instant invention is directed to an alternative approach for reducing muscle glycogen levels in Pompe mice. Skeletal muscle glycogen synthase activity is the result of transcription of the Gys1 gene. In contrast, liver synthase activity is generated mostly by expression of the Gys2 gene and its encoded enzyme produces glycogen as a ready store of glucose for body-wide metabolism. Recent progress in developing therapies for Duchene muscular dystrophy has demonstrated that it is possible to deliver a therapeutically relevant dose of a phosphorodiamidate morpholino-based antisense oligonucleotide (PMO) for the purpose of skipping mutant exons and generating a truncated, albeit functional dystrophin. The PMO dose needed to restore dystrophin synthesis can be greatly reduced if it is conjugated to a cell penetrating peptide (PPMO). Delivery of a therapeutically relevant dose of a phosphorodiamidate morpholino-based antisense oligonucleotide (PMO) for the purpose of skipping mutant exons was utilized to induce exon skipping of the Gys1 mRNA for the purpose of reducing its transcript levels, presumably and without being limited as to theory, via nonsense mediated decay, with concomitant reductions in the skeletal muscle enzyme. Treating Pompe mice with a PPMO targeting a specific sequence in exon 6 of Gys1 mRNA (GS-PPMO) reduces in a dose dependent manner the Gys1 transcript in skeletal muscle and heart but not the Gys2 transcript in liver. Likewise, the glycogen synthase protein level is reduced in skeletal muscle and heart and synthase activity is restored. Consequently, glycogen accumulation is completely abated in skeletal muscle; the impact is less in the heart. These results Indicate that substrate reduction by antisense oligonucleotide (ASO)-mediated knock down of skeletal muscle glycogen synthase is a therapy, or an adjuvant therapy to enzyme replacement, for Pompe disease.
[0041] The present disclosure relates to oligomeric antisense compounds, i.e., AONs, such as phosphorodiamidate morpholino (PMO) compounds, peptide nucleic acids (PNAs). 2-O alkyl (e.g., methyl) antisense oligonucleotides, and tricyclo-DNA antisense nucleotides for use in modulating pre-mRNA and mRNA transcribed from GYS1. The present disclosure also includes other AONs that result from other nucleotide modifications, such as for example, a modification to one or more of the non-bridging oxygens in the phosphodiester linkage. Such modifications lead to, for example, phosphorothioates. The present disclosure relates to any AON that specifically hybridize with one or more of pre-mRNA or mRNA transcribed from GYS1 and induce a reduction in glycogen accumulation in a disease state. The AONs contemplated for use in the instant invention include those attached to a cell-penetrating peptide (CPP) to enhance delivery. The AON-CPP may comprise multiple AON, including PMO AON, attached to a single CPP. In at least one embodiment of the present disclosure the multiple AON-CPP conjugate further comprises a cathepsin cleavable linker. The cathepsin cleavable linker can occur in between the AON and the CPP or it can occur in a sequence such as AON-cathepsin linker-AON-cathepsin linker-CPP. In another embodiment, the multiple PMO-CPP conjugate further comprises a cathepsin cleavable linker. The cathepsin cleavable linker can occur in between the PMO and the CPP or it can occur in a sequence such as PMO-cathepsin linker-PMO-cathepsin linker-CPP.
[0042] As used herein, an AON specifically hybridizes to a target polynucleotide, such as pre-mRNA or mRNA, when the AON hybridizes to the target under physiological conditions. In the context of the present disclosure, hybridization occurs via hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary purine and pyrimidine bases. For example, adenine (A) and thymine (T) are complementary nucleobases which pair through the formation of hydrogen bonds.
[0043] AONs, such as PMO compounds, of the present disclosure are complementary to a target pre-mRNA or mRNA when hybridization occurs according to generally accepted base-pairing rules. e.g., adenine (A)-thymine (T), cytosine (C)-guanine (G), adenine (A)-uracil (U). In particular, complementary as used herein refers to the capacity for precise pairing between two nucleobases. For example, if a base (B) at a certain position of an AON is capable of hydrogen binding with a nucleotide at the same position of a pre-mRNA or mRNA molecule, then the AON and the pre-mRNA or mRNA molecule are considered to be complementary to each other at that position. The AON and pre-mRNA or mRNA target are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by bases that can hydrogen bond with each other. Thus, specifically hybridizable and complementary are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the AON, such as a PMO, and the pre-mRNA or mRNA target. Absolute complementarity, i.e., a 100% complementary base pair match, is not necessary as long as the heteroduplex formed between the target pre-mRNA or mRNA and the AON has sufficient stability to bring about the desired effect such as a reduction in glycogen accumulation.
[0044] According to the present disclosure, an AON, such as a PMO, is specifically hybridizable when binding of the AON to the target pre-mRNA or mRNA molecule Interferes with the normal function of the target pre-mRNA or mRNA molecule, and/or it brings about the desired effect, and there is a sufficient degree of complementarity to avoid intolerable non-specific binding of the AON to a non-target sequence under conditions in which specific binding is desired, for example under physiological conditions for in vivo applications or under conditions in which assays are performed for in vitro applications.
[0045] Such hybridization between an AON and pre-mRNA or mRNA interferes with their normal functions, such as translation of protein from the mRNA and splicing of the pre-mRNA to yield one or more mRNA species. In at least one embodiment of the present disclosure, the hybridization between the AON and pre-mRNA affects the splicing of the pre-mRNA to form stable RNA. In another embodiment the hybridization affects the translation of glycogen synthase 1 from mRNA.
[0046] AONs according to the present disclosure Include PMO compounds as well as PNA compounds, phosphoramidate compounds, methylene methylimino (MMI) compounds, 2-O-methyl compounds and 2-methoxy ethyl compounds, wherein the oligonucleobase of each subunit are set forth in
##STR00001## ##STR00002##
[0047] In the case of each of Formula 1-VI, B is a nucleotide base. The primary nucleobases are cytosine (DNA and RNA), guanine (DNA and RNA), adenine (DNA and RNA), thymine (DNA) and uracil (RNA), abbreviated as C, G, A. T. and U, respectively. A, G, C, and T appear in DNA, these molecules are called DNA-bases; A, G, C, and U are called RNA-bases. Uracil replaces thymine in RNA. These two bases are identical except that uracil lacks the 5 methyl group. Adenine and guanine belong to the double-ringed class of molecules called purines (abbreviated as R). Cytosine, thymine, and uracil are all pyrimidines (abbreviated as Y).
[0048] AON compositions can comprise morpholino oligonucleotide compositions. Morpholinos are synthetic molecules having a structure that closely resembles a naturally occurring nucleic acid. These nucleic acids bind to complementary RNA sequences by standard nucleic acid base pairing. Structurally, morpholinos differ from DNA or RNA in that these molecules have nucleic acid bases bound to morpholine rings instead of deoxyribose or ribose rings. Additionally, the backbone structure of morpholinos consists of non-ionic or cationic linkage groups instead of phosphates. For example, replacement of anionic phosphates with the uncharged phosphorodiamidate groups eliminates ionization in the usual physiological pH range, making morpholinos in organisms or cells uncharged molecules. Morpholinos are most commonly used as single-stranded oligos, though heteroduplexes of a morpholino strand and a complementary DNA strand may be used in combination with cationic cytosolic delivery reagents.
[0049] Unlike some other antisense structural types (e.g., phosphorothioates), morpholinos do not degrade their target RNA molecules. Instead, morpholinos act by steric blocking, i.e., binding to a target sequence within an RNA and sterically hindering molecules which might otherwise interact with the RNA. Bound to the 5-untranslated region of messenger RNA (mRNA), morpholinos can Interfere with progression of the ribosomal initiation complex from the 5 cap to the start codon. This prevents translation of the coding region of the targeted transcript (called knocking down gene expression). Some morpholinos knock down expression so effectively that after degradation of preexisting proteins the targeted proteins become undetectable by Western blot.
[0050] Morpholinos can also Interfere with pre-mRNA processing steps, usually by preventing splice-directing snRNP complexes from binding to their targets at the borders of introns on a strand of pre-RNA. Preventing U1 (at the donor site) or U2/U5 (at the polypyrimidine moiety and acceptor site) from binding can result in modified splicing, commonly leading to the exclusion of exons from a mature mRNA transcript. Splice modification can be conveniently assayed by reverse-transcriptase polymerase chain reaction (RT-PCR) and is seen as a band shift after gel electrophoresis of RT-PCR products.
[0051] Morpholinos have also been used to block intronic splice silencers and splice enhancers. U2 and U12 snRNP functions have been inhibited by morpholinos. Morpholinos targeted to slippery mRNA sequences within protein coding regions can induce translational frame shifts. Activities of morpholinos against this variety of targets suggest that morpholinos can be used as a general-purpose tool for blocking interactions of proteins or nucleic acids with mRNA.
[0052] In certain embodiments, the compositions of the present invention are composed of morpholino subunits linked together by uncharged phosphorus-containing linkages, one to three atoms long, joining the morpholino nitrogen of one subunit to the 5 exocyclic carbon of an adjacent subunit, wherein the base attached to the morpholino group is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide. The purine or pyrimidine base-pairing moiety is typically adenine, cytosine, guanine, uracil or thymine. Preparation of such oligomers is described in detail in U.S. Pat. No. 5,185,444, which is hereby incorporated by reference in its entirety. Variations can be made to this linkage as long as they do not interfere with binding or activity. For example, the oxygen attached to phosphorus may be substituted with sulfur (thiophosphorodiamidate). The 5 oxygen may be substituted with amino or lower alkyl substituted amino. The pendant nitrogen attached to phosphorus may be unsubstituted, monosubstituted, or disubstituted with (optionally substituted) lower alkyl. The purine or pyrimidine base pairing moiety is typically adenine, cytosine, guanine, uracil, thymine or inosine. The synthesis, structures, and binding characteristics of morpholinos are detailed in U.S. Pat. Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166, 315, 5,521,063, 5,506,337, and International Patent Application Publication No. WO 2008/036127 all of which are incorporated herein by reference.
[0053] In some aspects, the morpholino antisense oligonucleotides of the present invention can be complementary to the pre mRNA sequences in the transcript emanating from the GSY1 locus. In some embodiments, the morpholino antisense oligonucleotide is at least any of about 90%, 95%, or 100%, inclusive, including any percentages in between these values, identical to an mRNA target. In another embodiment, the morpholino antisense oligonucleotide binds to the GSY1 mRNA transcript in a sequence-specific manner. In some embodiments, the morpholino antisense oligonucleotide comprises a 5 amine modification. In another embodiment, the morpholino antisense oligonucleotide can be a phosphorodiamidate cationic peptide-linked morpholino antisense oligonucleotide.
[0054] The morpholino antisense oligonucleotides described herein are linked to a cationic peptide which facilitates systemic delivery of the morpholino antisense oligonucleotides into muscle cells. In general, a cationic peptide as described herein can be 8 to 30 amino acid residues in length and consist of subsequences selected from the group consisting of RXR, RX, RB, and RBR: where R is arginine (which may include D-arginine), B is -alanine, and each X is independently NH(CHR.sup.1).sub.nC(O), where n is 4-6 and each R.sup.1 is independently H or methyl, such that at most two R.sup.1's are methyl. In some embodiments, each R.sup.1 is hydrogen. In other embodiments, the cationic peptide can be any of 8, 9, 10, 11, 12, 13, 14, 15, 18, 17, 18, 19, 20, 21, 22, 23, 24, 25, 28, 27, 28, 29, or 30 amino acid residues in length. In another embodiment, the variable n is 5, e.g. as in 8-aminohexanoic acid. In one embodiment, the cationic peptide comprises the amino acid sequence Ac(RXRRBR).sub.2XB, where Ac is an acetyl group. In another embodiment, the cationic peptide comprises the amino acid sequence Ac(RXR).sub.4XB, where Ac is an acetyl group. Further information regarding synthesis and structure of cationic cell-penetrating peptides can be found in U.S. Patent Application Publication No. 2009/0099066, the disclosure of which is incorporated by reference herein in its entirety.
[0055] In one aspect, the cationic peptide is linked directly to the morpholino antisense oligonucleotide, in other embodiments, the cationic peptide is linked to the morpholino antisense oligonucleotide via a spacer moiety linked to the 5 end of the morpholino antisense oligonucleotide. The spacer moiety may be incorporated into the peptide during cationic peptide synthesis. For example, where a spacer contains a free amino group and a second functional group (e.g., a carboxyl group or an amino group) that enables binding to another molecular moiety, the spacer may be conjugated to a solid support used for peptide synthesis. Thereafter, the cationic peptide may be synthesized directly onto the spacer's free amino group by standard solid phase techniques. In some embodiments, the AON-CPP compound may comprise multiple AON, including PMO AON, attached to a single cationic peptide (CPP). In at least one embodiment of the present disclosure the multiple AON-CPP conjugate further comprises a cathepsin cleavable linker. The cathepsin cleavable linker can occur in between the AON and the CPP or It can occur in a sequence such as AON-cathepsin linker-AON-cathepsin linker-CPP. In another embodiment, the multiple PMO-CPP conjugate further comprises a cathepsin cleavable linker. The cathepsin cleavable linker can occur in between the PMO and the CPP or it can occur in a sequence such as PMO-cathepsin linker-PMO-cathepsin linker-CPP.
[0056] In another embodiment, the spacer moiety may be conjugated to the cationic peptide after peptide synthesis. Such conjugation may be achieved by methods well established in the art. In one embodiment, the linker contains at least one functional group suitable for attachment to the target functional group of the synthesized cationic peptide. For example, a spacer with a free amine group may be reacted with the cationic peptide's C-terminal carboxyl group. In some embodiments, the spacer moiety comprises:
##STR00003##
[0057] In one embodiment, the cationic peptide-linked morpholino antisense oligonucleotides have the following structure:
##STR00004##
wherein R.sup.2 is a cationic peptide (such as any of the cationic peptides disclosed herein), R.sup.3 is H, CH.sub.3 or CH.sub.2CONH.sub.2, and R.sup.4 is a morpholino antisense oligonucleotide comprising the sequence 5-(AGC).sub.n-3 (SEQ ID NO.: 5), 5-(GCA).sub.n-3 (SEQ ID NO.: 6), or 5-(CAG).sub.n-3(SEQ ID NO.: 7), wherein n is any of about 5-25. In another embodiment, the cationic peptide-linked morpholino antisense oligonucleotides can further comprise 1 to 2 additional morpholino nucleotides on the 5 and/or 3 end of the oligonucleotides.
[0058] In another aspect, the cationic peptide linked morpholino antisense oligonucleotide comprises
##STR00005##
wherein Ac is acetyl, R is arginine (which may include D-arginine), B is -alanine, each X is independently NH(CHR.sup.1).sub.nC(O), where n is 4-6 and each R.sup.1 is H, and R.sup.4 is a morpholino antisense oligonucleotide comprising a therapeutic sequence.
[0059] In another aspect, the cationic peptide linked morpholino antisense oligonucleotide comprises
##STR00006##
wherein Ac is acetyl, R is arginine (which may include D-arginine), B is -alanine, each X is independently NH(CHR.sup.1).sub.nC(O), where n is 4-6 and each R.sup.1 is H, and R.sup.4 is a morpholino antisense oligonucleotide comprising a therapeutic sequence.
[0060] In some embodiments, compound may include a variable sequencespacerlinker according to any of the sequences of Table 2 or Table 3; wherein R is L-arginine or arginine: X is 3-cis-aminocyclohexane or 1,3 cis-aminocyclohexane carboxylic acid; and Z Is cis-2-aminocyclopentane-1-carbonyl or cis-(1R,2S)-2-aminocyclopentane carboxylic acid. In some embodiments, X can be any combination of 0.1, or more residues that are R, X, and Z. In some embodiments, X can also include other types of residues, such as proline, glycine, or alanine, or additional modified or nonstandard amino acids. In some embodiments, the variable sequence includes alpha, beta, gamma, or delta amino acids, or cycloalkane structures. In some embodiments, the linker includes the sequence FS (SEQ ID NO.: 8). In some embodiments, the linker includes the sequence FSQ (SEQ ID NO.: 9) or FSQK (SEQ ID NO.: 10), wherein F is phenyalanine, S is serine, K is lysine and Q is glutamine. In some embodiments, the linker includes the sequence FxyB (SEQ ID NO.: 11), where x is any amino acid, standard or nonstandard, y is glutamic acid (E), aspartic acid (D), and lysine (K), serine (S), or threonine (T), and B is -alanine or -glycine.
TABLE-US-00001 TABLE 2 SEQ Hit Sequence Localization ID NO: 2C4 Ac-RXXXXXRRR(Ahx)FSQG-OH Nucleus 12 4G9 Ac-RXXXXXXRR(Ahx)FSQG-OH Nucleus 13 9F5 Ac-RXXXRXRXR(Ahx)FSQG-OH Nucleus 14 12G4 Ac-RRXXZXXXR(Ahx)FSQG-OH Nucleus 15 12D10 Ac-RRRXXXXXR(Ahx)FSQG-OH Nucleus 16 12D11 Ac-RXRXXXXXR(Ahx)FSQG-OH Nucleus 17 12E4 Ac-RRZXXXXXR(Ahx)FSQG-OH Nucleus 18 21A5 Ac-RXXXXZXZR(Ahx)FSQG-OH Nucleus 19 11G1 Ac-RXXZXRXXR(Ahx)FSQG-OH Cytosol 20 12D4 Ac-RRXRXXXXR(Ahx)FSQG-OH Cytosol 21 13D2 Ac-RRZXXZXXR(Ahx)FSQG-OH Cytosol 22
[0061] In another embodiment, the cationic peptide linked to the morpholino antisense oligonucleotide is one of the peptides in Table 3.
TABLE-US-00002 TABLE 3 SEQ Hit Sequence ID NO. 9H8 Ac-RXXXXXRXR(Ahx) 23 9H9 Ac-RZXXXXRXR(Ahx) 24 9H11 Ac-RXZXXXRXR(Ahx) 25 1A2 Ac-RRRRRRRRR(Ahx) 26 12D12 Ac-RZRXXXXXR(Ahx) 27 13D3 Ac-RXZXXZXXR(Ahx) 28 12D10 Ac-RRRXXXXXR(Ahx) 29 2C4 Ac-RXXXXXRRR(Ahx) 30 4G9 Ac-RXXXXXXRR(Ahx) 31 11F4 Ac-RXXXXRXXR(Ahx) 32 9F5 Ac-RXXXRXRXR(Ahx) 33 12D11 Ac-RXRXXXXXR(Ahx) 34 20B7 Ac-RXXXXXXZR(Ahx) 35 20C4 Ac-RXXZXXXZR(Ahx) 36 5D4 Ac-RXXXRZXRR(Ahx) 37 9H7 Ac-RRXXXXRXR(Ahx) 38 5B1 Ac-RXXXZXXRR(Ahx) 39 4H6 Ac-RXXZXXXRR(Ahx) 40 12D4 Ac-RRXRXXXXR(Ahx) 41 15A8 Ac-RXXXXXZXR(Ahx) 42 12D8 Ac-RXZRXXXXR(Ahx) 43 12E3 Ac-RZXXXXXXR(Ahx) 44 12H2 Ac-RXXZZXXXR(Ahx) 45 4G10 Ac-RZXXXXXRR(Ahx) 46 15H5 Ac-RXXXXZZXR(Ahx) 47 11F1 Ac-RXRXXRXXR(Ahx) 48 21C7 Ac-RRXXZZXZR(Ahx) 49 12E2 Ac-RXXXXXXXR(Ahx) 50 12E4 Ac-RRZXXXXXR(Ahx) 51 12G4 Ac-RRXXZXXXR(Ahx) 52 21A5 Ac-RXXXXZXZR(Ahx) 53
[0062] When employed as pharmaceuticals, the antisense oligonucleotides, including cationic peptide-linked morpholino antisense oligonucleotides, disclosed herein can be formulated with a pharmaceutically acceptable excipient or carriers to be formulated into a pharmaceutical composition.
[0063] When employed as pharmaceuticals, the antisense oligonucleotides, including cationic peptide-linked morpholino antisense oligonucleotides, can be administered in the form of pharmaceutical compositions. These compounds can be administered by a variety of routes including oral, rectal, transdermal, subcutaneous, intravenous, intramuscular, and intranasal. These compounds are effective as both Injectable and oral compositions. Such compositions are prepared in a manner well known in the pharmaceutical art and comprise at least one active compound.
[0064] This invention also includes pharmaceutical compositions which contain, as the active ingredient, one or more of the antisense oligonucleotides, including cationic peptide-linked morpholino antisense oligonucleotides, associated with one or more pharmaceutically acceptable excipients or carriers. In making the compositions of this invention, the active ingredient is usually mixed with an excipient or carrier, diluted by an excipient or carrier or enclosed within such an excipient or carrier which can be in the form of a capsule, sachet, paper or other container. When the excipient or carrier serves as a diluent, it can be a solid, semi-solid, or liquid material, which acts as a vehicle, carrier or medium for the active ingredient. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments containing, for example, up to 10% by weight of the active compound, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders.
[0065] In preparing a formulation, it may be necessary to mill the active compound to provide the appropriate particle size prior to combining with the other ingredients. If the active compound is substantially insoluble, it ordinarily is milled to a particle size of less than 200 mesh. If the active compound is substantially water soluble, the particle size is normally adjusted by milling to provide a substantially uniform distribution in the formulation, e.g. about 40 mesh.
[0066] Some examples of suitable excipients or carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl cellulose. The formulations can additionally include: lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl- and propylhydroxy-benzoates; sweetening agents; and flavoring agents. The compositions of the invention can be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to the patient by employing procedures known in the art.
[0067] The compositions are preferably formulated in a unit dosage form, each dosage containing from about 5 mg to about 100 mg or more, such as any of about 5 mg to about 10 mg, about 5 mg to about 20 mg, about 5 mg to about 30 mg, about 5 mg to about 40 mg, about 5 mg to about 50 mg, about 5 mg to about 60 mg, about 5 mg to about 70 mg, about 5 mg to about 80 mg, or about 5 mg to about 90 mg, inclusive, including any range in between these values, of the active ingredient. The term unit dosage forms refers to physically discrete units suitable as unitary dosages for individuals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient or carrier.
[0068] The cationic peptide-linked morpholino antisense oligonucleotides are effective over a wide dosage range and are generally administered in a therapeutically effective amount. It will be understood, however, that the amount of the cationic peptide-linked morpholino antisense oligonucleotides actually administered will be determined by a physician, in the light of the relevant circumstances, including the condition to be treated, the chosen route of administration, the actual compound administered, the age, weight, and response of the individual patient, the severity of the patient's symptoms, and the like.
[0069] For preparing solid compositions such as tablets, the principal active ingredient/cationic peptide-linked morpholino antisense oligonucleotide is mixed with a pharmaceutical excipient or carrier to form a solid preformulation composition containing a homogeneous mixture of a compound of the present invention. When referring to these preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.
[0070] The tablets or pills of the present invention may be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action. For example, the tablet or pill can comprise an inner dosage and an outer dosage component, the letter being in the form of an envelope over the former. The two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.
[0071] The liquid forms in which the novel compositions of the present invention may be incorporated for administration orally or by injection include aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as corn oil, cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as elixirs and similar pharmaceutical vehicles.
[0072] Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders. The liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described supra. The compositions can be administered by the oral or nasal respiratory route for local or systemic effect. Compositions in pharmaceutically acceptable solvents may be nebulized by use of inert gases. Nebulized solutions may be inhaled directly from the nebulizing device or the nebulizing device may be attached to a face mask tent, or intermittent positive pressure breathing machine. Solution, suspension, or powder compositions may also be administered, orally or nasally, from devices which deliver the formulation in an appropriate manner.
[0073] The overall effect of such interference with target pre-mRNA and mRNA transcribed from GYS1 is selective modulation of the expression of GYS1 and a change in glycogen accumulation. In the context of the present disclosure, modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. According to the present disclosure, inhibition is the preferred form of modulation of gene expression. The modulation of the expression of GYS1 is selective over the modulation of GYS2 according to the present disclosure because the pre-mRNA and RNA transcribed from GYS1 is targeted rather than pre-mRNA and RNA transcribed from GYS2.
[0074] In at least one embodiment, the ASO compound has from 15-25 subunits of a subunit selected from Formulas (I)-(VI). In another embodiment, the ASO compound has from 20-25 subunits of a subunit selected from Formulas (I)-(VI). In yet another ASO, the ASO compound has about 25 subunits of a subunit selected from Formulas (I)-(VI), such as from 24-26 subunits.
[0075] In a specific embodiment, the ASO, including a PMO, has a nucleobase sequence of one of the sequences of Table 4: Identification of active phosphorodiamidate morpholino oligomer (PMO) sequences designed to target Gys1.
TABLE-US-00003 TABLE4 %Gys1mRNA SEQID Morpholinosequence remaining NO: 1 TCAGGGTTGTGGACTCAATCATGCC 11114 54 2 AAGGACCAGGGTAAGACTAGGGACT 99.70.1 55 3 GTCCTGGACAAGGATTGCTGACCAT 8116 56 4 CTGCTTCCTTGTCTACATTGAACTG 897 57 5 ATACCCGGCCCAGGTACTTCCAATC 7910 58 6 CTGGACAAGGATTGCTGACCATAGT 724 59 7 AATTCATCCTCCCAGTCTTCCAATC 7120 60 8 TCCCACCGAGCAGGCCTTACTCTGA 8321 61
[0076] Gys1 mRNA levels were assessed in tibialis anterior muscles of C57BI/6 mice injected with individual PMOs as described in the Materials and Methods. The PMO sequence (in line 10) targeting exon 6 for skipping and referred to herein as GS-PMO produced the greatest impact on Gys1 mRNA levels as assessed by semi-quantitative PCR and was selected for subsequent studies.
[0077] AONs, such as PMO compounds, according to the present disclosure that specifically hybridize to a target sequence at or near a splice site of pre-mRNA transcribed from GYS1 can lead to inclusion of an intron in the mRNA or to skipping both the intron and the exon near the splice site target. Either event can lead to the introduction of a premature stop codon, or a frame shift producing a nonsense mRNA. The inclusion of an exon usually leads to the inclusion of a stop codon in the reading frame of that intron. A frame shift caused by exon skipping also often leads to a premature stop codon in the frame-shifted exon. Premature stop codons are recognized and degraded by the nonsense-mediated machinery leading to exo and endo-nucleolytic mRNA degradation. (Bhuvanagiri et al., 2010) The degradation of mRNA transcribed from GYS1 may lead to down regulating mRNA coding for glycogen synthase 1, a reduced amount of glycogen synthase 1, and ultimately alleviation of symptoms associated with the buildup of glycogen in the cells.
[0078] Accordingly, the present disclosure includes a method of down regulating mRNA coding for glycogen synthase 1 comprising administering to an animal an AON, such as a PMO, according to the present disclosure.
[0079] The present disclosure also includes a method for reducing glycogen synthase 1 in skeletal and cardiac muscle comprising administering to an animal an AON, such as a PMO, according to the present disclosure.
Examples
Methods and Materials
[0080] Design of Phosphorodiamidate Morpholino Oligomers
[0081] Phosphorodiamidate morpholino oligomers (PMOs) were designed to hybridize to Gys1 mRNA so as to invoke either exon skipping or translation inhibition as described by Morcos. The sequences designed to skip exons in Gys1 mRNA are as follows:
TABLE-US-00004 (SEQIDNO.:54) PMO1(5-TCAGGGTTGTGGACTCAATCATGCC-3)
targeted the intronic sequence proximal to the splice acceptor site of intron 7;
TABLE-US-00005 (SEQIDNO.:55) PMO2(5-AAGGACCAGGGTAAGACTAGGGACT-3)
targeted the intronic sequence proximal to the splice acceptor site of intron 4;
TABLE-US-00006 (SEQIDNO.:56) PMO3(5-GTCCTGGACAAGGATTGCTGACCAT-3)
targeted the exon-intron boundary of exon 8;
TABLE-US-00007 (SEQIDNO.:57) PMO4(5-CTGCTTCCTTGTCTACATTGAACTG-3)
targeted the intron-exon boundary of exon 5;
TABLE-US-00008 (SEQIDNO.:58) PMO5(5-ATACCCGGCCCAGGTACTTCCAATC-3)
targeted the exon-intron boundary of exon 14;
TABLE-US-00009 (SEQIDNO.:59) PMO6(5-CTGGACAAGGATTGCTGACCATAGT-3)
similar to PMO 3 also targeted the exon-intron boundary of exon 8;
TABLE-US-00010 (SEQIDNO.:60) PMO7(5-AATTCATCCTCCCAGTCTTCCAATC-3)
was designed to inhibit translation initiation by targeting a sequence 3 to the initiation codon of Gys1;
TABLE-US-00011 (SEQIDNO.:61) PMO8(5-TCCCACCGAGCAGGCCTTACTCTGA-3)
targeted the exon-intron boundary of exon 7;
TABLE-US-00012 (SEQIDNO.:62) PMO9(5-GACCACAGCTCAGACCCTACCTGGT-3)
targeted the exon-intron boundary of exon 6.
TABLE-US-00013 (SEQIDNO.:63) PMO10(5-TCACTGTCTGGCTCACATACCCATA-3)
targeted the exon-intron boundary of exon 5;
[0082] Conjugation of Cell-Penetrating Peptides to Morpholino Oligonucleotides
[0083] PPMO conjugation was conducted as previously described by Abes et al. J Control Release. Dec. 1, 2006; 116(3):304-313 with modifications. Peptide B (Ac(RXRRBR)2XBOH) (SEQ ID NO.: 64) was activated in dimethylformamide containing O-(6-Chlorobenzotriazol-1-yl)-N,N,N,N-tetramethyluronium hexafluorophosphate (HCTU)diisopropylethylamine (DIEA) at molar ratios of 1:2 per moles of peptide at room temperature (RT). The Morpholino, GS1-ES6, (5-TCACTGTCTGGCTCACATACCCATA-3) (SEQ ID NO.: 63) with a 5 primary amine modification was dissolved in dimethylsulfoxide and added to activated peptide at a 1.2-1.5:1 molar ratio of peptide:ASO and allowed to react at RT for 2 h; when completed the reaction was quenched with water. PPMO conjugates were separated from unbound PMO by isolation over carboxymethyl sepharose and eluted in 2M guanidine-HCl, 1M NaCl, pH 7.5, 20% acetonitrile. The eluate was dialyzed against several buffer exchanges of 0.1 mM NaHCO.sub.3 in a dialysis cassette with molecular weight cut-off of 3,000 Da. The dialyzed PPMO was quantified by spectrophotometric absorbance in 0.1N HCl at 265 nm, frozen, and lyophilized. Molecular weight of conjugated GS1-ES6 PPMO was confirmed by MALDI mass spectrometry.
[0084] In-Vivo Experiments
[0085] Animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (US Department of Health and Human Services, NIH Publication No. 86-23) and by Genzyme's IACUC committee.
[0086] Intramuscular TA Injections
[0087] Six week-old C57BL/6 mice were anesthetized with isoflurane and the tibialis anterior (TA) muscle was injected as previously described [Wheeler T M et al., J Clin Invest. December 2007; 117(12):3952-3957]. TA muscles were injected with 12 uL of 0.4 U/L bovine hyaluronidase 2 hours before PMO injection and electroporation. One TA was injected with 20 g (1 g/l) of various PMOs (Table 4) and the contralateral TA with 20 l phosphate buffered saline (PBS). Immediately following injection, the muscle was electroporated using the parameters of 100 V/cm, 10 pulses at 1 Hz, and 20 ms duration per pulse. Mice were euthanized two weeks after electroporation and TA muscle collected and snap frozen until analysis.
[0088] Systemic Administration
[0089] Six week-old male and female GAA.sup./ and C57BL/6 mice were employed to evaluate the efficacy of substrate inhibition using peptide-linked morpholinos. Tissues were collected from a cohort of animals at the start of the studies to serve as a baseline reference for the glycogen accumulation assay (n=10). GS-PPMO was dissolved in PBS and administered at 15 or 30 mg/kg bodyweight by tail vein injection once every 2 weeks for a total of 12 weeks (n=9-10). The positive control, rhGAA, was reconstituted in a buffer consisting of 25 mM sodium phosphate pH 6.2, 2% mannitol, and 0.005% polysorbate 80 and 20 mg/kg administered by tail vein injection once every 2 weeks for 12 weeks (buffer, n=10; rhGAA, n=10). To minimize the potential for a hypersensitivity reaction to rhGAA, mice were intraperitoneally pretreated with 5 mg/kg diphenhydramine starting at the third dose of rhGAA. Two weeks after the final dose mice were euthanized, tissues collected and snap frozen in liquid nitrogen for in vitro analyses or fixed in 10% neutral buffered formalin for histological analysis.
[0090] In-Vitro Experiments
[0091] RNA Analysis
[0092] Total RNA was isolated from frozen tissue using a commercially available kit with optional DNA digestion. RT-PCR was conducted using custom primers used for cDNA synthesis and PCR amplification. Primer sequences: Gys1 forward, 5-CTGGCGCTGTGGACTTCTA-3 (SEQ ID NO.: 65), Gys1 reverse, 5-ACACTGGTGGGAAAGACTGC-3 (SEQ ID NO.: 66). Gys2 forward, 5-CCAGCTTGACAAGTTCGACA-3 (SEQ ID NO.: 67), Gys2 reverse, 5-AAACACCCCAAGGTGACAAC-3 (SEQ ID NO.: 68), b-actin forward, 5-AGCCATGTACGTAGCCATCC-3 (SEQ ID NO.: 69) and b-actin reverse, 5-CTCTCAGCTGTGGTGGTGAA-3 (SEQ ID NO.: 70). RT-PCR products (25 cycles) were separated on 2% agarose gels containing ethidium bromide and scanned on a bio-imaging system. Band intensity was quantified using Image J software. Levels of Gys1 and Gys2 mRNA was determined relative to beta actin.
[0093] Preparation of Tissue Homogenates
[0094] Tubes containing frozen tissues with 6 (vol/wt) homogenization buffer designed to inhibit phosphatases and proteases (20 mM Tris/HCL, pH 7.5, 150 mM NaCl, 25 mM B-glycerophosphate, 20 mM Sodium Fluoride, 1 mM Sodium Orthovanadate, 2 mM Sodium Pyrophosphate, 2 mM EDTA and complete protease inhibitor cocktail were homogenized. Lysates were frozen for 24 hours at 80C. Thawed lysates were centrifuged 16.1 rcf for 15 minutes at 4C; the supernatants were aliquoted and stored at 80C. Protein determination of the lysates was performed with a Micro BCA kit.
[0095] Western Blot Analysis of Tissue Lysate
[0096] 50-100 g of tissue homogenate was boiled in 2 sample buffer containing dithiothreitol. The lysate was then applied to a 4-15% precast Tris/HCl-polyacrylamide gel. Proteins were transferred to nitrocellulose with a dry blot apparatus. The blots were blocked overnight with 3% milk and the appropriate antibody added at a final concentration of 0.02-0.08 ng/ml and incubated for 1 hr at room temp. The blot was then incubated with an HRP-conjugated secondary antibody for 1 hr at room temperature and treated with an ECL substrate detection kit as described by the manufacturer. Protein band intensity was quantified using Image J software. Levels of glycogen synthase 1 and 2 protein was determined relative to GAPDH.
[0097] Glycogen Synthase Activity Assay
[0098] Glycogen synthase activity in tissue lysates was measured using a gel filtration radioactivity assay as described previously [Niederwanger A et al., J of Chromatography B, 2005:820:143-145]. A 60 L reaction solution consisting of 10 g of protein lysate (2 ng/L), 4% glycogen, 30 mM UDP-glucose, 4.5 mM glucose-6-phosphate, homogenization buffer (described above) and labeled uridine diphosphate glucose [Glucose-.sup.14C-U] was incubated in a 37 C. water bath for 1 h, the reaction was stopped with 0.6N perchloric acid, and 50 L of the reaction was loaded onto a quick spin (G-50) sephadex columns and centrifuged at 1000g for 4 min. The eluted radiation was added to LSC cocktail and radiation was measured using a scintillation counter. Enzyme activity was calculated by determining the amount of UDP-[U.sup.14C]-glucose incorporated into glycogen per minute per milligram of protein
[0099] Measurement of Tissue Glycogen
[0100] Tissue glycogen levels were determined as previously described (Ziegler R J et al., Hum Gene Ther. June 2008; 19(6):609-211. Fluorescence was detected and analyzed using a micro-plate reader, 530 nm excitation and 590 nm emission, with acquisition and analysis software. Rabbit liver glycogen was used to construct the standard curve. Glycogen levels were determined by subtracting the glucose levels in the undigested samples from those in the digested samples.
[0101] Serum Chemistry
[0102] Whole blood was collected in serum separator tubes from the retro-orbital plexus of anesthetized mice one hour after the final dose of GS-PPMO. Blood was allowed to clot for thirty minutes and then centrifuged at 1300g for fifteen minutes. Serum was dispensed as aliquots and frozen at 20 C. until analysis. In-vitro diagnostic quantitative determination of chemistry analytes in serum was performed by spectrophotometric methods at 37 C.
[0103] Histology
[0104] Kidney and liver were collected from mice following euthanasia, fixed for up to 72 h in 10% neutral buffered formalin and processed for paraffin embedding. Serial 5 m-thick sections were generated and stained with hematoxylin and eosin solution. A board certified veterinary pathologist, blinded-to the treatments, evaluated the slides for qualitative analysis.
[0105] Statistical Analysis
[0106] Data is expressed as mean t SEM. Data analysis was performed using one way ANOVA and Newman-Keuls post-hoc. A probability value of P<0.05 was considered to be statistically significant.
[0107] PMO-based antisense oligonucleotide confers selective knockdown of Gys1 mRNA in murine muscle.
[0108] A collection of PMO antisense oligonucleotides was designed to selectively reduce the expression of the Isoform of glycogen synthase found mainly in skeletal muscle and heart with the potential to induce exon skipping in the cognate Gys1 but not the Gys2 transcript. Exon skipping was designed to introduce a premature stop codon into the Gys1 transcript to effect the production of an unstable mRNA prone to nonsense-mediated decay. Incorporation of a nonsense codon would also be expected, after translation, to lead to a non-functional enzyme.
[0109] Candidate ASOs were first tested by direct Injection into the TA muscle of mice followed by electroporation. One week later Gys1 mRNA levels were quantified. Twelve ASOs were tested and two resulted in what appeared to be a substantial reduction in Gys1 mRNA (Table 4). One PMO sequence in particular (number 10 in Table 4) targeted the skipping of exon 6 and was evaluated further.
[0110] The selected PMO was synthesized with a 5 primary amine to facilitate conjugation of a well-characterized arginine-rich cell penetrating sequence that had been shown previously to facilitate muscle delivery. This conjugated PMO (GS-PPMO) was injected through a tail vein into Pompe mice once every two weeks for a total of 12 weeks. Age-matched Pompe mice administered saline vehicle or 20 mg/kg recombinant -glucosidase (rhGAA) on the same schedule served as treatment controls. Age-matched wild type (C57BI/6) mice served as untreated controls. Analysis of tissue extracts from Pompe mice at the end of the study showed that treatment with either 15 or 30 mg/kg GS-PPMO significantly reduced Gys1 mRNA levels in the quadriceps and diaphragm muscle (
[0111] Systemic administration of GS-PPMO to Pompe mice selectively reduces glycogen synthase 1 levels.
[0112] Western blots were used to assess the degree to which the reductions in Gys1 mRNA led to concomitant reductions in glycogen synthase protein in muscle and liver. In Pompe mice, glycogen synthase protein was found to be substantially elevated in the skeletal muscle and in the heart compared to C57I/6 control animals (
[0113] Treatment of Pompe mice with GS-PPMO (15 or 30 mg/kg) lowered the amount of glycogen synthase in the quadriceps and diaphragm to wild type levels (
[0114] Systemic administration of GS-PPMO reduces glycogen synthase activity in the skeletal muscle and heart of Pompe mice.
[0115] Treating Pompe mice with GS-PPMO led to complete correction of the elevated glycogen synthase activity in the quadriceps (
[0116] Systemic treatment with GS-PPMO abates accumulation of tissue glycogen in Pompe mice.
[0117] Tissue extracts were subjected to quantitative glycogen analysis to determine whether the noted reductions in glycogen synthase protein levels and activity in GS-PPMO-treated Pompe mice also resulted in a concomitant lowering of lysosomal glycogen accumulation. Treating Pompe mice with GS-PPMO led to a dose dependent decrease in glycogen accumulation in the quadriceps and heart (
[0118] Systemic administration of GS-PPMO does not elicit overt changes in histopathology and blood chemistry.
[0119] The potential toxicologic impact of GS-PPMO treatment and knockdown of GYS1 mRNA was evaluated to assess the therapeutic index associated with administering a PMO-based ASO for Pompe disease. Pompe mice treated with either dose of GS-PPMO did not demonstrate significant differences in weight gain from mice in the control cohort (
[0120] GS-PPMO was capable of provoking Gys1 mRNA decreases in quadriceps, diaphragm and heart in a dose dependent manner. The bioactivity seen in the heart was only significant at the higher dose tested, a finding consistent with PPMOs tested for exon skipping of dystrophin (data not shown). GS-PPMO activity at the mRNA level appeared to be sequence specific as there was no impact on the liver isoform, Gys2. This finding was expected given that GS-PPMO is complementary to intron sequence in Gys1. The fact that GS-PPMO appears specific for the muscle enzyme suggests that its action will not interfere with systemic glucose mobilization in Pompe patients, which is governed by the predominant liver enzyme encoded by the Gys2 gene. Also as expected, administration of rhGAA had no impact on the steady state level of Gys1 or Gys2 mRNA in any tissue tested.
[0121] The GS-PPMO mediated knock down of Gys1 mRNA greatly reduced the amount of Gys1 protein in quadriceps and diaphragm at both doses tested, and also in the heart at the higher dose. These findings are impressive given the elevation of the protein in these tissues seen in Pompe mice compared to control animals. There was no change in the level of liver Gys2 protein which is consistent with the designed specificity of GS-PPMO towards Gys1 mRNA. The effect of GS-PPMO treatment on glycogen synthase enzyme activity in the quadriceps and heart was further evaluated and substantial reduction was found in both tissues as well as some noteworthy differences. Glycogen synthase activity was considerably elevated in the quadriceps and heart of Pompe mice; a finding consistent with the protein levels cited above and previous reports. Treating Pompe mice with GS-PPMO reduced activity in these tissues to very near the wild type levels found in C57BI/6 mice at both doses tested. This was also true in the heart but only with the higher dose employed. It is remarkable to note that even with the elevated level of GS-activity in the untreated Pompe heart, the administration of GS-PPMO (15 mg/kg) increased GS-activity further by 200-fold. Glycogen synthase activity is regulated at the level of protein phosphorylation that is controlled by environmental conditions through the mTOR pathway.
[0122] The effect of rhGAA and GS-PPMO treatment on glycogen build up in Pompe mice was also assessed. Analysis of quadriceps and diaphragm after treatment with rhGAA at 20 mg/kg both revealed modest declines in glycogen compared to vehicle-treated Pompe mice. Treatment with GS-PPMO was significantly more effective at abating glycogen build up in the quadriceps and diaphragm, the latter tissue being equally amenable to treatment with either dose. The heart showed complete abatement of glycogen build up by rhGAA treatment to a level even below that found in untreated C57BI/6 control mice. This is in contrast to the aforementioned increase in GS activity and may be due to the well-noted presence of CI-M6P receptors in the heart permitting greater efficacy of rhGAA in that tissue. GS-PPMO treatment resulted in a modest dose-dependent decline of glycogen build up in heart.
[0123] Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.