PLASMID CURING

Abstract

A conjugative recombinant vector is provided for displacing a target plasmid from a host cell. The vector is capable of replicating in the host cell, and is adapted to compete with and/or inhibit replication of the target plasmid. Also provided are systems, cells, compositions and kits comprising the vector. The invention finds use in the displacement of target plasmids such as those carrying antibiotic resistance genes, and in methods of treating bacterial infections.

Claims

1. A conjugative recombinant vector for displacing a target plasmid from a host cell, the vector being capable of replicating in the host cell and adapted to compete with and/or inhibit replication of the target plasmid, wherein the vector is derived from an IncP parent plasmid comprising an IncP replicon which comprises an origin of replication (oriV), or a functional fragment or variant thereof, that is associated with a series of iterons, and wherein the vector comprises the IncP replicon comprising a deletion in one or more of the iterons relative to the parent plasmid.

2. The recombinant vector according to claim 1, wherein the recombinant vector comprises the IncP replicon comprising a deletion in one or both terminal iterons of the series, relative to the parent plasmid.

3. The recombinant vector according to claim 1, wherein the recombinant vector comprises the IncP replicon comprising a deletion in an iteron other than iterons 5-9 (i5-i9), relative to the parent plasmid.

4. The recombinant vector according to claim 1, wherein the recombinant vector comprises an IncP replicon comprising a deletion in iteron 1 and/or iteron 10 (i10), relative to the parent plasmid.

5. The recombinant vector according to claim 1, wherein the vector further comprises a first nucleic acid sequence which encodes TrfA, or a homologue, functional fragment or variant thereof.

6. The recombinant vector according to claim 1, wherein the vector further comprises a second nucleic acid sequence which encodes KorB or a homologue, functional fragment or variant thereof.

7. The recombinant vector according to claim 1, wherein the recombinant vector has a copy number which is greater than that of the parent plasmid.

8. The recombinant vector according to claim 1, wherein the recombinant vector comprises the transfer genes oriT, tra and trb.

9. The recombinant vector according to claim 1, wherein the recombinant vector comprises a nucleic acid sequence comprising all or selected parts of an origin of replication or one or more replicons of the target plasmid, such that the recombinant vector is adapted to inhibit replication of the target plasmid.

10. The recombinant vector according to claim 1, wherein the recombinant vector comprises a nucleic acid sequence encoding an inhibitor molecule which inhibits or prevents replication of the target plasmid.

11. The recombinant vector according to claim 1, wherein the recombinant vector is adapted to neutralize the toxic effects of a post-segregational killing (PSK) system of the target plasmid.

12. The recombinant vector according to claim 1, wherein the recombinant vector comprises one or more genes encoding a selectable marker.

13. A system for displacing a target plasmid from a host cell, the system comprising: a) a conjugative recombinant vector which is capable of replicating in the host cell, wherein the vector is derived from an IncP parent plasmid comprising an IncP replicon, the IncP replicon of the parent plasmid comprising an origin of replication (oriV), or a functional fragment or variant thereof, which is associated with a series of iterons, wherein the vector comprises an IncP replicon comprising a deletion in one or more of the iterons relative to the parent plasmid, and wherein the vector is adapted to compete with and/or inhibit replication of the target plasmid; b) a first nucleic acid sequence which encodes TrfA, or a homologue, functional fragment or variant thereof; and c) a second nucleic acid sequence which encodes KorB, or a homologue, functional fragment or variant thereof.

14. (canceled)

15. (canceled)

16. A method of displacing a target plasmid from a host cell, the method comprising introducing a conjugative recombinant vector into the host cell, wherein the recombinant vector is derived from an IncP parent plasmid and comprises an IncP replicon that is modified to have an elevated copy number relative to that of the parent plasmid.

17. The method of claim 16, wherein: i) the recombinant vector is capable of replicating in the host cell and adapted to compete with and/or inhibit replication of the target plasmid, the IncP replicon comprises an origin of replication (oriV), or a functional fragment or variant thereof, that is associated with a series of iterons, and the IncP replicon comprises a deletion in one or more of the iterons relative to the parent plasmid, or ii) the method comprises introducing into the host cell a system comprising: a) the conjugative recombinant vector, wherein the recombinant vector is capable of replicating in the host cell, the IncP replicon comprises an origin of replication (oriV), or a functional fragment or variant thereof, which is associated with a series of iterons, wherein the vector vector comprises an IncP replicon comprising a deletion in one or more of the iterons relative to the parent plasmid, and wherein the vector is adapted to compete with and/or inhibit replication of the target plasmid; b) a first nucleic acid sequence which encodes TrfA, or a homologue, functional fragment or variant thereof; and c) a second nucleic acid sequence which encodes KorB, or a homologue, functional fragment or variant thereof.

18. The method of claim 16, wherein the target plasmid carries one or more antibiotic resistance genes.

19. The method of claim 16, wherein the host cell is a bacterial cell.

20. A method of treatment of a bacterial infection in a subject, the method comprising administering to the subject: i) a conjugative recombinant vector for displacing a target plasmid from a host cell, the vector being capable of replicating in the host cell and adapted to compete with and/or inhibit replication of the target plasmid, wherein the vector is derived from an IncP parent plasmid comprising an IncP replicon which comprises an origin of replication (oriV), or a functional fragment or variant thereof, that is associated with a series of iterons, and wherein the vector comprises the IncP replicon comprising a deletion in one or more of the iterons relative to the parent plasmid, ii) a system for displacing a target plasmid from a host cell, the system comprising: a) a conjugative recombinant vector which is capable of replicating in the host cell, wherein the vector is derived from an IncP parent plasmid comprising an IncP replicon, the IncP replicon of the parent plasmid comprising an origin of replication (oriV), or a functional fragment or variant thereof, which is associated with a series of iterons, wherein the vector comprises an IncP replicon comprising a deletion in one or more of the iterons relative to the parent plasmid, and wherein the vector is adapted to compete with and/or inhibit replication of the target plasmid; b) a first nucleic acid sequence which encodes TrfA, or a homologue, functional fragment or variant thereof; and c) a second nucleic acid sequence which encodes KorB, or a homologue, functional fragment or variant thereof, or iii) a cell containing the recombinant vector of i) or the system of ii).

21. (canceled)

22. The recombinant vector of claim 1, wherein the vector further comprises: a) a first nucleic acid sequence which encodes TrfA, or a homologue, functional fragment or variant thereof; and b) a second nucleic acid sequence which encodes KorB, or a homologue, functional fragment or variant thereof.

Description

DETAILED DESCRIPTION

[0139] Embodiments of the invention will now be described by way of example and with reference to the accompanying figures in which:

[0140] FIG. 1 is a map of RK2 showing the region replaced by the anti-F cassette and showing the targets of the anti-F functions. The other functions marked are: oriV, the vegetative replication origin; oriT, the transfer origin; tra and trb regions encoding proteins for DNA processing and mating bridge formation during transfer; trfA, encoding the Replication protein that activates oriV; ccr/par, the central control region that regulates transcription of RK2 backbone genes and also encodes active partitioning functions; and psk/mrs, encoding addiction and multimer resolution functions. Mobile elements Tn1 and IS21 are associated with ampicillin and kanamycin resistance genes. Recombineering was used to replace aphA and IS21 in RK2 with the anti-F cassette that blocks the repFIA, repFIB and repFIC replicons and neutralises the effect of the flmABC and letAB addiction loci;

[0141] FIG. 2 shows the conjugative IncP-1 derivatives constructed and their effectiveness as vehicles for plasmid curing. The anti-F cassette when inserted into RK2 itself caused limited target plasmid loss (Table 3) whereas when inserted into pUB307 it was found to cause very efficient target plasmid loss. Introducing the pUB307 deletion (bases 5464/5466 to 12045/12047) into RK2 by recombineering also potentiated curing while the deletions klcAB and klcABC (bases 4340-116699) did not. Reintroducing the region with iteron 10 (bases 11749 to 12048) by recombineering into pUB307 destroyed the potentiation;

[0142] FIG. 3 is a map of the plasmid pCURE-F-RK2307;

[0143] FIG. 4 is a map of the plasmid pCURE-K-307;

[0144] FIG. 5 shows Mini-RK2 plasmids with the anti-F cassette and ability to displace Fprolac. Plasmid pCT549 consists of two segments from RK2: oriV to trbB and korA to kfrC (apostrophe indicates a truncated gene). TrfA acts at oriV: monomers act positively through iterons 5-9 and dimers act negatively through all the iterons. Due to its construction oriV of pCT549 excluded iteron 10 (i10) and with anti-F cassette efficient curing was seen. A derivative with iterons 1 to 10 gave a lower relative copy number and efficient curing is lost. Deletion of i1 restores efficient curing and copy number. Deleting up to korB had no effect but deleting past it destroys curing. Reinserting korB restores efficient curing;

[0145] FIG. 6 shows graphs showing the results of an unselected invasion assay to monitor displacement of target plasmids by pCURE plasmids or negative controls in bacteria introduced at a donor:recipient ratio of 1:1000. Data presented is the mean of triplicate cultures. A steep decline in target plasmid was observed with pCURE-F-307 and pCURE-K-307 which was reproducible and highly significant. FIG. 6A. Donor bacteria (HB101 with pCURE-F plasmids or negative controls) were monitored by streptomycin resistance, while target bacteria (JM109 initially with Fprolac) were monitored by nalidixic acid resistance. Presence of Fprolac was monitored on M9 Minimal medium without proline. B. Donor bacteria (HB101 with pCURE-K plasmids or negative controls) were monitored by streptomycin resistance, while target bacteria (J53rif initially with pCT::aph) were monitored by rifampicin resistance. Presence of pCT::aph was monitored by kanamycin resistance. Spread of pCT::aph into donor bacteria was detected by selection of kanamycin and streptomycin resistance;

[0146] FIG. 7 shows the result of experiments to determine the effect of recombinant vectors on antibiotic resistance plasmids in the mouse gut. Rif.sup.R mouse-derived E. coli AL1 carrying pCT::aph was fed to mice on days 3-5 and kanamycin on days 4-6 before monitoring plasmid carriage until day 28. Mice received E. coli Nissle 1917 carrying Tet.sup.R curing plasmid, pCURE-K-307 days 10-12 and tetracycline days 11-13 resulting in the appearance of Tet.sup.R E. coli including Rif.sup.R Tet.sup.R indicating transfer to target bacteria. pCURE-K-307 had disappeared by day 20 but about 10% of the E. coli were Rif.sup.R indicating displacement of pCT::aph rather than loss of the strain. Kanamycin was given days 25-26 but no Kan.sup.R bacteria re-appeared and PCR screening of faeces samples at the end of the experiment proved negative. Carriage of pCT::aph was determined by Kan.sup.R while carriage of pCURE-K-307 was determined by Tet.sup.R;

[0147] FIG. 8 is a sequence alignment of oriV region sequences for plasmids RK2, R751 and pDS3 (accession number JX469834.1), with the iterons identified. Numbers above the line indicate the coordinate of the starting nucleotide for that segment.

EXAMPLES

[0148] The well-studied IncP-1 Birmingham plasmid RK2 (essentially identical to RP1 and RP4) was selected as a starting point (FIG. 1) since IncP plasmids, which were originally identified as responsible for the spread and maintenance of carbenicillin resistance in skin and gut bacteria in a Burns Unit in 1969, has a transfer system that can promote transfer between both Gram negative and positive bacteria. Moreover, RK2 also has a copy number in the region of 3-7 per chromosome which is higher than many of the large conjugative plasmids that would be prime targets for the strategy so it was thought that the cloned segments should be active in blocking replication of their target replicons. The course of implementing this strategy described below revealed exciting and unexpected new information about IncP-1 plasmid biology as well as helping define a strategy for building a successful conjugative curing plasmid.

Materials and Methods

Bacterial Strains, Plasmids and Growth Conditions

[0149] The bacterial strains used were Escherichia coli DH5, C600, MV10NaIR, JM109, HB101, Nissle1917, AL1 (this study, Rif.sup.R mutant of mouse E. coli strain). Plasmids used in or constructed as part of this study are listed in Table 1.

TABLE-US-00006 TABLE 1 Plasmids used and constructed during this study Plasmid Properties Reference RK2 IncP-1; Amp.sup.R Kan.sup.R Tet.sup.R Ingram, L. C., et al. (1973) Antimicrobial Agents and Chemotherapy 3, 279-288. pUB307 IncP-1; Kan.sup.R Tet.sup.R; spontaneous deletion that lost Tn1 Grinsted, J. et al. (1973) Plasmid 1, 34- 37. pR9242 IncP-1 (R995); Kan.sup.R Tet.sup.R; site-directed deletion of KlcA Tn1 F proAB RepFIA RepFIB RepFIC/FIIA Tra.sup. in JM109 Bhattacharyya, A. et al. (2001) J. Mol. Biol. 310, 51-67. pMS208A8.2 pMB1 replicon, korC.sub.RK2:Amp.sup.R Thomas, C. M. et al. (1998) Nucl. Acids. Res. 15, 5345- 5359. pCURE2 pMB1 replicon, oriTRK2, sacB, anti-IncF; Ap.sup.R Kan.sup.R Hale, L. et al. (2010) BioTechniques. 48 (3), 223-228 pEK499 IncF Tra.sup. Amp.sup.R Sm.sup.R Su.sup.R Cam.sup.R Tet.sup.R Cp.sup.R Tp.sup.R Woodford N. et al. (2009) Antimicrob Agents Chemother, 53, 4472-82. pCT::aph IncK Tra.sup.+ Kan.sup.R Cottell, J. L. et al. (2011) Emerg. Infect. Dis. 17, 645- 652. pMEL1 From pACYC184:p15A replicon; Cam.sup.R, Tet.sup.R, sacB This study pMILL1 pMEL1 with 500 bp arms from RK2 (coordinates 38,075- This study 38,573: arm 1; 39,555-40,056: arm 2) to insert antiF cassette pMILL2 pMILL1 with anti-IncF cassette inserted as a Bg/II-AatII This study fragment pLAZ1 pMILL1 without EcoRI site in cat, Cam.sup.R This study pLAZ2 pLAZ1 with anti-F cassette inserted as a Bg/II-AatII This study fragment; Cam.sup.R pLAZ2.1 pLAZ2 with pEK499 copAB inserted in EcoRI site of This study anti-F cassette; Cam.sup.R pLAZSOE1 pMEL1 with SOEd arms for pUB307 deletion. Cloned This study into HindIII and SaII sites; Cam.sup.R pLAZSOE4 pMEL1 with 2x 500 bp from RK2 to introduce the iteron This study 10 region back into pUB307 pSLK1 pMILL1 with anti-IncK cassette inserted as an Ncol to This study BamHI fragment RK2aph IncP-1, Amp.sup.R, Tet.sup.R, aph from RK2 mediated by This study pMILL1 RK2307 IncP-1, Kan.sup.R Tet.sup.R, RK2 with site directed deletion This study identical to that in pUB307 made using pLAZSOE1 RK2klcA-korC IncP-1, Km.sup.R Tc.sup.R spontaneous delet.sup.n between klcAp & This study kleAp pUB307aph IncP-1, Tet.sup.R, aph from pUB307 mediated by pMILL1 This study pUB307::iteron10 pUB307 with iteron 10 after recombineering with This study pLAZSOE4 pCURE-F-RK2 IncP-1, Amp.sup.R, Tet.sup.R, antiF cassette inserted via pMILL2 This study into RK2 pCURE-F-307 IncP-1a, Tc.sup.R, antiF cassette inserted via pMILL2 into This study pUB307 pCURE-F-9242 IncP-1, Tet.sup.R, antiF cassette inserted via pMILL2 into This study pR9242 pCURE-F- RK2 IncP-1, Tet.sup.R, RK2klcA-korC-derivative (4340- This study klcA-korC 11669) with antiF cassette inserted by recombineering using pMILL2 pCURE-F- IncP-1, Tet.sup.R, pUB307::iteron10 with antiF cassette This study 307::i10 inserted by recombineering using pMILL2 pCURE-FEK499- IncP-1, TetR, antiF cassette with extra copA copB This study 307 segment from pEK499 inserted via pLAZ2.1 into pUB307 pCURE-K-RK2 IncP-1, Amp.sup.R, Tet.sup.R, antiK cassette inserted via pSLK1 This study into RK2 pCURE-K-307 lIncP-1, Tet.sup.R, antiK cassette inserted via pSLK1 into This study pUB307 pCT549 Mini IncP-1, Kan.sup.RTet.sup.R, Thomas, C. M. korA.sup.+incC.sup.+korB.sup.+korF.sup.+korG.sup.+kfrA.sup.+B.sup.+C.sup. et al. (1984) EMBO J 3, 57- 63. pCURE-F-549 Mini IncP-1, Tet.sup.R, antiF, This study, FIG. korA.sup.+incC.sup.+korB.sup.+korF.sup.+korG.sup.+kfrA.sup.+B.sup.+C.sup. 3 pCURE-F- Mini IncP-1, Tet.sup.R, antiF, This study, FIG. 549::i10 korA.sup.+incC.sup.+korB.sup.+korF.sup.+korG.sup.+kfrA.sup.+B.sup.+C.sup. 3 pCURE-F- Mini IncP-1, Tet.sup.R, antiF, This study, FIG. 549::i10i1 korA.sup.+incC.sup.+korB.sup.+korF.sup.+korG.sup.+kfrA.sup.+B.sup.+C.sup. 3 pCURE-F-549 Mini IncP-1, Tet.sup.R, antiF, korA.sup.+incC.sup.+korB.sup.+ This study, FIG. trbB-korF 3 pCT549trbB- Mini IncP-1, Tet.sup.R, antiF, korA.sup.+incC.sup.+ This study, FIG. korB 3 pCURE-F-549 Mini IncP-1, Tet.sup.R, antiF, korA.sup.+inc.sup.korB.sup.+ This study, FIG. trbB-incC::korB 3 pRK2501 Mini IncP-1, Tet.sup.R, Kan.sup.R; korA.sup.+incC.sup.+korB.sup. Kahn, M. et al. (1979) Meth. Enzymol. 68, 268-280. pRK2501::antiF Mini lncP-1, Tet.sup.R, Km.sup.R; korA.sup.+incC.sup.+korB.sup. This study

[0150] E. coli strains were cultured aerobically, in either L-broth/L-agar or M9 Minimal Medium, at 37 C. Final concentrations of antibiotics used were: Ampicillin (Amp), 100 g/ml; kanamycin (Km or kan), 50 g/ml; chloramphenicol (Cm), 50 g/ml; nalidixic acid (nal), 25 g/ml; and tetracycline (Tet or tet), 25 g/ml. For the blue white screening L-agar was supplemented with X-gal (20 g/ml) and IPTG (0.5 mM).

DNA Analysis and Manipulation

[0151] Restriction enzymes were purchased from New England Biolabs; T4 DNA ligase and Taq DNA polymerase were from Invitrogen; Velocity proof-reading DNA polymerase was from Bioline; Q5 high fidelity Taq polymerase was from NEB. PCR amplification of DNA was achieved using the primers (AltaBioscience, University of Birmingham, UK; or Sigma Aldrich) listed in Table 2. Reactions were cycled in a SensoQuest Lab Cycler following standard procedures. PCR products were purified using the Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare). Small-scale plasmid DNA preparations were performed using the AccuPrep Plasmid MiniPrep DNA Extraction Kit (Bioneer) adapted from the alkaline lysis method of Bimboim and Doly. DNA sequencing reactions were prepared and run on an ABI 3730 DNA analyser (Functional Genomics Facility, University of Birmingham, U.K.) following the chain termination method.

TABLE-US-00007 TABLE2 Primersdesignedandusedduringthisstudy Template, Primer Basesequence(5-3wherenotindicated).sup.a comments SEQIDNo. AmplificationofRK2armstoallowintegrationinplaceoftheaphgene RK2Arm1F AGGCGTCGACCAAAGGGTTCGCAGACTG RK2 SEQIDNo.11 GGG RK2Arm1R GACGTCGCTAACAGATCTTCCTTAATTAAG SEQIDNo.12 GCATCCCTGACAGACAACGC RK2Arm2F TTAATTAAGGAAGATCTGTTAGCGACGTCC SEQIDNo.13 AGGGAGGCGTTCAGGACGAC RK2Arm2R CCGCAAGCTTCACAGCCGGGGCATCTTTG SEQIDNo.14 AG Amplificationofanti-IncFandanti-IncKfunctions Anti-IncFF GTCGACGTCCCCTGTTATCCCTACCCGG pCURE2 SEQIDNo.15 Anti-IncFR GCGAGATCTAGGGTAATCCCGGATCTTCG SEQIDNo.16 Anti-IncK AGCCATGGCCATAAGGCATTCAGGA R387 SEQIDNo.17 Anti-IncK GTGGATCCGCAGGCTCTGCTCG SEQIDNo.18 ALIncKF ATGGTGACAAAGAGAGTGCAAC pCT::aph SEQIDNo.19 ALIncKR TTACAGCCCTTCGGCGATG SEQIDNo.20 AmplificationofcopABregionfrompEK499 499copABF GTCCAATTGGTCGACCGTCACAATTCTCAA pEK499 SEQIDNo.21 GTCGC 499copABR GTCCAATTGCTCGAGGTCACACCATCCTG pEK499 SEQIDNo.22 CACTTAC CreationofdeletionfrompUB307inRK2 307Arm1F CGCGTCGACTAGCCGTAGCACGACTCGAT RK2 SEQIDNo.23 G 307Arm1R CAATTACGTCTCCCATTACGACCATGCGC RK2 SEQIDNo.24 307Arm2F CGTAATGGGAGACGTAATTGAGCATTTCC RK2 SEQIDNo.25 AGGC 307Arm2R CGGAAGCTTGGCGGACGTTGACACTTGA RK2 SEQIDNo.26 Reinsertionofregionwithiteron10intopUB307 +i10Arm1F CGCGTCGACCCGCTAGATCGCAAAGGAT RK2 SEQIDNo.27 +i10Arm1R GAATCGGGTATCCCATTACGACCATGCGC RK2 SEQIDNo.28 +i10Arm2F CGTAATGGGATACCCGATTCTGCGGTTAC RK2 SEQIDNo.29 A +i10Arm2R TATGCCGCCGGACGTAATTGAGCATTTCC RK2 SEQIDNo.30 AGG Mutate ATGCTCATCCGGAGTTCCGTATGGCAATG pACYC184 SEQIDNo.31 EcoRIin AAAGACG pACYC184 CGTCTTTCATTGCCATACGGAACTCCGGAT pACYC184 SEQIDNo.32 GAGCAT Manipulationofmini-RK2plasmidpCT549 oriV+i10F ATCGAATTCCGGCCGTACCCGATTC SEQIDNo.33 oriV+i1R GAGATAGATCTAGCGTGGACTCAAG SEQIDNo.34 oriV-i10F CATGAATTCGTTTAGAGCGAGCCAGGAAA SEQIDNo.35 G oriV-i1R TGAAGATCTACCGCAGGGAAATTCTCGTC SEQIDNo.36 BglII-PacI- 5 SEQIDNo.s37 HindIIIlinker AGCTTACGTTAATTAAATGTACGACGTCCT and38 AA3(SEQIDNO37) 3ATGCAATTAATTTACATGCTGCAGGATTC TAG5(SEQIDNO38) MfeIPacloriV ATCCAATTGGATTTAATTAACCGGCCGTAC Withi10 SEQIDNo.39 CCGATTC oriVEcoRIXbaI ATTCTAGATACGAATTCTACCTCAAGGCTC Withi10 SEQIDNo.40 TCGCGAATG MfeIPacloriV ATCCAATTGGATTTAATTAAGTTTAGAGCG Withouti10 SEQIDNo.41 AGCCAGGAAAG oriVEcoRIXbaI ATTCTAGATACGAATTCTACCTCAAGGCTC Withouti10 SEQIDNo.42 TCGCGAATG korF-trbBa.sup.b ATGTCTAGAACTGTCAAAGCGCACCCG SEQIDNo.43 korF-trbBc.sup.b ATGTCTAGACGCTGTCTTTGGGGATCAGC SEQIDNo.44 korB-trbBc.sup.b ATGTCTAGACCGCAGTCATTGGGAAATCT SEQIDNo.45 C incC-trbBc.sup.b ATGTCTAGACCGTGACCAAAGTTTTCATCG SEQIDNo.46 korBF AGTGCATGCGAAGATGGAGATTTCCCAAT SEQIDNo.47 G .sup.aRestriction sites are shown underlined. .sup.bcindicates clockwise on the standard map of RK2 i.e. running with the coordinates in the RK2 Genbank file. aindicates anticlockwise.

Comparison of Plasmid Copy Number

[0152] A minimum of triplicate selective overnight (16 h) cultures of E. coli carrying the query plasmids plus 2 kb pACYC194 derivative pDS3 as internal standard in question grown in LB with shaking at 200 rpm and 37 C. were harvested and then plasmid DNA extracted as described above. Plasmid DNA was digested with an enzyme that would cut just once, to linearise the DNA and make ethidium bromide binding uniform. Band intensities were determined with QuantityOne software from Biorad and normalised against the pDS3 band. Colonies from serial dilution of the cultures were replica plated to determine % plasmid carriage.

Conjugative Transfer

[0153] Following overnight growth, 100 l of donor was mixed with 1 ml of E. coli MV10 NaIR recipient and filtered onto a 0.45 m sterile Millipore filter. Filters were placed on L agar plates which were incubated at 37 C. for 6 hours. Cells from the filter were resuspended in 1 ml of 0.85% sterile saline solution each and serially diluted before spreading on selective agar and incubation at 37 C.

Recombinational Engineering (Recombineering) of Conjugative IncP-1 Plasmid Genomes

[0154] For insertions, deletions or replacements primers as listed in Table 2 were used to amplify approximately 500 bp arms on either side of the point or region to be changed. The arms were joined by designing the internal primers to have complementarity, sometimes incorporating new restriction sites, to allow joining together by SOEing (Splicing by Overlap Extension) PCR. To do this the initial PCR products were purified, mixed and then extended for three cycles before adding the external primers for the remaining cycles. The product was routinely cloned between HindIII and SalI sites of a pACYC184 derivative pMEL1 that has the sacB gene (allowing counter-selection with sucrose) inserted between the XbaI and HindIII sites. To incorporate the antiF cassette this was then inserted into pMILL1 between the homology arms (using BglII and AatII sites designed in the inner primers) to give pMILL2.

[0155] The recombineering plasmid was introduced into E. coli C600 that already carries the target plasmid, selecting with Cam and an antibiotic appropriate for the target plasmid (routinely Tet). Conjugative transfer to MV10naIR was then carried out once again selecting both markers and Nalthe pMEL1-derived plasmid should not transfer unless it has undergone recombination with the conjugative plasmid. Individual colonies were restreaked to purify and single colonies from these plates used to inoculate liquid cultures were grown overnight without Cm. Selection of resolution products was then achieved either by spreading on L-agar with sucrose (5% w/v) or by isolating plasmid DNA and cutting with XbaI that cuts in pMEL1 but not in the IncP-1 backbone to linearise the unwanted plasmids which will not transform bacteria.

[0156] pCURE-F-307 was constructed in the same way as pCURE-F-RK2 but starting from pUB307 which is like RK2 but has the deletion referred to above that runs from position 5464/5466 to 12045/12047 (there are three bases at the junction that could come from either side of the deletion) relative to the IncP-1 genome sequence.

[0157] pCURE-F-RK2307 was constructed by first re-creating the pUB307 deletion starting from RK2 and then inserting the antiF cassette into this derivative as for pCURE-F-RK2 and pCURE-F-307. The 307 deletion was created in RK2 using pLAZSOE1 (Table 1 above) which contained the spliced homology arms defining the deletion (see Table 2 under the heading Creation of deletion from pUB307 in RK2).

[0158] pCURE-K-RK2307 and/or pCURE-K-307 were constructed in the same way starting from RK2307 and pUB307 using recombineering plasmid pSLK1 (Table 1) which is pMILL1 (containing the homology arms to insert cassettes in place of the IncP aph gene) with the anti-K cassette inserted instead of the anti-F cassette.

[0159] pCURE-FEK499-307 was constructed using the recombineering plasmid pLAZ2.1 which is essentially pLAZ2 with the IncFIIA copAB segment amplified from pEK499 (using the primers listed in Table 2 under the title Amplification of copAB region from pEK499) inserted at the EcoRI site in the antiF cassette. However, because there is an EcoRI site in the cat gene (conferring chloramphenicol resistance) of pLAZ2 we went back to pMILL1 and did site directed mutagenesis to destroy the EcoRI site without altering the polypeptide encoded. We then inserted the anti-F cassette as for pMILL2, giving pLAZ2 and then cut this with EcoRI to insert the copAB segment from pEK499. This plasmid with an expanded anti-F cassette was then used to insert the cassette into pUB307 as indicated above.

Testing Curing Efficiency

[0160] For transfer by conjugation, overnight liquid cultures of E. coli C600 carrying the pCURE plasmid to be tested, or an appropriate control, were washed to remove any selective antibiotics, then mixed 1:1 and 1:10 with a strain carrying the target plasmid and a standard filter mating carried out at 37 C. for 1 h. The bacteria from the membrane were then resuspended in 1 ml saline and serially diluted before plating on selective agar to determine the total number of transconjugants and transconjugants still carrying the target plasmid. Displacement of Fprolac was determined both by spreading on M9 medium supplemented appropriately with and without proline to determine % loss of Pro.sup.+ phenotype and by growth on L-agar with IPTG and X-gal when the target strain additionally carried pUC18 to determine the Lac.sup.+ phenotype. A similar method was used when introducing the curing plasmid by transformation except that the target bacteria were made competent by standard CaCl.sub.2) treatment and transformation was done with purified pCURE DNA.

[0161] For the unselected invasion assay donor bacteria were mixed with target strain to give approximately 10.sup.6 donors and 10.sup.9 recipient bacteria before spreading 100 l on a nitrocellulose filter (25 mm diameter, 0.45 m pore size, EMD-Millipore, Darmstad, Germany) on an L-agar plate. After 24 h incubation at 37 C. the bacteria were resuspended in 2 ml saline, mixed thoroughly and both serially diluted to profile transfer and curing and 100 l spread on a fresh nylon membrane.

Manipulation of Mini-RK2 Plasmids

[0162] To make the pCT549 derivatives was not easy because simple insertion of EcoRI-BglII oriV fragments or BglII-PacI fragments into this plasmid proved difficult. To insert EcoRI-BglII oriV fragments without the antiF cassette the oriV segment was generated by PCR, joined to pGEM-T Easy and sequenced. The pGEMT-derivative and pCT549 were then cut with BglII and ligated before transformation into E. coli C2110, which being DNA poll deficient cannot replicate pGEM-T, selecting cointegrants. Plasmid DNA from transformants was checked for the relative orientation of the joined segments and the one chosen that could be cut with EcoRI and recircularised by ligation to replace the old oriV with the new one.

[0163] To allow the antiF cassette to be inserted beside oriV, new primers were designed putting XbaI plus EcoRI sites downstream of oriV and MfeI plus PacI sites where BglII is normally. After cloning in pGEM-T Easy and checking sequence the MfeI-XbaI oriV fragment was ligated with the pACYC184 derivative pLAZ2 cut with EcoRI and XbaI. In pLAZ2 EcoRI defines the end of the antiF cassette and the XbaI site is on the same side. The MfeI/EcoRI ends can join but do not regenerate either site. The other end of the antiF cassette in pLAZ2 is defined by a BglII site so this construction generates a BglII-antiF-PacI-oriV-EcoRI-XbaI segment and this was inserted into pCT549 by the trick described above involving BglII cutting, ligation and C2110. The antiF cassette was similarly inserted into mini-RK2 plasmid, pRK2501, that already lacked korB.

[0164] To remove parts of the korA-incC-korB-korF-korG-kfrABC region and remnants of trbB near trfA, inverse PCR was carried out on pCT549+antiF cassette with primers incorporating an XbaI site since XbaI does not cut the RK2 backbone or the antiF cassette. Long range PCR was carried out with Q5 high fidelity Taq polymerase using their recommended primer design and conditions removing korF-trbB, korB-trbB and incC-trbB. The product was purified, cut with XbaI and recircularised and transformed into DH5. To remove incC but not korB the korB orf was amplified and it and the korF-trbB plasmid were ligated after cutting with XbaI (cuts upstream of trbBp) and SphI which cuts in incC.

Mouse Experiments

[0165] All animal care procedures and experiments were approved by the Animal Ethics Committee of Western Sydney Local Health District (protocol 4276.08.17) in accordance with the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes and carried out essentially as described previously. Five week old female BALB/c mice (Animal Resource Centre; Perth, WA, Australia) were housed in groups of three in open-lid M1 polypropylene cages (Able Scientific, Australia) on a 12 h light/dark cycle, with food and water available ad libitum (Biological Services Facility, Westmead Institute for Medical Research). Each different treatment involved groups of 3 mice. Mice were acclimatised (d6 to d0) before experiments, followed by run-in (d1-d3) in the experimental room to establish the baseline. Mice were fasted for 6 h before being given access to sucrose water and then normal food was continuously available. Bacterial cultures carrying a plasmid were resuspended in sucrose water (8%, w/v) to an OD600 of 0.40.05 and fed to mice on specified days and/or antibiotics (10-50 mg L-1) as appropriate. On the specified days each mouse was briefly transferred into a separate plastic box for weighing and to collect fresh faeces. Faeces (100 g per mouse) were suspended in 1 ml phosphate buffered saline (PBS), dilutions plated on CHROMagar with appropriate antibiotics and colonies counted after incubation 0/N at 37 C. Periodically 100 colonies were picked onto further plates to determine accurate proportions of resistance phenotypes. PCR to detect the IncK plasmid replicon in Rif.sup.S E. coli was done using primers AL_IncK_F and AL_IncK_R (Table 2). Mouse faeces solutions (100 mg in 1 mL saline) were diluted 1:100 times in water and 3 l used as template in 50 l reaction. E. coli carrying pCT::aph was used as positive control. At the end of the experiment PCR was carried out to determine whether any pCT::aph plasmid DNA could be detected if that was not evident by direct plating. Mice were euthanised by an overdose of CO.sub.2 immediately after completion of experiments.

[0166] The groups of mice were as follows. Group 1 (control group): received normal food and drink plus sucrose water when other groups received it but without bacteria or antibiotics. Group 2 (antibiotic control group): received normal food and drink plus sucrose water with antibiotics when groups 3 & 4 received antibiotics. Group 3 (colonisation control group): received E. coli AL1 (pCT::aph) in sucrose water for days 3-5 plus Kanamycin for days 4-6, then normal food and water for the rest of the experiment, monitoring E. coli AL1(pCT::aph) in faeces until end of experiment. Group 4 (curing experimental group A): received E. coli AL1(pCT::aph) in sucrose water for 3 days plus Kan (3 days) as group 3, then challenged with E. coli Nissle1917(pCURE-K-307) for days 10-12 and Tet for days 11-13 and monitor faeces for different sets of E. coli (endogenous coloniser, curing strains and challenger). Group 5 (curing experimental group B): received E. coli AL1 (pCT::aph) in sucrose water for 3 days plus Kan (3 days), then challenged with E. coli Nissle1917 (pCURE-K-307) for 3 days but no antibiotics and monitored faeces as above. Group 6 (curing experimental group C): received E. coli AL1 (pCT::aph) in sucrose water for 3 days plus Kan (3 days), then challenged with E. coli Nissle1917 (pCURE-K-307) every day for 8 days (d10-17) and monitored faeces as above.

Results

Example 1: Development of Recombinant Vectors

[0167] The previously constructed anti-IncF cassette from pCURE2, designed to displace IncF plasmids, including loci that inhibit replication (repFIA, incC; repFIB; repFIC, copAB; repFIC/repFIIA, copAB) and that neutralise addiction systems (flmB, sok; letA, ccdA; pemI and srnC, sok), was inserted into RK2 by recombination to replace the aph (Kang) gene (FIG. 1). This created pCURE-F-RK2 (FIG. 2; nomenclature indicates first that it is a plasmid carrying a curing cassette, second the plasmid group it targets, and third the plasmid the vector is based on) along with a control, RK2aph, deleted for the aph region but without the anti-IncF cassette. The efficiency with which pCURE-F-RK2 can displace Fprolac (chosen because loss of the F plasmid can be detected by loss of the ability to grow on minimal medium without proline and by blue/white X-gal screening when the strain also carries a plasmid such as pUC18 that complements the lacZ defect in the lac operon carried by the F) from JM109 was tested by mixing donor and recipient bacteria to allow transfer on solid agar, selecting for acquisition of pCURE-F-RK2 followed by replica plating onto appropriately supplemented M9 medium to detect loss of Fprolac (Table 3). None of the initial transconjugant colonies were completely free of Fprolac but on further culturing and screening, curing increased to between 85 and >99% while RK2 without the anti-IncF cassette as well as RK2aph did not affect Fprolac stability at all (Table 3). This indicates that the anti-IncF cassette, when joined to the IncP-1 plasmid to give pCURE-F-RK2, is able to sustain the unidirectional displacement of F-like plasmids, but is much less efficient at this than when in the high copy number pCURE2 plasmid.

[0168] To demonstrate curing of resistance plasmids carrying -lactamases we inserted the anti-F cassette into a spontaneous deletion derivative of IncP-1 plasmid RP1 (indistinguishable from RK2), pUB307, because it had lost the transposon Tn1 that includes the b/a gene conferring AP.sup.R. We had previously determined the ends of this deletion and found that it runs from position 5464/5466 to 12045/12047 (there are three bases at the junction that could come from either side of the deletion) relative to the IncP-1 genome sequence, removing backbone sequences flanking Tn1 as well as the transposon itself (FIG. 2). This new plasmid (pCURE-F-307) was unexpectedly found to be much more effective than pCURE-F-RK2 in causing displacement of Fprolac from JM109 (Table 3). To check whether the potentiation of curing activity in the pUB307-derived plasmids is due to this deletion rather than to other changes elsewhere in the plasmid, we recreated the pUB307 deletion starting from RK2, using a reverse-genetics approach as described above. The same potentiation of curing was observed (Table 3; pCURE-F-RK2307), confirming that the deletion in pUB307 is indeed responsible for this effect.

[0169] To determine whether this increased ability to cure is specific for F-like plasmids we inserted the IncK replication control region of archetypal plasmid R387 as an anti-IncK cassette into both RK2 and pUB307 at the same location and tested for curing of IncK plasmid pCT::aph. Once again, low efficiency curing was observed with the pCURE-K-RK2 and high efficiency with pCURE-K-307. To check whether the potentiation is specific to delivery by conjugative transfer (which involves a single-stranded DNA intermediate) we introduced the plasmids by transformation. This showed that the same potentiation was observed irrespective of how the plasmid entered the target bacteria. Since the deletion removes the start of the klcA-klcB-korC operon it may affect expression of korC that encodes a transcriptional repressor providing autogenous control of the operon. The deletion could cause either increased expression due to removal of the normal autogenous control or decreased expression due to the absence of an obvious alternative promoter. We therefore introduced a plasmid expressing korC, pMS208A8.2, into the JM109 recipient with Fprolac for the curing experiment and repeated the experiment, comparing the curing ability of pCURE-F-RK2 and pCURE-F-307, but this did not affect the curing observed (data not shown). Therefore it seems unlikely that the potentiation seen with pCURE-F-307 is due to decreased korC expression.

TABLE-US-00008 TABLE 3 One- and two-step curing data for key anti-F and anti-K plasmids constructed in this study. Target plasmid and % cured .sup.a Curing plasmid or Fprolac initial.sup.b Fprolac after.sup.b pEK499 (IncF) R387 (IncK) initial control (ctl) colonies re-culturing initial colonies colonies RK2 (vector ctl) <1 <1 <1 <1 RK2aph (vector ctl) <1 <1 <1 <1 pCURE-F-RK2 <1 >85 <1 .sup.ND.sup.c pUB307 (vector ctl) <1 <1 <1 <1 RK2307 (vector ctl) <1 <1 ND ND pCURE-F-307 >99 ND <1 ND pCURE-F-RK2307 >99 ND ND ND pCURE-K-RK2 ND ND ND <1 pCURE-K-307 ND ND ND >99 pCURE-FEK499-307 >99 ND >99 ND .sup.a These tests were carried out multiple times on separate occasions. Comparisons were done by replica plating 100 colonies. The phenotype was generally very clear: <1 means 0/100 colonies had lost the target plasmid; >99 means 100/100 had lost the target plasmid; >85 means we saw significant curing but there were always some colonies that retained the target plasmid and 85% cured was the lowest rate observed. Blue/white screening could also be used and gave a clear cut the difference between efficient and inefficient curing as shown in FIG. 2. .sup.bStage 1 involved screening transconjugant colonies from initial selection plates for complete loss of Pro+ phenotype. Stage 2 involved re-culturing from initial colonies into LB medium + tetracycline selective for RK2 or pCURE-F-RK2, growing O/N, plating on L-agar + tetracycline and then screening for retention of the Pro+ phenotype. .sup.cNot Done

[0170] To explore further the genetic basis for the potentiation, we used deletions that remove sub-segments of the region deleted in pUB307. Plasmid pR9242 is a deletion derivative of R995 that removes essentially all of klcA and klcB by creating an in-frame fusion of the first six codons of klcA, a 6 bp XbaI recognition site and the stop codon of klcB. When the anti-F cassette was inserted into this plasmid (R995klcAB), in the same location as in pCURE-F-RK2, no potentiation was seen (FIG. 2). In attempting to delete further DNA between klcAp and oriV we isolated a spontaneous deletion that removed klcA, klcB and korC (RK24340-11669) leaving the kleA operon being expressed from the klcAp. The anti-F cassette was inserted into this deletion derivative in the same location but once again the curing efficiency was similar to that of pCU RE-F-RK2 (FIG. 2), indicating that removal of all or part of the klcA, klcB, korC operon is not the reason for the potentiation of curing.

[0171] The last segment deleted in pUB307 to be tested is immediately adjacent to oriV and contains a single repeated sequence motif called an iteron (iteron 10, FIG. 2) that should bind the Rep protein, TrfA. The role of this single iteron has not been studied but deletion of the other single iteron (iteron 1) on the opposite side of oriV has been shown to increase copy number. To test this we used homologous recombination to reinsert the short region between oriV and klcA that contains iteron 10, giving pUB307::iteron10 and then combined this with the anti-F cassette (giving pCURE-F-307::i10). A curing test showed that the potentiation had been lost (FIG. 2). Attempts to confirm the change in copy number by qPCR did not give reliable data but determination of the kanamycin resistance levels conferred by the constitutively expressed aph gene in RK2 and pUB307 showed that the presence of the region with iteron 10 reduced resistance about 2-fold, corresponding to an approximately 2-fold change in copy number.

[0172] Direct confirmation of a copy number difference associated with the presence/absence of iteron 10 was obtained by comparison of isolated plasmid DNA intensity for mini-IncP-1 plasmid pCT54930 which, as constructed originally, does not have iteron 10 (FIG. 3). We amplified the oriV region from RK2 with iteron 10 and substituted it into the pCT549 backbone. Comparison of plasmid DNA yield, with and without iteron 10, indicated the copy number difference was about 2-fold (FIG. 3). Nevertheless, the same change in plasmid curing ability was observed in these mini-IncP-1 plasmids with anti-F cassette when the region with iteron 10 was absent (FIG. 3). We also considered the possibility that the change in potency could be due to some other property encoded in the region that contains iteron 10 so with this region intact we deleted the region with iteron 1 (bases 12927 to 12990 of RK2 according to the complete IncP-1 backbone). Deletion of iteron 1 resulted in a similar rise in copy number and similar potentiation of curing to removal of the region with iteron 10 suggesting that it is the presence or absence of these lone iterons that is responsible for the change in curing activity (FIG. 3).

[0173] As part of this analysis we also used as vector an even smaller derivative of RK2, pRK2501 that does not include the korB gene from the central control region and so is partially de-repressed for trfA (the rep gene) expression and has a higher copy number (2.5 compared to pCT549 with iteron 10). To our surprise this did not support curing of the Fprolac from JM109 despite its elevated copy number, suggesting that at least one additional factor in the RK2 backbone may be necessary for the curing activity by the anti-F cassette. We deleted the major block of backbone genes in pCT549 that are not essential for replicationfrom the trbB promoter to the start of the korF gene (removing kfrA, kfrB and the remaining part of kfrC as well as korF and korG). This leaves just oriV, the trfA region (encoding the Rep protein TrfA) plus the central control/active partitioning region32 (encoding repressor KorA, partitioning ATPase IncC [a ParA homologue] and centromere-binding protein and global repressor KorB) and observed that this did not result in loss of potentiation of curing efficiency. Since the only major difference between this derivative and pRK2501 is the absence of a functional korB in pRK2501 it appeared that korB must be necessary for the potentiation and this was confirmed by creating a deletion of all of korB from the pCT549 backbone (FIG. 3). We therefore reinserted korB into the deletion derivative that had lost most of incC and found that this derivative had regained the ability to displace the target F plasmid efficiently (FIG. 3). This indicates that the potent curing ability of pCURE307 is not only dependent on manipulation of the oriV region but also requires an intact korB gene although a complete set of par functions is not essential (FIG. 3).

Example 2: Effectiveness of Recombinant Vectors

[0174] A critical test of a conjugative pCURE is whether it can spread through a population and displace target plasmids in the absence of selection. Therefore E. coli HB101 (pCURE-F-307) was mixed with E. coli JM109 at a ratio of 1 donor:1000 recipients and 10.sup.8 bacteria of the mixture placed on a nylon filter on L-agar. After overnight growth, the bacteria on the filter were washed off with 2 ml saline before re-placing on a fresh nylon filter on L-agar as well as serially diluting to sample composition. This was repeated to give 5 cycles of growth and pCURE plasmid spread. The results showed that the pCURE plasmids spread rapidly in the absence of selection and that pCURE-F-307 was able to spread and reduce the target F plasmid in a reciprocal way, with plasmid positive bacteria falling to less than 0.1% of the target population (FIG. 6). This experiment demonstrates that the elements we have shown are required for efficient curing are effective without selection. The same test was used to demonstrate displacement of IncK plasmid pCT::aph from J53RifR bacteria (FIG. 6B). Because pCT::aph is conjugative, it can potentially spread to the donor bacteria. We observed that pCT::aph spread efficiently to the HB101 bacteria in the negative control tests where the donor bacteria carried IncP plasmids lacking the anti-F cassette but, where they carried the anti-F cassette, pCT::aph was not able to establish itself.

[0175] Since F-like plasmids are the commonest plasmid types encountered among multi-resistance plasmids in Enterobacteriaceae, it is important that our anti-F pCURE plasmids can be adapted to displace all possible targets. To demonstrate the feasibility of this, we chose pEK499 which we found not to be displaced by the anti-F cassette in pCURE2 and pCURE-F-307 (Table 3). Bioinformatic analysis revealed that this may be because the copA antisense RNA region of pEK499 shows 3 mismatches to the specificity loop in the repFIIA segment in the pCURE2 anti-F cassette so that its repFIIA replicon may not be inhibited by the anti-FIIA element of the anti-F cassette. The copAB region of pEK499 region was therefore amplified and incorporated into the anti-F cassette before it was inserted into pUB307 to give pCURE-FEK499-307. As predicted, the addition of this region allowed pEK499 displacement (Table 3). This shows that the inability of pCURE2 and pCURE-F-307 to displace pEK499 was due to the lack of activity against the FIC/FIIA replicon and shows the ease with which specificity of the anti-F cassette can be extended.

Example 3: Mouse Studies

[0176] The final test of the system was to determine whether our conjugative pCURE could spread in an animal gut model. We chose the IncK plasmid pCT::aph as the model target for displacement as it has been shown to persist in diverse E. coli strains in different animals and humans. It also has the advantage of possessing an active conjugative transfer system, in contrast to either the Fprolac or pEK499, neither of which are Tra+, thus representing the toughest sort of in vivo challenge. pCURE-K-307 was the test curing plasmid and we performed the tests in mice. After a number of exploratory tests, we chose to establish pCT::aph (the plasmid to be displaced from the mouse gut) by isolating an E. coli strain from a mouse in our first experiment, selecting a rifampicin resistant mutant, introducing pCT::aph into this strain (designated AL1) by conjugation in the lab and then feeding the plasmid-positive strain to the target mice. The strain established itself very efficiently (up to 10.sup.9 cfu/g faeces) but pCT::aph spread to other resident gut bacteria was only detected when the mouse received kanamycin (to select for the aph gene on the plasmid) the day after adding the plasmid-positive strain, and for the two following days (FIG. 5). That the Kan.sup.R Rif.sup.S bacteria carry pCT::aph was demonstrated by PCR with IncK-specific primers. In the control group of mice with no further treatment the level of Kan.sup.R E. coli stabilised and remained for the rest of the experiment (FIG. 5B). In the test group, once the level of pCT::aph was stable, we attempted to displace it by feeding the mouse with E. coli Nissle1917 strain (which is accepted as a safe probiotic for human use) carrying pCURE-K-307. The colonisation by Nissle1917(pCURE-K-307) of the mouse gut was also very good (we detected 10.sup.7 cfu/g faeces). However, efficient transfer and displacement of pCT::aph was only detected in the group of mice that received Nissle1917(pCURE-K-307) with subsequent tetracycline for 3 to 4 days (FIG. 5B). Once the Nissle1917(pCURE-K-307) was established by this period of selection, which in itself did not eliminate the target bacteria, pCURE-K-307 was observed to increase in target bacteria in vivo in the absence of selection but was then lost (FIG. 5B). That transfer occurs in the gut is clear from the fact that the proportion of the Tet.sup.R bacteria that are Rif.sup.R rises with time to 100%, suggesting that the donor strain disappears faster than the transconjugants. That the target plasmid had disappeared completely was shown by a period of kanamycin selection near the end of the experimentthis caused the E. coli counts to fall 100-fold but the remaining E. coli were still kanamycin sensitive. PCR with IncK-specific primers was also used to confirm the absence of pCT::aph from the gut of the treated mice. This demonstrates not only successful elimination of the target plasmid but also that the short selection with antibiotics allows some endogenous microbiota to survive.

DISCUSSION

[0177] This research demonstrates the feasibility of constructing an effective broad host range conjugative plasmid vector system that can spread without selective pressure and can specifically displace target plasmids of different incompatibility groups. This shows that the potential to re-sensitise resistant bacterial populations is real and this could be an important alternative strategy to combat antimicrobial resistance. We also show that displacement is effective in the mouse gut following a period of selection.

REFERENCES

[0178] 1. Hale et al., (2010) Biotechniques, 48(3), 223-228; [0179] 2. Freire-Martin et al., Curing vector for IncI1 Plasmids and its use to provide evidence for a metabolic burden of IncI1 CTX-M-1 plasmid pIFM3971 on Klebsiella pneumonia (2016) J Med Microbiol. 65, 611-618; [0180] 3. Herring et al., Gene replacement without selection: regulated suppression of amber mutations in Escherichia coli, Gene. 311, 153-163; [0181] 4. Grinsted, J., Bennett, P. M. & Richmond, M. H. A restriction enzyme map of R-plasmid RP1. Plasmid 1, 34-37, 1977; [0182] 5. Ingram, L. C., et al. (1973) Antimicrobial Agents and Chemotherapy 3, 279-288. [0183] 6. Grinsted, J. et al. (1973) Plasmid 1, 34-37; [0184] 7. Bhattacharyya, A. et al. (2001) J. Mol. Biol. 310, 51-67; [0185] 8. Thomas, C. M. et al. (1998) Nucl. Acids. Res. 15, 5345-5359; [0186] 9. Woodford N. et al. (2009) Antimicrob Agents Chemother, 53, 4472-82; [0187] 10. Cottell, J. L. et al. (2011) Emerg. Infect. Dis. 17, 645-652; [0188] 11. Thomas, C. M. et al. (1984) EMBO J 3, 57-63.; [0189] 12. Doran et al, Journal of Biological Chemistry. 273, 8447-8453; [0190] 13. Shah et al., Journal of Molecular Biology. 254, 608-622; [0191] 14. Kahn, M. et al. (1979) Meth. Enzymol. 68, 268-280.