Composition comprising an extract of leaves of the <i>Lansium domesticum </i>plant and methods of use for depigmentation of the skin and/or skin appendages

Abstract

The present disclosure describes a Lansium domesticum leaf extract and methods of using the leaf extract for decreasing the pigmentation of the skin and/or of the skin appendages, and/or decreasing the pigment spots on the skin. The disclosure further describes methods of using the leaf extract for the treatment of pathological conditions involving a pigment dysregulation. The disclosure also describes cosmetic compositions and pharmaceutical compositions comprising the leaf extract.

Claims

1. A method for decreasing pigmentation of skin or skin appendages, and/or for decreasing pigment spots on skin, comprising administering an effective amount of a Lansium domesticum leaf extract or a composition comprising said Lansium domesticum leaf extract to a human subject in need thereof.

2. The method of claim 1, wherein the Lansium domesticum leaf extract is obtained by extraction in water, alcohol, glycol, polyol, or a mixture of water/alcohol, water/glycol or water/polyol of 100/0 to 0/100 (w/w).

3. The method of claim 1, wherein the Lansium domesticum leaf extract is obtained by aqueous extraction.

4. The method of claim 1, wherein the Lansium domesticum leaf extract is present in a cosmetic composition comprising at least one cosmetically acceptable excipient, wherein the Lansium domesticum leaf extract is at a concentration of from 110.sup.4% to 10% by weight, between 110.sup.4% and 5% by weight, between 110.sup.3% and 3% by weight, or between 0.001% and 0.1% by weight relative to the total weight of the composition.

5. The method of claim 1, wherein the Lansium domesticum leaf extract is present in a nutraceutical composition comprising at least one nutraceutically acceptable excipient, wherein the Lansium domesticum leaf extract is at a concentration of from 110.sup.4% to 10% by weight, between 110.sup.4% and 5% by weight, between 110.sup.3% and 3% by weight, or between 0.001% and 0.1% by weight relative to the total weight of the composition.

6. The method of claim 1, wherein the Lansium domesticum leaf extract increases the expression of miRNA490 and/or decreases the amount of tyrosinase protein in skin or skin appendages of the human subject.

7. The method of claim 1, wherein the Lansium domesticum leaf extract increases the expression of miRNA490 and/or decreases the amount of tyrosinase protein in melanocytes of the human subject.

8. The method of claim 1, wherein the Lansium domesticum leaf extract or the composition comprising said Lansium domesticum leaf extract is administered topically onto skin or skin appendages of said human subject.

9. The method of claim 1, wherein the Lansium domesticum leaf extract or the composition comprising said Lansium domesticum leaf extract is topically applied onto all or part of a human body selected from the group consisting of hand, neck, neckline, stomach, arm, thigh, hip, waist, and face.

10. The method of claim 1, wherein the Lansium domesticum leaf extract or the composition comprising said Lansium domesticum leaf extract is administered orally.

11. The method of claim 1, wherein the Lansium domesticum leaf extract is in a nutraceutical composition in form of gel capsules, capsules, powder, or gel.

12. A method for treating a pathological condition including pigment dysregulation, comprising administering an effective amount of a Lansium domesticum leaf extract to a human subject in need thereof.

13. The method of claim 12, wherein the pathological condition is a pathological hyperpigmentation.

14. The method of claim 12, wherein the pathological condition is Addison's disease, liver failure, purpura, melanoma, or dermatosis papulosa nigra.

15. The method of claim 12, wherein the Lansium domesticum leaf extract is obtained by extraction in water, alcohol, glycol, polyol, or a mixture of water/alcohol, water/glycol or water/polyol of 100/0 to 0/100 (w/w).

16. The method of claim 12, wherein the Lansium domesticum leaf extract is obtained by aqueous extraction.

17. The method of claim 12, wherein the Lansium domesticum leaf extract increases the expression of miRNA490 and/or decreases the amount of tyrosinase protein in melanocytes of the human subject.

18. The method of claim 12, wherein the Lansium domesticum leaf extract is administered topically.

19. The method of claim 12, wherein the Lansium domesticum leaf extract is present in a pharmaceutical or dermatological composition comprising at least one pharmaceutically or dermatologically acceptable excipient, wherein the Lansium domesticum leaf extract is at a concentration of from 110.sup.4% to 10% by weight, between 110.sup.4% and 5% by weight, between 110.sup.3% and 3% by weight, or between 0.001% and 0.1% by weight relative to the total weight of the composition.

20. A pharmaceutical or dermatological composition comprising a Lansium domesticum leaf extract and a pharmaceutically or dermatologically acceptable excipient, wherein said Lansium domesticum leaf extract is present at a concentration of from 110.sup.4% to 10% by weight, between 110.sup.4% and 5% by weight, between 110.sup.3% and 3% by weight, or between 0.001% and 0.1% by weight relative to the total weight of the composition.

Description

EXAMPLES

Example 1: Various Methods for Preparing the Lansium domesticum Extract

Example 1a

(1) Ten percent (10%) by weight of L. domesticum leaves were extracted with magnetic stirring in water as sole solvent for a period of 2 hours at ambient temperature, that is to say at a temperature of 20 C. The extract thus obtained was filtered and then spray-dried in the presence of maltodextrin added to the medium at a final concentration of 75% by weight relative to the total weight of the maltodextrin and of the extract (w/w). The extract thus obtained is in powder form.

Example 1b

(2) Fifteen percent (15%) by weight of L. domesticum leaves were extracted with magnetic stirring in water as sole solvent for a period of 2 hours at ambient temperature, that is to say at a temperature of 20 C. The extract thus obtained was filtered and then spray-dried in the presence of maltodextrin added to the medium at a final concentration of 75% by weight relative to the total weight of the maltodextrin and of the extract (w/w). The extract thus obtained is in powder form.

Example 1c

(3) Ten percent (10%) by weight of L. domesticum leaves were extracted with magnetic stirring in a water/ethanol mixture (75, 25) (w/w) for a period of 2 hours at ambient temperature, that is to say at a temperature of 20 C. The extract thus obtained was filtered and then spray-dried in the presence of maltodextrin added to the medium at a final concentration of 75% by weight relative to the total weight of the maltodextrin and of the extract (w/w). The extract thus obtained is in powder form.

Example 1d

(4) Ten percent (10%) by weight of L. domesticum leaves were extracted with magnetic stirring in water as sole solvent for a period of 2 hours at a temperature of 80 C. The extract thus obtained was filtered and then spray-dried in the presence of maltodextrin added to the medium at a final concentration of 75% by weight relative to the total weight of the maltodextrin and of the extract (w/w). The extract thus obtained is in powder form.

Example 2: Decrease in the Amount of Tyrosinase (TYR) Protein in the Presence of miRNA490

(5) Protocol:

(6) Normal human melanocytes, that is to say not exhibiting any pathological skin condition, from a normal healthy donor, were cultured in an M-PRO specific medium containing K-SFM (Invitrogen) with geniticin (100 g/ml) and normocin (0.3%), with or without addition of synthetic miRNA490 (20 nmol/l final concentration). The cells were cultured at 37 C. (under 5% CO.sub.2) and then seeded into an M-DIF medium for the extraction below.

(7) The total cell proteins were extracted from the melanocytes cultured above, with a lysis buffer (RIPA, Sigma) supplemented with an anti-protease cocktail (Roche). An amount of 13 g of proteins of each sample was purified on gel (NuPage Novex, Invitrogen) then transferred onto a cellulose membrane. The membranes were saturated with a Tris buffer (5% Tris buffered saline) for 1 hour at ambient temperature and then incubated at 4 C. overnight with an anti-TYR (sc-20035) and anti-TRP1 (sc-58438) primary antibody or an anti-actin (HRP-b-actin (A3854)) primary antibody (Sigma) as control, followed by a second incubation for 1 hour at ambient temperature with a secondary antibody. The detection was carried out with the ECL prime kit (GE Amersham). The amount of tyrosinase (TYR) was measured by Western blot, the results are presented below and are the mean (MEAN) of three assays (n=3).

(8) Results:

(9) TABLE-US-00001 TABLE 2 MEAN SD Control 100 1.0 +miRNA490 (20 nmol/l) 53.5 7.4 SD: Standard deviation; MEAN: mean Conclusion: these results showed that miRNA490 caused a decrease of at least 46.5% of the amount of tyrosinase detected in the human melanocytes.

Example 3: Decrease in the Amount of Tyrosinase (TYR) Protein in the Presence of the Lansium domesticum Extract

(10) Protocol:

(11) Normal human melanocytes were cultured in an M254 culture medium (Life technologies) at a temperature of 37 C. (5% CO.sub.2), then the L. domesticum extract prepared according to example 1a) was added to the medium at a final concentration of 8.510.sup.3% (volume/volume). The cells were lysed and the amount of total protein was measured by the BSA method.

(12) The amount of protein was measured by Western blot (Sally Sue, Protein Sample, San Jose) (n=6).

(13) Results:

(14) TABLE-US-00002 TABLE 3 MEAN Control 100 L. domesticum extract 8.5 10.sup.3 % (v/v) 63.11 (n = 6; p < 0.01 (**)) SD: Standard deviation; MEAN: mean

(15) The L. domesticum extract according to the invention made it possible to decrease the amount of tyrosinase by at least 37%.

Example 4: Increase in the Expression of miRNA490 in Normal Human Melanocytes in the Presence of the Lansium domesticum Extract

(16) Protocol:

(17) The culturing of the melanocytes was carried out as described in the protocol of example 2. The total RNA was extracted from the melanocytes after culture (SV 96 total RNA Isolation System kit) then converted into cDNA by RT-PCR (mi SCRIPT SYBR Green PCR kit). The amplification of the miRNA490 (Table 4) was carried out using the commercial primers (Qiagen) (references 218300 MS00004319 (Hs_miR-490_1 miScript Primer Assay) and QF00065247 (Hs_RNU1-8_QF_1 QuantiFast Probe Assay) for the reference gene (Accession number NR_004430.2)).

(18) TABLE-US-00003 TABLE4 Sequence miR-490-3p(MIMAT0002806 CAACCUGGAGGACUCCAUGCUG (mirBase)) SEQIDNo2
Results:

(19) The results presented in Table 5 are the mean of five assays (n=5)

(20) TABLE-US-00004 TABLE 5 MEAN SD Control 100 15.0 L. domesticum extract at 9 10.sup.3 (w/w) 143.2 26.8 SD: Standard deviation; MEAN: mean Conclusion: the L. domesticum extract according to the invention made it possible to increase the expression of miRNA490 in the human melanocytes by at least 1% and up to 85%.

Example 5: Decrease in the Amount of Melanin in the Presence of the Lansium domesticum Extract

(21) Protocol:

(22) B16 melanocytes were cultured in Eagle's Minimum Essential Medium containing 2% foetal serum (foetal calf serum) for 3 days at 37 C. under 5% CO.sub.2, then the L. domesticum extract was added at a final concentration of 410.sup.3 or 910.sup.3 by weight relative to the total weight of the medium (w/w) and the medium was incubated for a further three days. The same medium was incubated under identical conditions without L. domesticum extract in the presence of NDP-a-MSH (control). The amount of melanin was measured by measuring the optical density at 475 nm.

(23) The results of the melanin measurement are the mean of six assays (n=6).

(24) Results:

(25) TABLE-US-00005 TABLE 6 MEAN SD Control 100 6 L. domesticum extract 4 10.sup.3 % (w/w) 19.2 1.7 L. domesticum extract 9 10.sup.3 % (w/w) 21.4 0.6 SD: Standard deviation; MEAN: mean Conclusion: the results showed a decrease of at least 78% of the amount of melanin detected in the melanocytes and up to 88.5%, in the presence of the L. domesticum extract according to the invention.

Example 6: Cosmetic Ingredient Comprising a Lansium domesticum Extract

(26) TABLE-US-00006 L. domesticum extract according to example 1a) 0.1-10% Water qs 100

Example 7: Cosmetic Compositions Comprising the Active Ingredient According to the Invention

(27) The compositions below are prepared according to methods known to those skilled in the art, in particular as regards the various phases to be mixed together. *The cosmetic ingredient corresponds to that of example 6 above.

(28) Formulation 7a:

(29) TABLE-US-00007 Cosmetic ingredient* 0.001-10% EDTA 0.05 Steareth-2 2.00 Steareth-21 2.50 Cetearyl alcohol 1.00 Propylheptyl caprylate 15.00 Sodium hydroxide (30% in solution) 0.10 Mixture of phenoxyethanol, chlorphenesin, benzoic acid, 1.25 butylene glycol, sorbic acid (Germazide PBS) Mixture of polyacrylate-X, isohexadecane and polysorbate 4.00 60 (Sepigel SMS 60) Water qs 100
Formulation 7b:

(30) Use of the cosmetic ingredient according to the invention in a formulation of water-in-oil type

(31) TABLE-US-00008 A PEG 30 3 Dipolyhydroxystearate Captic triglycerides 3 Cetearyl octanoate 4 Dibutyl adipate 3 Grapeseed oil 1.5 Jojoba oil 1.5 Phenoxyethanol, methylparaben, propylparaben, 0.5 butylparaben, ethylparaben B Glycerin 3 Butylene glycol 3 Magnesium sulfate 0.5 EDTA 0.05 Water qs 100 C Cyclomethicone 1 Dimethicone 1 D Fragrance 0.3 E Cosmetic ingredient* 0.001-10%
Formulation 7c:

(32) Use of the products of the invention in an aqueous gel formulation (face)

(33) TABLE-US-00009 A Water qs 100 Carbomer 0.5 Butylene glycol 15 Phenoxyethanol, methylparaben, 0.5 propylparaben, butylparaben, ethylparaben B Cosmetic ingredient* 0.001-10%
Formulation 7d:

(34) Use of the products of the invention in a formulation of shampoo or shower gel type (body)

(35) TABLE-US-00010 A Water qs 100 B Butylene glycol, methylparaben, 0.5 Ethylparaben, propylparaben Phenoxyethanol, methylparaben, 0.5 propylparaben, butylparaben, ethylparaben C Citric acid 0.8 D Sodium Laureth Sulfate 40.0 E Cosmetic ingredient* 0.001-10%

Example 8: Example of Cosmetic Formulation Containing the Extract According to the Invention Intended for Face Care

(36) TABLE-US-00011 A Glyceryl Stearate, Ceteareth-20, Ceteareth-12, 6.00 Cetearyl Alcohol, Cetyl Palmitate Cetearyl Alcohol 2.00 Cetearyl Isononanoate 3.00 Isopropyl Myristate 5.00 Propylheptyl caprylate 2.00 Dicaprylyl Carbonate 2.00 Dimethicone 1.00 Tocopherol 0.20 B Water 67.25% Propylene Glycol, Phenoxyethanol, Chlorphenesin, 2.50 Methylparaben Disodium EDTA 0.05 Butylene Glycol 3.00 C Xanthan gum 0.2 Sodium stearoyl glutamate 0.5 D Water 5 Extract according to example 1a) 0.3%

Example 9: In Vivo Analysis of the Decrease in the Amount of Melanin and in the Surface Area of the Pigment Spots on the Skin in the Presence of an L. domesticum Extract

(37) Protocol:

(38) the decrease in amount of melanin and in the surface area of the pigment spots was evaluated by means of the siascopy technique (Siascope) on the facial skin of a population of 25 women from 18 to 70 years old, of Asian origin (Phototype III, IV), having a non-uniform coloration of the skin and pigment spots.

(39) The application of the cosmetic formulation of example 8, containing 0.3% by weight of the L. domesticum extract prepared according to example 1a), relative to the total weight of the formulation, or of the same formulation without extract, termed placebo, was carried out on the half-faces of the population for a period of 56 days. The results are presented on base 100 (T0) and correspond to a percentage decrease after 56 days of application.

(40) Result:

(41) TABLE-US-00012 TABLE 7 Decrease in the surface area of the pigment spots (%) T0 T56 T56/T0 Placebo 100 95 5 L. domesticum extract Ex. 1a) 0.3% 100 77 23** (Student's test: **p < 0.01) Conclusion: the L. domesticum extract decreased the surface area of the pigment spots by 23% after 56 days of application, and by 18% in comparison with the placebo.

(42) TABLE-US-00013 TABLE 8 Decrease in the amount of melanin (%) T0 T56 T56/T0 Placebo 100 83 7 L. domesticum extract Ex. 1a) 0.3% 100 77 23** (Student's test: **p < 0.01) Conclusion: the L. domesticum extract decreased the amount of melanin by 23% after 56 days of application, and by 16% in comparison with the placebo.