CODON OPTIMIZED PRECURSOR GENE AND SIGNAL PEPTIDE GENE OF HUMAN INSULIN ANALOGUE

Abstract

Provided is a nucleic acid molecule of a codon optimized precursor gene and signal peptide gene of a human insulin analogue. The nucleic acid molecule comprises a nucleic acid molecule encoding the precursor of the fusion insulin analogue and a nucleic acid molecule encoding the yeast secreting signal peptide -factor. The nucleic acid molecule improves the expression of the precursor of the insulin analogue in Pichia Pastoris, and reduces the production cost of the human insulin analogue.

Claims

1. A nucleic acid molecule comprising molecule or structure having the following general formula:
5-(PS).sub.a-(SP).sub.b-(LS).sub.c-GE-(PS).sub.d-3, wherein PS is a nucleic acid molecule encoding a processing site, a is 0 or 1; SP is a nucleic acid molecule encoding a signal peptide, b is 0 or 1; LS is a nucleic acid molecule encoding a spacer peptide, c is 0 or 1; GE is a nucleic acid molecule encoding a polypeptide of interest; and PS is a nucleic acid molecule encoding a processing site, d is 0 or 1; and the nucleic acid molecule encoding the signal peptide comprises a sequence shown as SEQ ID NO:1.

2. A nucleic acid molecule comprising molecule or structure having the following general formula:
5-(PS).sub.a-(SP).sub.b-(LS).sub.c-GE-(PS).sub.d-3, wherein PS is a nucleic acid molecule encoding a processing site, a is 0 or 1; SP is a nucleic acid molecule encoding a signal peptide, b is 1; LS is a nucleic acid molecule encoding a spacer peptide, c is 0 or 1; GE is a nucleic acid molecule encoding a human insulin analogue precursor polypeptide; and PS is a nucleic acid molecule encoding a processing site, d is 0 or 1; and the nucleic acid molecule encoding the human insulin analogue precursor polypeptide comprises sequence shown as SEQ ID NO:3.

3. The nucleic acid molecule according to claim 1, wherein the polypeptide of interest is a human insulin analogue precursor comprising a nucleic acid molecule encoding an amino acid sequence shown as SEQ ID NO: 4.

4. The nucleic acid molecule according to claim 2, wherein the nucleic acid molecule encoding the signal peptide comprises a nucleic acid molecule encoding an amino acid sequence shown as SEQ ID NO: 2.

5. The nucleic acid molecule according to claim 2, wherein the nucleic acid molecule encoding human insulin analogue precursor comprises a substitution at positions 88-96 of SEQ ID NO: 3.

6. The nucleic acid molecule according to claim 1, wherein the amino acid sequence of the spacer peptide comprises SEQ ID NO: 16.

7. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule: a) comprises a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO:15; or b) consists of a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO:15.

8. The nucleic acid molecule according to claim 1, wherein the processing site is a restriction site.

9. A vector comprising the nucleic acid molecule according to claim 1.

10. A host cell comprising the vector of claim 9.

11. A method for producing a human insulin analogue comprising the step of cultivating the host cell of claim 10 in a medium.

12. The method of claim 11, further comprising the step of: 1) expressing a human insulin analogue precursor; and 2) obtaining a human insulin analogue by enzymatically digesting the human insulin analogue precursor obtained in step 1).

13. The method according to claim 11, wherein the human insulin analogue is a human insulin with deletion of B30, and/or the human insulin analogue is further substituted with an acylated group.

14. The nucleic acid molecule according to claim 3, wherein the nucleic acid sequence comprises a sequence shown as SEQ ID NO: 3.

15. The nucleic acid molecule according to claim 4, wherein the nucleic acid sequence comprises a sequence shown as SEQ ID NO: 1 or SEQ ID NO: 12.

16. The nucleic acid molecule according to claim 5, wherein the substitution at positions 88-96 of SEQ ID NO: 3 is with GCCGCTAAG, GCTGCCAAG, GCTGCTAAA or GCCGCCAAG.

17. The nucleic acid molecule according to claim 6, wherein the nucleic acid molecule encoding the spacer peptide comprises a sequence shown as SEQ ID NO: 5.

18. The host cell according to claim 10, wherein the host cell is a yeast.

19. The host cell according to claim 18, wherein the yeast is Pichia Pastoris.

20. The method according to claim 13, wherein the lysine at position B29 in the human insulin analogue is substituted with an acylated group.

21. The method according to claim 20, wherein the human insulin analogue after substitution is lysine B29 (N.sup.-(N.sup.-hexadecane fatty diacid-L-lysine-N.sup.-oxobutylyl)) des(B30) human insulin.

Description

DETAILED DESCRIPTION OF THE DISCLOSURE

[0053] The following examples are provided to further illustrate the invention, but are not intended to limit the scope of the invention.

[0054] The vectors, host bacteria and culture media used in the examples of the present invention were purchased from Invitrogen. pPIC9K, a Pichia Pastoris expression vector, contains an alcohol oxidase AOX1 promoter, which can be induced by methanol, and the vector also contains -factor signal peptide sequence and is capable of expressing foreign proteins via secretory expression. pPIC3.5K, another Pichia Pastoris expression vector, contains alcohol oxidase AOX1 promoter, which can be induced by methanol, and the vector does not contain -factor signal peptide sequence. Pichia Pastoris GS115 strain was used as host bacteria. The formulation of the culture medium was provided by the Pichia Pastoris manual.

EXAMPLE 1

Construction of Recombinant Expression Vector for Insulin Precursor

[0055] EcoR I and Not I restriction sites were added into the 5- and 3-ends of Control 1 (SEQ ID NO: 10), Control 2 (SEQ ID NO: 11) and IP-S (SEQ ID NO: 6), respectively and synthesized by Nanjing Kingsray Biotech Co., Ltd. The synthesized nucleic acid molecule sequence was ligated into T vector.

TABLE-US-00008 SEQIDNO:6 GAAGAAGGTGAACCAAAGTTCGTCAACCAGCACTTGTGTGGTTCCCATT TGGTTGAGGCTCTGTACTTGGTCTGTGGAGAAAGAGGTTTCTTTTACAC CCCAAAGGCTGCTAAGGGTATCGTTGAGCAATGTTGCACCTCTATTTGT TCCCTGTATCAGTTGGAAAACTACTGCAACTAA; SEQIDNO:10 GAAGAAGGTGAACCAAAGTTCGTTAACCAACACTTGTGCGGTTCCCACT TGGTTGAAGCTTTGTACTTGGTTTGCGGTGAAAGAGGTTTCTTCTACAC TCCTAAGGCTGCTAAGGGTATTGTCGAACAATGCTGTACCTCCATCTGC TCCTTGTACCAATTGGAAAACTACTGCAACTAA; SEQIDNO:11 GAAGAAGGTGAACCAAAGTTTGTTAACCAACATTTGTGTGGTTCTCATT TGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACAC TCCAAAGGCTGCTAAGGGTATTGTTGAACAATGTTGTACTTCTATTTGT TCTTTGTACCAATTGGAAAACTACTGTAACTAA.

[0056] The T vector carrying the insulin precursor nucleic acid molecule and the expression vector pPIC9K were digested with both EcoR I and Not I, and then the target fragment and the vector fragment were separately recovered by a Gel Recovery Kit. After purification of the digested fragments, and the target fragment was ligated to the vector pPIC9K with T4 ligase.

[0057] The above-mentioned ligation solution was transformed into E. coli TOP10 competent cells, and plated onto a plate with ampicillin resistance. After cultivation, the bacterial colony was picked, and the plasmid was extracted and verified by digestion with both restriction enzymes. Three recombinant expression vectors comprising Control 1, Control 2 and IP-S sequence respectively, were finally obtained.

EXAMPLE 2

Expression of Insulin Precursor by Pichia Pastoris Recombinant Strain

[0058] The three recombinant expression vectors constructed in Example 1 were transformed into Pichia Pastoris GS115 respectively, the recombinant strains expressing Control 1 and Control 2 were used as control strains, and the recombinant strain expressing IP-S was used as test strain.

[0059] The colonies from the three recombinant bacteria were inoculated into 5 mL YPD medium, and cultivated at a constant temperature of 30 C. while shaking at 250 rpm, until the value of OD.sub.600 reached about 10 (16-18 hours). The cells were collected and resuspended in 50 mL BMGY medium, and cultivated overnight at a constant temperature of 30 C. while shaking at 250 rpm, until the value of OD.sub.600 reached about 30. The cells were collected by centrifuging at 1500 rpm for 5 minutes and resuspended in 25 mL of BMMY medium. 1/200 volume of methanol (final concentration of 0.5%) was added into the medium, and cultivated at a constant temperature of 30 C. while shaking at 250 rpm for 96 hours, while 1/200 volume of methanol was supplemented every 24 hours. Upon the expression was finished, the supernatant was obtained after centrifugation at 10,000 rpm. The yield of the insulin precursor comprised in the supernatant was measured by HPLC, and converted into a percentage relative to the expression amount of the insulin precursor expressed by the control strain. The percentage of expression level of the insulin precursor is shown as Table 1.

TABLE-US-00009 TABLE 1 Signal Expression Percentage of Bacterial strain vector peptide Gene yield (%) Control bacterium pPIC9K -factor Control 1 100 Control bacterium pPIC9K - factor Control 2 125 Test bacterium pPIC9K - factor IP-S 225

[0060] The data in Table 1 shows that the amount of insulin precursor expressed by the optimized insulin precursor gene was increased by 1.8 to 2.25 times compared to those in the two control groups. It can be seen that the optimized insulin precursor gene has superior expression efficiency and can significantly improve the yield of the expressed insulin precursor.

EXAMPLE 3

Construction of Recombinant Expression Vectors Comprising Insulin Precursor Gene Fused to Different -Factors

[0061] Nucleic acid molecules shown as SEQ ID NO: 13 and SEQ ID NO: 8, in which -factor (SEQ ID NO: 12) and -factor-S (SEQ ID NO: 1) were separately fused to the site in the upstream of IP-S, were synthesized. EcoR I and Not I restriction sites were also incorporated at both 5 and 3 ends of the synthesized nucleic acid molecules. The synthesized nucleic acid molecules were ligated to the T vector.

TABLE-US-00010 SEQIDNO:12 ATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCG CATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAAT TCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGAT GTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTA TAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCT CGAGAAAAGA SEQIDNO:1 ATGAGATTTCCTTCTATTTTCACTGCTGTTTTGTTTGCCGCTTCCTCTG CTTTGGCAGCTCCAGTTAATACAACCACTGAAGATGAGACTGCTCAAAT CCCAGCCGAAGCAGTTATTGGTTACTCCGACTTGGAAGGAGATTTTGAC GTCGCTGTTTTACCATTCTCTAATTCCACTAATAACGGTCTGTTGTTTA TTAATACTACCATTGCTTCTATCGCCGCTAAGGAGGAAGGTGTGTCCCT CGAGAAAAGA SEQIDNO:13 ATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCG CATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAAT TCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGAT GTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTA TAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCT CGAGAAAAGAGAAGAAGGTGAACCAAAGTTCGTCAACCAGCACTTGTGT GGTTCCCATTTGGTTGAGGCTCTGTACTTGGTCTGTGGAGAAAGAGGTT TCTTTTACACCCCAAAGGCTGCTAAGGGTATCGTTGAGCAATGTTGCAC CTCTATTTGTTCCCTGTATCAGTTGGAAAACTACTGCAACTAA SEQIDNO:8 ATGAGATTTCCTTCTATTTTCACTGCTGTTTTGTTTGCCGCTTCCTCTG CTTTGGCAGCTCCAGTTAATACAACCACTGAAGATGAGACTGCTCAAAT CCCAGCCGAAGCAGTTATTGGTTACTCCGACTTGGAAGGAGATTTTGAC GTCGCTGTTTTACCATTCTCTAATTCCACTAATAACGGTCTGTTGTTTA TTAATACTACCATTGCTTCTATCGCCGCTAAGGAGGAAGGTGTGTCCCT CGAGAAAAGAGAAGAAGGTGAACCAAAGTTCGTCAACCAGCACTTGTGT GGTTCCCATTTGGTTGAGGCTCTGTACTTGGTCTGTGGAGAAAGAGGTT TCTTTTACACCCCAAAGGCTGCTAAGGGTATCGTTGAGCAATGTTGCAC CTCTATTTGTTCCCTGTATCAGTTGGAAAACTACTGCAACTAA

[0062] Nucleic acid molecules shown as SEQ ID NO: 14 and SEQ ID NO: 15, in which -factor (SEQ ID NO: 12) and -factor-S (SEQ ID NO: 1) were separately fused to the site in the upstream of control 1, were synthesized. EcoR I and Not I restriction sites were also incorporated at both 5 and 3 ends of the synthesized nucleic acid molecules. The synthesized nucleic acid molecules were ligated to the T vector.

TABLE-US-00011 SEQIDNO:14 ATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCCG CATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAAT TCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGAT GTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTA TAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCT CGAGAAAAGAGAAGAAGGTGAACCAAAGTTCGTTAACCAACACTTGTGC GGTTCCCACTTGGTTGAAGCTTTGTACTTGGTTTGCGGTGAAAGAGGTT TCTTCTACACTCCTAAGGCTGCTAAGGGTATTGTCGAACAATGCTGTAC CTCCATCTGCTCCTTGTACCAATTGGAAAACTACTGCAACTAA SEQIDNO:15 ATGAGATTTCCTTCTATTTTCACTGCTGTTTTGTTTGCCGCTTCCTCTG CTTTGGCAGCTCCAGTTAATACAACCACTGAAGATGAGACTGCTCAAAT CCCAGCCGAAGCAGTTATTGGTTACTCCGACTTGGAAGGAGATTTTGAC GTCGCTGTTTTACCATTCTCTAATTCCACTAATAACGGTCTGTTGTTTA TTAATACTACCATTGCTTCTATCGCCGCTAAGGAGGAAGGTGTGTCCCT CGAGAAAAGAGAAGAAGGTGAACCAAAGTTCGTTAACCAACACTTGTGC GGTTCCCACTTGGTTGAAGCTTTGTACTTGGTTTGCGGTGAAAGAGGTT TCTTCTACACTCCTAAGGCTGCTAAGGGTATTGTCGAACAATGCTGTAC CTCCATCTGCTCCTTGTACCAATTGGAAAACTACTGCAACTAA.

[0063] The above T vector and the expression vector pPIC3.5K were digested with both endonucleases EcoR I and Not I, and then the target fragment and the vector fragment were separately recovered by Gel Recovery Kit. After purification of the digested fragments, and the target fragment was ligated to the vector pPIC3.5K with T4 ligase.

[0064] The above-mentioned ligation solution was transformed into E. coli TOP10 competent cells, and plated onto a plate with ampicillin resistance. After cultivation, the bacterial colony was picked, and the plasmid was extracted and verified by digestion with both restriction enzymes. Four recombinant expression vectors which separately incorporate -factor or -factor-S signal peptide for expressing insulin precursor gene with different nucleotide sequences, were finally obtained.

EXAMPLE 4

Expression of Insulin Precursor by Pichia Pastoris Recombinant Strain, Before and After Optimization

[0065] The recombinant expression vectors constructed in Example 3 were separately transformed into Pichia Pastoris GS115.

[0066] The recombinant bacterium colonies were inoculated into 5 mL YPD medium, and cultivated at a constant temperature of 30 C. while shaking at 250 rpm, until the value of OD.sub.600 reached about 10 (16-18 hours). The cells were collected and re-suspended in 50 mL BMGY medium, and cultivated overnight at a constant temperature of 30 C. while shaking at 250 rpm, until the value of OD.sub.600 reached about 30. The cells were collected by centrifuging at 1500 rpm for 5 minutes and re-suspended in 25 mL of BMMY medium. 1/200 volume of methanol (final concentration of 0.5%) was added into the medium, and cultivated at a constant temperature of 30 C. while shaking at 250 rpm for 96 hours, while 1/200 volume of methanol was supplemented every 24 hours. Upon the expression was finished, the supernatant was obtained after centrifugation at 10,000 rpm. The yield of the insulin precursor comprised in the supernatant was measured by HPLC.

[0067] The recombinant bacterium expressing control 1 gene fused to -factor was used as a control bacterium. The yield of insulin precursor by other strains was converted into a percentage relative to the yield of the insulin precursor expressed by the control strain, as shown as Table 2.

TABLE-US-00012 TABLE2 Bacterial Signal Expression Percentage strain vector peptide Gene ofyield(%) Control pPIC3.5K -factor Control1 100 bacterium testbacterium PPIC3.5K -factor-S Control1 150 testbacterium PPIC3.5K -factor IP-S 225 testbacterium PPIC3.5K -factor-S IP-S 275

[0068] The data in Table 2 shows that the yield of the insulin precursor was increased by 1.5 times after merely optimizing the signal peptide in the nucleic acid molecule, and such yield was increased by 2.25 times after merely optimizing the insulin precursor gene. By contrast, the yield of the insulin precursor was increased by 2.75 times after optimizing both the signal peptide and the insulin precursor gene. Taken together, codon optimization can increase the expression level of insulin precursor to 1.5-2.75 times.