Material for capturing circulating cells in the blood, method of preparation and use

Abstract

A material chosen from alumina ceramic grafted with at least one aptamer, at least one antibody or their combination for capturing circulating foreign cells, preferably circulating tumor cells, the method of preparing such material, its use and the device comprising it are disclosed.

Claims

1. An alumina ceramic material grafted with at least one aptamer, at least one antibody or combinations thereof.

2. The material according to claim 1 in which at least one aptamer, at least one antibody or a combination thereof is grafted to said alumina ceramic material by a binding molecule.

3. The material according to claim 2 wherein the binding molecule is a trialkoxysilane of formula .sup.NN.sup.+N-L-Si(OR1)(OR2)(OR3) in which L is a linear, branched or cyclic divalent hydrocarbon radical comprising 1 to 20 carbon atoms, preferably 1 to 10 carbon atoms, and R1, R2, R3 are the same or different and represent a linear or branched alkyl group comprising 1 to 6 carbon atoms, preferably 1 to 3 carbon atoms.

4. The material according to claim 1 in which at least one aptamer is single stranded DNA.

5. The material according to claim 1 wherein the at least one aptamer or at least one antibody is an aptamer substituted by or an antibody substituted by at least one linear or branched cyclic hydrocarbon group comprising a terminal alkyne function having the formula CCH and from 3 to 20 carbon atoms, preferably from 10 to 15 carbon atoms, said hydrocarbon group being optionally substituted by one or more heteroatoms.

6. The material according to claim 1 having at least one surface in contact with the blood of a patient, said surface not being porous.

7. The material according to claim 1, in which the at least one aptamer or the at least one antibody is capable of binding to at least one of the proteins chosen from mucin-1 (MUC-1), EpCam, HER-2, EGFR, vimentin, E-cadherin, N-cadherin, OB-cadherin, CD44v6, CD44v8, PSA, cytokeratin 8, cytokeratin 19, ABC-G2 and their combinations, preferably the protein mucin-1 (MUC-1).

8. The material according to claim 1 wherein the at least one aptamer, at least one antibody or their combination is linked to at least one labeling molecule.

9. An aptamer, antibody or a combination thereof grafted onto the alumina ceramic material according to claim 1 for the capture of circulating foreign cells, preferably of circulating tumor cells.

10. The aptamer, antibody or a combination thereof for its use according to claim 9 wherein the circulating tumor cells are from breast cancer, lung cancer, prostate cancer, colorectal cancer, bladder cancer, stomach cancer, melanoma.

11. A method for preparing the material according to claim 1, comprising grafting the alumina ceramic with at least one aptamer, at least one antibody or a combination thereof.

12. The method of claim 11, wherein at least one aptamer, at least one antibody or a combination thereof is grafted to said alumina ceramic material by a binding molecule, said method comprising at least the following steps: binding of the binding molecule to the alumina ceramic material by reaction of one or more alkoxy functions of the binding molecule with one or more hydroxyl groups of the alumina ceramic material; and binding of the aptamer or antibody to the binding molecule by click chemistry reaction.

13. The method of claim 11 wherein the at least one aptamer or the at least one antibody is an aptamer substituted by or an antibody substituted by at least one linear or branched cyclic hydrocarbon group comprising a terminal alkyne function having the formula CCH and from 3 to 20 carbon atoms, preferably from 10 to 15 carbon atoms, said hydrocarbon group being optionally substituted by one or more heteroatoms.

14. The method according to claim 10 wherein the aptamer or the antibody is substituted and the binding of the substituted aptamer or of the substituted antibody to the binding molecule is carried out by reaction of the terminal alkyne function of the aptamer substituted or the antibody substituted with the terminal azide function of formula NN.sup.+N.sup. of the binding molecule.

15. A device for capturing circulating foreign cells, preferably circulating tumor cells, comprising the material according to claim 1 and at least one housing.

16. The material according to claim 2 in which at least one aptamer is single stranded DNA.

17. The material according to claim 3 in which at least one aptamer is single stranded DNA.

18. The material according to claim 2 wherein the at least one aptamer or at least one antibody is an aptamer substituted by or an antibody substituted by at least one linear or branched cyclic hydrocarbon group comprising a terminal alkyne function having the formula CCH and from 3 to 20 carbon atoms, preferably from 10 to 15 carbon atoms, said hydrocarbon group being optionally substituted by one or more heteroatoms.

19. The material according to claim 3 wherein the at least one aptamer or at least one antibody is an aptamer substituted by or an antibody substituted by at least one linear or branched cyclic hydrocarbon group comprising a terminal alkyne function having the formula CCH and from 3 to 20 carbon atoms, preferably from 10 to 15 carbon atoms, said hydrocarbon group being optionally substituted by one or more heteroatoms.

20. The material according to claim 4 wherein the at least one aptamer or at least one antibody is an aptamer substituted by or an antibody substituted by at least one linear or branched cyclic hydrocarbon group comprising a terminal alkyne function having the formula CCH and from 3 to 20 carbon atoms, preferably from 10 to 15 carbon atoms, said hydrocarbon group being optionally substituted by one or more heteroatoms.

Description

FIGURES

[0182] FIG. 1 is a diagram of the formula of the anti-MUC-1 aptamer substituted with a hydrocarbon group comprising a terminal alkyne.

[0183] FIG. 2 is an infrared spectrum of AzPTES as produced prior to its binding to the aptamer and ceramic.

[0184] FIG. 3 is a diagram summarizing the reaction on dense alumina according to Example 1.

[0185] FIG. 4 shows photographs taken by confocal microscopy of a material according to the invention not grafted (A), of a material according to the invention grafted by an aptamer labeled with FITC according to the invention (B), and a three-dimensional map of the material according to the invention grafted with an aptamer labeled with FITC according to the invention (C).

[0186] FIG. 5 shows confocal microscopic photographs of MDA MB231 cells in the presence or absence of an FITC-labeled aptamer.

EXAMPLES

[0187] The following examples are given by way of illustration of the present invention, and are in no way intended to limit its scope.

[0188] Described below are examples of preparation by grafting an aptamer onto an alumina ceramic in order to prepare an alumina ceramic grafted with at least one aptamer according to the invention.

[0189] The ceramic used is a dense Al.sub.2O.sub.3 alumina ceramic of DIN C799 type, produced by the company SCERAM. According to the supplier's specifications, C799 alumina comprises 99.7% Al.sub.2O.sub.3 alumina and has a density of 3.8 and an absolute density of 3.9 g/cm.sup.3. The open porosity of this ceramic is 0%.

[0190] The aptamer used is a 72 base single stranded DNA oligonucleotide designed by the SELEX method to bind to the MUC-1 protein and has the sequence:

TABLE-US-00003 (SEQIDNO:1) 5GGGAGACAAGAATAAACGCTCAAGCAGTTGATCCTT TGGATACCCTGGTTCGACAGGAGGCTCACAACAGGC3

[0191] In order to be able to react with other molecules, the aptamer was modified at its 5 end by the addition of a hydrocarbon group including a terminal alkyne group. The reaction of the azide of the binding molecule with the terminal alkyne group of the substituted aptamer forms a triazole ring. The diagram of the formula of the substituted aptamer is represented in FIG. 1. The aptamer thus substituted is used for the implementation of Examples 1 and 2. The substituted anti-MUC-1 aptamer is produced to order and obtained. commercially.

Example 1 Method of Grafting an Anti-MUC-1 Aptamer onto a Dense Alumina Ceramic

[0192] Example 1 illustrates the preparation method according to the invention in which the binding molecule is first bound to the alumina ceramic before a substituted anti-MUC-1 aptamer is bound to the binding molecule. All of the synthetic reactions are summarized in FIG. 3.

Step 1Synthesis of the 3-azidopropyl) triethoxysilane Binding Molecule (AzPTES)

[0193] 1.93 g of chlorosilane (8 mmol), 0.2 g of KI (1.2 mmol) and 1.56 g of NaN.sub.3 (24 mmol) are mixed in a 50 ml Schlenk tube. The system is placed under vacuum and then under an argon atmosphere and 10 ml of DMF (N,N-dimethylformamide) are introduced under argon. The reaction is started for 24 h at 80 C. and 330 rpm. The solution is then yellow. After 24 hours, the solution has turned white and has two phases. Once the medium has returned to ambient temperature, the solution is filtered through a Celite 545 filter (approximately 1 cm) soaked in 15 ml of DMF on a No. 3 frit, then rinsed with 5 ml of DMF. The DMF is evaporated using a rotary evaporator (70 C., 90 rpm).

[0194] Dichloromethane (30 ml) is added to the solution. This is washed twice with 30 ml of water, then the organic phase is dried over MgSO.sub.4, then filtered and placed in a rotary evaporator (40 C., 90 rpm) in order to remove the dichloromethane and any traces of DMF. White residues are observed. The solution is centrifuged for 5 min at 1500 rpm. The oily-looking yellow supernatant containing AzPTES is recovered and then weighed: 1.1 g (4 mmol) of product are recovered. The molar yield of this step is approximately 56%. The AzPTES has the following formula:

##STR00001##

[0195] The infrared and NMR characterization results of AzPTES are as follows:

[0196] FR-IR (ATR, resolution 4 cm.sup.1, 8 analyzes/sample): Band observed at 2100 cm.sup.1 characteristic of the N3 group. Other bands observed: 1075 cm.sup.1 characteristic of the SiOC group, 775 cm.sup.1 characteristic of the SiC group. The infrared spectrum of AzPTES is shown in FIG. 3.

[0197] 1H NMR (500 MHz, CDCl3, 25 C., , ppm): 0.69 (m, 2H, CH2-Si), 1.23 (t, 9H, CH3, J=7.0 Hz), 1.71 (m, 2H, CH2), 3.26 (t, 2H, CH2-N3, J=6.9 Hz), 3.83 (q, 6H, CH2-O, J=7.0 Hz)

[0198] 13C NMR (500 MHz, CDCl3, 25 C., , ppm): 7.7 (CH2-Si), 18.3 (CH3), 22.7 (CH2), 53.9 (CH2-N3), 58.5 (CH2-O)

Step 2Binding of AzPTES to the Alumina Ceramic

[0199] An alumina ceramic pellet 14 mm in diameter and 4 mm thick is used.

[0200] The Al.sub.2O.sub.3 alumina ceramic pellet is placed in the oven at 120 C. overnight. A 50 ml two-necked flask is placed in the oven at 120 C. for 5 minutes in order to remove any trace of moisture in the flask. The ceramic is then introduced into the flask. This is placed under vacuum and then under argon. 7 ml of anhydrous toluene is introduced under argon. The mixture is brought to 60 C., 330 rpm. Once the temperature of 60 C. is reached, 2 nmol of AzPTES is introduced in argon, drop by drop, then a refrigerant is installed on the flask and placed under argon. The reaction is carried out for 3 h at 90 C., 330 rpm.

[0201] After 3 h, the ceramic is washed with 10 ml of toluene for 2 min in an ultrasonic bath (water, power: 100%, 80 Hz) three times, then once with 10 ml of 95% ethanol.

[0202] X-ray photoelectron spectrometry (XPS) analysis detects the presence of silicon and nitrogen, evidence that the binding of DNA-bound AzPTES to alumina ceramic has functioned. In fact, silicon and nitrogen are not part of the chemical elements present in ceramic. The presence of silicon on the surface of the material indicates that the binding of AzPTES to the material has worked and the presence of nitrogen indicates the presence of the single stranded DNA forming the aptamer.

Step 3Binding of the Anti-MUC-1 Aptamer to AzPTES Bound to the Alumina Ceramic

[0203] 4.8 mg of catalyst (CuBr(PPh.sub.3).sub.3, 1.5 l of trimethylamine and 7 ml of acetonitrile are mixed with the ceramic bound to AzPTES. The whole is brought to 60 C., 330 rpm. Once the temperature of 60 C. has been reached, the DNA is introduced dropwise. A condenser is placed on the flask and the reaction is carried out for 6 h at 90 C., 330 rpm for binding of the aptamer to AzPTES. The reaction medium is then transparent.

[0204] At the end of the reaction, the catalyst (CuBr(PPh.sub.3).sub.3) is removed by filtration of the solution using a filter (porosity 0.45 m) on a syringe. The ceramic is washed three times with acetonitrile and then once with ethanol in an ultrasonic bath as described in step 1.

[0205] The alumina ceramic is then cleaned with 3 ml of sterile 95% ethanol. The pellet is then stored at 4 C. to avoid or reduce the degradation of the aptamer grafted onto the ceramic. The material thus grafted may be stored for 1 month at 4 C.

[0206] The reaction medium and the washing media (acetonitrile and ethanol) are added and then placed in a rotary evaporator at 40 C., 90 rpm. After the solvents have evaporated, 200 l of ultrapure water are added to the DNA desorbed by the washings.

[0207] The ungrafted DNA is then quantified in visible UV at 260 nm and 280 nm according to any method well known to those skilled in the art.

[0208] An infrared analysis (ATR, resolution 4 cm.sup.1, 8 analyzes/sample) makes it possible to observe a band at 3325.35 cm.sup.1, characteristic of the NH functions of DNA, as well as a broad band. at 2114.90 cm.sup.1 characteristic of the alkyne group, and a band at 1639.12 cm.sup.1 characteristic of DNA ketones.

[0209] The bond yield of the aptamer on the ceramic material according to the method of Example 2 is about 44%.

Example 2

[0210] Example 1 was reiterated using an aptamer marked at its 3 end by the FITC. The material thus prepared was observed under a confocal microscope. An unlabeled alumina ceramic material was also observed as a control: as may be seen in FIG. 4A, no fluorescence is visible on the surface of the material.

[0211] It was observed that the material prepared according to the process according to the invention was grafted homogeneously with the aptamer (FIG. 4B). A three-dimensional map was produced by scanning the grafted material of FIG. 4B with a laser over a thickness of 8 m with a pitch of 0.8 m, which corresponds to taking a confocal image every 0.8 m. The digital compilation of these images provides the three-dimensional map shown in FIG. 4C. As this map shows, the material according to the invention is grafted with the aptamer labeled with FITC in a dense and homogeneous manner (FIG. 4C).

Example 3

[0212] In vitro binding assays were performed on MDA MB231 breast cancer cells. MDA MB231 cells are epithelial cells derived from adenocarcinoma of the breast. MDA MB231 cells are cultured according to the supplier's instructions. The cells are then trypsinized, washed and centrifuged for 10 min at 1500 rpm. For the test, 20,000 cells are taken up in 500 l of cell culture medium without fetal calf serum (FCS). Three conditions are tested: [0213] Negative control: culture medium (20 l), [0214] FITC alone diluted in the culture medium (20 l), or [0215] FITC-labeled aptamer in culture medium (20 l).
The aptamer used is an aptamer specific for the MUC1 receptor and comprises 72 bases as follows:

TABLE-US-00004 (SEQIDNO:1) 5-GGGAGACAAGAATAAACGCTCAAGCAGTTGATCCTT TGGATACCCTGGTTCGACAGGAGGCTCACAACAGGC-3

[0216] The aptamer is labeled with fluorescein isothiocyanate FITC at its 3 end according to any technique well known to those skilled in the art.

[0217] The cells are then incubated for 1 hour at 37 C. and 5% CO.sub.2 before being transferred to a 24-well plate and incubated 12 h-16 h at 37 C. and 5% CO.sub.2. The cells are then washed and fixed with 500 l of PBS PAF at 4% before being observed by confocal microscopy, with or without fluorescence, with a magnification 10.

[0218] FIG. 5A shows photographs of cells grown in wells under the negative control condition, i.e. cells grown in culture medium without fluorescence marker. The photograph on the left corresponds to the observation without fluorescence while the photograph on the right shows the cells observed with fluorescence. No fluorescence is observed on the cells. The cells, therefore, do not emit spontaneous fluorescence.

[0219] FIG. 5B shows photographs of cells grown in wells under the FITC only control condition, i.e. cells grown in culture medium containing FITC but no aptamer. The photograph on the left corresponds to the observation without fluorescence while the photograph on the right shows the cells observed with fluorescence. No fluorescence is observed on the cells. Fluorochrome FITC therefore does not spontaneously bind to cells.

[0220] FIG. 5C shows photographs of cells grown in wells with the FITC-labeled aptamer. The photograph on the left corresponds to the observation without fluorescence while the photograph on the right shows the cells observed with fluorescence. As may be seen, the cells on which the FITC-labeled aptamer binds emit fluorescence.

CONCLUSION

[0221] The present invention therefore provides an alumina ceramic material grafted with an aptamer, an antibody or a combination thereof, the grafting being carried out covalently, preferably by means of a binding molecule, as well as a method of preparation of such a material. The material according to the invention therefore makes it possible to provide a biocompatible and hemocompatible material for the capture of foreign cells, preferably circulating tumor cells present in the blood of a patient. The material according to the invention is inert with respect to the patient's blood so that it does not capture any element circulating in the patient's blood other than the targeted foreign cells and that it does not cause any depletion, denaturation or coagulation. or reaction that could harm the patient. The material according to the invention also makes it possible to treat the total blood volume of a patient, or even to allow several passages of the total blood volume in contact with the material to capture and remove the maximum possible number of circulating cells from the patient's blood. The material according to the invention may therefore be used for therapeutic purposes to reduce the risk of metastasis or the risk of cancer recurring. The material according to the invention may also be used to improve the effectiveness of a chemotherapeutic treatment.

[0222] The material according to the invention may also be used as part of a device for capturing circulating foreign cells, preferably an extracorporeal device for capturing circulating tumor cells. In fact, unlike the devices of the prior art in which the aptamers and/or antibodies are adsorbed to the surface of the material, the material according to the invention is covalently grafted by at least one aptamer and/or at least an antibody.

[0223] This grafting prevents an aptamer and/or an antibody from being detached, carried along by the flow, and from passing into the patient's bloodstream.