Methods of making heavy chain only antibodies using transgenic animals
10906970 · 2021-02-02
Assignee
Inventors
- Franklin Gerardus Grosveld (Rotterdam, NL)
- Richard Willhelm Janssens (Rotterdam, NL)
- Dubravka Drabek (Rotterdam, NL)
- Roger Kingdon Craig (Sandbach, GB)
Cpc classification
C07K2317/569
CHEMISTRY; METALLURGY
A61P9/10
HUMAN NECESSITIES
C07K16/00
CHEMISTRY; METALLURGY
C07K2317/22
CHEMISTRY; METALLURGY
A61P7/02
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C07K16/1063
CHEMISTRY; METALLURGY
C07K2319/73
CHEMISTRY; METALLURGY
C07K2317/64
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
A61P15/00
HUMAN NECESSITIES
International classification
C07K16/00
CHEMISTRY; METALLURGY
C07K16/24
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a method of generation of fully functional heavy chain-only antibodies in transgenic mice in response to antigen challenge.
Claims
1. A method for the production of soluble, antigen-specific heavy chain only antibodies comprising: (a) immunising a transgenic rodent expressing a heterologous V.sub.H heavy chain locus with an antigen wherein: (i) the V.sub.H heavy chain locus comprises a variable region comprising at least one V.sub.H gene segment, from 20 to 40 D gene segments, at least one J gene segment and a heavy chain constant region comprising at least one constant region gene that does not encode a functional C.sub.H1 domain; (ii) a V.sub.H gene segment, a D gene segment and a J gene segment are capable of recombining to form a VDJ coding sequence; (iii) the recombined V.sub.H heavy chain locus, when expressed upon antigen challenge, is capable of forming a soluble, heavy chain-only antibody comprising a soluble, antigen-specific V.sub.H binding domain and a constant effector region devoid of a functional C.sub.H1 domain; (b) cloning said recombined V.sub.H heavy chain locus from an antibody-producing cell of said immunised transgenic rodent after affinity maturation via somatic mutation; and (c) producing said soluble, antigen specific heavy chain only antibody from the clone of step (b).
2. A method for the production of soluble, antigen-specific heavy chain only antibodies comprising: (a) immunising a transgenic rodent expressing a heterologous heavy chain locus with an antigen wherein: (i) the V.sub.H heavy chain locus comprises a variable region comprising at least one V.sub.H gene segment, from 20 to 40 D gene segments, at least one J gene segment and a heavy chain constant region comprising a C or C gene that does not encode a functional C.sub.H1 domain; (ii) a V.sub.H gene segment, a D gene segment and a J gene segment are capable of recombining to form a VDJ coding sequence; (iii) the recombined V.sub.H heavy chain locus, when expressed upon antigen challenge, is capable of forming a soluble, heavy chain-only antibody comprising a soluble, antigen-specific V.sub.H binding domain and a C or C constant effector region devoid of a functional C.sub.H1 domain; (b) cloning said recombined V.sub.H heavy chain locus from an antibody-producing cell of said immunised transgenic rodent after affinity maturation via somatic mutation; and (c) producing said soluble, antigen specific heavy chain only antibody from the clone of step (b).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2) Flexible linkers () and hinge () regions are indicated.
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12) The VH genes, D and J segments and C exons are preferably human, but could be from any other species including camelids. In the latter case the camelid VH (VHH) genes would not be mutated as they are naturally soluble.
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
GENERAL TECHNIQUES
(26) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g. in cell culture, molecular genetics, nucleic acid chemistry, hybridisation techniques and biochemistry). Standard techniques are used for molecular, genetic and biochemical methods (see generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Ausubel et al., Short Protocols in Molecular Biology (1999) 4th Ed., John Wiley & Sons, Inc.) and chemical methods. In addition Harlow & Lane, A Laboratory Manual, Cold Spring Harbor, N. Y, is referred to for standard Immunological Techniques.
(27) Any suitable recombinant DNA technique may be used in the production of the bi- and multi-valent polypeptide complexes, single heavy chain antibodies, and fragments thereof, of the present invention. Typical expression vectors, such as plasmids, are constructed comprising DNA sequences coding for each of the chains of the polypeptide complex or antibody. Any suitable established techniques for enzymic and chemical fragmentation of immunoglobulins and separation of resultant fragments may be used.
(28) The present invention also provides vectors including constructs for the expression of heavy chain-only antibodies in transgenic mice and the construction and expression of polypeptide complaxes of the present invention.
(29) It will be appreciated that a single vector may be constructed which contains the DNA sequences coding for more than polypeptide chain. For instance, the DNA sequences encoding two different heavy chains may be inserted at different positions on the same plasmid.
(30) Alternatively, the DNA sequence coding for each polypeptide chain, may be inserted individually into a plasmid, thus producing a number of constructed plasmids, each coding for a particular polypeptide chain. Preferably, the plasmids into which the sequences are inserted are compatible.
(31) Each plasmid is then used to transform a host cell so that each host cell contains DNA sequences coding for each of the polypeptide chains in the polypeptide complex.
(32) Suitable expression vectors which may be used for cloning in bacterial systems include plasmids, such as Col E1, pcR1, pBR322, pACYC 184 and RP4, phage DNA or derivatives of any of these.
(33) For use in cloning in yeast systems, suitable expression vectors include plasmids based on a 2 micron origin.
(34) Any plasmid containing an appropriate mammalian gene promoter sequence may be used in cloning in mammalian systems. Insect or bacculoviral promoter sequences may be used fir insect cell gene expression. Such vectors include plasmids derived from, for instance, pBR322, bovine papilloma virus, retroviruses, DNA viruses and vaccinia viruses.
(35) Suitable host cells which may be used for expression of the polypeptide complex or antibody include bacteria, yeasts and eukaryotic cells, such as insect or mammalian cell lines, transgenic plants, insects, mammalian and other invertebrate or vertebrate expression systems.
(36) Polypeptide Complexes and Single Heavy Chain Antibodies of the Present Invention
(37) It will be understood that term polypeptide complex, a single heavy chain antibody and heterlogous heavy chain locus of the present invention also include homologous polypeptide and nucleic acid sequences obtained from any source, for example related cellular homologues, homologues from other species and variants or derivatives thereof.
(38) Thus, the present invention encompasses variants, homologues or derivatives of the polypeptide complexes and antibodies as herein described.
(39) In the context of the present invention, a homologous sequence is taken to include an amino acid sequence which is at least 80, 85, 90, 95, 96, 97, 98, 99, 99.5, 99.6, 99.7, 99.8, 99.9% identical, preferably at least 98 or 99%, identical, at the amino acid level over at least 30, preferably 50, 70, 90 or 100 amino acids. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
(40) The present invention also includes constructed expression vectors and transformed host cells for use in producing the polypeptide complexes and antibodies of the present invention.
(41) After expression of the individual chains in the same host cell, they may be recovered to provide the complete polypeptide complex or heavy chain-only antibody in active form.
(42) It is envisaged that, in preferred forms of the invention, the individual heavy chains will be processed by the host cell to form the complete polypeptide complex or antibody which advantageously is secreted therefrom. Preferably, the effector chain is produced separately either by a host cell or by synthetic means.
(43) Techniques for the preparation of recombinant antibody polypeptide complexes is described in the above references and also in, for example, EP-A-0 623 679; EP-A-0 368 684 and EP-A-0 436 597.
(44) Immunisation of a Transgenic Organism
(45) In a further aspect, the present invention provides a method for the production of the antibodies of the present invention comprising administering an antigen to a transgenic organism of the present invention.
(46) The antibodies and polypeptide complexes produced from transgenic animals of the present invention include polyclonal and monoclonal antibodies and fragments thereof. If polyclonal antibodies are desired, the transgenic animal (e.g. mouse, rabbit, goat, horse, etc.) may be immunised with an antigen and serum from the immunised animal, collected and treated by known procedures. If serum containing polyclonal antibodies contains antibodies to other antigens, the polyclonal antibodies of interest can be purified by immunoaffinity chromatography and such like techniques which will be familiar to those skilled in the art. Techniques for producing and processing polyclonal antisera are also known in the art.
(47) Uses of the Polypeptide Binding Complexes and Antibodies of the Present Invention
(48) The polypeptide complexes and antibodies including fragments thereof of the present invention may be employed in: in vivo therapeutic and prophylactic applications, in vitro and in vivo diagnostic applications, in vitro assay and reagent applications, and the like.
(49) Therapeutic and prophylactic uses of the polypeptide complexes and antibodies of the invention involve the administration of the above to a recipient mammal, such as a human.
(50) Substantially pure polypeptide complexes and antibodies including fragments thereof of at least 90 to 95% homogeneity are preferred for administration to a mammal, and 98 to 99% or more homogeneity is most preferred for pharmaceutical uses, especially when the mammal is a human. Once purified, partially or to homogeneity as desired, the polypeptide complexes and heavy-chain-only antibodies as herein described may be used diagnostically or therapeutically (including extracorporeally) or in developing and performing assay procedures using methods known to those skilled in the art.
(51) Generally, the polypeptide complexes and antibodies of the present invention will be utilised in purified form together with pharmacologically appropriate carriers. Typically, these carriers include aqueous or alcoholic/aqueous solutions, emulsions or suspensions, which may include saline and/or buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride and lactated Ringer's.
(52) Suitable physiologically-acceptable adjuvants, if necessary to keep a polypeptide complex in suspension, may be chosen from thickeners such as carboxymethylcellulose, polyvinylpyrrolidone, gelatin and alginates.
(53) Intravenous vehicles include fluid and nutrient replenishers and electrolyte replenishers, such as those based on Ringer's dextrose. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents and inert gases, may also be present (Mack (1982) Remington's Pharmaceutical Sciences, 16th Edition).
(54) The polypeptide complexes and antibodies, including fragments thereof, of the present invention may be used as separately administered compositions or in conjunction with other agents. These can include various immunotherapeutic drugs, such as cyclosporine, methotrexate, adriamycin, cisplatinum or an immunotoxin. Alternatively, the polypeptide complexes can be used in conjunction with enzymes for the conversion of pro-drugs at their site of action.
(55) Pharmaceutical compositions can include cocktails of various cytotoxic or other agents in conjunction with the selected antibodies of the present invention or even combinations of the selected antibodies of the present invention.
(56) The route of administration of pharmaceutical compositions of the invention may be any of those commonly known to those of ordinary skill in the art. For therapy, including without limitation immunotherapy, the polypeptide complexes or antibodies of the invention can be administered to any patient in accordance with standard techniques. The administration can be by any appropriate mode, including parenterally, intravenously, intramuscularly, intraperitoneally, transdermally, via the pulmonary route, or also, appropriately, by direct infusion with a catheter. The dosage and frequency of administration will depend on the age, sex and condition of the patient, concurrent administration of other drugs, counter-indications and other parameters to be taken into account by the clinician.
(57) The polypeptide complexes and antibodies of this invention can be lyophilised for storage and reconstituted in a suitable carrier prior to use. Known lyophilisation and reconstitution techniques can be employed. It will be appreciated by those skilled in the art that lyophilisation and reconstitution can lead to varying degrees of functional activity loss and that use levels may have to be adjusted upward to compensate.
(58) In addition, the polypeptide complexes and antibodies of the present invention may be used for diagnostic purposes. For example, antibodies as herein described may be generated or raised against antigens which are specifically expressed during disease states or whose levels change during a given disease states.
(59) For certain purposes, such as diagnostic or tracing purposes, labels may be added. Suitable labels include, but are not limited to, any of the following: radioactive labels, NMR spin labels and fluorescent labels. Means for the detection of the labels will be familiar to those skilled in the art.
(60) The compositions containing the polypeptide complexes and antibodies of the present invention or a cocktail thereof can be administered for prophylactic and/or therapeutic treatments.
(61) A composition containing one or more polypeptide complexes or antibodies of the present invention may be utilised in prophylactic and therapeutic settings to aid in the alteration, inactivation, killing or removal of a select target cell population in a mammal. In addition, the selected repertoires of polypeptide complexes and antibodies described herein may be used extracorporeally or in vitro selectively to kill, deplete or otherwise effectively remove a target cell population from a heterogeneous collection of cells.
Example 1
(62) In preliminary experiments, transgenic mice were prepared to express a heavy chain locus wherein two llama V
(63) Constructs
(64) To overcome this problem, a genomic cosmid library was screened for clones containing the VH genes using standard methods. One (or more) different germline VHs were randomly chosen based on their sequence (five genera classes in the case of human VH's). Hydrophilic amino acid codons were introduced at positions 42, 49, 50 and 52 according to IMGT numbering (Lefranc et al. (1999)). The VH genes were combined into a BAC vector by standard procedures such as direct cloning using custom made linkers or homologous recombination.
(65) Two clones were selected from the human genomic Pac library RPCI-11 (BACPAC Recource Center, USA): clone 1065 N8 containing human heavy chain D and J segments, C (IgM) and C (IgD) and clone 1115 N15 containing the C3 (IgG3) genes. Bac clone 11771 from a different human genomic library (Incyte Genomics, CA, USA) was used as a source of C2 (IgG2) gene and the immunoglobulin heavy chain LCR (Mills et al. (1997) J. Exp Med., 15; 186(6):845-58).
(66) Using standard techniques, the C3 and C2 genes were subcloned separately into pFastBac vector (Invitrogen). Similarly any of the other Ig constant regions can be cloned from these BACs (IgA, IgE). A complete deletion of CH1 exon was achieved by homologous recombination (Imam et al. (2001)) using sequences that flank the CH1 exon of each constant region. An frt site could optionally be introduced in front of the C switch region to allow the generation of single copy loci from multicopy loci by treatment with flp recombinase in vivo by standard means e.g. by breeding to rosa-flp mice (
(67) The separate VH genes, D and J segments and C and LCR exons were cloned into one BAC either by conventional restriction digestion and ligations or by homologous recombination (or a mixture of both) or any other cloning technique.
(68) Further constructs could then be created.
(69) IgM-Only Locus
(70) In order to obtain the IgM construct (
(71) IgM Plus IgG Locus, (C is Optional)
(72) In order to obtain the IgM plus IgG construct (
(73) IgM Plus IgG Locus (C is Optional)
(74) In order to obtain the IgM plus IgG construct (
(75) Transgenic Mice, Breeding and Genotyping
(76) The final BAC was introduced into transgenic mice by standard microinjection of fertilized eggs or via embryonic stem cell transfection technology.
(77) Transgenic loci were checked for integrity and number of copies by Southern blot analysis of tail DNA (Southern 1975) using 5 and 3end locus probes. Founders were bred as lines in the MT/ background. Genotyping was done by standard PCR analysis using primers for each of the different regions of the locus. Sequence analysis of the RT-PCR products derived from BM cDNA of transgenic mice where the entire CH1 exon from both the C2 and the C3 was been deleted (one with (HLL lines) and one without the C and C genes, showed that the transgenic loci are not only capable of VDJ recombination, but that the IgG transcripts resemble those found in llama and camel HCAbs.
(78) Immunohistochemistry
(79) Spleens were embedded in OCT compound. Frozen 5 m cryostat sections were fixed in acetone and single or double labeled as previously described (Leenen et al. 1998). Monoclonal antibodies anti B220/RA3-6B2, anti-CD11c/N418 (Steinman et al., 1997), were applied as hybridoma culture supernatants. Peroxidase coupled goat anti-human IgG and anti-human IgM were from Sigma. Second-step reagents were peroxidase labeled goat anti-rat Ig (DAKO, Glostrup, Denmark) or anti-hamster Ig (Jackson ImmunoResearch Laboratories, West Grove, Pa.) and goat anti-rat Ig alkaline phosphatase (Southern Biotechnology, Birmingham, Ala., USA).
(80)
(81) Flow Cytometric Analyses
(82) Single cell suspensions were prepared from lymphoid organs in PBS, as described previously (Slieker et al. 1993). Approximately 110.sup.6 cells were incubated with antibodies in PBS/0.5% bovine serum albumin (BSA) in 96 well plates for 30 min at 4 C. Cells were washed twice in PBS/0.5% BSA. For each sample, 310.sup.4 events were scored using a FACScan analyzer (Becton Dickinson, Sunnyvale, Calif.). FACS data were analyzed using CellQuest version 1.0 computer software. Four-color analysis was performed on a Becton Dickinson FACS Calibur. The following mAbs were obtained from BD Pharmingen (San Diego, Calif.): FITC conjugated anti B220-RA3-6B2, PE conjugated anti CD19. FACS scan data of spleen cells, stained with anti-CD19 and anti-B220 are displayed in the bottom panel of
(83) On the left of the figure is a representation of Flp recombination in vivo by breeding HLL lines to a FlpeR transgenic line and supporting FACS scan data on spleen cells of the recombinant, showing B cell rescue as seen in the directly generated original HLL-MD lines. On the right is a representation of Cre recombination in vivo by breeding to Cag Cre transgenic line and FACS data on spleen cells of the single copy recombinant.
(84) Immunization and Hybridoma Production (
(85) Transgenic mice containing a heavy chain only antibody locus consisting of two llama VHH domains, human D and J regions and IgG2 and 3 constant regions (without a CH1 domain) were created.
(86) 8 week old mice were immunized with either E. Coli heat shock protein 70 (hsp70). 20 g or 5 g of antigen with Specol adjuvant (IDDLO, Lelystadt, NL) was injected respectively s.c. on days 0, 14, 28, 42 and i.p. on day 50. Blood was taken on day 0, 14 and 45. After three boosts a low titer of antigen specific antibodies was detected in 1 out of 3 Hsp70 immunized HLL-MD1 mice (
(87) A standard spleen cell fusion with a myeloma cell line was performed to generate a monoclonal antibody resulting in a monoclonal hybridoma cell line against the hsp70 protein. The anti-HSP 70 HCAb consists of the llama VHH segment closest to the D region (VHH 2) recombined to the human IgHD3-10 segment (acc.num. X13972) and the human IgHJ4-02 segment (acc.num.X86355). Although not at high frequency, the VHHs has a few mutations that give rise to the amino acid alterations seen in
(88) Transgenic mice containing a heavy chain only antibody locus consisting of two llama VHH domains, human D and J regions, a human IgM and IgG2 and 3 constant regions (all without a CH1 domain,
(89) Serum Ig ELISA
(90) Blood from 15-25 weeks old mice was collected in EDTA coated tubes, spun for 15 at room temperature (RT) and the supernatant diluted 1:5 in PBS. A 96 well plate was coated for 2 h with 5 mg/ml of a goat anti human IgG (YES Biotechnology) or a goat anti human IgM (Sigma), washed with PBS, blocked for 1 h at RT with blocking solution (1.5% BSA/1.5% powder milk/0.1% tween 20/PBS) and washed three times with PBS. Dilution series of serum samples and standards (human IgG2 or human IgM (Sigma, Zwijndrecht, NL)) were loaded and incubated for 2-4 h and the plates washed 6 times with PBS before addition of a secondary antibody (1:2000 diluted goat anti human IgG or goat anti human IgM coupled to HRP (Sigma, Zwijndrecht, NL)). All dilutions were done in a blocking solution. After 1-2 h incubation at RT and washing in PBS, POD substrate (Roche) was added.
(91) The ELISA for the detection of antigen specific soluble sdAbs from the IgG2 phage library is shown in
(92) Antibody Library Construction and Screening
(93) Total RNA was isolated from spleens of DKTP immunized single copy IgG only mice (
(94) Transformation into TG1 electro-competent cells yielded in a human single domain antibody library. Two rounds of selection were performed using panning on vaccine antigens adsorbed onto plastic (immunotubes coated with undiluted vaccine). Restriction analysis and sequencing were standard.
(95) RT-PCR of Heavy Chain-Only Locus
(96) It was then investigated whether HLL-MD locus functions as a normal locus in producing a diverse antibody repertoire by sequencing the RT PCR products obtained using IgG2 and IgG3 specific primers on cDNA from Peyer's patches.
(97) Although, the RT-PCR analysis on Peyer's patches showed that both VH are used, all the antibodies sequenced rearranged the V
(98) This analysis showed that both VHs, different human D and all of the human J segments are used, to contribute to a diverse antibody repertoire. It also showed the presence of IgG3 switched B cells and the occurrence of somatic mutations by comparison of each rearranged gene with its germline counterpart i.e. the original VH in the transgenic construct (see
(99) Immunostaining
(100)
(101) TABLE-US-00001 241 AGACTCT 80 RL 301 CCTGTGCAGCCTCTGGAAGCATCTTCAGTATCAATGCCATGGGCTGGTACCGCCAGGCTC 100 SCAASGSIFSINAMGWYRQA 361 CAGGGAAGCAGCGCGAGTTGGTCGCAGCTATTACTAGTGGTGGTAGCACAAGGTATGCAG 120 PGKQRELVAAITSGGSTRYA 421 ACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGGTGTATCTGC 140 DSVKGRFTISRDNAKNTVYL 481 AAATGAACAGCCTGAAACCTGAGGACACGGCCGTCTATTACTGTTTGATCTCTATGGTTC 160 QMNSLKPEDTAVYYCLISMV 541 GGGGAGCCCGTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGAGCTCA 180 RGARFDYWGQGTLVTVSSEL 601 AAACCCCACTT 200 KTPL
(102) The IgG3 hinge starts at amino acid 198 ELKTPL. For comparison see the IgG2 hinge region in
(103) Western Blot Analyses
(104)
(105) The signal shown in
(106) Size Fractionation of Human IgM Produced by the IgM Plus IgG Locus Mouse
(107) The serum from the IgM plus IgG mice (
(108) ELISA analysis was performed on a number of hybridomas made from mice containing the IgM plus IgG (
Example 2
(109) The bi-specific bi-valent antibody was generated by combining two heavy chain only mono-specific antibodies. The first antibody forms the backbone bringing in the first specificity and the effector functions (variable region and constant region respectively). This was combined with the second antibody with the second specificity via a newly designed hinge. This hinge was similar to the existing IgG2 hinge sequence but was altered by replacing the cysteins with prolines to prevent crosslinking of the cysteins in the antibody dimer and providing extra flexibility via the prolines to prevent the second antibody being spatially constrained, which otherwise may have inhibited its function.
(110) The starting backbone antibody was an antibody raised against the E. coli HSP70 protein. The HSP70 antigen was injected into transgenic mice that contained a heavy chain only antibody locus as described in (see above
(111) The forward primer was: CTGGAATTCTCAACCGAGCTGGGGCTGAGC (SEQ ID NO:4) providing an EcoRI site for cloning purposes (underlined) an efficient translation start sequence (bold) and the normal start codon (greyshade).
(112) The reverse primer was: GACAAGCTTTACCCGGAGACAGGGAGAGGC (SEQ ID NO:5) providing a HindIII cloning site (underlined) and remaining the normal stop codon.
(113) The amplification therefore leads to a EcoRI/HindIII fragment containing an EcoRI site (underlined), an efficient translation start sequence (bold) and the normal start codon of the HSP antibody gene (greyshade, see also
(114) The reverse 3end primer was: GACAAGCTTTACCCGGAGACAGGGAGAGGC (SEQ ID NO:6) providing a HindIII cloning site (underlined) and removing the normal stop codon. This resulted in a fragment (
(115) The second cloned antibody bringing in the second specificity comprised the VHH domain of a llama antibody against the pig retrovirus (PERV) gag antigen (Dekker et al., (2003) J Virol., 77 (22): 12132-9,
(116) Forward: GTCGCCCAGGTCCAACTGCAGGAGTCTG (SEQ ID NO:7) and the reverse primer GTCGAATTCTCATTCCGAGGAGACGGTGACCTGGGTC(SEQ ID NO:8). This provides the amplified fragment (
(117) The two antibody sequences were combined into one diabody sequence via the novel hinge. The novel hinge was generated from two oligonucleotides that together form a double strand oligonucleotide with 5 and 3 overhangs (respectively HindIII and XhoI compatible) for cloning purposes. It was designed to be in frame with the end of the HSP70 sequence and the start of the agag sequence. Formation of the sulphide bridges normally present in the human IgG2 hinge, was prevented by replacing the cysteins (greyshade) with prolines (underlined). The prolines add extra flexibility to the hinge to allow the proper functioning of the second antibody domain that becomes connected to COOH terminus of the first antibody via the hinge.
(118) The normal IgG hinge sequence (cysteine codons in greyshade, proline codons underlined) GAGCGCAAATGCGAG
CCACCG
CCA (SEQ ID NO:9) and its complement were replaced by AGCTTCTGAGCGCAAACCACCAGTCGAGCCACCACCGCCACCAC (SEQ ID NO:10) and its complement TCGAGTGGTGGCGGTGGTGGCTCGACTGGTGGTTTGCGCTCAGA) (SEQ ID NO:11).
(119) This also provided the fragment (white box hinge,
(120) The three fragments (HSP70 IgG2, hinge and agag) were subsequently ligated into a bluescript (Pbluescript11 sk+) expression plasmid that contains a chicken actin promoter and a CMV enhancer sequence (
(121) The diabody expression plasmid was grown and cotransfected with the plasmid pGK-hygro (to allow the selection of transfected cells) by standard methods (Superfect) into CHO cells (
(122) Therefore, a follow-up experiment was carried out. First the gag antigen was fixed to the bottom of a plastic well (first well
(123) In order to collect the secreted diabody the CHO clones were grown under the same standard conditions and in media (SIGMA hybridoma medium, serum-free) used for the collection of antibodies from hybridomas.
(124) Methods: Wells of a Nunc-Immuno plate (Maxisorp) were coated with purified recombinant gag protein (12.5 g/ul in PBS) O/N 4 C. Blocked for two hrs with 1% milk/1% BSA in PBS. CHO-DB clone-1 medium diluted in PBS-Milk-BSA (or controls) were incubated for 3 hrs at room temperature (RT). Bacterial B121 cell lysate (containing HSP70 protein) diluted in PBS-Milk-BSA was incubated for 3 hrs at RT and washed. Bound proteins were eluted with Laemmli sample buffer containing 2-Mercaptoethanol. The samples were analysed by Western blot and therefore run on a 10% SDS-PAGE and blotted on nitrocellulose membrane. The blot was blocked for two hrs with PBS-Milk-BSA and incubated with primary antibodies. The products were visualized by standard methods using secondary antibodies coupled to enzymes that allow visual staining. The reagent used were:
(125) Gag: Rabbit polyclonal (1:2000) 2 hrs RT
(126) Diabody: Goat human IgG-HRP (1:2500) 2 hrs RT
(127) HSP70: Monoclonal G20-380 medium (1:2) 2 hrs RT.
(128) Secondary antibodies were: Goat Rabbit-AP (1:2000) 2 hrs RT and Goat Human IgG-HRP (1:2500) 2 hrs RT against the HSP70 monoclonal.
(129) To visualize the protein bands first NBT/BCIP substrate (purple) reacting with alkaline phosphatase (AP) and second DAB substrate (brown) reacting with horseradish peroxidase (HRP) was used.
(130) All washing steps were done with PBS-0.05% Tween-20.
(131) Controls were carried out by leaving out one of the components or adding medium from CHO cells not producing diabodies (
(132) The fact that all three components (the diabody plus both antigens) were only present in the well of lane 1 that received all three components (see also legend bottom of
(133) Generation of Bispecific IgA or Multi-Specific IgM
(134) The generation of bispecific IgA is essentially as described for IgG (above), but using in addition to the Vhsol, D and J, the constant region C leading to the generation of IgA (
(135) The generation of IgM is largely similar, but offers an additional possibility because IgM molecules can form large multimers (with or without J chains). Thus in addition to molecules similar to those described above (
Example 3
(136) An expression vector encoding a polypeptide complex comprising: a heavy chain including a binding domain which binds to PSCA (prostate stem cell antigen), an assembly domain consisting the leucine zipper motif of Jun and antibody hinge, CH2 and CH3 domains; and a light chain including a complementary assembly domain consisting of the leucine zipper motif of Fos is constructed using molecular biology techniques as described in Sambrook et al ((1989) Molecular CloningA Laboratory Manual, Cold Spring Harbor Laboratory Press).
(137) The expression vector is then transferred to a suitable host cell by conventional techniques to produce a transfected host cell for optimized expression of the vector. The transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
(138) Once produced, the polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
(139) The soluble effector domain consisting of 3,3-diindolylmethane (DIM) is then fused to the complementary assembly domain using techniques known to those skilled in the art.
Example 4
(140) An expression vector encoding the heavy chain of the polypeptide complex of the present invention comprising; a soluble VHH binding domain which binds to AFP (Alpha-Fetoprotein) and an assembly domain consisting the leucine zipper motif of Jun, and antibody hinge, CH2 and CH3 domains is constructed using molecular biology techniques as described in Sambrook et al.
(141) A second expression vector encoding the light chain of the polypeptide complex of the present invention is also constructed. This comprises a complementary assembly domain consisting of the leucine zipper motif of Fos.
(142) The expression vectors are then transferred to a suitable host cell by conventional techniques to produce a co-transfected host cell for optimized expression of the vector. The transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
(143) Once produced, the polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
(144) The soluble effector domain consisting of 3,3-diindolylmethane (DIM) is then fused to the complementary assembly domain using techniques known to those skilled in the art.
Example 5
(145) VCAM and VLA-4
(146) An expression vector encoding a polypeptide complex comprising: a heavy chain including a binding domain which binds to PSCA (prostate stem cell antigen), an assembly domain consisting VCAM and antibody hinge, CH2 and CH3 domains; and a light chain including a complementary assembly domain consisting of VLA-4 fused to ricin A toxin is constructed using molecular biology techniques as described in Sambrook et al.
(147) The expression vector is then transferred to a suitable host cell by conventional techniques to produce a transfected host cell for optimized expression of the vector. The transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
(148) Once produced, the polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
Example 6
(149) An expression vector encoding a polypeptide complex comprising: a heavy chain including a binding domain which binds to PSCA (prostate stem cell antigen), an assembly domain consisting the leucine zipper motif of Jun and antibody hinge, CH2 and CH3 domains; and a light chain including a complementary assembly domain consisting of the leucine zipper motif of Fos and a soluble effector domain encoding purine nucleoside phosphorylase (PNP) is constructed using molecular biology techniques as described in Sambrook et al.
(150) The expression vector is then transferred to a suitable host cell by conventional techniques to produce a transfected host cell for optimized expression of the vector. The transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
(151) Once produced, the polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
(152) PNP converts fludarabine to the toxic metabolite 2-fluoroadenine which kills the cells that comprise the PNP enzyme and in addition diffuses to kill surrounding uninfected cells, a local bystander effect.
Example 7
(153) An expression vector encoding a first heavy chain of the polypeptide complex of the present invention comprising; a soluble VHH binding domain which binds to V3-PND region of glycoprotein antigen gp120 and an assembly domain consisting the leucine zipper motif of Jun and antibody hinge, CH2 and CH3 domains is constructed using molecular biology techniques as described in Sambrook et al.
(154) A second expression vector encoding a second heavy chain of the polypeptide complex of the present invention is also constructed comprising: a soluble VHH binding domain which binds to GP-41, an assembly domain consisting of the leucine zipper motif of Jun and antibody hinge, CH2 and CH3 domains.
(155) A third expression vector encoding the light chain of the polypeptide complex of the present invention is also constructed. This comprises a complementary assembly domain consisting of the leucine zipper motif of Fos.
(156) The expression vectors are then transferred to a suitable host cell by conventional techniques to produce a co-transfected host cell for optimized expression of the vector. The transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
(157) Once produced, the polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
(158) The soluble effector domain consisting of HIV-1 MN V3 (PND) peptide immunogen is then fused to the complementary assembly domain using techniques known to those skilled in the art.
Example 8
(159) An expression vector encoding a first heavy chain of the polypeptide complex of the present invention comprising: a soluble VHH binding domain which binds to V3-PND region of glycoprotein antigen constructed using molecular biology techniques as described in Sambrook et al ((1989) Molecular CloningA Laboratory Manual, Cold Spring Harbor Laboratory Press).
(160) A second expression vector encoding a second heavy chain of the polypeptide complex of the present invention is also constructed comprising: a soluble VHH binding domain which binds to GP-41.
(161) The two heavy chains are characterised in that the constant regions for the two heavy chains comprise identical , CH2, CH3 and CH4 domains.
(162) The expression vectors are then transferred a host cell which constitutively expresses a J chain by conventional techniques to produce a co-transfected host cell for optimized expression of the vector. The transfected or transformed host cell is then cultured using any suitable technique known to these skilled in the art to produce the polypeptide complex of the invention.
(163) Once produced, the polypeptide complexes are purified by standard procedures of the art, including cross-flow filtration, ammonium sulphate precipitation and affinity column chromatography (e.g., protein A).
(164) The soluble effector domain consisting of HIV-1 MN V3 (PND) peptide immunogen is then fused to the complementary assembly domain using techniques known to those skilled in the art.
(165) All publications mentioned in the above specification are herein incorporated by reference.
(166) Various modifications and variations of the described methods and system of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in biochemistry, molecular biology and biotechnology or related fields are intended to be within the scope of the following claims.