Methods and compositions for producing double allele knock outs
11060083 ยท 2021-07-13
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12Y204/01068
CHEMISTRY; METALLURGY
C12N15/79
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12Y302/01018
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/67
CHEMISTRY; METALLURGY
C12N15/79
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
Abstract
The present invention provides a method and compositions utilizing the CRISPR system to disrupt a target gene in eukaryotic cells to produce double allele knock outs. The method finds use in producing afucosylated antibodies with enhanced ADCC activity.
Claims
1. A method of producing a double allele knock-out of a target gene in a eukaryotic cell, comprising the steps of: providing the cells with a CRISPR system comprising a Cas9 nuclease, wherein the Cas9 nuclease has two functional nuclease domains that produce a double-stranded break, and three to seven targeting RNAs located in the same gene, wherein each targeting RNA is comprised of a crRNA and a tracrRNA, wherein each crRNA has a different sequence, and expressing the CRISPR nuclease and the targeting RNAs whereby the target gene is knocked out in both alleles of the cell.
2. The method of claim 1, wherein the CRISPR system comprises three targeting RNAs.
3. The method of claim 2, wherein each targeting RNA has the same tracrRNA.
4. The method of claim 2, wherein at least two targeting RNAs are complementary to a corresponding target sequence in the targeted gene, and wherein the target sequences are located in a contiguous stretch of 375 bp, 200 bp, or 150 bp in the target gene.
5. The method of claim 1, wherein said cells are mammalian.
6. The method of claim 5, wherein said cells are CHO cells, 293 cells, NSO cells, embryonic stem cells, or derivatives thereof, or antibody-producing cells or derivatives thereof.
7. The method of claim 1, wherein the tracrRNA and the crRNA are connected by a hairpin RNA linkage.
8. The method of claim 1, wherein at least two targeting RNAs are complementary to a corresponding target sequence in the targeted gene, and wherein the target sequences are in a single exon of the targeted gene.
9. The method of claim 1, further comprising the step of providing the eukaryotic cells with a nucleic acid construct comprising a polynucleotide encoding an antibody and a control region operably linked to the polynucleotide encoding the polypeptide.
10. The method of claim 9, further comprising the step of expressing the antibody from the nucleic acid construct in the eukaryotic cell.
11. The method of claim 1, wherein the targeted gene is a fucosyltransferase.
12. The method of claim 1, wherein the targeted gene is glutamine synthetase.
13. The method of claim 1, wherein the targeted gene is dihydrofolate reductase (DHFR).
14. The method of claim 1, wherein the targeted gene is a sialidase.
15. The method of claim 1, further comprising the step of growing the eukaryotic cell that has the target gene knocked out in both alleles of the eukaryotic cell.
16. A method of producing a double allele knock-out of a target gene in a eukaryotic cell, comprising the steps of: providing the cells with a CRISPR system comprising a Cas9 nuclease, wherein the Cas9 nuclease has two functional nuclease domains that produce a double-stranded break, and three to seven targeting RNAs located in the same gene, wherein each targeting RNA is comprised of a crRNA and a tracrRNA, wherein each crRNA has a different sequence, expressing the CRISPR nuclease and the targeting RNAs whereby the target gene is knocked out in both alleles of the cell, and losing the CRISPR system from the eukaryotic cell.
17. The method of claim 16, further comprising the step of growing the eukaryotic cell that has the target gene knocked out in both alleles of the eukaryotic cell.
18. The method of claim 17, further comprising the step of providing the eukaryotic cells with a nucleic acid construct comprising a polynucleotide encoding an antibody and a control region operably linked to the polynucleotide encoding the polypeptide.
19. The method of claim 18, further comprising the step of expressing the antibody from the nucleic acid construct in the eukaryotic cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION OF THE INVENTION
(9) The invention is illustrated by way of example and not by way of limitation. It should be noted that references to an or one or some embodiment(s) in this disclosure are not necessarily to the same embodiment, and all such references mean at least one. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. In this application, the use of or means and/or unless stated otherwise. Furthermore, the use of the term including, as well as other forms, such as includes and included, is not limiting.
(10) Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition.
(11) Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are well known and commonly used in the art. The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art, or as described herein. So that the present invention may be more readily understood, selected terms are defined below.
(12) The term antibody, as used herein, broadly refers to any immunoglobulin (Ig) molecule comprised of four polypeptide chains, two heavy (H) chains and two light (L) chains, or any functional fragment, mutant, variant, or derivation thereof, which retains the essential epitope binding features of an Ig molecule, including for example, one or more polypeptides substantially encoded by immunoglobulin genes, fragments of immunoglobulin genes, hybrid immunoglobulin genes (made by combining the genetic information from different animals), or synthetic immunoglobulin genes, or a single-chain antibody, a Fab, a F(ab).sub.2, a scFv, a dAB, a VHH, a camelid antibody, or a nanobody. Such mutant, variant, or derivative antibody formats are known in the art. Non-limiting embodiments of which are discussed below.
(13) In a full-length antibody, each heavy chain is comprised of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as LCVR or VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG 1, IgG2, IgG 3, IgG 4, IgA1 and IgA2) or subclass.
(14) An isolated antibody, as used herein, is intended to refer to an antibody that is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds the CD20 antigen found on the surface of normal and malignant B lymphocytes). An isolated antibody that specifically binds the CD20 antigen may, however, have cross-reactivity to other antigens, such as the CD20 molecules from other species. Moreover, an isolated antibody may be substantially free of other cellular material and/or chemicals.
(15) The term polynucleotide as referred to herein means a polymeric form of two or more nucleotides, either ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms of DNA, but particularly is double-stranded DNA.
(16) The term isolated polynucleotide as used herein shall mean a polynucleotide (e.g., of genomic, cDNA, or synthetic origin, or some combination thereof) that, by virtue of its origin, the isolated polynucleotide is not associated with all or a portion of a polynucleotide with which the isolated polynucleotide is found in nature; is operably linked to a polynucleotide that it is not linked to in nature; or does not occur in nature as part of a larger sequence.
(17) The term vector, as used herein, is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a plasmid, which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as recombinant expression vectors (or simply, expression vectors). In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, plasmid and vector may be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, which serve equivalent functions. Inside cells, vectors and/or plasmids may exist extrachromosomally or integrated into host cell DNA.
(18) The term operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control sequence operably linked to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. Operably linked sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. The term expression control sequence as used herein refers to polynucleotide sequences, which are necessary to effect the expression and processing of coding sequences to which they are ligated. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion. The nature of such control sequences differs depending upon the host organism; in eukaryotes, generally, such control sequences include promoters and transcription termination sequence. The term control sequences is intended to include components whose presence is essential for expression and processing, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.
(19) The terms introducing a purified DNA into a eukaryotic host cell or transfection denote any process wherein an extracellular DNA, with or without accompanying material, enters a host cell. The term cell transfected or transfected cell means the cell into which the extracellular DNA has been introduced and thus harbors the extracellular DNA. The DNA might be introduced into the cell so that the nucleic acid is replicable either as a chromosomal integrant or as an extra chromosomal element. Promoter as used herein refers to a nucleic acid sequence that regulates expression of a gene.
(20) The term recombinant host cell (or simply host cell), as used herein, is intended to refer to a cell into which exogenous DNA has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell, but, to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term host cell as used herein. Particularly host cells include eukaryotic cells.
(21) Eukaryotic cell refers to any mammalian or non-mammalian cell from a eukaryotic organism. By way of non-limiting example, any eukaryotic cell that is capable of being maintained under cell culture conditions and subsequently transfected would be included in this invention. Especially preferable cell types include, e.g., stem cells, embryonic stem cells, Chinese hamster ovary cells (CHO), 293 cells, NS0 cells, COS, BHK21, NIH3T3, HeLa, C2Cl2, cancer cells, plant cells, fungal cells, and primary differentiated or undifferentiated cells. Other suitable host cells are known to persons of ordinary skill in the art.
(22) The gene of interest or transgene preferably encodes a protein (structural or regulatory protein). As used herein protein refers generally to peptides and polypeptides having more than about ten amino acids. The proteins may be homologous to the host (i.e., endogenous to the host cell being utilized), or heterologous, (i.e., foreign to the host cell being utilized), such as a human protein produced by yeast. The protein may be produced as an insoluble aggregate or as a soluble protein in the periplasmic space or cytoplasm of the cell, or in the extracellular medium.
(23) Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art, or as described herein. The foregoing techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. Illustrative methods are described in Current Protocols in Immunology (Edited by: Coligan, J. E., et al., John Wiley & Sons, NY, N.Y., 2001), Ausubel et al., Current Protocols in Molecular Biology, Greene Publ. Assoc. Inc. & John Wiley & Sons, Inc., NY, N.Y., 2001), Sambrook et al. (Molecular Cloning, 3rd Ed., Cold Spring Harbor Laboratory, Plainview, N.Y., 2001) and elsewhere.
Overview of the Invention
(24) The present invention utilizes the CRISPR system to disrupt a target gene in eukaryotic cells. More specifically, the system transiently expresses Cas9, tracrRNA (single or multiple), and multiple crRNAs targeting multiple exon sites of a gene of interest in a eukaryotic cell such as CHO cells, 293 cells, NS0 cells, or any antibody producing cells. The main advantage of the system of the present invention compared to published CRISPR methods is that it specifically knocks out two targeted alleles in one step by using multiple crRNA sequences in the same system. Most of the publications related to CRISPR utilize the Surveyor nuclease assay (Transgenomic, Inc., Omaha, Nebr.) or deep sequencing to assess genome editing rates and do not differentiate single allele or double allele mutations. The present approach to efficient double allele genome editing targets the same gene/exon with multiple crRNA targets. Without wishing to be bound by any particular theory, we hypothesized that targeting multiple crRNA sites would significantly enhance the possibility of producing double allele knock-outs. Indeed, our results show that multiple crRNAs act synergistically to produce 1-5% double allele knock-out cells. Surprisingly and unexpectedly, an optimal number of crRNAs (targeting RNAs) produced 4-5% knock-out frequencies and adding further crRNAs did not increase the knock-out frequency. Further, it was surprising and unexpected that 3-4 crRNAs produced far more than additive effects on the knock out frequency, especially when the crRNA sites were located close to each other, e.g., the target sequences for the crRNAs are within 500, 450, 400, 375, 300, 250, 200, 150, 100, or 50 bp of the target cell DNA. This effect of proximity on the frequency of double allele knock-outs was also surprising and unexpected.
(25) When the targeted DNA is cleaved by Cas9 to create double-strand-breaks, the gene of interest may be disrupted by introducing frame-shift insertions or deletions (indels) by non-homologous end joining (NHEJ). When two single-strand cleavage sites are created by the single catalytic site variant Cas9-D10A, the gene of interest may be disrupted by deletion between the cleavages sites. Previously, the Cas9 system has been shown to create targeted gene-editing in multiple mammalian cell types (Mali et al., Science, 2013, 339:823-826; Cong, L. et al., Science, 2013, 339:819-823). However, since the non-homologous end joining rates are typically low depending on the target site and the cell type, previous Cas9 systems have not been able to select a knock-out cell line null at both alleles in an efficient single step. The present invention describes methods and compositions for the creation of double allele knock-outs in a single step using multiple targeting RNA sites in a gene of interest. In other embodiments, more than one gene is targeted at the same time.
(26) The CRISPR system is applicable to genome modification in many organisms. In nature, CRISPR systems are used by bacteria and archaea to defend against phage and plasmids by RNA-directed degradation of DNA. Exogenous DNA is apparently processed by proteins encoded by some of the CRISPR-associated (cas) genes into small elements (of 30 bp in length), which are then somehow inserted into the CRISPR locus near the leader sequence. Short segments of foreign DNA, called spacers, are incorporated into the genome between CRISPR repeats, and serve as a memory of past exposures. CRISPR repeats range in size from 24 to 48 base pairs. In Type II CRISPR systems, the Cas9 protein forms a complex with 2 small RNAs sharing a complementary sequence: crRNA and tracrRNA. The crRNA contains a sequence complementary to the DNA spacer sequence and helps to guide the Cas9-RNA complex to the targeted foreign DNA. A single chimeric guiding RNA (gRNA) may be utilized by connecting crRNA and tracrRNA with a hairpin RNA linkage. Cas9 unwinds the DNA duplex and cleaves both strands upon recognition of a target sequence by the crRNA, but a double stranded break results only if the correct protospacer-adjacent motif (PAM) is present at the 3 end. Cas9 can be directed to cleave any sequence with a compatible PAM, by expressing a chimeric gRNA (Mali, P. et al., Science, 2013, 339(6121):823-6), or a spacer array together with the tracrRNA required for processing (Cong, L. et al., Science, 2013, 339(6121):819-23). Knocking out one of the two Cas9 nuclease domains converts the enzyme into a nickase that causes nicks (breaks in one strand) of nucleic acid, allowing it to unwind. CRISPR is generally described in Richter et al., Viruses, 2012, 4:2291-2311; Cong L., supra; and Mali P. et al., supra.
(27) In one embodiment, the gene of interest for targeting is a fucosyltransferase, for example, Fut8, alpha-(1-6)-fucosyltransferase. Fucosyltransferase is an enzyme that transfers an L-fucose sugar from a GDP-fucose (guanosine diphosphate-fucose) donor substrate to an acceptor substrate. The acceptor substrate can be another sugar such as the transfer of a fucose to a core GlcNAc (N-acetylglucosamine) sugar as in the case of N-linked glycosylation, or to a protein, as in the case of O-linked glycosylation produced by 0-fucosyltransferase. In a further embodiment, the targeted gene codes for glutamine synthetase. For example, glutamine synthetase (GS) (EC 6.3.1.2) is an enzyme that plays an essential role in the metabolism of nitrogen by catalyzing the condensation of glutamate and ammonia to form glutamine. In another embodiment, the targeted gene is dihydrofolate reductase (DHFR). Dihydrofolate reductase, or DHFR, is an enzyme that reduces dihydrofolic acid to tetrahydrofolic acid, using NADPH as electron donor, which can be converted to the kinds of tetrahydrofolate cofactors used in 1-carbon transfer chemistry.
(28) In another embodiment, the targeted gene is a sialidase (e.g., NEU2 or NEU3). NEU2 and NEU3 belong to a family of glycohydrolytic enzymes that remove sialic acid residues from glycoproteins and glycolipids. Disrupting NEU2 or NEU3 in antibody-producing cells may prevent the removal of terminal sialic acid from the glycosylated antibody and improve antibody activity and circulating half-life.
(29) In one embodiment, the gene of interest for targeting is a proapoptotic gene, such as BAX, BID, BAK, or BAD. Disrupting a proapoptotic gene in antibody production cells may disrupt apoptotic process and enhance cell survival and antibody production.
(30) CRISPR
(31) Genome-editing nucleases are valuable tools for genetic engineering. The present invention utilizes a sequence-specific nuclease system termed CRISPR (clustered regularly interspaced short palindromic repeats). In vivo, this microbial nuclease system helps defend against invading phages and plasmids. CRISPR loci in microbial hosts contain a combination of CRISPR-associated genes as well as non-coding RNA elements capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage. CRISPR uses genomically encoded RNA arrays to control the cleavage of foreign DNA by a CRISPR-associated (Cas) nuclease. Three types (I-III) of CRISPR systems that utilize Cas variant nucleases have been identified across a wide range of bacterial hosts (Makarova et al., Nat. Rev. Microbiol., 2011, 9(6):467-77; Karvelis et al., RNA Biol., 2013, 10(5):841-51). Each CRISPR locus contains an array of repetitive sequences (direct repeats) interspaced by short stretches of non-repetitive sequences (spacers). The spacer sequence corresponds to a protospacer sequence in the targeted genome, which is typically 20-30 nucleotides followed by an NGG protospacer-adjacent motif (PAM). To utilize the associated Cas nuclease for nucleic acid cleavage, the non-coding CRISPR array is transcribed and cleaved within direct repeats into short crRNAs containing individual spacer sequences, which direct Cas nucleases to the target site (protospacer).
(32) The type II CRISPR utilized in the present invention is well characterized and carries out targeted DNA double-strand break in four sequential steps. First, two non-coding RNA, the pre-crRNA (CRISPR RNAs) array and tracrRNA (trans-activating crRNA), are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the repeat regions of the pre-crRNA and mediates the processing of pre-crRNA into mature crRNAs containing individual spacer sequences. Third, the mature crRNA:tracrRNA complex directs Cas9 to the target DNA via base-pairing between the spacer on the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM), an additional requirement for target recognition. Finally, Cas9 mediates cleavage of target DNA to create a double-stranded break within the protospacer (www.genome-engineering.org/crispr/). At least 12 base pairs (bp) of perfect homology in the spacer sequence, in addition to the PAM, appears to be necessary for CRISPR endonuclease activity (Esvelt and Wang, Mol. Syst. Biol., 2013, 9:641).
(33) Mammalian expression constructs from Streptococcus pyogenes CRISPR components, including nuclear-localized Cas9 and processed forms of guide RNAs can be transfected into various cell types to disrupt targeted alleles in a cell population. The CRISPR system is also amenable to multiplexing. Multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several sites within the mammalian genome.
(34) In addition to initiating targeted gene disruptions, genome editing using CRISPR can also take advantage of the cellular homologous recombination machinery to replace a DNA locus with an engineered donor DNA cassette that contains regions of homology flanking a single-stranded break site. Cong, et al., have disclosed the engineering of two different type II CRISPR systems, which demonstrated that Cas9 nucleases can be directed by short RNAs to induce precise cleavage at endogenous genomic loci in human and mouse cells (Science, 2013, 339:819-823). They also reported that Cas9 can be converted into a nicking enzyme to facilitate homology-directed repair with minimal mutagenic activity. Mali, et al., have also disclosed that they engineered the type II bacterial CRISPR system to function with custom guide RNA (gRNA) in human cells (Science, 2013, 339:823-826).
(35) Method of Producing Double Allele Knock-Outs
(36) In one embodiment, the present invention comprises a method for producing a double allele knock-out in a eukaryotic cell by providing the cell with a CRISPR system comprising a nuclease and at least two targeting RNAs. In an embodiment, the CRISPR system has 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, or 3-10 targeting RNAs. An example of one application of this method is to produce cells that secrete afucosylated antibodies. The Fut8 gene encodes alpha-(1,6)-fucosyltransferase, an enzyme that catalyzes the transfer of fucose from GDP-fucose to N-linked type complex glycopeptides. Since afucosylated antibodies have enhanced ADCC activity, knocking out Fut8 is desirable in antibody production cells. In one embodiment of the present invention, Chinese hamster Fut8 contains 9 exons, 121,971 nucleotides from starting codon to stop codon. The gene structure of Chinese hamster Fut8 is shown in Table 1.
(37) TABLE-US-00001 TABLE 1 Exon 1 2 3 4 5 6 7 8 9 Sequence 1-203 25955-26069 26177-26341 48351-48464 64540-64776 100533-100781 102114-102290 112809-112961 121666-121971
(38) The ten protospacer sequences in the first four exons shown in Table 2 may be selected for the construction of expression vectors. In Table 2, the crRNA target c refers to the complementary strand and the bold sequences refer to a PAM (protospacer-adjacent motif). These sequences all begin with G to facilitate U6 transcription initiation, and then 20 nucleotides following by NGG. Multiple crRNA expression vectors may be constructed comprising one of the targeted spacer sequence or multiple spacer sequences.
(39) TABLE-US-00002 TABLE2 Targeted crRNAtarget exon Targetsequence(5-3) T1(7-30) Exon1 GCATGGACTGGTTCCTGGCGTTGG (SEQIDNO:5) T2(105-127,c) GTTCTCTGCTAGAATGGTCAGGG (SEQIDNO:6) T3(131-154,c) GCTCCAGCTTTGCAAGAATCTTGG (SEQIDNO:7) T4(182-204) GGAGAATGGCTGAGTCTCTCCGG (SEQIDNO:8) T5(25954-25980) Exon2 GAATACCAGAAGGCCCTATTGATCAGG (SEQIDNO:9) T6(26260-26283) Exon3 GAAGAAATTAAAGAAATTAGAAGG (SEQIDNO:10) T7(26293-26315,c) GAATTTCATCTGCATGTCTTTGG (SEQIDNO:11) T8(48363-48391) Exon4 GATCTATACTACCTCAGTCAAACAGATGG (SEQIDNO:12) T9(48414-48438) GAAGCCAAAGATCTGACAGAGCTGG (SEQIDNO:13) T10(48440-48462,c) GCAGATATGTTATTCTCCGCTGG (SEQIDNO:14)
(40) Wild-type CHO cells and an antibody expressing CHO cell line may be used to characterize Fut8 gene knock-out efficiency. Typically, the cells are transfected with at least one mammalian expression vector of Cas9, tracrRNA, and crRNA. After two days of culturing, the cells are continuously monitored for cell surface fucose content by fluorescent labeling with Lens culinaris Agglutinin (LCA)-FITC (Vector Laboratories, Burlingame, Calif.) and flow cytometry analysis. Negative binding of LCA-FITC indicates that both alleles of Fut8 have been knocked out. In some embodiments, the Fut8 comprises the modified exon 1 sequence represented by SEQ ID NO: 2, 3 or 4 (as shown in
(41) In another embodiment, the present invention involves a dual-expression vector LB200 containing a Cas9 expression cassette under the control of a CMV promoter and a tracrRNA expression cassette under the control of human U6 promoter (
(42) In certain embodiments, the tracrRNA and the crRNA may be connected by a hairpin RNA linkage. RNA bases include adenine (A), guanine (G), cytosine (C) and uracil (U). RNA molecules are polymers of nucleotides joined to one another by covalent bonds between the phosphate of one nucleotide and the sugar of another. These linkages are called phosphodiester linkages. Although single stranded, RNA is not always linear. It has the ability to fold into complex three dimensional shapes and form hairpin loops. Within these loops, the bases bind to one another: adenine pairs with uracil (A-U) and guanine pairs with cytosine (G-C). Hairpin loops are commonly observed in RNA molecules such as messenger RNA (mRNA) and transfer RNA (tRNA).
(43) Expression vectors herein may contain expression control sequences that are known in the art and include, for example, promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), and the like, that provide for the expression of the polynucleotide sequence in a host cell. Expression control sequences interact specifically with cellular proteins involved in transcription (Maniatis et al., Science, 1987, 236:237-1245). Exemplary expression control sequences are described in, for example, Goeddel, Gene Expression Technology: Methods in Enzymology, 1990, Vol. 185, Academic Press, San Diego, Calif.
(44) Expression of Cas9 may be driven by any eukaryotic promoter, including, but not limited to, a CMV promoter, an EF1 promoter, a SV40 promoter, a RSV promoter, or a PGK promoter. CMV promoters suitable for use in the present invention are available in plasmid form from sources including GSL Biotech LLC (Chicago, Ill.), Promega Corporation (Madison, Wis.), Sigma-Aldrich (St. Louis, Mo.), and Clontech Laboratories (Mountain View, Calif.). Suitable EF1 promoters are available from Clontech Laboratories and Oxford Genetics (Oxfordshire, UK). Suitable SV40 promoters in plasmid form are widely available from sources including Promega Corporation, Invitrogen (Carlsbad, Calif.), and Oxford Genetics. RSV and PGK promoters may be obtained from similar companies.
(45) Expression of RNA may be driven by any RNA polymerase promoter, including, but not limited to, a human U6 promoter, a human H1 promoter, or a human 7SK promoter. Suitable human U6 promoters may be obtained in plasmid form from sources including Invitrogen and Oxford Genetics.
(46) Targeting RNA refers to a crRNA that directs Cas9 to the targeted DNA sequence for genome editing. It contains RNA sequence complementary to the protospacer DNA sequence in the gene of interest. Targeting RNA may be connected with full or partial sequence of tracrRNA by a hairpin RNA linkage.
(47) Antibody Production
(48) The method of the present invention and plasmids produced thereby may be used to transfect eukaryotic cells such that those cells then produce antibodies of interest, preferably, therapeutic antibodies. Production and purification of therapeutic antibodies are well known in the art. For example, expression from host cells, wherein expression vector(s) encoding the heavy and light chains is (are) transfected into a host cell by standard techniques. The various forms of the term transfection are intended to encompass a wide variety of techniques commonly used for the introduction of exogenous DNA into a eukaryotic host cell, e.g., electroporation, calcium-phosphate precipitation, DEAE-dextran transfection and the like. Although it is possible to express the antibodies of the invention in either prokaryotic or eukaryotic host cells, expression of antibodies in eukaryotic cells is preferable, and most preferable in mammalian host cells, because such eukaryotic cells (and in particular mammalian cells) are more likely than prokaryotic cells to assemble and secrete a properly folded and immunologically active antibody.
(49) Particular mammalian host cells for expressing the recombinant antibodies of the invention include Chinese Hamster Ovary (CHO cells), NS0 myeloma cells, COS cells and SP2 cells. When recombinant expression vectors encoding antibody genes are introduced into mammalian host cells, the antibodies are produced by culturing the host cells for a period of time sufficient to allow for expression of the antibody in the host cells or, in particular, secretion of the antibody into the culture medium in which the host cells are grown. Antibodies can be recovered from the culture medium using standard protein purification methods.
(50) In one embodiment, the methods of the present invention may be used to produce biosimilar antibodies, for example, rituximab antibodies. Biosimilars, also known as follow-on biologics, are biologic medical products whose active drug substance is made by a living organism or derived from a living organism by means of recombinant DNA or controlled gene expression methods. Biosimilars or follow-on biologics are terms used to describe officially approved subsequent versions of innovator biopharmaceutical products made by a different sponsor following patent and exclusivity expiry on the innovator product.
(51) Rituximab (tradename Rituxan) is a genetically engineered chimeric murine/human monoclonal antibody directed against the CD20 antigen found on the surface of normal and malignant B lymphocytes. The antibody is an IgG1 kappa immunoglobulin containing murine light and heavy-chain variable region sequences and human constant region sequences. Rituximab is composed of two heavy chains of 451 amino acids and two light chains of 213 amino acids. The Fab regions of rituximab bind to the CD20 antigen on B lymphocytes, while the Fc domain recruits antibodies and complement to mediate cell lysis. Rituximab is used in the treatment of CD20-positive non-Hodgkins lymphoma, chronic lymphocytic leukemia, and rheumatoid arthritis.
(52) Trastuzumab (tradename Herceptin) is a genetically engineered humanized monoclonal antibody directed against the HER2 antigen found on the surface of certain types of breast cancer cells. Trastuzumab is composed of two heavy chains of 451 amino acids and two light chains of 213 amino acids. The Fab regions of trastuzumab bind to the HER2 antigen on breast cancer cells, while the Fc domain recruits antibodies and complement to mediate cell lysis. Trastuzumab is used in the treatment of HER2 overexpressing breast cancers.
(53) The inventions disclosed herein will be better understood from the experimental details which follow. The following examples are offered by way of illustration and not by way of limitation of the inventions as described more fully in the claims which follow thereafter.
EXAMPLES
Example 1: Disruption of Fut8 Gene in CHO Cells by Targeting Single crRNA Sites
(54) S. pyogenes tracrRNA (SEQ ID NO:15) was cloned into a mammalian expression vector under the control of a human U6 promoter (SEQ ID NO:16).
(55) TABLE-US-00003 S.pyogenestracrRNA (SEQIDNO.15) ATCTTGTTGGAACCATTCAAAACAGCATAGCAAGTTAAAATAAGGCTAG TCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT HumanU6promoter (SEQIDNO:16) AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGC ATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGT AAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTT CTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATA TGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTT GTGGAAAGGACGAAACACC
(56) The tracrRNA expression cassette was synthesized and cloned into vector pcDNA3 (Invitrogen) between restriction sites Dra III and Bst1107 I to give vector LB-tracrRNA. S. pyogenes Cas9 cDNA encoding Cas9 protein (SEQ ID NO:18) was mammalian codon-optimized (SEQ ID NO:17) and fused with a nuclear localization signal (NLS, SEQ ID NO:19 and SEQ ID NO:20).
(57) TABLE-US-00004 S.pyogenescodonoptimizedDNAencodingCas9 (SEQIDNO.17) 1 ATGGACAAGAAATATTCAATCGGACTTGACATTGGAACAAACTCTGTCGGCTGGGCCGTC MDKKYSIGLDIGTNSVGWAV 61 ATTACTGATGAGTACAAAGTGCCATCCAAGAAGTTCAAAGTATTGGGCAACACAGATCGG ITDEYKVPSKKFKVLGNTDR 121 CACAGTATCAAAAAAAACCTGATCGGCGCACTGCTGTTTGACTCTGGAGAAACCGCTGAG HSIKKNLIGALLFDSGETAE 181 GCTACTAGACTTAAGCGCACTGCCCGGCGTAGGTACACCAGGAGAAAGAATCGCATCTGT ATRLKRTARRRYTRRKNRIC 241 TATCTGCAGGAGATCTTTAGCAACGAAATGGCTAAGGTTGACGATAGTTTTTTCCACCGC YLQEIFSNEMAKVDDSFFHR 301 CTGGAGGAGAGTTTCCTCGTAGAGGAGGACAAGAAACACGAGCGTCACCCTATTTTCGGA LEESFLVEEDKKHERHPIFG 361 AACATCGTGGATGAAGTCGCTTACCACGAGAAGTATCCTACAATTTATCACTTGCGCAAG NIVDEVAYHEKYPTIYHLRK 421 AAACTCGTGGATAGCACAGACAAAGCTGACCTGCGCCTTATCTATCTGGCACTGGCACAT KLVDSTDKADLRLIYLALAH 481 ATGATAAAGTTTCGCGGGCATTTCCTTATTGAGGGAGATTTGAATCCCGATAACAGTGAC MIKFRGHFLIEGDLNPDNSD 541 GTGGATAAACTTTTCATACAATTGGTCCAGACCTATAATCAACTCTTTGAAGAGAATCCA VDKLFIQLVQTYNQLFEENP 601 ATCAACGCATCTGGTGTGGACGCTAAGGCCATTCTCAGTGCCCGGCTGTCAAAATCTAGG INASGVDAKAILSARLSKSR 661 CGCCTTGAGAATCTGATTGCACAGCTGCCCGGGGAAAAGAAGAACGGCTTGTTTGGAAAT RLENLIAQLPGEKKNGLFGN 721 CTGATCGCTCTGTCTCTGGGTCTCACACCTAATTTCAAGTCAAATTTCGACCTGGCCGAG LIALSLGLTPNFKSNFDLAE 781 GATGCAAAGCTTCAGCTTAGCAAAGATACCTACGATGATGACCTCGACAATCTTCTCGCC DAKLQLSKDTYDDDLDNLLA 841 CAGATCGGCGACCAATATGCTGACCTGTTCCTGGCCGCTAAGAATCTGTCTGATGCCATC QIGDQYADLFLAAKNLSDAI 901 CTGCTTTCTGATATCCTGCGCGTCAATACCGAAATAACCAAGGCACCACTTTCTGCTTCC LLSDILRVNTEITKAPLSAS 961 ATGATTAAAAGGTACGACGAGCATCACCAAGATCTCACTCTCCTTAAGGCCCTTGTGCGT MIKRYDEHHQDLTLLKALVR 1021 CAGCAACTGCCCGAAAAGTACAAAGAAATCTTCTTTGACCAGTCTAAGAATGGGTACGCC QQLPEKYKEIFFDQSKNGYA 1081 GGCTACATCGATGGAGGCGCATCCCAGGAAGAATTTTATAAGTTCATTAAGCCCATACTG GYIDGGASQEEFYKFIKPIL 1141 GAAAAGATGGACGGCACTGAGGAACTGCTTGTCAAGCTGAACAGAGAAGATCTTCTGCGC EKMDGTEELLVKLNREDLLR 1201 AAACAGCGTACCTTCGATAATGGTTCTATTCCACACCAAATTCATCTGGGAGAGCTCCAC KQRTFDNGSIPHQIHLGELH 1261 GCCATTCTCCGGAGACAAGAGGACTTTTATCCATTCCTGAAGGATAATCGCGAGAAGATC AILRRQEDFYPFLKDNREKI 1321 GAAAAGATTCTCACATTTCGGATTCCATACTACGTTGGCCCCCTTGCCCGAGGTAATAGC EKILTFRIPYYVGPLARGNS 1381 CGTTTTGCTTGGATGACCAGGAAGAGTGAGGAAACCATTACCCCTTGGAACTTTGAAGAA RFAWMTRKSEETITPWNFEE 1441 GTGGTAGATAAGGGAGCCTCCGCACAAAGCTTTATTGAGCGAATGACTAATTTCGATAAG VVDKGASAQSFIERMTNFDK 1501 AATCTGCCAAACGAAAAAGTCTTGCCTAAACACTCCCTGCTGTACGAGTATTTCACAGTG NLPNEKVLPKHSLLYEYFTV 1561 TATAACGAGTTGACAAAAGTCAAGTATGTTACTGAGGGCATGCGAAAACCCGCTTTCCTG YNELTKVKYVTEGMRKPAFL 1621 TCCGGTGAACAGAAAAAAGCCATTGTCGACCTGCTCTTTAAAACTAACCGTAAGGTCACC SGEQKKAIVDLLFKTNRKVT 1681 GTCAAACAACTTAAGGAAGACTATTTTAAGAAAATCGAGTGCTTTGACTCCGTTGAGATT VKQLKEDYFKKIECFDSVEI 1741 TCCGGAGTAGAAGATCGATTCAACGCCAGTCTGGGTACATATCACGACCTCCTGAAGATA SGVEDRFNASLGTYHDLLKI 1801 ATCAAAGACAAGGATTTTCTGGATAATGAGGAGAATGAGGACATACTGGAGGACATTGTC IKDKDFLDNEENEDILEDIV 1861 CTGACCTTGACCTTGTTCGAAGACCGGGAAATGATTGAAGAGAGGCTGAAAACCTACGCC LTLTLFEDREMIEERLKTYA 1921 CACCTGTTCGACGATAAGGTTATGAAGCAACTGAAACGTAGGAGGTACACTGGGTGGGGC HLFDDKVMKQLKRRRYTGWG 1981 CGACTTTCTCGTAAGCTTATTAACGGAATTAGAGATAAGCAGTCTGGTAAGACCATTCTC RLSRKLINGIRDKQSGKTIL 2041 GACTTCCTGAAAAGCGATGGCTTTGCTAACCGTAACTTTATGCAGCTGATTCACGACGAT DFLKSDGFANRNFMQLIHDD 2101 TCTCTGACATTCAAAGAAGATATCCAGAAAGCTCAAGTCTCTGGTCAGGGCGACAGCCTG SLTFKEDIQKAQVSGQGDSL 2161 CACGAGCACATTGCAAACCTGGCCGGCAGCCCAGCTATCAAGAAGGGAATACTTCAAACA HEHIANLAGSPAIKKGILQT 2221 GTGAAGGTGGTAGACGAGCTGGTGAAGGTCATGGGTCGCCACAAGCCAGAAAACATAGTA VKVVDELVKVMGRHKPENIV 2281 ATCGAGATGGCACGTGAAAACCAGACAACCCAGAAGGGGCAGAAGAATTCTAGAGAGCGG IEMARENQTTQKGQKNSRER 2341 ATGAAAAGAATTGAGGAAGGGATCAAGGAACTGGGCTCTCAGATCCTCAAGGAGCACCCA MKRIEEGIKELGSQILKEHP 2401 GTAGAGAATACACAGCTCCAAAATGAAAAACTGTACTTGTATTACCTGCAAAACGGCAGG VENTQLQNEKLYLYYLQNGR 2461 GACATGTACGTCGACCAGGAACTGGACATTAATCGCCTGAGTGATTATGACGTCGACCAT DMYVDQELDINRLSDYDVDH 2521 ATCGTCCCTCAGTCCTTCCTGAAAGATGATAGCATCGACAACAAAGTCCTCACTCGGTCC IVPQSFLKDDSIDNKVLTRS 2581 GACAAAAACCGTGGCAAGAGCGACAATGTCCCTTCTGAGGAAGTTGTGAAGAAGATGAAG DKNRGKSDNVPSEEVVKKMK 2641 AATTATTGGCGTCAGCTCCTGAATGCAAAGTTGATCACTCAGAGGAAATTCGACAATCTC NYWRQLLNAKLITQRKFDNL 2701 ACTAAGGCTGAGCGAGGAGGGCTGTCCGAGCTGGACAAAGCCGGATTTATCAAACGTCAA TKAERGGLSELDKAGFIKRQ 2761 CTCGTTGAGACTCGGCAGATCACTAAGCACGTCGCTCAAATCCTTGATTCCAGAATGAAT LVETRQITKHVAQILDSRMN 2821 ACCAAGTACGATGAAAACGATAAGTTGATCCGCGAGGTGAAAGTCATTACACTGAAGTCT TKYDENDKLIREVKVITLKS 2881 AAGCTCGTGTCTGATTTTCGCAAGGACTTCCAATTCTATAAAGTGAGGGAGATCAACAAT KLVSDFRKDFQFYKVREINN 2941 TATCACCACGCCCACGACGCTTATCTCAATGCTGTGGTGGGCACTGCCCTGATCAAGAAA YHHAHDAYLNAVVGTALIKK 3001 TATCCCAAACTGGAGTCAGAGTTTGTGTATGGAGATTACAAAGTGTACGATGTGAGGAAG YPKLESEFVYGDYKVYDVRK 3061 ATGATCGCCAAGAGCGAGCAGGAGATCGGAAAAGCAACAGCCAAGTACTTCTTTTACAGC MIAKSEQEIGKATAKYFFYS 3121 AATATCATGAATTTCTTTAAGACCGAGATCACCTTGGCCAATGGTGAGATCCGAAAACGC NIMNFFKTEITLANGEIRKR 3181 CCTCTGATAGAGACTAATGGCGAAACTGGTGAGATTGTTTGGGACAAGGGAAGAGATTTC PLIETNGETGEIVWDKGRDF 3241 GCAACTGTGAGGAAGGTCCTGTCTATGCCCCAGGTGAATATCGTTAAAAAGACCGAGGTG ATVRKVLSMPQVNIVKKTEV 3301 CAGACTGGTGGCTTCAGTAAGGAGTCTATCCTGCCTAAGCGCAACAGCGACAAACTGATT QTGGFSKESILPKRNSDKLI 3361 GCACGAAAGAAGGACTGGGACCCCAAGAAATACGGAGGGTTCGACAGCCCTACCGTGGCT ARKKDWDPKKYGGFDSPTVA 3421 TACAGCGTGCTTGTGGTCGCAAAGGTGGAGAAGGGGAAATCTAAGAAGCTGAAAAGTGTG YSVLVVAKVEKGKSKKLKSV 3481 AAAGAGCTGCTGGGCATTACCATTATGGAACGGAGTTCTTTCGAGAAGAACCCCATCGAT KELLGITIMEPSSFEKNPID 3541 TTTCTGGAAGCCAAGGGCTATAAGGAAGTTAAAAAGGACTTGATTATCAAGCTGCCTAAG FLEAKGYKEVKKDLIIKLPK 3601 TATAGTTTGTTCGAACTTGAAAACGGTAGAAAAAGGATGCTCGCCTCCGCAGGTGAGCTG YSLFELENGRKRMLASAGEL 3661 CAGAAGGGAAACGAATTGGCTCTCCCATCCAAATACGTGAACTTCTTGTACCTGGCCAGC QKGNELALPSKYVNFLYLAS 3721 CATTACGAAAAACTCAAAGGCTCCCCAGAGGACAACGAACAGAAGCAGCTGTTTGTGGAA HYEKLKGSPEDNEQKQLFVE 3781 CAACATAAACATTACTTGGACGAAATAATCGAGCAGATCAGCGAGTTTTCCAAGAGAGTT QHKHYLDEIIEQISEFSKRV 3841 ATCCTGGCCGATGCAAACCTCGATAAGGTCCTTTCCGCCTACAACAAGCACAGAGACAAA ILADANLDKVLSAYNKHRDK 3901 CCAATCCGGGAGCAGGCCGAGAATATTATCCACCTGTTCACCCTGACAAACCTTGGAGCA PIREQAENIIHLFTLTNLGA 3961 CCTGCTGCATTCAAATATTTCGATACTACAATCGATCGAAAGCGCTACACAAGTACCAAG PAAFKYFDTTIDRKRYTSTK 4021 GAGGTGCTGGACGCCACTCTGATCCATCAGTCCATAACTGGACTGTATGAAACTCGTATC EVLDATLIHQSITGLYETRI 4081 GATCTGAGCCAGTTGGGGGGAGATTCTCGGGCAGAT DLSQLGGDSRAD nuclearlocalizationsignal CCCAAGAAGAAGAGGAAGGTG(SEQIDNO:19) PKKKRKV(SEQIDNO:20)
(58) The Cas9 cDNA was synthesized and cloned into vector LB-tracrRNA between restriction sites Xba I and Pme I to give vector LB200. Expression of Cas9 was driven by a CMV promoter. The plasmid map of LB200 is shown in
(59) TABLE-US-00005 S.pyogenesCRISPRdirectrepeat (SEQIDNO:21) GTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAAC
(60) The expression cassettes were synthesized and cloned in vector pIDT-Smart (Integrated DNA Technologies). The plasmid map of LB202a is shown in
(61) TABLE-US-00006 TABLE 3 Plasmid crRNA structure LB202a DR-T1-DR LB202b DR-T2-DR LB202c DR-T3-DR LB203 DR-T1-DR-T2-DR LB204 DR-T1-DR-T2-DR-T3-DR LB205 DR-T1-DR-T2-DR-T3-DR-T4-DR LB206 DR-T5-DR-T6-DR-T7-DR LB207 DR-T8-DR-T9-DR-T10-DR
(62) Fucose on the CHOS cell surface (Invitrogen, Carlsbad, Calif.) can be readily detected by staining with 5 g/ml of fluorescent Lens culinaris Agglutinin (LCA-FITC, Vector Laboratories), and then subjected to flow cytometric analysis (
(63) TABLE-US-00007 TABLE 4 Transfection Targeting condition Plasmid 1 Plasmid 2 sites 1 LB200 LB202a T1 2 LB202b T2 3 LB202c T3 4 LB203 T1-2 5 LB204 T1-3 6 LB205 T1-4 7 LB206 T5-7 8 LB207 T8-10 9 LB205 + LB206 T1-7 10 LB205 + LB206 + T1-10 LB207 11 LB201 LB202a T1 12 LB202b T2 13 LB202c T3 14 LB203 T1-2 15 LB204 T1-3 16 LB205 T1-4 17 LB206 T5-7 18 LB207 T8-10 19 LB205 + LB206 T1-7 20 LB205 + LB206 + T1-10 LB207
Example 2: Disruption of Fut8 Gene in CHO Cells by Targeting Multiple crRNA Sites
(64) Mammalian expression vectors LB203-207 (Table 3) were constructed to express crRNA targeting multiple target sequences T1-T10 in the hamster Fut8 gene. All vectors utilized human U6 promoter to express a crRNA array similar to that in
(65) 110.sup.6 CHOS cells were co-transfected with 2-4 plasmids shown in Table 4 (condition #4-10, #14-20). One week after transfection, the cells were stained with LCA-FITC, and then subjected to flow cytometric analysis to determine binding of LCA to cell surface fucose.
(66) Wild type CHO-S cells exhibited strong staining of LCA on the cell surface (
(67) TABLE-US-00008 TABLE 5 Co-trans- LCA-FITC LCA- fection CRISPR negative Cells FITC Plasmids Targets (M.sub.2, %) wt CHO-S 0 0 0.12 wt CHO-S + 0 0 0.17 Transfection #1 + 2 1 0.14 Transfection #4 + 2 2 0.73 Transfection #5 + 2 3 (T1-3) 4.85 Transfection #6 + 2 4 (T1-4) 5.07 Transfection #7 + 2 3 (T5-7) 4.81 Transfection #8 + 2 3 (T8-10) 5.05 Transfection #9 + 3 7 (T1-7) 4.00 Transfection #10 + 4 10 (T1-10) 1.96
(68) Cells transfected with 3-4 CRISPR targets had the highest frequency of double allele knock-outs of Fut8. Cells transfected with 2 CRISPR targets also produced double allele knock-outs, whereas cells transfected with a single CRISPR target did not produce double allele knock-outs detectable over the background. The combination of 3-4 CRISPR targets together in a cell, surprisingly and unexpectedly, produce a synergistic effect in which the frequency of double allele knock-outs was far greater than the predicted rate from the additive effect of the combined CRISPR targets. It was also surprising that cells transformed with 3-4 CRISPR targets had higher frequency of double allele knock-outs than cells transformed with 7 or 10 CRISPR targets. There was a surprising and unexpected distance effect as closer spacing of the multiple CRISPR targets increased the frequency of double allele knock-outs.
(69) Transfection #14-20 exhibited similar LCA-FITC staining profiles as that of transfection #11-13 as shown in
Example 3: Isolation of Fut8 Knock-Out CHO Cells
(70) Cells in the M2 peak of transfection #5 were sorted into 96-well plates as single cells. After colonies grew out in 2 weeks, 11 clones exhibiting a similar growth profile as the wild-type CHOS cells were picked and expanded into shake flasks and cryopreserved. These clones were confirmed to be negative on LCA-FITC staining and to contain biallelic frame-shift mutations in the Fut8 gene by PCR and sequencing. The LCA staining data of 3 clones are shown in
(71) The 11 Fut8/ CHO clones were tested for transfection efficiency using a GFP expression vector. 110.sup.6 cells were transfected with 10 g of DNA using a Neon Electroporation System and the percentage of GFP positive cells were characterized by flowmetric analysis after 2 days. Most of the clones exhibited similar transfection efficiency as the wild-type CHOS cells (
(72) The 11 Fut8/ CHO clones were also tested for antibody production after transient transfection. Rituximab was used as the model antibody. 110.sup.6 cells were co-transfected with 5 g each of the rituximab heavy and light chain expression vectors using Neon Electroporation System. The antibody concentrations in the culture media were determined by Elisa after 2 days (Table 6). Clones 2.123-4, -6 and -13 exhibited similar antibody expression levels as the wild-type CHOS cells.
(73) TABLE-US-00009 TABLE 6 Cells Ab (ug/ml) WT CHOS 0.58 2.123-1 0.03 2.123-4 0.51 2.123-6 0.52 2.123-11 0.32 2.123-12 0.06 2.123-13 0.49 2.123-15 0.32 2.123-20 0.14 2.123-23 0.32 2.123-25 0.20 2.124-6 0.17
Example 4: Production and Characterization of Afucoslylated Antibodies
(74) Nucleotide sequences coding biosimilar antibody rituximab heavy and light chain sequences were cloned into mammalian expression vectors under hEF1 promoter. The rituximab heavy chain protein sequence and coding nucleotide sequence including introns are provided as SEQ ID NO:22 and SEQ ID NO:23, respectively. The rituximab light chain protein sequence and coding nucleotide sequence are provided as SEQ ID NO:24 and SEQ ID NO:25, respectively.
(75) Nucleotide sequences coding biosimilar antibody trastuzumab heavy and light chain sequences were cloned into mammalian expression vectors so the hEF1 promoter controlled expression. The trastuzumab heavy chain protein sequence and coding nucleotide sequence including introns are provided as SEQ ID NO:26 and SEQ ID NO:27, respectively. The trastuzumab light chain protein sequence and coding nucleotide sequence are shown in SEQ ID NO:28 and SEQ ID NO:29, respectively.
(76) The rituximab and trastuzumab expression plasmids were used to transfect wild-type CHOS cells, or 2 different Fut8/ CHO clones: 2.123-4 and 2.123-13 (Table 6). Cells in a volume of about 200 l (110.sup.6 cells/ml) were transfected with 100 g each of the heavy and light chain expression vectors, and 200 l of Freestyle Max transfection reagent (Invitrogen). The conditioned media was harvested after cell viability reached below 70% in about 7 days and was subjected to Protein A chromatography to purify the antibody.
(77) TABLE-US-00010 TABLE 6 Transfection Antibody Host Cells Fut8 2.191.2 WT rituximab WT CHOS +/+ 2.191.3 AF rituximab 2.123-4 / 5.3.2 AF trastuzumab 2.123-4 / 5.3.3 AF trastuzumab 2.123-13 / 5.9.1 WT trastuzumab WT CHOS +/+
(78) 100 g of wild-type (WT) or afucosylated (AF) antibodies were used for for glycan analysis. The purified antibodies were denatured and digested with trypsin. The N-glycans were subsequently enzymatically released from the peptides by treating with PNGase F, and then quantified with mass spectrometry. Each glycan was represented by a 5-digit code: number of hexose (Gal, Man, or Glc), number of N-acetylhexosamine (GlcNAc or GalNAc), number of deoxyhexose (Fuc), number of N-acetylneuraminic acid (Neu5Ac), and number of N-glycolylneuraminic acid (Neu5Gc). Fucose-containing glycans have 1 in the middle digit whereas glycans without fucose have 0 in the middle digit. For example, glycan 33100 contains 3 hexoses, 3 N-acetylhexosamines, and 1 fucose. Rituximab and trastuzumab produced from the wild-type CHOS cells exhibited robust fucose presence, whereas those antibodies produced from Fut8/ CHO cells exhibited complete lack of fucose (
(79) The purified antibodies were also used to characterize ADCC activities. Human peripheral blood mononuclear cells (PBMC) were used as effectors. Human lymphoma Raji cells were used as target cells for rituximab whereas human breast cell line SK-BR3 were used as target cells for trastuzumab. The effector cells to target cells ratios were kept at 20:1. The cytotoxicity was determined by LDH release.
(80) The target cells were washed and seeded in 96-well plates (10,000 cells in 50 l). 50 l of culture media with various concentrations of antibody was added to the cells and incubated for 30 min in cell culture incubator. The effector cells (200,000 cells in 100 l, E:T=20:1) were then added to initiate the ADCC reaction. Final concentration of 1% of triton X-100 was added to control target cells without effector cells or antibody to lyse the target cells and served as the maximum lysis control. The assay buffers were added to control cells without effector cells or antibody and served as the minimum LDH release control. Target cells incubated with effector cells without the presence of antibodies were set as background control of non-specific LDH release. The 96-well plates were incubated at 37 C./5% CO.sub.2 incubator for 6 hours. The ADCC activity was assayed with a LDH Cytotoxicity Assay Kit (Fisher Scientific). The afucosylated rituximab (
Example 5: Isolation of Fut8 Knock-Out Rituximab Production Cells
(81) Biosimilar antibody rituximab heavy and light chain sequences were cloned into mammalian expression vectors under hEF1 promoter. After stable transfection in CHOS cells, a clone 2G8 was isolated that produced rituximab. 110.sup.6 of the 2G8 cells were co-transfected with 5 g each of vector LB200 and LB204 to knock out the Fut8 gene. One week after transfection, the cells were stained with fluorescence labeled LCA, and then subjected to flow cytometric analysis. The negative cells of LCA-FITC staining were sorted into single cells in 96-well plates. After colonies grew out in 2 weeks, the clones were expanded and confirmed for lack of LCA-FITC staining. Fut8 genes were sequenced and frame-shift mutations were confirmed.
Example 6: Disruption of Sialidase Genes in CHO Cells by Targeting Multiple crRNA Sites
(82) Sialylation influences pharmacokinetics, immunogenicity, and function of recombinant therapeutic glycoproteins (Bork, et al., J Pharm Sci., 2009, 98: 3499-3508). The degree of sialylation correlates with serum half-life of recombinant proteins. Sialic acids are also important modulators of immunogenicity of recombinant proteins, a major problem with protein-based therapeutics. Sialic acids are important for masking antigenic determinants or epitopes. Thus, increased sialylation is generally preferred. Despite their influence on several important properties of recombinant proteins, sialic acid incorporation is highly variable. IgG and Fc fragments produced in CHO cells exhibit a very low level of sialylation (<2%; Raymond, 2012, Chapter 17, pp. 397-418. In: Biochemistry, Genetics and Molecular Biology, ed. S. Petrescu, InTech Open Access. ISBN 978-953-51-0771-2). Release of intracellular sialidases near the end of production culture is the main cause of low sialylation level.
(83) The Chinese hamster genome contains 3 sialidase genes: lysosomal Neu1, cytoplasmic Neu2, and plasma membrane Neu3. Among them, Neu2 and Neu3 have been shown to affect sialylation levels of produced glycoproteins (Zhang and Ross, 2012, Compositions and methods for improved glycoprotein sialylation, U.S. Pat. No. 8,273,723). Particularly, Neu2 plays the most important role in removing sialic acid from the glycan after being released from dead cells at the end of batch culture production. Neu2 (GenBank: U06143.1) and Neu3 (GenBank: FJ476074.1) both contain 2 exons and open reading frames of 1137 and 1251 nt, encoding proteins of 379 and 417 amino acids, respectively.
(84) Three CRISPR target protospacer sequences in Neu2 and Neu3 exons for genome editing in CHO cells are selected to minimize potential off-target modification as described (Hsu, P. D., et al., Nat Biotechnol., 2013, 31:827-32). Expression vectors for CRISPR array, similar to the vector LB204, are constructed to contain 3 Neu2 protospacer targets or 3 Neu3 protospacer targets under the human U6 promoter.
(85) We have previously optimized mammalian cell expression vector LB200 expressing Cas9 under the CMV promoter and tracrRNA under the human U6 promoter. We have also constructed LB221 (
(86) The CHO cells with be co-transfected with LB200 or LB221, and the vectors expressing CRISPR array targeting Neu2 and/or Neu3. If LB221 is used, the GFP-positive cells will be sorted into 96-well plates as single cells two days after transfection. After colonies grow out in 2-3 weeks, the plates will be duplicated into a new set of 96-well plates by passaging the cells 1:10. Triton X-100 (0.1%) or Tween 20 (0.5%) will be added to the original 96-well plates to permeabilize the cell membrane and release the cytoplasmic sialidase into the culture media. The clarified media will be used to assay sialidase activity with a fluorescent substrate methylumbelliferyl Neu5Ac (Neu5Ac-a-4MU, Santa Cruz Biotechnology). Media (100 uL) will be incubated with 4 mM Neu5Ac-a-4MU in black 96-well plates for 90 min. at 37 C. before addition of 100 L of 0.2 M glycine buffer, pH 10.4, to stop the enzymatic reaction. The fluorescence will be measured using a plate reader with an excitation of 362 nm and an emission of 448 nm. The linear range of the assay will be determined. The change in fluorescence over the 90-min. incubation is directly proportional to the sialidase activities. All experiments will include wild-type CHO as a baseline control. Clones exhibiting less fluorescence in the assay likely contain Neu2 or Neu3 modification. The Neu2 and Neu3 sequences of these clones will be PCR-amplified and sequenced to confirm frameshift mutations. The sialidase negative clones will be expanded and cryopreserved. The Neu2 and Neu3 knock out maybe carried out sequentially or simultaneously.
(87) All publications, patents, patent applications and other documents cited in this application are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, patent application or other document were individually indicated to be incorporated by reference for all purposes.
(88) While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention.