NOVEL ADENO-ASSOCIATED VIRUS VIRION FOR TREATMENT OF TAY-SACHS DISEASE AND SANDHOFF DISEASE
20210030823 ยท 2021-02-04
Inventors
- Kohji ITOH (Tokushima, JP)
- Daisuke TSUJI (Tokushima, JP)
- Shinichi Muramatsu (Tochigi, JP)
- Katsuhito ASAI (Kanagawa, JP)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
A61K48/005
HUMAN NECESSITIES
A01K2267/0318
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
A61K48/0075
HUMAN NECESSITIES
C12N9/2402
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61P25/28
HUMAN NECESSITIES
Abstract
According to a conventional method for treatment of Sandhoff disease and Tay-Sachs disease comprising administering a modified -subunit to a patient in the form of a protein, it is necessary that administration be performed frequently. This invention relates to a recombinant adeno-associated virus virion comprising: capsomere comprising a protein capable of forming a virus virion; and a polynucleotide packaged in the capsomere comprising a promoter sequence and nucleotide sequences operably linked to the promoter sequence encoding a first amino acid sequence derived from the amino acid sequence of the -subunit of wild-type human -hexosaminidase composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 by substitution of amino acids 312 to 318 with glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order and a second amino acid sequence, which is an amino acid sequence of a signal peptide linked to the N terminus of the first amino acid.
Claims
1. A recombinant adeno-associated virus virion comprising: a capsomere comprising a protein capable of forming a virus virion; and a polynucleotide packaged in the capsomere comprising a promoter sequence and nucleotide sequences operably linked to the promoter sequence encoding a first amino acid sequence derived from the amino acid sequence of the -subunit of wild-type human -hexosaminidase composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 by substitution of amino acids 312 to 318 with glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order and a second amino acid sequence, which is an amino acid sequence of a signal peptide linked to the N terminus of the first amino acid.
2. The virus virion according to claim 1, wherein the first amino acid sequence further involves substitution of amino acid 452 with asparagine and/or amino acid 453 with arginine in the amino acid sequence composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28.
3. The virus virion according to claim 2, wherein the first amino acid sequence comprises any of the amino acid sequences selected from (A) to (C): (A) the amino acid sequence composed of amino acids 31 to 532 in the sequence as shown in SEQ ID NO: 25; (B) an amino acid sequence derived from the amino acid sequence composed of amino acids 31 to 532 in the sequence as shown in SEQ ID NO: 25 by deletion, substitution, or addition of 1 to several amino acids other than the amino acids at the sites of substitution, wherein a protein comprising the amino acid sequence has an activity derived from the wild-type human -hexosaminidase -subunit and protease resistance; and (C) an amino acid sequence having at least 90% identity to the amino acid sequence composed of amino acids 31 to 532 in the sequence as shown in SEQ ID NO: 25, wherein a protein comprising the amino acid sequence has an activity derived from the wild-type human -hexosaminidase -subunit and protease resistance, provided that the amino acids at the site of substitution are identical to those in the amino acid sequence as shown in SEQ ID NO: 25.
4. The virus virion according to claim 1, wherein the second amino acid sequence is the amino acid sequence composed of amino acids 1 to 30 in the sequence as shown in SEQ ID NO: 25 or the amino acid sequence composed of amino acids 1 to 54 in the sequence as shown in SEQ ID NO: 28.
5. The virus virion according to claim 1, wherein the 5 terminus and the 3 terminus of the polynucleotide comprise the 5 terminal inverted terminal repeat (ITR) sequence and the 3 terminal inverted terminal repeat (ITR) sequence derived from AAV1, AAV2, AAV3, or AAV4.
6. The virus virion according to claim 1, wherein the 5 terminus and the 3 terminus of the polynucleotide comprise the nucleotide sequence as shown in SEQ ID NO: 13 and the nucleotide sequence as shown in SEQ ID NO: 14, respectively.
7. The virus virion according to claim 1, wherein the promoter sequence is a systemic promoter or neural cell-specific promoter sequence.
8. The virus virion according to claim 7, wherein the promoter sequence is a sequence of a systemic promoter selected from the group consisting of cytomegalovirus (CMV) promoter, EF-1 promoter, SV40 promoter, and CAG promoter.
9. The virus virion according to claim 7, wherein the promoter sequence is a sequence of a neural cell-specific promoter selected from the group consisting of Synapsin I promoter sequence, myelin basic protein promoter sequence, neuron-specific enolase promoter sequence, calcium/calmodulin-dependent protein kinase II (CMKII) promoter, tubulin I promoter, platelet-derived growth factor strand promoter, glial fibrillary acidic protein GFAP) promoter sequence, L7 promoter sequence (cerebellar Purkinje cell-specific promoter), and glutamate receptor delta-2 promoter (cerebellar Purkinje cell-specific promoter).
10. The virus virion according to claim 1, wherein the protein capable of forming a virus virion comprises an amino acid sequence having 90% or higher identity to the amino acid sequence of the VP capsid protein derived from the type 1, type 2, type 3, type 9, type rh10, type PHP.B, or type PHP.eB adeno-associated virus or an amino acid sequence derived from the amino acid sequence having 90% or higher identity to the amino acid sequence of the VP1 capsid protein by substitution of at least 1 surface-exposed tyrosine residue with another amino acid residue.
11. The virus virion according to claim 1, wherein the protein capable of forming a virus virion comprises an amino acid sequence derived from the amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 2, 4, or 6 by substitution of at least 1 surface-exposed tyrosine residue with another amino acid residue.
12. The virus virion according to claim 11, wherein the protein capable of forming a virus virion comprises an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 2, 4, or 6 by substitution of at least tyrosine 445, tyrosine 444, or tyrosine 446, respectively.
13. The virus virion according to claim 10, wherein the tyrosine residue is substituted with a phenylalanine residue.
14. The virus virion according to claim 1, wherein the protein capable of forming a virus virion comprises the amino acid sequence as shown in SEQ ID NO: 8, 10, or 12 or an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 8, 10, or 12 by deletion, substitution, insertion, and/or addition of 1 to several amino acids other than the amino acids 444 to 446 and is capable of forming a virus virion.
15. (canceled)
16. (canceled)
17. A method for treatment of Tay-Sachs disease and/or Sandhoff disease comprising administering the virus virion according to claim 1 to a patient who is in need of treatment of Tay-Sachs disease and/or Sandhoff disease.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
EMBODIMENTS OF THE INVENTION
1. Human -Hexosaminidase Modified -Subunit
[0078] The wild-type human -hexosaminidase 1-subunit is expressed in the form of an immature protein comprising the amino acid sequence composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 and an amino acid sequence of a signal peptide linked to the N terminus thereof, and it functions as a mature protein upon removal of the signal peptide. An example of the amino acid sequence of the signal peptide of the wild-type human -hexosaminidase -subunit is the amino acid sequence composed of amino acids 1 to 54 in the sequence as shown in SEQ ID NO: 28. Specifically, the wild-type human -hexosaminidase -subunit comprises the amino acid sequence as shown in SEQ ID NO: 28 during the immature stage.
[0079] In the present invention, the protein comprising the first amino acid sequence derived from the amino acid sequence composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 of the wild-type human -hexosaminidase -subunit by substitution of amino acids 312 to 318 with glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order (hereafter, referred to as the protein of the present invention or the modified -subunit) is a recombinant protein that had acquired an activity derived from the wild-type human -hexosaminidase -subunit by altering the structure of the wild-type human -hexosaminidase -subunit active site and protease resistance by altering the structure of the protease recognition site of the wild-type human -hexosaminidase -subunit. The protein or the modified -subunit of the present invention may be a mature protein consisting of the first amino acid sequence, or it may be an immature protein comprising the first amino acid sequence and the second amino acid sequence, which is an amino acid sequence of a signal peptide linked to the N terminus of the first amino acid sequence.
[0080] Examples of the second amino acid sequence, which is an amino acid sequence of a signal peptide linked to the N terminus of the first amino acid sequence, include the amino acid sequence composed of amino acids 1 to 30 in the sequence as shown in SEQ ID NO: 25 and the amino acid sequence composed of amino acids 1 to 54 in the sequence as shown in SEQ ID NO: 28.
[0081] When activity derived from the -subunit is acquired in the present invention, at the -subunit substrate binding site, the binding reactivity with the -subunit substrate becomes relatively increased from the binding reactivity with the -subunit substrate. Accordingly, a structural change concerning such properties is not limited to a structural change that makes the binding to the -subunit substrate completely impossible. A structural change that would cause the protein that had the binding reactivity with the -subunit substrate significantly higher than the binding reactivity with the -subunit substrate to have a significantly increased binding reactivity with the -subunit substrate is within the scope of the present invention. When activity derived from the -subunit is acquired, in particular, the protein preferably has the -subunit substrate specificity. When the protein has -subunit substrate specificity, the active site structure (in particular, the position and the type of the amino acid residue that plays a key role in substrate binding reactivity) and the presence of the loop structure necessary for aggregation with (binding to) the GM2 activation factor are identical to those of the -subunit.
[0082] When protease resistance is acquired, the protein becomes uninfluenced or less likely to be influenced by protease-induced hydrolysis as a result of a structural change at the protease recognition site (i.e., the protein is not hydrolyzed or less likely to be hydrolyzed by a protease).
[0083] Protein structures concerning the properties described above can be changed in the manner described below.
[0084] The structure of the n-subunit active site can be changed to acquire the -subunit-derived activity in accordance with the method described in detail in WO 2010/082622.
[0085] On the basis of the x-ray crystal structure information on human Hex A (the heterodimer of the -subunit and the -subunit) and Hex B (the homodimer of the -subunit), specifically, an amino acid residue within an active pocket to recognize the GM2 ganglioside as a substrate and an amino acid residue associated with binding to the GM2 activator (that plays a role in association between the enzyme and its substrate; i.e., GM2 ganglioside) of the -subunit are identified, and regions of the -subunit molecules corresponding to the identified amino acid residues are substituted with the particular amino acid residues identified in the -subunit. The term corresponding regions used herein refers to sites arranged in parallel when the amino acid sequences are aligned by inserting a gap into one of the sequences, according to need, so as to maximize the amino acid sequence identity between the -subunit and the -subunit. Amino acid sequence alignment can be performed with the use of a well-known method in the art, such as sequence analysis software (e.g., BLAST (Basic Local Alignment Search Tool at the National Center for Biological Information, U.S.A.) with default (initial) parameters.
[0086] Examples of sites in the -subunit corresponding to amino acid residues in an active pocket of the -subunit to recognize the GM2 ganglioside as a substrate include amino acid 452 and amino acid 453. Examples of amino acid residues associated with binding to the GM2 activator of the -subunit in the -subunit include amino acids 312 to 315.
[0087] In the protein of the present invention, amino acids 312 to 315 of the -subunit may be substituted in order to acquire the -subunit-derived activity. In the protein of the present invention, preferably, amino acids 312 to 315 and amino acid 452 and/or amino acid 453 of the -subunit may be substituted in order to acquire the -subunit-derived activity. In the protein of the present invention, more preferably, amino acids 312 to 315, amino acid 452, and amino acid 453 of the -subunit may be substituted in order to acquire the -subunit-derived activity.
[0088] The amino acids in the -subunit can be substituted in accordance with corresponding amino acids in the -subunit. Specifically, amino acids 312 to 315 are substituted with glycine, serine, glutamic acid, and proline in that order, amino acid 452 is substituted with asparagine, and amino acid 453 is substituted with arginine.
[0089] A structural change in the -subunit active site aimed at acquisition of protease resistance can be performed by substitution of a protease recognition site in the -subunit with a protease non-recognition site. The term protease recognition site used herein refers to an amino acid sequence that is hydrolyzed by a particular protease. In the present invention, the protease recognition site in the 1-subunit can be substituted with the protease non-recognition site by, for example, substituting a region of the -subunit that is known to have protease resistance with a corresponding region of the -subunit.
[0090] An example of amino acid residues in the -subunit corresponding to the protease non-recognition site in the -subunit is amino acids 312 to 318 in the -subunit. In the protein of the present invention, at least amino acids 312 to 318 in the 1-subunit may be substituted in order to acquire protease resistance.
[0091] The amino acids in the -subunit can be substituted in accordance with corresponding amino acids in the -subunit. Specifically, amino acids 312 to 315 are substituted with glycine, serine, glutamic acid, and proline in that order, and amino acids 316 to 318 are substituted with serine, glycine, and threonine in that order, as described above.
[0092] As a result of substitution of at least amino acids 312 to 318 in the -subunit in the manner as described above, the resulting protein would become unrecognizable by a protease, and the protein becomes uninfluenced or less likely to be influenced by protease-induced hydrolysis.
[0093] Accordingly, the first amino acid sequence in the protein of the present invention is, for example, an amino acid sequence derived from the amino acid sequence composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 by substitution of amino acids 312 to 318 with glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order. In the first amino acid sequence in the protein of the present invention, in addition, amino acid 452 and/or amino acid 453 in the amino acid sequence composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 may be substituted with asparagine and arginine, respectively. Preferably, the first amino acid sequence in the protein of the present invention is an amino acid sequence derived from the amino acid sequence composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 by substitution of amino acids 312 to 318, amino acid 452, and amino acid 453 in the manner described above.
[0094] Information concerning the amino acid sequence of the -subunit comprising the signal peptide of the wild-type human -hexosaminidase (SEQ ID NO: 28) and that concerning the nucleotide sequence encoding such amino acid sequence (SEQ ID NO: 27) are available, for example, under Accession number: NM 000512 and Accession number: NM 000521 at the GenBank. Such information is registered under Entry name: HEXB-HUMAN; Accession number: P07686 at Swiss-Prot (available on http://tw.expasy.org/uniprot/). The nucleotide sequence (cDNA) encoding the amino acid sequence of the -subunit as shown in SEQ ID NO: 27 is a nucleotide sequence composed of nucleotides 118 to 1788 of a 1,919-bp nucleotide sequence available from the GenBank (Accession number: NM 000521). In the present invention, information concerning such amino acid sequences and nucleotide sequences can be used.
[0095] Specifically, the first amino acid sequence in the protein of the present invention is preferably any of (a) to (c) below:
[0096] (a) any of the amino acid sequences (i) to (iv) below:
[0097] (i) an amino acid sequence derived from the amino acid sequence composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 by substitution of amino acids 312 to 318 with glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order;
[0098] (ii) an amino acid sequence derived from the amino acid sequence composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 by substitution of amino acids 312 to 318 with glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order and substitution of amino acid 452 with asparagine;
[0099] (iii) an amino acid sequence derived from the amino acid sequence composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 by substitution of amino acids 312 to 318 with glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order and substitution of amino acid 453 with arginine; or
[0100] (iv) an amino acid sequence derived from the amino acid sequence composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 by substitution of amino acids 312 to 318 with glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order, substitution of amino acid 452 with asparagine, and substitution of amino acid 453 with arginine;
[0101] (b) an amino acid sequence derived from any of the amino acid sequences (i) to (iv) above by deletion, substitution, or addition of 1 or several amino acids other than the amino acids at the sites of substitution above, wherein a protein comprising the amino acid sequence has an activity derived from the wild-type human J-hexosaminidase -subunit and protease resistance; or
[0102] (c) an amino acid sequence having at least 90% identity to any of the amino acid sequences (i) to (iv) above (it should be noted that the amino acids at the site of substitution are identical to those in the amino acid sequence as shown in SEQ ID NO: 25), wherein a protein comprising the amino acid sequence has an activity derived from the wild-type human -hexosaminidase -subunit and protease resistance.
[0103] As the amino acid sequence (a) above, the amino acid sequence (iv) is preferable among the amino acid sequences (i) to (iv) above. An example of such amino acid sequence is the amino acid sequence composed of amino acids 31 to 532 in the sequence as shown in SEQ ID NO: 25.
[0104] The amino acid sequence (b) above is not particularly limited, provided that it is derived from any of the amino acid sequences (i) to (iv) as defined in (a) above by deletion, substitution, or addition of 1 or several amino acids (for example, about 1 to 10, preferably about 1 to 5, more preferably 1 to 5, and most preferably 1 or 2 amino acids) other than the amino acids at the sites of substitution, and a protein comprising the amino acid sequence (b) has an activity derived from the -subunit and protease resistance.
[0105] The activity derived from the -subunit can be examined by, for example, allowing a target protein to be expressed in a mammalian-derived cell such as a CHO cell or human fibroblast, collecting the protein, and assaying 4-MUGS-degrading activity. Specifically, the protein (enzyme solution) is mixed with 4-methylumbelliferyl-6-sulfo-N-acetyl--D-glucosaminide (artificial substrate), these substances are subjected to the reaction at pH 4.5, and the amount of 4-methylumbelliferone that the unit amount of the enzyme solution can liberate per unit time is determined. Thus, activity of interest can be assayed. While 4-methylumbelliferone can be detected by any of various known methods, a method of detection involving the use of, for example, a fluorometer is preferable. A target protein may be incorporated into a known expression vector, the resulting vector may be introduced into a cell, and the target protein may be expressed therein.
[0106] Whether or not the target protein has protease resistance can be determined by, for example, allowing the target protein to be expressed in a mammalian-derived cell such as a CHO cell or human fibroblast, collecting the target protein, treating the collected target protein with a protease, subjecting the treated protein to a known protein detection method such as Western blotting, and detecting the presence or absence of a hydrolyzed form of the protein.
[0107] The amino acid sequence (c) above is not particularly limited, provided that it has at least 90% identity to any of the amino acid sequences (i) to (iv) as defined in (a) above, and a protein comprising the amino acid sequence (c) has an activity derived from the wild-type human -hexosaminidase -subunit and protease resistance (it should be noted that the amino acids at the site of substitution are identical to those in the amino acid sequence as shown in SEQ ID NO: 25). The term identity used herein refers to the percentage of identical and similar amino acid residues relative to all the overlapping amino acid residues in the 2 amino acid sequences optimally aligned with or without the introduction of gaps thereinto. Sequence identity can be determined by a method or with the use of sequence analysis software known to a person skilled in the art (e.g., BLAST (Basic Local Alignment Search Tool at the National Center for Biological Information, U.S.A.) at default parameters; i.e., initial parameters. When 2 sequences have at least 90% identity, identity is 90% or higher, preferably 95% or higher, and more preferably 99% or higher. Whether or not the protein of interest has activity derived from the t-subunit and protease resistance can be determined in the manner described above.
[0108] When the first amino acid sequence is any of the amino acid sequences (a) to (c) above, the second amino acid sequence of the signal peptide is preferably the amino acid sequence composed of amino acids 1 to 30 in the sequence as shown in SEQ ID NO: 25 or the amino acid sequence composed of amino acids 1 to 54 in the sequence as shown in SEQ ID NO: 28, with the amino acid sequence composed of amino acids 1 to 30 in the sequence as shown in SEQ ID NO: 25 being particularly preferable.
[0109] When the protein of the present invention is expressed in the patient's body, it may exist in the form of a monomer (i.e., a modified (mutant) -subunit) or in the form of a dimer of the mutant protein (i.e., a modified (mutant) human -hexosaminidase B).
2. Nucleotide Sequence Encoding Amino Acid Sequence of Human -Hexosaminidase Modified -Subunit
[0110] A polynucleotide in the recombinant adeno-associated virus virion of the present invention comprises nucleotide sequences encoding the first amino acid sequence and the second amino acid sequence. An example of the nucleotide sequence encoding the first amino acid sequence is the nucleotide sequence (a) or (b) below.
[0111] (a) Any of the nucleotide sequences (i) to (iv) below:
[0112] (i) a nucleotide sequence derived from the nucleotide sequence composed of nucleotides 163 to 1671 in the sequence as shown in SEQ ID NO: 27 by substitution of nucleotides 934 to 936, nucleotides 937 to 939, nucleotides 940 to 942, nucleotides 943 to 945, nucleotides 946 to 948, nucleotides 949 to 951, and nucleotides 952 to 954 with nucleotides indicating codons of glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order, respectively;
[0113] (ii) a nucleotide sequence derived from the nucleotide sequence composed of nucleotides 163 to 1671 in the sequence as shown in SEQ ID NO: 27 by substitution of nucleotides 934 to 936, nucleotides 937 to 939, nucleotides 940 to 942, nucleotides 943 to 945, nucleotides 946 to 948, nucleotides 949 to 951, and nucleotides 952 to 954 with nucleotides indicating codons of glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order and substitution of nucleotides 1354 to 1356 with nucleotides indicating a codon of asparagine, respectively;
[0114] (iii) a nucleotide sequence derived from the nucleotide sequence composed of nucleotides 163 to 1671 in the sequence as shown in SEQ ID NO: 27 by substitution of nucleotides 934 to 936, nucleotides 937 to 939, nucleotides 940 to 942, nucleotides 943 to 945, nucleotides 946 to 948, nucleotides 949 to 951, and nucleotides 952 to 954 with nucleotides indicating codons of glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order and substitution of nucleotides 1357 to 1359 with nucleotides indicating a codon of arginine, respectively; or
[0115] (iv) a nucleotide sequence derived from the nucleotide sequence composed of nucleotides 163 to 1671 in the sequence as shown in SEQ ID NO: 27 by substitution of nucleotides 934 to 936, nucleotides 937 to 939, nucleotides 940 to 942, nucleotides 943 to 945, nucleotides 946 to 948, nucleotides 949 to 951, and nucleotides 952 to 954 with nucleotides indicating codons of glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order, substitution of nucleotides 1354 to 1356 with nucleotides indicating a codon of asparagine, and substitution of nucleotides 1357 to 1359 with nucleotides indicating a codon of arginine, respectively.
[0116] (b) A nucleotide sequence comprised in a DNA which hybridizes under stringent conditions to a DNA comprising a nucleotide sequence complementary to any of the nucleotide sequences (i) to (iv) above, which comprises nucleotides corresponding to the nucleotides at the sites of substitution that are identical to those at the sites of substitution, and encodes a protein having an activity derived from the wild-type human -hexosaminidase -subunit and having protease resistance.
[0117] In the present invention, a codon is not limited to a sequence of 3 nucleotides (a triplet) in the post-transcriptional RNA sequence, and a codon is also a sequence of 3 nucleotides in a DNA sequence. Accordingly, a codon in a DNA sequence is indicated with the use of thymine (T) instead of uracil (U).
[0118] The nucleotide sequence as shown in SEQ ID NO: 27 composed of 1,671 nucleotides encodes the -subunit comprising a signal peptide of the wild-type human -hexosaminidase (54 amino acids) (the -subunit comprises the amino acid sequence of 556 amino acids in the sequence as shown in SEQ ID NO: 28). The nucleotide sequence composed of nucleotides 163 to 1671 in the sequence as shown in SEQ ID NO: 27 encodes a mature protein of the wild-type human J-hexosaminidase -subunit (the mature protein comprises the amino acid sequence of 502 amino acids; i.e., amino acids 55 to 556, as shown in SEQ ID NO: 28).
[0119] As the nucleotide sequence (a) above, the nucleotide sequence (iv) is preferable among the nucleotide sequences (i) to (iv) above. An example of such nucleotide sequence is the nucleotide sequence composed of nucleotides 1518 to 3026 in the sequence as shown in SEQ ID NO: 26. The nucleotide sequence composed of nucleotides 1518 to 3026 in the sequence as shown in SEQ ID NO: 26 encodes the amino acid sequence composed of amino acids 31 to 532 in the sequence as shown in SEQ ID NO: 25.
[0120] A polynucleotide comprising a mutant nucleotide sequence as described above can be prepared by a known site-directed mutagenesis technique described in, for example, Molecular Cloning, A Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory Press, 1989 and Current Protocols in Molecular Biology, John Wiley & Sons, 1987-1997, such as the Kunkel method, the Gapped duplex method, or PCR
[0121] Concerning the nucleotide sequence (b) above, the stringent conditions are conditions of washing following hybridization. Under the stringent conditions, salt concentration of the buffer is 15 to 330 mM and temperature is 25 C. to 65 C. Preferably, salt concentration is 15 to 150 mM and temperature is 45 C. to 55 C. Specifically, salt concentration is 80 mM and temperature is 50 C.
[0122] A nucleotide sequence of the DNA which hybridizes to the nucleotide sequence (a) above preferably has at least 40%, more preferably 60% or higher, further preferably 90% or higher, particularly preferably 95% or higher, and most preferably 99% or higher homology.
[0123] In the nucleotide sequence (b) above, nucleotides corresponding to the nucleotides at the sites of substitution are identical to the nucleotides at the sites of substitution. The nucleotides corresponding to the nucleotides at the sites of substitution are nucleotides (a triplet) positionally opposed to the nucleotides (a triplet) complementary to the nucleotides at the sites of substitution in a hybrid resulting from hybridization of DNA comprising the nucleotide sequence (b) to a complementary strand of DNA comprising the nucleotide sequence (a).
[0124] As the nucleotide sequence (b), a nucleotide that is not completely identical to the nucleotide sequence (a) but is completely identical to the post-translational amino acid sequence is particularly preferable (i.e., a nucleotide sequence derived from the nucleotide sequence (a) by silent mutation).
[0125] The polynucleotide in the recombinant adeno-associated virus virion of the present invention comprises a nucleotide sequence that is located adjacent to an upstream region of the nucleotide sequence encoding the first amino acid sequence, such as the nucleotide sequence (a) or (b), and encodes the second amino acid sequence of the signal peptide. Examples of the nucleotide sequences encoding the second amino acid sequence include the nucleotide sequence composed of nucleotides 1428 to 1517 in the sequence as shown in SEQ ID NO: 26 and the nucleotide sequence composed of nucleotides 1 to 162 in the sequence as shown in SEQ ID NO: 27. When the nucleotide sequence encoding the first amino acid sequence is the nucleotide sequence (a) or (b) above, the nucleotide sequence encoding the second amino acid sequence is preferably the nucleotide sequence composed of nucleotides 1428 to 1517 in the sequence as shown in SEQ ID NO: 26.
3. Recombinant Adeno-Associated Virus Virion
[0126] The recombinant adeno-associated virus virion of the present invention comprises: a capsomere comprising a protein capable of forming a virus virion; and a polynucleotide packaged in the capsomere comprising a promoter sequence and nucleotide sequences operably linked to the promoter sequence encoding the first amino acid sequence and the second amino acid sequence.
[0127] In the following description, the nucleotide sequences encoding the first amino acid sequence and the second amino acid sequence are occasionally referred to as the target nucleotide sequences.
[0128] The polynucleotide comprising the promoter sequence and the target nucleotide sequence operably linked to the promoter sequence may be of the sense strand or antisense strand. Specifically, the polynucleotide comprising the promoter sequence and the target nucleotide sequence operably linked to the promoter sequence encompasses a polynucleotide complementary thereto.
[0129] The recombinant adeno-associated virus virion of the present invention (the rAAV virion) can penetrate the blood-brain barrier of an organism (e.g., the blood-brain barrier of an immature fetus and a newborn baby and the blood-brain barrier of a mature adult). The rAAV virion of the present invention can target neural cells in the brain, the spinal cord, and other organs of an adult via peripheral administration. The term peripheral administration used herein refers to the route of administration that a person skilled in the art generally recognizes as peripheral administration, such as intravenous, intraarterial, intraperitoneal, intracardiac, intramuscular, or intraumbilical vein administration (the intraumbilical vein administration may be applied when a fetus is the target). The rAAV virion of the present invention can also target neural cells via intracerebral or intraspinal administration. In the cells into which the rAAV virion of the present invention had been incorporated, the modified -subunit of wild-type human -hexosaminidase (modHexB) is expressed from the polynucleotide, modHexB is secreted from the cells, modHexB is transported to other cells through the bloodstream, and cross-correction effects exerted in such other cells are observed.
[0130] Hereafter, features of the recombinant adeno-associated virus virion of the present invention are described.
3.1 Adeno-Associated Virus (AAV)
[0131] The natural adeno-associated virus (AAV) is a nonpathogenic virus. Various recombinant virus vectors have been prepared with the utilization of such features and used to deliver genes of interest for gene therapy (see, for example, WO 2003/018821, WO 2003/053476, WO 2007/001010, and Journal of the Pharmaceutical Society of Japan, 126 (11) 1021-1028). The wild-type AAV genome is a single-stranded DNA molecule of an approximately 5-kb nucleotide length, and it is of a sense or antisense strand. In general, the AAV genome comprises inverted terminal repeat (ITR) sequences of approximately 145 nucleotide length at both the 5 and 3 terminuses of the genome. ITR is known to have a wide variety of functions, such as a function as a replication origin of the AAV genome and a packaging signal of the genome into the virion (see, for example, Journal of the Pharmaceutical Society of Japan, 126 (11), 1021-1028 as mentioned above). The internal region of the wild-type AAV genome flanked by ITRs (hereafter, referred to as the internal region) comprises the AAV replication (rep) gene and the capsid (cap) gene. The rep gene and the cap gene each encode a protein Rep associated with virus replication and a capsid protein that forms a capsomere, which is an outer envelope of a regular icosahedron (e.g., at least one of VP1, VP2, and VP3). Detailed description is provided in, for example, Human Gene Therapy 13, pp. 345-354, 2002, Neuronal Development 45, pp. 92-103, 2001, Experimental Medicine 20, pp. 1296-1300, 2002, Journal of the Pharmaceutical Society of Japan 126 (11), 1021-1028, and Hum. Gene Ther., 16, 541-550, 2005.
[0132] Various types of natural adeno-associated viruses have been known, and each virus tends to infect different target cell (described in, for example, Gao, G, et al., Curr. Gene Ther., 5: 285-297, 2005, Xin, K-Q et al., J. Virol., 80: 11899-910, 2006, and Hellstroem, M, et al., Gene Ther., 16: 521-32, 2009). The rAAV vector of the present invention can be preferably prepared from, for example, natural adeno-associated virus type 1 (AAV1), type 2 (AAV2), type 3 (AAV3), type 4 (AAV4), type 5 (AAV5), type 6 (AAV6), type 7 (AAV7), type 8 (AAV8), or type 9 (AAV9), although the virus is not limited thereto. The nucleotide sequences of these adeno-associated virus genomes are known, and a reference can be made to the nucleotide sequences registered under GenBank Accession Numbers: AF063497.1 (AAV1), AF043303 (AAV2), NC_001729 (AAV3), NC_001829.1 (AAV4), NC_006152.1 (AAV5), AF028704.1 (AAV6), NC_006260.1 (AAV7), NC_006261.1 (AAV8), and AY530579 (AAV9). Among them, type 2, type 3, type 5, and type 9 are derived from humans. In the present invention, use of nucleotide sequences encoding capsid proteins derived from AAV1, AAV2, AAV9, AAV-rh10, AAV-PHP.B, and AAV-PHP.eB is particularly preferable. Among human-derived AAVs, AAV1 and AAV9 are reported to have relatively high efficiency for infection of neural cells (e.g., Taymans et al., Hum. Gene Ther., 18: 195-206, 2007). Also, AAV2 has already been used in clinical practice such as gene therapy of Parkinson's disease (e.g., Kaplitt et al., Lancet 369: 2097-2105, 2007, Marks et al., Lancet Neurol. 7: 400-408, 2008, Christine et al., Neurology 73: 1662-1669, 2009, Muramatsu et al., Mol. Ther., 18:1731-1735, 2010).
3.2. Capsid Protein in the rAAV Virion of the Present Invention
[0133] The capsid protein in the rAAV virion of the present invention is preferably a VP1 capsid protein derived from AAV1, AAV2, AAV9, AAV-rh10, AAV-PHP.B, or AAV-PHP.eB, and more preferably a capsid protein comprising an amino acid sequence having 90% or higher identity to the amino acid sequence of the VP1 capsid protein derived from AAV1, AAV2, AAV9, AAV-rh10, AAV-PHP.B, or AAV-PHP.eB or an amino acid sequence derived from the amino acid sequence having 90% or higher identity to the amino acid sequence of the VP1 capsid protein derived from AAV1, AAV2, AAV9, AAV-rh10, AAV-PHP.B, or AAV-PHP.eB by substitution of at least one surface-exposed tyrosine residue (e.g., a tyrosine residue with the amino acid side chain being exposed to the virus virion surface) with another amino acid. The rAAV virion of the present invention comprising such capsid protein easily penetrates the blood-brain barrier of a fetus, a newborn baby, and an adult. According to a more preferable embodiment, the capsid protein in the rAAV virion of the present invention comprises an amino acid sequence derived from the VP1 amino acid sequence (e.g., SEQ ID NO: 2, 4, or 6) by substitution of at least one surface-exposed tyrosine residue (e.g., a tyrosine residue with the amino acid side chain being exposed to the virus virion surface) with another amino acid. An example of such protein comprises an amino acid sequence having sequence identity of approximately 90% or higher, 91% or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, 99.1% or higher, 99.2% or higher, 99.3% or higher, 99.4% or higher, 99.5% or higher, 99.6% or higher, 99.7% or higher, 99.8% or higher, or 99.9% or higher to the amino acid sequence as shown in SEQ ID NO: 2, 4, or 6, with at least 1 surface-exposed tyrosine residue being substituted with another amino acid, and such protein is capable of forming a virus virion. In general, a higher sequence identity is more preferable. The capsid protein in the rAAV virion of the present invention forms a capsomere alone or in combination with another capsid protein member (e.g., VP2 and/or VP3), and the rAAV virion of the present invention comprising the AAV genome (or the AAV vector genome) packaged in the capsomere can be formed. Examples of amino acid residues that can be substituted with each other include other amino acid residues in the group of similar amino acid residues (described below). A modified capsid protein resulting from substitution with other amino acid residues can be prepared in accordance with a method known in the art, such as a common genetic engineering technique. Such genetic engineering technique is described in, for example, Molecular Cloning 3rd Edition, J. Sambrook et al., Cold Spring Harbor Lab. Press, 2001 and Current Protocols in Molecular Biology, John Wiley & Sons, 1987-1997.
[0134] The capsid protein in the rAAV virion of the present invention preferably comprises an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 2 by substitution of at least one surface-exposed tyrosine residue at position 252, 273, 445, 701, 705, or 731 with another amino acid, and such tyrosine residue is more preferably substituted with a phenylalanine residue. In the amino acid sequence as shown in SEQ ID NO: 2, tyrosine 445 is preferably substituted with phenylalanine. The capsid protein in the rAAV virion of the present invention preferably comprises an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 4 by substitution of at least one surface-exposed tyrosine residue at position 252, 272, 444, 500, 700, 704, or 730 with another amino acid, and such tyrosine residue is more preferably substituted with a phenylalanine residue. In the amino acid sequence as shown in SEQ ID NO: 4, tyrosine 444 is preferably substituted with phenylalanine. The capsid protein in the rAAV virion of the present invention preferably comprises an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 6 by substitution of at least one surface-exposed tyrosine residue at position 252, 274, 446, 701, 705, 706, or 731 with another amino acid, and such tyrosine residue is more preferably substituted with a phenylalanine residue. In the amino acid sequence as shown in SEQ ID NO: 6, tyrosine 446 is preferably substituted with phenylalanine. The capsomere of the rAAV virion of the present invention may comprise the protein by itself or such protein in combination with other members (VP2 and/or VP3). In the present invention, the amino acids to be substituted include amino acids at the corresponding positions in VP2 and VP3 of the relevant virus types. Preferably, a corresponding tyrosine residue is substituted with a phenylalanine residue. Such modified capsid protein can be prepared in accordance with a method known in the art, such as a common genetic engineering technique. Such genetic engineering technique is described in, for example, Molecular Cloning 3rd Edition. The virus virion of the present invention comprising such capsid protein can penetrate the blood-brain barrier of an adult and a fetus, as described above. Preferably, the virus virion comprising a functionally equivalent capsid protein can infect neural cells in the brain, the spinal cord, and other organs of an adult via peripheral administration. The term the neural system used in the present invention refers to an organ composed of neural tissue. In the present invention, neural cells into which the gene of interest is to be introduced include at least neurons contained in the central nervous system such as the brain or spinal cord, and such neural cells may further include neuroglia cells, microglia cells, astroglia cells, oligodendroglia cells, ependymal cells, and cerebrovascular endothelial cells. Among neural cells into which the gene of interest is to be introduced, the percentage of neurons is preferably 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, 99.9% or more, or 100%.
[0135] According to another embodiment, the capsomere of the rAAV virion of the present invention comprises a protein comprising the amino acid sequence as shown in SEQ ID NO: 8, 10, or 12 or an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 8, 10, or 12 by deletion, substitution, insertion, and/or addition of 1 or more amino acids at positions other than amino acids 444 to 446 and capable of forming a virus virion. More specifically, the capsid protein in the rAAV virion of the present invention is enclosed in the capsomere of the rAAV virion of the present invention alone or in combination with another capsid protein member (e.g., VP2 and/or VP3), and the AAV genome (or the recombinant AAV vector genome) is packaged in the capsomere. Two or more of the deletion, substitution, insertion, and addition of amino acids may occur simultaneously. For example, such protein comprises the amino acid sequence as shown in SEQ ID NO: 8, 10, or 12 or an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 8, 10, or 12 by deletion, substitution, insertion, and/or addition of 1 to 50, 1 to 40, 1 to 39, 1 to 38, 1 to 37, 1 to 36, 1 to 35, 1 to 34, 1 to 33, 1 to 32, 1 to 31, 1 to 30, 1 to 29, 1 to 28, 1 to 27, 1 to 26, 1 to 25, 1 to 24, 1 to 23, 1 to 22, 1 to 21, 1 to 20, 1 to 19, 1 to 18, 1 to 17, 1 to 16, 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9 (1 to several), 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 amino acid at position(s) other than amino acids 444 to 446 and is capable of forming a virus virion. In general, a smaller number of amino acids subjected to deletion, substitution, insertion, and/or addition is preferable. The resulting rAAV virion of the present invention can penetrate the blood-brain barrier of an adult and a fetus as described above. Preferably, the virus virion can be introduced into neural cells in the brain, the spinal cord, and other organs via peripheral administration. Also, the rAAV virion of the present invention can be administered peripherally to the mother, so that it can be introduced into neural cells in the brain, the spinal cord, and other organs of a fetus in the maternal body. Such modified capsid protein can be prepared in accordance with a method known in the art, such as a common genetic engineering technique.
[0136] Examples of amino acids that can be substituted with each other in the protein (polypeptide) of the present invention are demonstrated below. Amino acids within the same group can be substituted with each other. Group A: leucine, isoleucine, norleucine, valine, norvaline, alanine, 2-aminobutyric acid, methionine, o-methylserine, t-butylglycine, t-butylalanine, and cyclohexylalanine; Group B: aspartic acid, glutamic acid, isoaspartic acid, isoglutamic acid, 2-aminoadipic acid, and 2-aminosuberic acid; Group C: asparagine and glutamine; Group D: lysine, arginine, ornithine, 2,4-diaminobutyric acid, and 2,3-diaminopropionic acid; Group E: proline, -hydroxyproline, and 4-hydroxyproline; Group F: serine, threonine, and homoserine; and Group G: phenylalanine and tyrosine.
[0137] The capsid proteins VP1, VP2, and/or VP3 contained in the rAAV virion of the present invention can be encoded by 1 or more types of polynucleotides. Preferably, all the capsid proteins in the present invention are encoded by a single polynucleotide. More preferably, the capsid protein is encoded by the polynucleotide as shown in SEQ ID NO: 7, 9, or 11.
[0138] The polynucleotide encoding the capsid protein contained in the rAAV virion of the present invention encodes a protein that is functionally equivalent to the capsid protein capable of forming the recombinant virus virion of the present invention. For example, such polynucleotide comprises the polynucleotide sequence as shown in SEQ ID NO: 7, 9, or 11 or a polynucleotide sequence derived from the polynucleotide sequence as shown in SEQ ID NO: 7, 9, or 11 by deletion, substitution, insertion, and/or addition of 1 or more nucleotides (e.g., 1 to 50, 1 to 40, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 9 (1 to several), 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, to 2, or 1) and encodes a protein comprising the amino acid sequence as shown in SEQ ID NO: 8, 10, or 12 or an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 8, 10, or 12 by deletion, substitution, insertion, and/or addition of 1 or more amino acids at positions other than amino acids 444 to 446 and capable of forming a virus virion. Two or more of the deletion, substitution, insertion, and addition of amino acids may occur simultaneously. The rAAV virion of the present invention comprising the capsid protein encoded by the polynucleotide can penetrate the blood-brain barrier of an adult and a fetus as described above. Preferably, the rAAV virion of the present invention can be introduced into neural cells in the brain, the spinal cord, and other organs of an adult via peripheral administration. Also, the rAAV virion of the present invention can be administered peripherally to the mother, so that it can be introduced into neural cells in the brain, the spinal cord, and other organs of a fetus in the maternal body. In general, a smaller number of such nucleotides subjected to deletion, substitution, insertion, and/or addition is preferable. For example, such polynucleotide can hybridize under stringent conditions to the polynucleotide as shown in SEQ ID NO: 7, 9, or 11 or a sequence complementary thereto and encodes a protein capable of forming the recombinant virus virion of the present invention (e.g., a protein comprising the amino acid sequence as shown in SEQ ID NO: 8, 10, or 12 or an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 8, 10, or 12 by deletion, substitution, insertion, and/or addition of 1 or more amino acids at positions other than amino acids 444 to 446).
[0139] Hybridization can be performed by a known method or a method in accordance therewith, such as a method described in Molecular Cloning 3rd Edition, J. Sambrook et al., Cold Spring Harbor Lab. Press, 2001. When using a commercially available library, hybridization can be performed in accordance with a method described in the manufacturer's instructions. The stringent conditions may by low-stringent conditions, moderately-stringent conditions, or high-stringent conditions. Under low-stringent conditions, for example, hybridization is performed in the presence of 5SSC, 5Denhardt's Solution, 0.5% SDS, and 50% formamide at 32 C. Under moderately-stringent conditions, for example, hybridization is performed in the presence of 5SSC, 5Denhardt's Solution, 0.5% SDS, and 50% formamide at 42 C. Under high-stringent conditions, for example, hybridization is performed in the presence of 5SSC, 5Denhardt's Solution, 0.5% SDS, and 50% formamide at 50 C. Under such conditions, DNA exhibiting a higher degree of homology can be efficiently obtained as temperature is raised. A plurality of elements are considered to affect hybridization stringency, and examples of such elements include temperature, probe concentration, probe length, ion intensity, duration, and salt concentration. A person skilled in the art can select adequate elements to realize equivalent stringency.
[0140] Polynucleotides capable of hybridization has identity of, for example, 70% or higher, 80% or higher, 90% or higher, 91% or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, 99.1% or higher, 99.2% or higher, 99.3% or higher, 99.4% or higher, 99.5% or higher, 99.6% or higher, 99.7% or higher, 99.8% or higher, or 99.9% or higher to the nucleotide sequence as shown in SEQ ID NO: 7, 9, or 11, which is determined using homology search software such as FASTA or BLAST with default parameters. In general, a larger degree of homology is preferable.
[0141] Amino acid sequence and polynucleotide sequence identity can be determined using the algorithm BLAST by Carlin and Altur (Proc. Natl. Acad. Sci., U.S.A., 87: 2264-2268, 1990, Proc. Natl. Acad. Sci., U.S.A., 90: 5873, 1993). A program referred to as BLASTN or BLASTX based on the BLAST algorithm has been developed (Altschul S F, et al.: J. Mol. Biol., 215: 403, 1990). When analyzing the nucleotide sequence using BLASTN, the parameters are set to, for example, the score of 100 and the word length of 12. When analyzing the amino acid sequence using BLASTX, the parameters are set to, for example, the score of 50 and the word length of 3. When using the BLAST and Gapped BLAST programs, default parameters of both the programs are used.
[0142] The Rep protein used in the present invention needs to have, for example, a function of recognizing the ITR sequence and replicating the genome based on the sequence, a function of recruiting the wild-type AAV genome (or the rAAV genome) and packaging the same within the virus virion, and a function of forming the rAAV virion of the present invention. As long as the Rep protein has such known functions at equivalent levels, it may have the same degree of amino acid sequence identity, and the same number of amino acids may be subjected to deletion, substitution, insertion, and/or addition as described above. Functional equivalency is, for example, the specific activity described above. In the present invention, a protein comprising the amino acid sequence as shown in SEQ ID NO: 16 is preferably used.
[0143] The polynucleotide encoding the Rep protein used in the present invention needs to encode a Rep protein having a function of recognizing the ITR sequence and replicating the genome based on the sequence, a function of recruiting the wild-type AAV genome (or the rAAV genome) and packaging the same within the virus virion, and a function of forming the rAAV virion of the present invention. As long as the polynucleotide encodes the Rep protein having such known functions at equivalent levels, it may have the same degree of nucleotide sequence identity, and the same number of nucleotides may be subjected to deletion, substitution, insertion, and/or addition as described above. Functional equivalency is, for example, the specific activity described above. In the present invention, a polynucleotide comprising the nucleotide sequence as shown in SEQ ID NO: 15 is preferably used.
[0144] An embodiment of the present invention provides polynucleotides encoding the capsid protein, such as VP1, VP2, and/or VP3, and the Rep protein encoded by the internal region of the wild-type AAV genome in the form that are incorporated into the AAV helper plasmid. Polynucleotides encoding the capsid protein, such as VP1, VP2, and/or VP3, and the Rep protein used in the present invention may be incorporated in 1, 2, 3, or more types of plasmids, according to need. Polynucleotides encoding at least 1 of the capsid protein and the Rep protein may be incorporated into the AAV genome, according to need. In the present invention, all the capsid proteins (VP1, VP2, and/or VP3) and the Rep protein are preferably encoded by a single polynucleotide and provided in the form of the AAV helper plasmids. A reference may be made to the examples of the present invention below.
3.3. The rAAV Genome of the Present Invention
[0145] The recombinant adeno-associated virus polynucleotide packaged within the rAAV virion of the present invention (hereafter, referred to as the rAAV genome of the present invention) can be prepared by substitution of a polynucleotide of the internal region flanked by the 5 ITR and the 3 ITR of the wild-type AAV genome (i.e., either or both the rep gene and the cap gene) with a gene cassette comprising a polynucleotide comprising the target nucleotide sequence (the gene for therapy) and a promoter sequence for transcription of the polynucleotide. Preferably, the 5 ITR and the 3 ITR are located at the 5 terminus and the 3 terminus of the AAV genome, respectively. The rAAV genome of the present invention preferably comprises the 5 ITR and the 3 ITR of the AAV1, AAV2, AAV3, or AAV9 genome as ITRs of the 5 terminus and the 3 terminus, more preferably the 5 ITR and the 3 ITR of the AAV3 genome, and particularly preferably the polynucleotide as shown in SEQ ID NO: 13 as the 5 ITR and the polynucleotide as shown in SEQ ID NO: 14 as the 3 ITR. In general, ITR has a structure in which a part thereof has been easily replaced with a complementary sequence (i.e., the flip-flop structure). Thus, the 5 ITR and the 3 ITR in the rAAV genome of the present invention may be in the opposite direction. In the rAAV genome of the present invention, the length of the gene cassette to be substituted with the internal region is preferably equivalent to the length of the original polynucleotide from the viewpoint of practical use. Specifically, the full-length of the rAAV genome of the present invention may be equivalent to the full-length of the wild-type; i.e., 5 kb. For example, the full-length is approximately 2 to 6 kb, and preferably approximately 4 to 6 kb.
[0146] In general, the virus genome packaged within the recombinant adeno-associated virus virion is single-stranded. This prolongs the time (several days) to express the target gene in the genome, disadvantageously. In order to overcome such problem, a gene for therapy to be introduced is designed to be self-complementary (referred to as the self-complementary (sc) vector) so as to promote expression after virus vector infection. In this case, an inverted sequence is necessary to form a double strand. To this end, the length of the therapeutic gene should be designed to be an approximately half the length of the non-sc genome vector. When the recombinant virus genome is the sc type, more specifically, the length of the target gene that can be incorporated is approximately 2 kb including a region necessary for a promoter, polyadenylation, and the like. Such design is described in detail in, for example, Foust K D, et al., Nat. Biotechnol., January 2009; 27 (1): 59-65, and Non-Patent Literature 3 as mentioned above. The rAAV genome used in the present invention may or may not be of an sc type. In the case of an sc type, the entire or a part of the expression cassette comprising the target nucleotide sequence can form double-stranded DNA.
[0147] In order to express a target modHexB polypeptide in the rAAV genome of the present invention, the target nucleotide sequence is operably linked to various types of known promoter sequences. A promoter sequence may be a tissue-non-specific systemic promoter (i.e., the ubiquitous promoter) or it may be a tissue-specific promoter. Since target modHexB is to be expressed in neural cells, a neural cell-specific promoter can be used as a tissue-specific promoter. It should be noted that the present inventors had discovered that higher therapeutic effects can be attained with the use of the systemic promoter, compared with the use of the neural cell-specific promoter.
[0148] A preferable systemic promoter is selected from the group consisting of cytomegalovirus (CMV) promoter, EF-1 promoter, SV40 promoter, and CAG promoter.
[0149] Neural-cell-specific promoter sequences used in the present invention are derived from, for example, neurons, neuroglia cells, oligodendroglia cells, cerebrovascular endothelial cells, microglia cells, or ventricular epidermal cells, although cells are not limited thereto. A preferable neural cell-specific promoter is selected from the group consisting of Synapsin I promoter sequence, myelin basic protein promoter sequence, neuron-specific enolase promoter sequence, calcium/calmodulin-dependent protein kinase II (CMKII) promoter, tubulin al promoter, platelet-derived growth factor strand promoter, glial fibrillary acidic protein (GFAP) promoter sequence, L7 promoter sequence (cerebellar Purkinje cell-specific promoter), and glutamate receptor delta-2 promoter (cerebellar Purkinje cell-specific promoter).
[0150] Concerning the rAAV virion of the present invention, a promoter sequence, such as calcium/calmodulin-dependent protein kinase II (CMKII) promoter, tubulin I promoter, or platelet-derived growth factor strand promoter, can be used. One of such promoter sequences may be used alone or a plurality of such promoter sequences may be used in combination.
[0151] A systemic promoter is particularly preferable, and CMV promoter is the most preferable.
[0152] The rAAV genome of the present invention may further comprise a known sequence, such as an enhancer sequence that assists mRNA transcription and translation into a protein, the Kozak sequence, and an adequate polyadenylation signal sequence.
[0153] The terms virus virion, virus vector, and virus particle used herein are used interchangeably, unless otherwise specified.
[0154] The term polynucleotide used herein is used interchangeably with the term nucleic acid, gene, or nucleic acid molecule, and the term refers to a nucleotide polymer. The term nucleotide sequence used herein is used interchangeably with the term nucleic acid sequence or nucleotide sequence, and it is indicated as a deoxyribonucleotide (abbreviated to as A, G, C, and T) sequence. For example, the term a polynucleotide comprising the nucleotide sequence as shown in SEQ ID NO: 1 or a fragment thereof refers to a polynucleotide comprising a sequence indicated by deoxynucleotides A, G, C, and/or T as shown in SEQ ID NO: 1 or a fragment thereof.
[0155] The virus genome or the polynucleotide of the present invention can be present in the form of DNA (e.g., cDNA or genome DNA). It may be in the form of RNA (e.g., mRNA), according to need. The virus genome and the polynucleotide used herein can be double-stranded or single-stranded DNA. Single-stranded DNA or RNA may be a coding strand (known as a sense strand) or a non-coding strand (known as an antisense strand). When the positions of the promoter encoded by the rAAV genome, the target gene, and the polyadenylation signal in the gene sequence are described herein, the rAAV genome of the sense strand is described concerning the sense strand, and the rAAV genome of the antisense strand is described concerning the complementary strand of the antisense strand, unless otherwise specified.
[0156] The terms protein and polypeptide are used interchangeably herein, and the terms indicate an amino acid polymer. In the polypeptide used herein, the left end is the N terminus (the amino terminus) and the right end is the C terminus (the carboxyl terminus) in accordance with a common practice of peptide description. A partial peptide in the polypeptide of the present invention (it may be referred to as the partial peptide of the present invention herein) is a partial peptide in the polypeptide of the present invention described above, and it preferably has properties similar to those of the polypeptide of the present invention.
[0157] The term plasmid used herein refers to a variety of known gene elements, such as a plasmid, phage, transposon, cosmid, or chromosome. A plasmid can replicate in a particular host and it can transport a gene sequence between cells. A plasmid comprises a variety of know nucleotides (DNA, RNA, PNA, and a mixture thereof) herein, and it may be single-stranded or double-stranded, with a double-stranded plasmid being preferable. For example, the term rAAV vector plasmid used herein is intended to comprise a double strand formed of the rAAV vector genome and a complementary strand thereof, unless otherwise specified. A plasmid used in the present invention may be linear or cyclic.
[0158] The target nucleotide sequence incorporated into the rAAV genome of the present invention is delivered to a neural cell and incorporated into the genome of the cell with higher efficiency, compared with a conventional technique. Use of the rAAV vector of the present invention enables gene introduction into the number of neural cells that is approximately 10, 20, 30, 40, or 50 times or larger, compared with the use of the conventional rAAV vector. The number of neural cells into which the gene of interest had been introduced can be determined by, for example, preparing a rAAV virion packaging the rAAV vector genome comprising an arbitrary marker gene integrated therein, administering the rAAV virion to a test animal, and counting the number of neural cells expressing the marker gene (or the marker protein) integrated into the rAAV vector genome. A known marker gene can be used. Examples of marker genes include LacZ gene, green fluorescent protein (GFP) gene, and luminescent protein gene (e.g., firefly luciferase).
[0159] In the present invention, the rAAV virion comprising the rAAV vector genome packaged therein can penetrate the blood-brain barrier of an organism. Through peripheral administration to a subject, accordingly, the target therapeutic gene can be introduced into neural cells of the brain, the spinal cord, and other organs of the subject.
[0160] The term packaging used herein refers to events including preparation of the single-stranded virus genome, assembly of a coat protein (capsid), and inclusion of the virus genome in a capsid (encapsidation). When an adequate plasmid vector (a plurality of plasmids, in general) is introduced into a cell line capable of packaging under adequate conditions, recombinant virus particles (i.e., virus virions or virus vectors) are assembled, and the resultant is secreted in the culture.
4. Preparation of the rAAV Virion of the Present Invention
[0161] Another aspect of the present invention provides a method for preparing the rAAV virion of the present invention. This method can comprise a step of transfecting (a) and (b) below to a cultured cell: (a) a first polynucleotide encoding the capsid protein of the present invention (generally referred to as the AAV helper plasmid); and (b) a second polynucleotide to be packaged in the rAAV virion of the present invention (that comprises the target nucleotide sequence). The method of preparation according to the present invention can comprise: (c) a step of transfecting a plasmid that encodes an adenovirus-derived factor referred to as the adenovirus (AdV) helper plasmid to a cultured cell or a step of infecting the cultured cell with adenovirus. The method of preparation according to the present invention can further comprise a step of culturing the transfected cultured cells and a step of recovering the recombinant adeno-associated virus vector from the culture supernatant. Such methods are known and used in the examples herein.
[0162] The method for preparing the rAAV virion of the present invention preferably comprises transfecting the polynucleotides (a) and (b) to a cultured cell: (a) a first polynucleotide encoding a protein comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 8, 10 and 12; and (b) a second polynucleotide comprising the promoter sequence and the target nucleotide sequence between the nucleotide sequence as shown in SEQ ID NO: 13 and the nucleotide sequence as shown in SEQ ID NO: 14. An example of such first polynucleotide and second polynucleotide is a combination of polynucleotides described in Example 3.
[0163] In the first polynucleotide, it is preferable that a nucleotide encoding the capsid protein of the present invention be operably linked to a known promoter sequence that can function in a cultured cell. As such promoter sequence, for example, cytomegalovirus (CMV) promoter, EF-1 promoter, or SV40 promoter can be adequately used. In addition, the first polynucleotide can adequately comprise, for example, a known enhancer sequence, a Kozak sequence, or a poly A addition signal sequence.
[0164] For example, the first polynucleotide encoding a protein comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 8, 10 and 12 can be prepared by the method described below. Concerning 3 types of AAVs; i.e., type 1 AAV (AAV1), type 2 AAV (AAV2), and type 9 AAV (AAV9), pAAV1-RC, pAAV2-RC, and pAAV9-RC plasmids each comprising a nucleotide sequence encoding the relevant coat protein VP1 are used as templates. These plasmids are derived from AAV3 Rep/VP described in the literature (Handa et. al., J. Gen. Virol., 81: 2077-2084, 2000) and comprise the Rep sequence of AAV3 (Muramatsu et al., Virology 221, 208-217, 1996). The nucleotide sequences of VP1 of such AAVs have already been registered under Accession Nos. AF063497, AF043303, and AY530579 at GenBank (as shown in SEQ ID NOs: 1, 3 and 5). A forward primer, which is DNA comprising SEQ ID NO: 17, and a reverse primer, which is DNA comprising SEQ ID NO: 18, are synthesized, and using pAAV1-RC as a template, tyrosine (Y) at position 445 of the amino acid sequence of VP1 of AAV1 (SEQ ID NO: 2) is substituted with phenylalanine (F) with the use of the Quick Change II XL site-directed mutagenesis kit (Stratagene). Also, a forward primer, which is DNA comprising SEQ ID NO: 19, and a reverse primer, which is DNA comprising SEQ ID NO: 20, are synthesized, and using pAAV2-RC as a template, tyrosine (Y) at position 444 of the amino acid sequence of VP1 of AAV2 (SEQ ID NO: 4) is substituted with phenylalanine (F). Also, a forward primer, which is DNA comprising SEQ ID NO: 21, and a reverse primer, which is DNA comprising SEQ ID NO: 22, are synthesized, and using pAAV9-RC as a template, tyrosine (Y) at position 446 of the amino acid sequence of VP1 of AAV9 (SEQ ID NO: 6) is substituted with phenylalanine (F). The pAAV1-yfRC, pAAV2-yfRC, and pAAV9-yfRC plasmids comprising polynucleotides encoding the substituted amino acid sequences AAV1-yfVP1 (SEQ ID NO: 8), AAV2-yfVP1 (SEQ ID NO: 10), and AAV9-yfVP1-3 (SEQ ID NO: 12), respectively, are prepared. All the pAAV1-yfRC, pAAV2-yfRC, and pAAV9-yfRC comprise the nucleotide sequence (SEQ ID NO: 15) encoding Rep of AAV2.
[0165] The second polynucleotide comprises the promoter sequence and the target nucleotide sequence. In addition, the second polynucleotide can adequately comprise, for example, a known enhancer sequence, a Kozak sequence, and a poly A addition signal sequence.
[0166] AAV is a helper-dependent virus. When AAV infects a cell for virion production (a cultured cell) in order to prepare the rAAV virion of the present invention, accordingly, co-infection with a helper virus (e.g., adenovirus, herpes virus, or vaccinia virus) is necessary. When a helper virus is not co-infected, AAV inserts the virus genome into the host chromosome, but no infectious AAV virion derived from the inserted virus genome is generated. When a host comprising the inserted virus genome is infected with a helper virus, the infectious AAV virion derived from the inserted genome can be generated. While AAV is capable of infecting a cell derived from a different species, a helper virus needs to be of the same species as the host cell. For example, human AAV can replicate in a canine cell co-infected with a canine adenovirus.
[0167] When preparing the rAAV virion of the present invention, a helper virus plasmid (e.g., adenovirus, herpes virus, or vaccinia virus) can be introduced into a cultured cell simultaneously with the first and the second polynucleotides. Preferably, the method for preparation of the present invention further comprises a step of introducing an adenovirus (AdV) helper plasmid. The AdV helper plasmid encodes a protein, such as E1a, E1b, E2a, or E4 orf4, necessary for AAV genome replication. Alternatively, a recombinant virus or non-virus vector (e.g., a plasmid or episome) that carries necessary helper functions may be used. Such recombinant virus is known in the art and can be produced in accordance with a known technique. A variety of adenovirus strains are available from ATCC (American Type Culture Collection) and commercially available. Also, many adenovirus sequences are available from public databases (e.g., PubMed or GenBank).
[0168] In the present invention, the AdV helper is preferably derived from the virus of the same species as the cultured cell. When the human cultured cell (293T) is used, for example, a human AdV-derived helper virus vector can be used. A commercially available AdV helper vector (e.g., AAV Helper-Free System: Catalog No. 240071, Agilent Technologies) can be used.
[0169] When preparing the rAAV virion of the present invention, the method for transfection of one or more types of plasmids into the cultured cell can employ any of various known methods, such as the calcium phosphate method, lipofection, or electroporation. Such methods are described in, for example, Molecular Cloning 3rd Ed., Current Protocols in Molecular Biology, John Wiley & Sons, 1987-1997.
5. Pharmaceutical Composition Comprising the rAAV Virion of the Present Invention
[0170] A further aspect of the present invention provides a pharmaceutical composition comprising the rAAV virion of the present invention (the rAAV vector). With the use of the pharmaceutical composition comprising the rAAV virion of the present invention (hereafter, referred to as the pharmaceutical composition of the present invention), the target gene of the -hexosaminidase modified -subunit can be introduced into the subject's cell with high efficiency. The present invention provides a method for treatment of Tay-Sachs disease and/or Sandhoff disease using the target gene thus introduced. Since the rAAV virion of the present invention can penetrate the blood-brain barrier of an organism, peripheral administration thereof to the subject enables gene delivery of the rAAV virion of the present invention to neural cells of the brain, the spinal cord, and other organs. In addition, the rAAV virion of the present invention enables gene delivery to neural cells of the brain, the spinal cord, the retina, and other organs via intracerebral or intraspinal administration.
[0171] When the pharmaceutical composition of the present invention is used, for example, administration can be made through the oral, parenteral (intravenous), intramuscular, oral mucosal, transrectal, transvaginal, percutaneous, or nasal route or via inhalation, with parenteral administration being preferable, and intravenous, intracerebral, or intraspinal administration being more preferable. A single active ingredient or two or more active ingredients can be incorporated into the pharmaceutical composition of the present invention. Such an active ingredient (or active ingredients) can be supplemented with pharmacologically acceptable carriers or additives and provided in the form of a pharmaceutical preparation. In such a case, the active ingredient(s) of the present invention can be contained in the pharmaceutical preparation in an amount of, for example, 0.1% to 99.9% by weight therein.
[0172] Examples of pharmacologically acceptable carriers or additives that can be used include excipient, disintegrator, disintegration enhancer, binding agent, lubricant, coating agent, dye, diluent, solubilizer, solubilization enhancer, isotonizing agent, pH modifier, and stabilizer.
[0173] Examples of pharmaceutical preparations suitable for oral administration include powders, tablets, capsules, fine grains, granules, liquids, and syrups. In the case of oral administration, various excipient, such as microcrystalline cellulose, sodium citrate, calcium carbonate, dipotassium phosphate, or glycine, can be used in combination with various disintegrators, such as starch (preferably maize, potato, or tapioca starch), alginic acid, or a sort of double salt of silicic acid, and binding agents for granulation, such as polyvinylpyrrolidone, sucrose, gelatin, and gum Arabic. Also, lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc, are often very effective for tablet formation. A composition of solids of the same species can be filled in a gelatin capsule. In this respect, examples of preferable substances include lactose, and high-molecular-weight polyethylene glycol. When an aqueous suspension and/or elixir are/is to be prepared for oral administration, active ingredients can be used in combination with various sweetening agents, flavoring agents, colorants, or dyes. Alternatively, an emulsifying agent and/or a suspending agent can also be used in combination, according to need. In addition, a diluent, such as water, ethanol, propylene glycol, glycerin, or a mixture of any thereof can be used in combination.
[0174] Examples of pharmaceutical preparations suitable for parenteral administration include injections and suppositories. In the case of parenteral administration, a solution of the active ingredients of the present invention in sesame oil or peanut oil or an aqueous solution thereof in propylene glycol can be used. An aqueous solution is adequately buffered (preferably a pH 8 or higher), according to need, and a liquid diluent needs to be made isotonic. An example of such liquid diluent is physiological saline. An aqueous solution thus prepared is suitable for intravenous injection, and an oleaginous solution is suitable for intraarticular injection, intramuscular injection, and subcutaneous injection. Such solutions can be easily prepared under aseptic condition in accordance with a standard pharmaceutical technique well known in the art. In addition, the active ingredients of the present invention can be topically administered, such as skin application. In such a case, topical administration is preferably made in the form of a cream, jelly, paste, or ointment in accordance with a standard medical practice.
[0175] A dose of the pharmaceutical composition of the present invention is not particularly limited, and an adequate dose can be determined in accordance with various conditions, such as disease type, the age and symptoms of a patient, the administration route, the purpose of treatment, or use of other medicines. A dose of the pharmaceutical composition of the present invention is, for example, I to 5,000 mg, and preferably 10 to 1,000 mg, per adult (e.g., body weight of 60 kg) per day, although the dose is not limited thereto. Such a daily dose may be administered in 2 to 4 separate instances. When the dose unit is expressed in vg (vector genome), a dose is for example 10.sup.9 to 10.sup.14 vg, preferably 10.sup.10 to 10.sup.13 vg, and more preferably 10.sup.10 to 10.sup.12 vg, per kg of the body weight, although the dose is not limited thereto.
EXAMPLES
[0176] Hereafter, embodiments of the present invention are described in detail with reference to the examples, although the present invention is not limited to the following examples. The percentage (%) is by weight, unless otherwise specified.
[0177] The method for preparing the AAV-CMV-modHEXB vector used in Examples 1 and 2 (which may also be referred to as AAV-CMV-mod2B) is described in Example 3, the method for preparing the AAV-SynI-modHEXB vector used in Examples 1 and 2 (which may also be referred to as AAV-SynI-mod2B) is described in Example 4, and the method for preparing the AAV-CMV-GFP vector used in Examples 1 and 2 is described in Example 5.
Example 1: Evaluation of Efficacy of Intraventricular Administration of AAV-CMV-modHEXB on Sandhoff Disease Mouse Model
1. Evaluation of Efficacy of AAV-CMV-modHEXB on Sandhoff Disease (Hexb/) Mouse Model (Deficiency of Both Hexa and Hexb) Via Intraventricular Administration
[0178] 1.1. Expression of -Hexosaminidase (Hex) Activity in the Brain and Other Organs after Intraventricular Administration of AAV-CMV-modHEXB to Sandhoff Disease (SD) Mouse Model
[0179] AAV-CMV-modHEXB (other name: AAV-CMV-mod2B) was administered once intraventricularly at 5.7510.sup.11 vg/25 l PBS (phosphate buffer) to 15-week-old Sandhoff disease mouse models (SD mice) (the late stage of disease development), the organs were extracted 1 week later, and tissues of the organs were disrupted via sonication (probe sonicator and warm-bath sonicator, 10 minutes) in distilled water containing a protease/phosphatase inhibitor cocktail (final concentration: 20 M leupeptin, 2 mM EDTA, 1 mM PMSF, 1 mM pepstatin A) (milliQ level) (wet tissue weight: 100 mg/0.3 ml). Following centrifugation at 4 C. and 12,000g for 15 minutes, the supernatants (tissue extracts) were prepared. The vector amount of 5.7510.sup.11 vg/SD mouse is equivalent to approximately 1.910.sup.13 vg/kg of body weight.
[0180] A given amount of the extract was subjected to assays of activity of degrading artificial fluorescent substrates; i.e., 4-methylumbelliferyl -D-glucosaminide (MUG) and 4-methylumbelliferyl 6-sulfo--D-glucosaminide (MUGS), in 0.1 M sodium citrate buffer (pH 4.2). Also, protein concentration in the extract was assayed, and substrate-degrading activity per unit protein amount; i.e., specific activity, was determined. In general, an SD mouse lacking HEXB and having HEXA does not have MUG-degrading activity but it has MUGS-degrading activity.
1.2. Expression of Human Modified -Hexosaminidase B (modHexB) Enzyme Protein in the Brain and Organs after Intraventricular Administration of AAV-CMV-modHEXB to Sandhoff Disease (SD) Mouse Models
[0181] In Western blot analysis of human modHexB, a given amount (10 pg each) of the tissue extracts obtained in Experiment 1.1 was used as a sample to perform SDS-electrophoresis (SDS-PAGE) (constant current: 15 mA) using 15% polyacrylamide gel. After electrophoresis, the gel was transcribed to a PVDF membrane at a constant voltage of 15 V, and the membrane was treated with a blocking agent for 1 hour. The resultant was treated with the anti-human HexA () rabbit polyclonal antibody NAG (A) as a primary antibody (a 1,000-fold dilution) at 4 C. overnight, washed with a Tris buffer, treated with the peroxidase-labeled anti-rabbit IgG antibody as a secondary antibody, washed, and subjected to detection of the human modHexB protein using a chemiluminescence kit and LAS4000mini (GEHealthcare).
[0182] The results of assays of MUG-degrading specific activity in organ extracts performed in Experiment 1.1 are shown in the upper chart of
1.3. Evaluation of Distribution of Human Modified -Hexosaminidase B (modHexB) Enzyme Protein and Decrease of Accumulated GM2 Ganglioside in Brain Regions of Sandhoff Disease (SD) Mouse Models after Intraventricular Administration of AAV-CMV-modHEXB
[0183] AAV-CMV-modHEXB was administered once intraventricularly at 5.7510.sup.11 vg/25 l PBS (phosphate buffer) to 15-week-old SD mice, the brain was extracted 1 week later, frozen sections thereof were prepared, the frozen sections were allowed to adhere to glass preparations and dehydrated, and the dehydrated frozen sections were fixed in a 4% paraformaldehyde/PBS solution at room temperature for 1 hour. The fixed sections were washed in PBS and subjected to blocking with 5% goat serum/PBS at room temperature for 1 hour.
[0184] The human modHEXB enzyme protein was analyzed by subjecting the brain sections after blocking and washing to treatment with the anti-human HexA () rabbit polyclonal antibody NAG (A) as a primary antibody (1,000-fold diluted) at 4 C. overnight. After the treated brain sections were washed with PBS, the washed brain sections were treated with the Alexa555-labeled anti-rabbit IgG as a secondary antibody, washed, and enclosed in 50% glycerol/PBS.
[0185] In order to examine the distribution of GM2 ganglioside (GM2) as the accumulated substrate in the brain and GM2 decrease caused by administration of the AAV vector, the brain sections were treated with the anti-GM2 mouse monoclonal IgM antibody (a 100-fold dilution) at 4 C. overnight. The treated brain sections were washed with PBS, treated with the Alexa388-labeled anti-mouse Ig secondary antibody, washed, and enclosed in 50% glycerol/PBS. As neural cell markers, NEUN (neuron marker), GFAP (astrocyte marker), and Iba1 (microglia marker) were subjected to immunofluorescent and histochemical analysis with the use of the primary antibody and the fluorescence-labeled secondary antibody. The immunofluorescence-labeled brain sections were observed using the BIOREVO apparatus (Keyence).
[0186]
[0187]
[0188]
[0189]
2. Distribution of Green Fluorescent Protein Expression in Sandhoff Disease (Hexb+/) Heterozygous Mouse Model Via Intraventricular Administration of AAV-CMV-GFP
[0190] To a 15-week-old Sandhoff disease heterozygous mouse model (Hexb+/, n=1), AAV-CMV-GFP (5.510.sup.11 vg) was administered intraventricularly (25 l), the cerebral ventricle was extracted 1 week later, the frozen brain sections were prepared, and EGFP (Ex=488 nm, Em=514 nm) was monitored using the BIOREVO apparatus. As neural cell markers, NEUN (neuron marker), GFAP (astrocyte marker), and Iba1 (microglia marker) were subjected to immunofluorescence staining with the use of the primary antibody and the fluorescence-labeled secondary antibody (Alexa544-anti-rabbit IgG), and GFP-expressing cell types were analyzed.
[0191]
3. Examination of Timing of Single Intraventricular Administration of AAV-CMV-modHEXB
[0192] To the aforementioned 15-week-old SD mouse (the late stage of disease development), AAV-CMV-modHEXB (other name: AAV-CMV-mod2B) was administered once intraventricularly at 5.7510.sup.11 vg/25 l PBS (phosphate buffer), and modHexB expression in the organs was analyzed 1 week later (at the age of 16 weeks). Further, AAV-CMV-modHEXB was administered once intraventricularly at 5.7510.sup.11 vg/25 l PBS (phosphate buffer) to a 14-week-old SD mouse (the late stage of disease development), and modHexB expression was analyzed 1 week later (at the age of 15 weeks). In addition, AAV-CMV-modHEXB was administered once intraventricularly at 5.7510.sup.11 vg/25 l PBS (phosphate buffer) to a 10-week-old SD mouse (the early stage of disease development) intraventricularly, and modHexB expression was analyzed 5 weeks later (at the age of 15 weeks). modHexB expression in each organ was evaluated in accordance with the procedure described in 1.1. above in which recovery of MUG-degrading activity was employed as the indicator.
[0193] The results are shown in
4. Examination of Single Intraventricular Dose of AAV-CMV-modHEXB
[0194] AAV-CMV-modHEXB was administered once intraventricularly at 5.7510.sup.9 vg, 3.4510.sup.10 vg, and 5.7510.sup.11 vg/25 l PBS (phosphate buffer), respectively, to 10-week-old SD mice (the early stage of disease development), and modHexB expression in each organ was analyzed 5 weeks later (at the age of 15 weeks). modHexB expression in each organ was evaluated in accordance with the procedure described in 1.1. above in which recovery of MUG-degrading activity was employed as the indicator.
[0195] The results are shown in
Summary of Experiments 1 to 4
[0196] In Experiment 2, AAV-CMV-GFP was administered intraventricularly at 5.510.sup.11 vg/mouse to 15-week-old Sandhoff disease heterozygous mouse models, and green fluorescence of GFP expressed in the vicinity of the site of administration was observed 1 week later. The AAV vector administered to the cerebral spinal fluid was introduced into the cerebral parenchyma-constituting cells, and the GFP gene was expressed under the control of the CMV promoter in the cells.
[0197] In Experiment 1.3, AAV-CMV-modHEXB was administered intraventricularly at 5.7510.sup.11 vg/mouse to a 15-week-old Sandhoff disease homozygous mouse (n=1), and immunofluorescence (red) to the anti-human Hex antibody was observed in a wide range of the cerebral region 1 week later (
[0198] In Experiment 1.3., immunofluorescence (green) to the anti-GM2 antibody was observed in a wide region of the cerebral region of the 15-week-old Sandhoff disease homozygous mouse as a result of immunohistochemical staining involving the use of the anti-GM2 ganglioside antibody and the anti-human Hex antibody (
5. Efficacy of Single Intraventricular Administration of AAV-CMV-modHEXB to 8-Week-Old Sandhoff Disease Mouse Model
5.1. Recovery of Hex (MUG-Degradation) Activity in Each Organ by Single Intraventricular Administration of AAV-CMV-modHEXB to Sandhoff Disease Mouse Model
[0199] After AAV-CMV-modHEXB was administered once intraventricularly at 5.7510.sup.11 vg/mouse to 8-week-old SD mice, the mice were subjected to autopsy at the age of 17 weeks, and Hex (MUG degradation) activity in each organ was assayed. The experimental procedure was the same as that in Experiments 1 to 3.
[0200] The results are shown in
5.2. Distribution of HexB and Decrease of Accumulated GM2 Ganglioside in Brain Regions of Sandhoff Disease (SD) Mouse Models after Single Intraventricular Administration of AAV-CMV-modHEXB
[0201] AAV-CMV-modHEXB was administered once intraventricularly at 5.7510.sup.11 vg/mouse to 8-week-old SD mice, the mice were subjected to autopsy at the age of 17 weeks, and the brain sections were subjected to immunostaining. The experimental procedure was the same as that in Experiments 1 to 3. Immunostaining was performed in accordance with the procedure described in Experiment 1.3.
[0202]
5.3. Decrease of CD68-Positive Activated Microglia in the Cerebral Region of Sandhoff Disease Mouse Model Via Single Intraventricular Administration of AAV-CMV-modHEXB
[0203] AAV-CMV-modHEXB was administered once intraventricularly at 5.7510.sup.11 vg/mouse to 8-week-old SD mice, the mice were subjected to autopsy at the age of 17 weeks, and the brain sections were subjected to immunostaining. The experimental procedure was the same as that in Experiments 1 to 3. Immunostaining was performed in accordance with the procedure descried in Experiment 1.3.
[0204]
5.4. Decrease of Inflammatory Chemokine (Mip1) in the Cerebral Region of Sandhoff Disease Mouse Model Via Single Intraventricular Administration of AAV-CMV-modHEXB
[0205] AAV-CMV-modHEXB was administered once intraventricularly at 5.7510.sup.11 vg/mouse to 8-week-old SD mice, the mice were subjected to autopsy at the age of 17 weeks, and inflammatory chemokine (Mip1-) in the brain, the cerebellum, and the brain stem was quantified. Mip1- in the brain, the cerebellum, and the brain stem of the wild-type mice (WT) and the SD mouse models (SD) was quantified in the same manner. Mip1- was quantified using the Mouse CCL3/MIP-1 alpha Quantikine ELISA Kit (R&D Systems). Other experimental procedure was the same as that in Experiments 1 to 3.
[0206] The results are shown in
6. Evaluation of Effects on Motor Functions, Body Weight, and Survival Time by the Rotarod Performance Test
6.1. Examination of Single Intraventricular Dose of AAV-CMV-modHEXB to Sandhoff Disease Mouse Models (Hexb/) for Improvement of Motor Functions and Body Weight
[0207] AAV-CMV-modHEXB was administered once intraventricularly at 5.7510.sup.10 vg/mouse or 5.7510.sup.11 vg/mouse to 8-week-old adult SD mice (the early stage of disease development), and the mice were subjected to the rotarod performance test every week starting at the age of 11 weeks.
[0208] The rotarod performance test was initiated at 4 round-per-minutes (rpm), the number of revolution was increased to 40 rpm in 120 seconds, each mouse was subjected to the test 6 times, and the average time until the mice fell from the rotarod was measured. The wild-type mice (WT) and the SD mice (SD) of the same age were subjected to the test under the same conditions. A practice test was performed 1 week before the actual test.
[0209] Body weight was measured and survival (survival time) was inspected at each time point.
[0210]
[0211] As a result of single administration of AAV-CMV-modHEXB at 5.7510.sup.11 vg/mouse at the age of 8 weeks, the SD mice exhibited the rotarod performance equivalent to the wild-type mice. When a dose of AAV-CMV-modHEXB was 5.7510.sup.10 vg/mouse, in contrast, the disease development was slightly delayed, and the survival time was not prolonged.
6.2. Effects of Single Intraventricular Administration of AAV-CMV-modHEXB to 8-Week-Old Sandhoff Disease Mouse Models (Hexb/) on Motor Functions
[0212] AAV-CMV-modHEXB was administered intraventricularly at 1.1510.sup.11 vg/mouse to 8-week-old SD mice. The rotarod performance test was performed in the same manner as in Experiment 6.1., and the average time until the mice fell from the rotarod was measured.
[0213] The results are shown in
7. Hex Activity Enhancement in Organs Via Single Administration of AAV-CMV-modHEXB to the Brain Ventricle or the Temporal Vein of Sandhoff Disease Heterozygous (Hexb+/) Newborn (P0 to P2) Mice
[0214] After AAV-CMV-modHEXB was administered to the brain ventricle or the temporal vein of SD heterozygous mice, enhancement of -hexosaminidase (Hex) activity in the brain and the organs was evaluated.
[0215] AAV-CMV-modHEXB was administered once at 1.1510.sup.11 vg/5 l PBS (phosphate buffer) or 1.1510.sup.10 vg/5 l PBS to the brain ventricle or the temporal vein of newborn SD heterozygous mice (P0 to P1), the mice were perfused with PBS at the age of 10 weeks, the organs (the brain, the heart, the lung, the liver, the spleen, and the kidney) were extracted, and tissue was disrupted via sonication (probe sonicator and warm-bath sonicator, 10 minutes) in distilled water containing a protease/phosphatase inhibitor cocktail (final concentration: 20 M leupeptin, 2 mM EDTA, 1 mM PMSF, 1 mM pepstatin A) (milliQ level) (wet tissue weight: 100 mg/0.3 ml). Following centrifugation at 4 C. and 12,000g for 15 minutes, the supernatant (tissue extract) was prepared.
[0216] A given amount of an extract was assayed in respect of activity of degrading an artificial fluorescent substrate; i.e., 4-methylumbelliferyl -D-glucosaminide (MUG), in 0.1 M sodium citrate buffer (pH 4.2). Also, protein concentration in the extract was assayed, and enzyme specific activity was determined.
[0217]
[0218]
8. Evaluation of Effects on Retention of Motor Functions, Maintenance of Body Weight, and Prolongation of Survival Time Via Single Administration of AAV-CMV-modHEXB to the Brain Ventricle or the Temporal Vein of Sandhoff Disease (Hexb/) Newborn (P0 to P2) Mice
[0219] After single administration of AAV-CMV-modHEXB to the brain ventricle or the temporal vein of SD mice, coordinated motor functions were evaluated by the rotarod performance test.
[0220] AAV-CMV-modHEXB was administered once at 1.1510.sup.10 vg/5 l PBS (phosphate buffer) to the brain ventricle or the temporal vein of newborn SD mice (P0 to P1), and the mice were subjected to the rotarod performance test every week starting at the age of 11 weeks.
[0221] The rotarod performance test was initiated at 4 round-per-minutes (rpm), the number of revolution was increased to 40 rpm in 120 seconds, each mouse was subjected to the test 6 times, and the average time until the mice fell from the rotarod was measured. The wild-type mice (WT) and the SD mice (SD) of the same age were subjected to the test under the same conditions. A practice test was performed 1 week before the actual test.
[0222] Body weight was measured and survival (survival time) was inspected at each time point.
[0223]
<Example 2: Evaluation of Effects of Administration of AAV-CMV-modHEXB and AAV-SynI-modHEXB on Neural Cells Induced to Differentiate from iPS Cells of Patients with Tay-Sachs Disease and Cultured Human Neural Cells of Sandhoff Disease Models>
[0224] 1. Evaluation of Effects of Administration of AAV-CMV-modHEXB and AAV-SynI-modHEXB on Neural Cells Induced to Differentiate from iPS Cells of Patients with Tay-Sachs Disease
[0225] In accordance with the method reported in Kondo T. et al., Cell Stem Cell 12 (4): 487-496, 2013, neural cells were induced to differentiate from iPS cells of patients with Tay-Sachs disease (TSD) (TSD iPS cells). A given number of TSD iPS cells were subjected to float culture in DFK 5% DS medium supplemented with dorsomorphin, SB431542, and non-essential amino acids (NEAA) for 8 days, the cultured cells were subjected to adhesion culture in DFN2D medium supplemented with N2 supplement, dorsomorphin, and NEAA for 16 days, the cultured cells were further subjected to adhesion culture in NB27full medium supplemented with neurotrophic factors; BDNF, GDNF, and NT-3, and B-27 Supplement (free of vitamin A and glutamax) for 25 days or longer, the cultured cells were subjected to passage culture, and the resultants were then subjected to the experiment of AAV-CMV-modHEXB and AAV-SynI-modHEXB administration.
[0226]
[0227] For immunocytochemical experiments, neural cells derived from healthy subjects and from TSD iPS cells shown on 8-well chamber slides were fixed in a 4% paraformaldehyde/PBS solution at room temperature for 1 hour. The slides were washed with PBS and subjected to blocking using 5% goat serum/PBS at room temperature for 1 hour.
1.1. Examination of Neural Cell Marker Expression and GM2 Ganglioside Accumulation
[0228] In order to examine whether or not GM2 ganglioside (GM2) had been accumulated in the neural cells that had been induced to differentiate from the TSD iPS cells or iPS cells derived from healthy subjects, the cells were treated with the anti-GM2 mouse monoclonal IgM antibody (a 100-fold dilution) at 4C overnight.
[0229] As human neural cell markers, primary antibodies reacting with -tubulin III (neurons), TBR1 (the cerebral cortex neurons), A2B5 (glial progenitor cells), and GFAP (astrocytes) were used. As secondary probes, biotin-labeled anti-mouse IGG+M antibody and the Cy3-labeled anti-rabbit IgG antibody were used. As a tertiary probe, FITC-streptavidin was used, and Hoechst 33258 was used for nuclear fluorostaining. Immunofluorescence was observed under a confocal laser scanning microscope (ZeissLSM700).
[0230] The results are shown in
1.2. Introduction of modHexB into the Neural Cells Derived from the iPS Cells of the patient with Tay-Sachs disease (TSD-N) using AAV-SynI-modHEXB and AAV-CMV-modHEXB
[0231] For determining dose dependency of modHexB gene introduction into the neural cells derived from the iPS cells of the patient with Tay-Sachs disease via administration of AAV-SynI-modHEXB and AAV-CMV-modHEXB (79 days after the initiation of differentiation induction, Day 79), 0.110.sup.6, 0.510.sup.6, and 1.010.sup.6 vg the AAV vector were administered to culture solutions per cell cultured on polyornithine/laminin-coated dishes, the culture solutions 7 days later (Day 86) were collected, the cells were washed and harvested, and the cell extracts were prepared.
[0232] Recovery of Hex activity was evaluated using artificial fluorescent substrates. Also, protein concentration in the extract was assayed, and enzyme specific activity was determined.
[0233] As artificial fluorescent substrates, 4-methylumbelliferyl -D-glucosaminide (MUG) and 4-methylumbelliferyl 6-sulfo--D-glucosaminide (MUGS) were used. In general, cells lacking the Hex subunit does not have MUGS-degrading activity, and cells lacking the Hex subunit does not have MUG-degrading activity.
[0234]
[0235]
2. Evaluation of Effects of AAV-CMV-modHEXB and AAV-SynI-modHEXB Administration on Cultured Human Neural Cells of Sandhoff Disease Models Prepared Via Genome Editing
2.1. Preparation of Cultured Human Neural Cells of Sandhoff Disease Models Via Genome Editing
[0236] The human HEXB knockout vector was prepared by designating the genome sequence: CGGCTTGGCCGAGACGCTCG, in Exon 1 of HEXB as a target sequence and using the GeneArt CRISPR Nuclease Vector with OFP Reporter Kit (Invitrogen #A21174). The vector was transfected into the human neuroblastoma; i.e., the SH-SY5Y cell line, via lipofection to perform HEXB KO via genome editing using the CRISPR/Cas9 system.
[0237] The SH-SY5Y cells into which the HEXB knockout vector had been introduced were subjected to FACS to sort OFP-expressing cells (CAS9-expressing cells), and maintenance culture was performed using DMEM/F12+10% FBS, 70 pg/100 pg/ml penicillin G/streptomycin medium. Through limiting dilution, defective strains having activity of degrading an artificial fluorescent substrate (MUG), which was decreased to 2% or lower of that of the parent strain, were selected.
[0238] The HEXB KO SH-SY5Y cells and the parent strain were fixed in a 4% paraformaldehyde/PBS solution at room temperature for 1 hour. The resultant was washed with PBS and subjected to blocking using 5% goat serum/PBS at room temperature for 1 hour. The accumulated substrate; i.e., GM2 ganglioside (GM2), was treated with the anti-GM2 mouse monoclonal IgM antibody (a 100-fold dilution) at 4 C. overnight. The resultant was washed, treated with a secondary antibody; i.e., the Cy3-labeled anti-rabbit IgG antibody, and Hoechst 33258 was used for nuclear fluorostaining. After washing, the resultant was enclosed in 50% glycerol/PBS, and immunofluorescence was observed under a confocal laser scanning microscope (ZeissLSM700).
[0239]
[0240]
[0241] In the HEXB KO SH-SY5Y cells (HEXB KO), MUG-degrading activity lowered to approximately 2% that of the wild-type parent strain (WT) and accumulation of the substrate (GM2 ganglioside) were observed.
2.2. Induction of Differentiation of HEXB KO SH-SY5Y Cells into Neural Cells
[0242] HEXB KO SH-SY5Y cells (HEXB KO) were cultured in the presence of DMEM/F12+3% FBS, 70 g/100 g/ml penicillin G/streptomycin, and 10 g/ml retinoic acid for 10 days or longer to induce the HEXB KO cells to differentiate into neural cells.
[0243] The differentiated neural cells were fixed in a 4% paraformaldehyde/PBS solution at room temperature for 1 hour. The fixed cells were washed in PBS and subjected to blocking with 5% goat serum/PBS at room temperature for 1 hour. The cells were treated with the primary antibodies reacting with Nestin (neural stem cell marker), PSA-NCAM (neural progenitor cell marker), and -Tubulin III and NF-L (neuron) at 4 C. overnight. As a secondary probe, the Cy3-labeled anti-rabbit IgG antibody was used, and Hoechst 33258 was used for nuclear fluorostaining. After washing, the resultant was enclosed in 50% glycerol/PBS, and immunofluorescence was observed under a confocal laser scanning microscope (ZeissLSM700).
[0244]
2.3. modHexB Introduction into Human HEXBKO Cultured Neural Cells Using AAV-CMV-modHEXB and AAV-SynI-modHEXB
[0245] Dose dependency of single administration of AAV-CMV-modHEXB and AAV-SynI-modHEXB into cultured human neural cells HEXB KO SH-SY5Y was determined by administering the AAV vector at 0.110.sup.5, 0.510.sup.5, 110.sup.5, and 1.010.sup.6 vg/cell to the human HEXB KO cultured neural cells (SH-SY5Y cells, 1.010.sup.6 cells) 8 days after differentiation induction, collecting the culture supernatant and the cells 7 days later, preparing cell extracts, and evaluating development of Hex activity using artificial fluorescent substrate MUG inside and outside the cells. Also, protein concentration in the cell extracts was assayed, and enzyme specific activity was determined.
[0246]
[0247]
2.4. Western Blot Analysis of modHexB Secreted Extracellularly
[0248] The AAV-CMV-modHEXB vectors obtained in Experiment 2.3. above were administered at relevant doses to cultured human neural cells HEXB KO SH-5Y5Y, a given amount of the protein in the culture supernatant (10 g each) 7 days later was subjected as a sample to SDS-PAGE involving the use of 10% polyacrylamide gel, and human modHexB was subjected to Western blot analysis. After electrophoresis, the gel was transcribed to a PVDF membrane at a constant voltage, and the membrane was treated with a blocking agent for 1 hour. The resultant was treated with the anti-human HexA () rabbit polyclonal antibody NAG (A) as a primary antibody (a 1,000-fold dilution) at 4 C. overnight, washed with a Tris buffer, treated with the peroxidase-labeled anti-rabbit IgG antibody as a secondary antibody, washed, and subjected to detection of the human modHexB-derived protein using a chemiluminescence kit (ECLplus) and LAS4000mini (GEHealthcare).
[0249]
3. Summary of Example 2
[0250] As a result of gene introduction using AAV-SynI-modHEXB comprising the modHEXB gene ligated to a region downstream of the neural cell-specific expression promoter, MUGS-degrading activity in the neural cells derived from the iPS cells of the patient with Tay-Sachs disease and MUG-degrading activity in the cultured human neuroblastoma SH-SY5Y HEXB KO of Sandhoff disease model were slightly recovered.
[0251] When AAV-CMV-modHEXB comprising the modHEXB gene ligated to a region downstream of the ubiquitous expression promoter (CMVs) was used, MUGS-degrading activity in the neural cells derived from the iPS cells of the patient with Tay-Sachs disease and MUG-degrading activity in the cultured human neuroblastoma SH-SY5Y HEXB KO of Sandhoff disease model were significantly recovered.
[0252] When AAV-CMV-modHEXB was administered to the cultured human neuroblastoma SH-SY5Y HEXB KO of Sandhoff disease model at 110.sup.6 vg/cell, the recombinant human modHexB progenitor protein expressed in the neural cells was secreted extracellularly. Thus, this suggests cross-correction effects.
Example 3: Preparation of AAV-CMV-modHEXB
(1) Modification of AAV Coat (Capsid) Protein VP1
[0253] Concerning type 9AAV (AAV9), the pAAV9-RC plasmid comprising a nucleotide sequence encoding the coat protein VP1 was used as a template. This plasmid is derived from AAV3 Rep/VP described in the literature (Handa et al., J. Gen. Virol., 81: 2077-2084, 2000) and comprises the AAV3 Rep sequence (Muramatsu et al., Virology 221, 208-217, 1996). The nucleotide sequence of AAV9 VP1 has already been registered under Accession No. AY530579 at GenBank (shown in SEQ ID NO: 5). The primers shown below were synthesized, and tyrosine (Y) at position 446 in the amino acid sequence of AAV9 VP1 (SEQ ID NO: 6) was substituted with phenylalanine (F) using the Quick Change II XL site-directed mutagenesis kit (Stratagene). The pAAV9-yfRC plasmid comprising a polynucleotide encoding the substituted amino acid sequence AAV9-yfVP1-3 (SEQ ID NO: 12) was prepared. pAAV9-yfRC comprises the nucleotide sequence encoding AAV2 Rep (SEQ ID NO: 15). [0254] yfAAV9-F: 5-CGACCAATACTTGTACTTTCTCTCAAAGAC-3 (SEQ ID NO: 21) [0255] yfAAV9-R 3-GCTGGTTATGAACATGAAAGAGAGTTTCTG-5 (SEQ ID NO: 22)
(2) Preparation of rAAV Vector
(a) Preparation of Vector Genome Plasmid
[0256] The pAAV-CMV-modHEXB plasmid comprising, between hairpin DNA sequences referred to as 5- and 3-inverted terminal repeat inverted terminal repeats (ITRs) of the pAAV3 plasmid comprising the DNA sequence of type 3AAV (AAV3), a DNA sequence comprising the CMV promoter, the first intron of the human growth hormone (hGH), modHEXB (DNA encoding the amino acid sequence as shown in SEQ ID NO: 25), WPRE (the woodchuck hepatitis virus post-transcriptional regulatory element), and the SV40 polyadenylation sequence inserted in that order from the 5 terminus toward the 3 terminus was prepared. SEQ ID NO: 26 shows the nucleotide sequence of the expression cassette from 5 ITR to 3 TTR of pAAV-CMV-modHEXB. In the nucleotide sequence as shown in SEQ ID NO: 26, a region of nucleotides 1 to 146 constitutes the 5 ITR, a region of nucleotides 382 to 951 constitutes the CMV promoter sequence, a region of nucleotides 1049 to 1369 constitutes the first intron sequence of hGH, a region of nucleotides 1428 to 3026 constitutes the modHEXB sequence, a region of nucleotides 3046 to 3634 constitutes the WPRE sequence, a region of nucleotides 3728 to 3862 constitutes the SV40 polyadenylation sequence, and a region of nucleotides 3939 to 4083 constitutes the 3 ITR sequence. The basic structure of this plasmid is described in Li et al., Mol. Ther., 13: 160-166, 2006.
(b) Transfection into HEK293 Cell
<Day 1>
[0257] The HEK293 cells (1.510.sup.6 cells) were seeded in a 225-cm.sup.2 flask and cultured in 10% FCS-DMEM/F12 medium in the presence of 5% CO.sub.2 at 37 C.
<Day 3>
[0258] Transfection was performed by the calcium phosphate method.
[0259] The AAV helper plasmid (pAAV9-yfRC), the AAV vector genome plasmid (pAAV-CMV-modHEXB), and the helper plasmid comprising the nucleotide sequence of Adenovirus (AdV) (pHelper, AAV Helper-Free System, Catalog No. 240071, Agilent Technologies) (25 g each, 75 g in total) were mixed with each other in 0.3 M CaCl.sub.2.
[0260] Thereafter, 2HBS (80 mM NaCl, 50 mM Hepes buffer, 1.5 mM Na.sub.2HPO.sub.4, pH 7.10) was added to prepare DNA-calcium phosphate. The culture medium in the flask was replaced with a medium supplemented with DNA-calcium phosphate, culture was conducted for several hours, and the medium was then replaced with a fresh medium.
<Day 6>
[0261] The virus virions (rAAV virions) were collected. The cells were peeled from the culture dish with the addition of 0.5 M EDTA and suspended in TBS (100 mM Tris HCl, pH 8.0, 150 mM NaCl). With the use of a dry ice-ethanol bath and a water bath (37 C.), a freeze-thaw process was repeated 3 times to disrupt the cells. Following centrifugation at 10,000g for 10 minutes, the supernatant was collected, and coarse debris was removed.
(c) Preparation of Virus Vector
[0262] In accordance with the procedure described below, ultracentrifugation was performed by cesium chloride CsCl density gradient to purify the rAAV vector. In the ultracentrifugation tube, 1.5 M CsCl and 1.25 M CsCl were superposed to prepare density gradient. After the cell debris solution containing the rAAV vector was superposed, ultracentrifugation was performed at 30,000 rpm for 2.5 hours. The refractive index (RI) was measured and a fraction containing the rAAV vector with RI of 1.365 to 1.380 was collected. This fraction was superposed again on the CsCl solution, and ultracentrifugation was performed at 36,000 rpm for 2.5 hours to obtain a fraction containing rAAV.
(d) Measurement of Virus Vector Titer (Real-Time PCR)
[0263] A serial dilution series of 10.sup.2 to 10.sup.6 of purified rAAV was prepared. Quantification was carried out with the use of a set of primers involving the use of the WPRE sequence as the standard and the Applied Biosystems 7900HT Fast Real-time PCR System (Applied Biosystems).
Example 4: Preparation of AAV-SynI-modHEXB
[0264] AAV-SynI-modHEXB was prepared in the same manner as the method for preparation of AAV-CMV-modHEXB described in Example 3, except for the use of the vector genome plasmid comprising an expression cassette modified from the expression cassette of AAV-CMV-modHEXB by substitution of the CMV promoter sequence composed of nucleotides 382 to 951 in the nucleotide sequence as shown in SEQ ID NO: 26 with the SynI promoter sequence as shown in SEQ ID NO: 23.
Example 5: Preparation of AAV-CMV-GFP
[0265] AAV-CMV-GFP was prepared in the same manner as the method for preparation of AAV-CMV-modHEXB described in Example 3, except for the use of the vector genome plasmid comprising an expression cassette modified from the expression cassette of AAV-CMV-modHEXB by substitution of the modHEXB sequence composed of nucleotides 1428 to 3026 in the nucleotide sequence as shown in SEQ ID NO: 26 with the known GFP sequence.
Example 6: Administration of AAV-CMV-modHEXB to Crab-Eating Macaque
[0266] AAV-CMV-modHEXB prepared in the manner described in Example 3 was administered once intraspinally to five 2-week-old healthy crab-eating macaques (Macaca fascicularis) at 2.010.sup.11 vg per kg of body weight. The 5 individuals were designated as Identification Numbers: #1 to #5. These individuals were observed for 3 months after administration, and no adverse effects were observed in terms of appetite, body weight, and behavior.
(Preparation of Tissue Extract)
[0267] Tissues indicated below were extracted 3 months after administration. [0268] Parietal cortex
[0269] Temporal cortex [0270] Entothinal cortex
[0271] Hippocampus
[0272] Putamen
[0273] Cerebellum
[0274] Brain stem
[0275] Cervical spinal cord (C4-C6)
[0276] Thoracic spinal cord (Th6-Th8)
[0277] Lumber spinal cord (L2-L4)
[0278] Heart
[0279] Lung
[0280] Liver
[0281] Spleen [0282] Kidney
[0283] 300 l of ultrapure water was added based on 100 mg each of the wet tissue, and ultrasonic disintegration treatment involving the use of an ultrasonic disintegrator for 2 minutes was repeated 10 times to obtain a cell debris solution.
[0284] Subsequently, the cell debris solution was ultrasonically treated using an ultrasonic washing apparatus (water bath) for 10 minutes.
[0285] The resulting debris solution was centrifuged at 4 C. and 12,000g for 15 minutes, and the supernatant was collected as an enzyme activity assay sample (tissue extract).
(Assay of Hex Activity of Tissue Extract)
[0286] A given amount each of the tissue extracts was subjected to assays of activity of degrading artificial fluorescent substrates; i.e., 4-methylumbelliferyl -D-glucosaminide (MUG) and 4-methylumbelliferyl 6-sulfo--D-glucosaminide (MUGS). Also, protein concentration in the tissue extracts was assayed, and substrate-degrading activity per unit protein amount; i.e., specific activity, was determined.
[0287] Substrate-degrading activity was assayed by subjecting a given amount of the tissue extract adequately diluted with ultrapure water and a MUG or MUGS solution to incubation at 37 C. for 30 minutes, adding 370 l of 0.2 M glycine-NaOH (pH 10.7) to terminate the reaction, fractionating the solution at 200 l/well to a 96-well plate, and performing fluorescent assay (excitation: 355 nm; detection: 460 nm). In order to prepare a calibration curve, 4-MU (4-methylumbelliferone) diluted to 0.5 nmol to 5 nmol in 0.2 M glycine-NaOH (pH 10.7) was also fractionated at 200 l/well to a 96-well plate, and fluorescent assay was performed.
[0288] The results are shown in
(Assay of Plasma Hex Activity)
[0289] Blood samples were obtained before AAV-CMV-modHEXB administration and 12 weeks after administration (immediately before euthanasia) to prepare plasma samples.
[0290] The blood plasma diluted to 10-fold with ultrapure water (15 l) and 15 l of the MUGS solution were incubated at 37 C. for 30 minutes, 370 l of 0.2 M glycine-NaOH (pH 10.7) was added to terminate the reaction, the solution was fractionated at 200 l/well to a 96-well plate, and fluorescent assay (excitation: 355 nm; detection: 460 nm) was performed. In order to prepare a calibration curve, 4-MU (4-methylumbelliferone) diluted to 0.5 nmol to 5 nmol in 0.2 M glycine-NaOH (pH 10.7) was also fractionated at 200 l/well to a 96-well plate, and fluorescent assay was performed.
[0291]
Example 7: Administration of AAV-CMV-GFP to Crab-Eating Macaque
[0292] AAV-CMV-GFP prepared in the manner described in Example 5 was administered once intraspinally to two 2-week-old healthy crab-eating macaques (Macaca fascicularis) at 2.010.sup.12 vg per kg of body weight. These individuals were observed for 3 months after administration, and no adverse effects were observed in terms of appetite, body weight, and behavior.
(Preparation of Tissue Extract)
[0293] Tissues indicated below were extracted 3 months after administration. [0294] Parietal cortex
[0295] Temporal cortex
[0296] Entothinal cortex
[0297] Hippocampus
[0298] Putamen [0299] Cerebellum
[0300] Brain stem
[0301] Spinal cord (C4-C6)
[0302] Spinal cord (Th6-Th8)
[0303] Spinal cord (L2-L4)
[0304] RIPA buffer (300 l, 50 mM Tris-HCl (pH ya 7.5), 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 1% NP-40) was added based on 100 mg each of wet tissue, and ultrasonic disintegration treatment involving the use of an ultrasonic disintegrator for 2 minutes was repeated 10 times to obtain a cell debris solution.
[0305] Subsequently, the cell debris solution was ultrasonically treated using an ultrasonic washing apparatus (water bath) for 10 minutes.
[0306] The resulting cell debris solution was centrifuged at 4 C. and 12,000g for 15 minutes, and the supernatant was collected as a GFP detection sample (tissue extract) via Western blotting.
(Detection of GFP in Tissue Extract Via Western Blotting)
[0307] The tissue extracts were each adjusted to contain 30 g of the protein, and ultrapure water 6dye(+) were added to bring the total amount of the solution to 18 d.
[0308] The samples with the modified volume were boiled for 3 minutes, the total amount of the solutions were applied to 15% SDS-PAGE gel, and electrophoresis was performed at 15 mA to 20 mA.
[0309] After electrophoresis, the gel was transcribed to a PVDF membrane at a constant voltage of 15 V for 1 hour.
[0310] After transcription, the PVDF membrane was treated with a blocking agent comprising Blocking One and TBS (Tris-buffered saline) at 1:1 for 1 hour.
[0311] A primary anti-GFP antibody, 1,000-fold diluted mouse-derived Anti-GFP Clontech j1-8 (Clontech), was subjected to incubation with the blocked PVDF membrane at 4 C. overnight.
[0312] Following the treatment with the primary antibody, the PVDF membrane was washed with TBS/0.1% Tween 20 for 5 minutes, and this washing process was performed 3 times.
[0313] The washed PVDF membrane was subjected to incubation with the secondary antibodies, the HRP-labeled anti-mouse Ig antibody (Anti-Mouse Ig HRP-linked lot: 32, 1,000-fold diluted) and the HRP-labeled anti-biotin antibody (Anti-Biotin HRP-linked lot: 32, 1,000-fold diluted, for detection of the molecular weight marker), for 1 hour.
[0314] Following the treatment with the secondary antibodies, the PVDF membrane was washed with TBS/0.1% Tween 20 for 5 minutes, and this washing process was performed 3 times.
[0315] The band intensity was detected using the BIORAD ChemiDoc XRS system.
[0316] The results are shown in
SEQUENCE LISTING FREE TEXT
[0317] SEQ ID NO: 1: the nucleotide sequence of the wild-type AAV-derived capsid protein AAV1-VP1 (GenBank: NC_002077.1)
[0318] SEQ ID NO: 2: the amino acid sequence of the wild-type AAV1-derived capsid protein AAV1-VP1 (GenBank: NC_2077.1)
[0319] SEQ ID NO: 3: the nucleotide sequence of the wild-type AAV2-derived capsid protein AAV2-VP1 (GenBank: NC_001401.2)
[0320] SEQ ID NO: 4: the amino acid sequence of the wild-type AAV2-derived capsid protein AAV2-VP1 (GenBank: NC_001401.2)
[0321] SEQ ID NO: 5: the nucleotide sequence of the wild-type AAV9-derived capsid protein AAV9-VP1 (GenBank: AY530579.1)
[0322] SEQ ID NO: 6: the amino acid sequence of the wild-type AAV9-derived capsid protein AAV9-VP1 (GenBank: AY530579.1)
[0323] SEQ ID NO: 7: the nucleotide sequence of the AAV1-derived capsid protein mutant AAV1-yfVP1
[0324] SEQ ID NO: 8: the amino acid sequence of the AAV1-derived capsid protein mutant AAV1-yfVP1
[0325] SEQ ID NO: 9: the nucleotide sequence of the AAV2-derived capsid protein mutant AAV2-yfVP1
[0326] SEQ ID NO: 10: the amino acid sequence of the AAV2-derived capsid protein mutant AAV2-yfVP1
[0327] SEQ ID NO: 11: the nucleotide sequence of the AAV9-derived capsid protein mutant AAV9-yfVP1
[0328] SEQ ID NO: 12: the amino acid sequence of the AAV9-derived capsid protein mutant AAV9-yfVP1
[0329] SEQ ID NO: 13: the nucleotide sequence of AAV3-derived 5 ITR (GenBank: NC_001729-derived)
[0330] SEQ ID NO: 14: the nucleotide sequence of AAV3-derived 3 ITR
[0331] SEQ ID NO: 15: the nucleotide sequence of the AAV2-derived rep gene
[0332] SEQ ID NO: 16: the amino acid sequence of the AAV2-derived protein
[0333] SEQ ID NO: 17: the nucleotide sequence of the mutagenesis primer 1 (yfAAV1-F)
[0334] SEQ ID NO: 18: the nucleotide sequence of the mutagenesis primer 2 (yfAAV1-R)
[0335] SEQ ID NO: 19: the nucleotide sequence of the mutagenesis primer 3 (yfAAV2-F)
[0336] SEQ ID NO: 20: the nucleotide sequence of the mutagenesis primer 4 (yfAAV2-R)
[0337] SEQ ID NO: 21: the nucleotide sequence of the mutagenesis primer 5 (yfAAV9-F)
[0338] SEQ ID NO: 22: the nucleotide sequence of the mutagenesis primer 6 (yfAAV9-R)
[0339] SEQ ID NO: 23: the Synapsin I promoter sequence (GenBank: M55300.1)
[0340] SEQ ID NO: 24: the myelin basic protein promoter sequence (GenBank: M63599 (human)-derived)
[0341] SEQ ID NO: 25: the amino acid sequence of modHEXB
[0342] SEQ ID NO: 26: the nucleotide sequence of the CMV-modHEXB expression cassette
[0343] SEQ ID NO: 27: the nucleotide sequence of the wild-type human -hexosaminidase -subunit
[0344] SEQ ID NO: 28: the amino acid sequence of the wild-type human -hexosaminidase -subunit
[0345] All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.